#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NBPF1	55672	broad.mit.edu	37	1	16891326	16891326	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:16891326T>C	ENST00000430580.2	-	28	4039	c.3152A>G	c.(3151-3153)gAa>gGa	p.E1051G		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	1031	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTTTTGAtcttcttccccttc	0.433																																					.													.	.	0			.						.						56.0	26.0	40.0					1																	16891326		617	655	1272	SO:0001583	missense	55672	.			TGATCTTCTTCCC	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.3152A>G	1.37:g.16891326T>C	ENSP00000474456:p.Glu1051Gly	20	0		14	4	.	0	0	2	2	0	Q8N4E8|Q9C0H0	Missense_Mutation	SNP	ENST00000430580.2	37																																																																																				.		0.433	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000106436.3	NM_017940	
CLCA1	1179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	86934706	86934706	+	Missense_Mutation	SNP	G	G	A	rs377703691		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:86934706G>A	ENST00000234701.3	+	2	403	c.52G>A	c.(52-54)Ggg>Agg	p.G18R	CLCA1_ENST00000394711.1_Missense_Mutation_p.G18R			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	18					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CCTTCTAGAAGGGGCCCTGAG	0.443																																					p.G18R		.											.	CLCA1-91	0			c.G52A						.	G	ARG/GLY	0,4406		0,0,2203	139.0	134.0	136.0		52	6.0	0.8	1		136	1,8599	1.2+/-3.3	0,1,4299	no	missense	CLCA1	NM_001285.3	125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	18/915	86934706	1,13005	2203	4300	6503	SO:0001583	missense	1179	exon1			CTAGAAGGGGCCC		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.52G>A	1.37:g.86934706G>A	ENSP00000234701:p.Gly18Arg	68	0		87	41	NM_001285	0	0	0	0	0	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	37	CCDS709.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.577478	0.65878	0.0	1.16E-4	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.11821	2.74;2.74	5.96	5.96	0.96718	Chloride channel calcium-activated (1);	0.298342	0.31415	N	0.007685	T	0.28995	0.0720	M	0.77486	2.375	0.36444	D	0.865661	D	0.89917	1.0	D	0.81914	0.995	T	0.02307	-1.1179	10	0.25106	T	0.35	-15.6633	17.336	0.87281	0.0:0.0:1.0:0.0	.	18	A8K7I4	CLCA1_HUMAN	R	18	ENSP00000234701:G18R;ENSP00000378200:G18R	ENSP00000234701:G18R	G	+	1	0	CLCA1	86707294	0.978000	0.34361	0.836000	0.33094	0.545000	0.35147	2.435000	0.44811	2.831000	0.97527	0.650000	0.86243	GGG	.		0.443	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
LCE1C	353133	hgsc.bcm.edu	37	1	152777877	152777877	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:152777877G>A	ENST00000607093.1	-	1	77	c.78C>T	c.(76-78)acC>acT	p.T26T	LCE1C_ENST00000368768.1_Silent_p.T26T			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	26	Pro-rich.				keratinization (GO:0031424)					NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gacactttggggTGgggcact	0.647																																					p.T26T		.											.	LCE1C-90	0			c.C78T						.						45.0	46.0	46.0					1																	152777877		2203	4300	6503	SO:0001819	synonymous_variant	353133	exon2			CTTTGGGGTGGGG		CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.78C>T	1.37:g.152777877G>A		50	0		198	18	NM_178351	0	0	0	0	0		Silent	SNP	ENST00000607093.1	37	CCDS1026.1																																																																																			G|1.000;A|0.000		0.647	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034658.2	NM_178351	
IVL	3713	broad.mit.edu	37	1	152883269	152883269	+	Silent	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:152883269A>G	ENST00000368764.3	+	2	1060	c.996A>G	c.(994-996)caA>caG	p.Q332Q	IVL_ENST00000392667.2_Silent_p.Q186Q			P07476	INVO_HUMAN	involucrin	332	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.Q332Q(3)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			aggaggggcaactggagcagc	0.662																																					p.Q332Q													.	IVL-93	3	Substitution - coding silent(3)	endometrium(3)	c.A996G						.						17.0	17.0	17.0					1																	152883269		2117	4166	6283	SO:0001819	synonymous_variant	3713	exon2			GGGGCAACTGGAG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.996A>G	1.37:g.152883269A>G		58	2		205	12	NM_005547	0	0	0	0	0	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																			.		0.662	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
DUSP23	54935	hgsc.bcm.edu	37	1	159751066	159751066	+	Missense_Mutation	SNP	A	A	T	rs141314838		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:159751066A>T	ENST00000368107.1	+	1	274	c.176A>T	c.(175-177)cAc>cTc	p.H59L	DUSP23_ENST00000368109.1_Missense_Mutation_p.H59L|DUSP23_ENST00000368108.3_Missense_Mutation_p.H59L			Q9BVJ7	DUS23_HUMAN	dual specificity phosphatase 23	59						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			lung(1)	1	all_hematologic(112;0.0537)					CTCACCCTGCACCGCCTGCGC	0.716																																					p.H59L		.											.	DUSP23-226	0			c.A176T						.						4.0	4.0	4.0					1																	159751066		1795	3557	5352	SO:0001583	missense	54935	exon2			CCCTGCACCGCCT		CCDS1187.1	1q23.1	2011-06-09			ENSG00000158716	ENSG00000158716		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	21480	protein-coding gene	gene with protein product						15147733	Standard	XM_005245289		Approved	FLJ20442, DUSP25	uc001ftz.1	Q9BVJ7	OTTHUMG00000022795	ENST00000368107.1:c.176A>T	1.37:g.159751066A>T	ENSP00000357087:p.His59Leu	3	0		183	78	NM_017823	6	1	287	658	364	Q9NX48	Missense_Mutation	SNP	ENST00000368107.1	37	CCDS1187.1	.	.	.	.	.	.	.	.	.	.	A	9.461	1.093071	0.20471	.	.	ENSG00000158716	ENST00000368109;ENST00000368108;ENST00000368107	D;D;D	0.82711	-1.64;-1.64;-1.64	4.89	3.76	0.43208	Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56062	0.1960	L	0.48935	1.535	0.58432	D	0.999997	B	0.24186	0.099	B	0.17433	0.018	T	0.53521	-0.8427	10	0.07644	T	0.81	-38.779	8.8034	0.34923	0.9101:0.0:0.0899:0.0	.	59	Q9BVJ7	DUS23_HUMAN	L	59	ENSP00000357089:H59L;ENSP00000357088:H59L;ENSP00000357087:H59L	ENSP00000357087:H59L	H	+	2	0	DUSP23	158017690	1.000000	0.71417	0.997000	0.53966	0.010000	0.07245	8.405000	0.90213	0.877000	0.35895	-0.441000	0.05720	CAC	.		0.716	DUSP23-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085552.1	NM_017823	
NFASC	23114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	204985554	204985554	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:204985554G>T	ENST00000401399.1	+	29	3809	c.3610G>T	c.(3610-3612)Gaa>Taa	p.E1204*	NFASC_ENST00000513543.1_Nonsense_Mutation_p.E1133*|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000339876.6_Nonsense_Mutation_p.E1204*|NFASC_ENST00000367171.4_Nonsense_Mutation_p.E1296*|NFASC_ENST00000404076.1_Nonsense_Mutation_p.E1121*|NFASC_ENST00000338586.6_Nonsense_Mutation_p.E1188*|NFASC_ENST00000338515.6_Nonsense_Mutation_p.E1221*|NFASC_ENST00000367172.4_Nonsense_Mutation_p.E1311*|NFASC_ENST00000539706.1_Nonsense_Mutation_p.E1138*|NFASC_ENST00000404907.1_Nonsense_Mutation_p.E1138*|NFASC_ENST00000367169.4_Nonsense_Mutation_p.E1035*|NFASC_ENST00000367170.4_Nonsense_Mutation_p.E1232*|NFASC_ENST00000360049.4_Nonsense_Mutation_p.E1133*			O94856	NFASC_HUMAN	neurofascin	1311	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCAGTTCAATGAAGACGGCTC	0.562																																					p.E1204X		.											.	NFASC-139	0			c.G3610T						.						197.0	175.0	182.0					1																	204985554		2203	4300	6503	SO:0001587	stop_gained	23114	exon30			TTCAATGAAGACG	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3610G>T	1.37:g.204985554G>T	ENSP00000385637:p.Glu1204*	89	0		310	34	NM_001005388	0	0	0	0	0	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Nonsense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.626230|11.626230	0.99583|0.99583	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000447819|ENST00000367173;ENST00000425360	.|.	.|.	.|.	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	0.000000|.	0.51477|.	D|.	0.000096|.	.|T	.|0.74718	.|0.3753	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73553	.|-0.3946	.|4	0.87932|.	D|.	0|.	.|.	18.6493|18.6493	0.91425|0.91425	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1311;1296;1232;1221;1204;1188;1153;1138;1133;1035;1121;1204;1138;1133;1129;182|1004;261	.|.	ENSP00000295776:E1153X|.	E|M	+|+	1|3	0|0	NFASC|NFASC	203252177|203252177	1.000000|1.000000	0.71417|0.71417	0.966000|0.966000	0.40874|0.40874	0.941000|0.941000	0.58515|0.58515	9.835000|9.835000	0.99442|0.99442	2.484000|2.484000	0.83849|0.83849	0.563000|0.563000	0.77884|0.77884	GAA|ATG	.		0.562	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
CAPN2	824	broad.mit.edu	37	1	223900400	223900400	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:223900400T>C	ENST00000295006.5	+	1	367	c.58T>C	c.(58-60)Tcc>Ccc	p.S20P	CAPN2_ENST00000433674.2_Intron	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	20					blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		GGGGCTGGGCTCCCACGACAG	0.711																																					p.S20P													.	CAPN2-523	0			c.T58C						.						21.0	22.0	22.0					1																	223900400		2193	4289	6482	SO:0001583	missense	824	exon1			CTGGGCTCCCACG	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.58T>C	1.37:g.223900400T>C	ENSP00000295006:p.Ser20Pro	20	1		227	14	NM_001748	0	0	0	0	0	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	ENST00000295006.5	37	CCDS31035.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.163629	0.57476	.	.	ENSG00000162909	ENST00000295006;ENST00000366869	D	0.97870	-4.58	4.22	3.01	0.34805	.	0.164203	0.37304	U	0.002150	D	0.93871	0.8039	L	0.53729	1.69	0.80722	D	1	P	0.48834	0.916	B	0.36418	0.224	D	0.91263	0.5038	10	0.44086	T	0.13	.	5.442	0.16515	0.2528:0.0979:0.0:0.6492	.	20	P17655	CAN2_HUMAN	P	20;49	ENSP00000295006:S20P	ENSP00000295006:S20P	S	+	1	0	CAPN2	221967023	0.001000	0.12720	0.980000	0.43619	0.853000	0.48598	1.115000	0.31209	1.536000	0.49237	0.402000	0.26972	TCC	.		0.711	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
CUL2	8453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	35360197	35360197	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:35360197G>C	ENST00000374748.1	-	3	362	c.49C>G	c.(49-51)Ctt>Gtt	p.L17V	CUL2_ENST00000374742.1_Missense_Mutation_p.L17V|CUL2_ENST00000374751.3_Missense_Mutation_p.L17V|CUL2_ENST00000602371.1_5'UTR|CUL2_ENST00000537177.1_Missense_Mutation_p.L36V|CUL2_ENST00000478044.1_5'UTR|CUL2_ENST00000374749.3_Missense_Mutation_p.L17V|CUL2_ENST00000374746.1_Missense_Mutation_p.L17V			Q13617	CUL2_HUMAN	cullin 2	17					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						GTCGTCAAAAGTTTGTTCCAT	0.358																																					p.L36V		.											.	CUL2-229	0			c.C106G						.						148.0	122.0	131.0					10																	35360197		2203	4300	6503	SO:0001583	missense	8453	exon2			TCAAAAGTTTGTT	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.49C>G	10.37:g.35360197G>C	ENSP00000363880:p.Leu17Val	116	0		173	41	NM_001198778	0	0	0	0	0	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585575	0.66105	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374742;ENST00000537177;ENST00000421317	T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.92	4.06	0.47325	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.058793	0.64402	N	0.000001	T	0.65491	0.2696	L	0.58101	1.795	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;P;D	0.66497	0.944;0.875;0.923	T	0.67150	-0.5743	10	0.87932	D	0	-7.8946	11.7589	0.51890	0.0663:0.1241:0.8097:0.0	.	17;36;17	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	V	17;17;17;17;17;36;17	ENSP00000363883:L17V;ENSP00000363880:L17V;ENSP00000363878:L17V;ENSP00000363881:L17V;ENSP00000363874:L17V;ENSP00000444856:L36V;ENSP00000414095:L17V	ENSP00000363874:L17V	L	-	1	0	CUL2	35400203	1.000000	0.71417	0.282000	0.24776	0.833000	0.47200	6.391000	0.73208	0.824000	0.34613	0.655000	0.94253	CTT	.		0.358	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70404893	70404893	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:70404893G>T	ENST00000373644.4	+	4	2616	c.2407G>T	c.(2407-2409)Gct>Tct	p.A803S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	803					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.A803T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCATAAAAACGCTATGAGCTC	0.353																																					p.A803S		.											.	TET1-663	1	Substitution - Missense(1)	endometrium(1)	c.G2407T						.						100.0	100.0	100.0					10																	70404893		2203	4300	6503	SO:0001583	missense	80312	exon4			AAAAACGCTATGA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.2407G>T	10.37:g.70404893G>T	ENSP00000362748:p.Ala803Ser	102	0		84	10	NM_030625	0	0	0	0	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609899	0.46527	.	.	ENSG00000138336	ENST00000373644	T	0.08458	3.09	5.92	4.93	0.64822	.	0.759080	0.12137	N	0.496237	T	0.05318	0.0141	L	0.27053	0.805	0.27338	N	0.956599	P	0.44429	0.835	B	0.38056	0.264	T	0.21449	-1.0245	10	0.24483	T	0.36	.	4.6605	0.12639	0.2192:0.0:0.7808:0.0	.	803	Q8NFU7	TET1_HUMAN	S	803	ENSP00000362748:A803S	ENSP00000362748:A803S	A	+	1	0	TET1	70074899	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	1.045000	0.30341	2.822000	0.97130	0.650000	0.86243	GCT	.		0.353	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
ACSM6	142827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	96967018	96967018	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:96967018C>A	ENST00000394005.3	+	3	466	c.457C>A	c.(457-459)Caa>Aaa	p.Q153K	C10orf129_ENST00000430183.1_5'UTR|C10orf129_ENST00000341686.3_Missense_Mutation_p.Q153K			Q6P461	ACSM6_HUMAN		153					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		AATTCGCTATCAATTACGCAT	0.468																																					p.Q153K		.											.	C10orf129-90	0			c.C457A						.						82.0	76.0	78.0					10																	96967018		2203	4300	6503	SO:0001583	missense	142827	exon4			CGCTATCAATTAC																												ENST00000394005.3:c.457C>A	10.37:g.96967018C>A	ENSP00000377573:p.Gln153Lys	53	0		94	20	NM_207321	0	0	0	0	0	A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Missense_Mutation	SNP	ENST00000394005.3	37	CCDS7440.2	.	.	.	.	.	.	.	.	.	.	C	6.282	0.420077	0.11928	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000394005	T;T	0.41065	1.01;1.01	1.2	0.259	0.15583	AMP-dependent synthetase/ligase (1);	.	.	.	.	T	0.23249	0.0562	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.09377	0.004	T	0.21586	-1.0241	9	0.87932	D	0	.	5.4913	0.16777	0.0:0.7911:0.0:0.2089	.	153	Q6P461	ACSM6_HUMAN	K	179;153;153	ENSP00000340296:Q153K;ENSP00000377573:Q153K	ENSP00000340296:Q153K	Q	+	1	0	C10orf129	96957008	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	-1.319000	0.02702	0.134000	0.18681	0.579000	0.79373	CAA	.		0.468	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049506.2		
PDZD7	79955	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	102783355	102783355	+	Missense_Mutation	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr10:102783355A>G	ENST00000370215.3	-	4	605	c.380T>C	c.(379-381)cTg>cCg	p.L127P	PDZD7_ENST00000470414.1_Missense_Mutation_p.L127P	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	127	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCCACGCACAGGCCAGCCCG	0.657																																					p.L127P		.											.	PDZD7-136	0			c.T380C						.						62.0	54.0	57.0					10																	102783355		2203	4300	6503	SO:0001583	missense	79955	exon4			ACGCACAGGCCAG	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.380T>C	10.37:g.102783355A>G	ENSP00000359234:p.Leu127Pro	13	0		31	13	NM_001195263	0	0	0	0	0	D5FJ77|Q8N321	Missense_Mutation	SNP	ENST00000370215.3	37	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403886	0.83230	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.50548	0.74	5.05	5.05	0.67936	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000001	T	0.79581	0.4470	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.961	D	0.87162	0.2215	10	0.87932	D	0	.	14.7786	0.69749	1.0:0.0:0.0:0.0	.	127;127	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	P	127	ENSP00000359234:L127P	ENSP00000359234:L127P	L	-	2	0	PDZD7	102773345	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.224000	0.95209	1.893000	0.54813	0.459000	0.35465	CTG	.		0.657	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1078339	1078339	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:1078339C>T	ENST00000441003.2	+	5	653	c.626C>T	c.(625-627)cCc>cTc	p.P209L	MUC2_ENST00000359061.5_Missense_Mutation_p.P209L	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	209	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGTGAGGATCCCGAGGAGGAG	0.642																																					p.P209L		.											.	MUC2-90	0			c.C626T						.						76.0	90.0	86.0					11																	1078339		2086	4194	6280	SO:0001583	missense	4583	exon5			AGGATCCCGAGGA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.626C>T	11.37:g.1078339C>T	ENSP00000415183:p.Pro209Leu	73	0		224	60	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	12.34	1.909914	0.33721	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14766	2.54;2.48	4.08	4.08	0.47627	.	0.567974	0.14666	U	0.305646	T	0.21881	0.0527	L	0.53729	1.69	0.45554	D	0.998508	P	0.37525	0.598	B	0.43386	0.418	T	0.04454	-1.0950	10	0.48119	T	0.1	.	16.2743	0.82636	0.0:1.0:0.0:0.0	.	209	E7EUV1	.	L	209	ENSP00000415183:P209L;ENSP00000351956:P209L	ENSP00000351956:P209L	P	+	2	0	MUC2	1068339	0.995000	0.38212	0.394000	0.26270	0.046000	0.14306	2.838000	0.48199	1.818000	0.53035	0.561000	0.74099	CCC	.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
PDE3B	5140	hgsc.bcm.edu	37	11	14666027	14666027	+	Missense_Mutation	SNP	C	C	G	rs373522381	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:14666027C>G	ENST00000282096.4	+	1	759	c.406C>G	c.(406-408)Ctc>Gtc	p.L136V	PSMA1_ENST00000418988.2_5'Flank|PDE3B_ENST00000455098.2_Missense_Mutation_p.L136V|PDE3B_ENST00000534317.1_3'UTR	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	136					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CACCTGCTTCCTCACCCGGAC	0.692													C|||	2	0.000399361	0.0015	0.0	5008	,	,		14055	0.0		0.0	False		,,,				2504	0.0				p.L136V		.											.	PDE3B-90	0			c.C406G						.						29.0	32.0	31.0					11																	14666027		2199	4294	6493	SO:0001583	missense	5140	exon1			TGCTTCCTCACCC	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.406C>G	11.37:g.14666027C>G	ENSP00000282096:p.Leu136Val	10	0		146	52	NM_000922	0	0	0	0	0	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	37	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170982	0.57584	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.74842	-0.72;-0.88	3.78	0.801	0.18679	.	8.111930	0.00166	N	0.000000	T	0.73953	0.3653	L	0.40543	1.245	0.31630	N	0.649153	P;P;P	0.52842	0.884;0.884;0.956	B;B;P	0.50659	0.358;0.358;0.647	T	0.62058	-0.6934	10	0.45353	T	0.12	.	6.7026	0.23232	0.0:0.5775:0.0:0.4225	.	136;136;136	B7ZM37;Q13370;A7E2E5	.;PDE3B_HUMAN;.	V	136	ENSP00000282096:L136V;ENSP00000388644:L136V	ENSP00000282096:L136V	L	+	1	0	PDE3B	14622603	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	1.686000	0.37669	0.130000	0.18549	0.313000	0.20887	CTC	.		0.692	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922	
OR4X1	390113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	48285602	48285602	+	Missense_Mutation	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:48285602T>G	ENST00000320048.1	+	1	190	c.190T>G	c.(190-192)Tta>Gta	p.L64V		NM_001004726.1	NP_001004726.1	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X, member 1 (gene/pseudogene)	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(1)	28						TCTCAGCTACTTATCCTTTGT	0.493																																					p.L64V		.											.	OR4X1-71	0			c.T190G						.						148.0	135.0	139.0					11																	48285602		2201	4298	6499	SO:0001583	missense	390113	exon1			AGCTACTTATCCT	AB065544	CCDS31487.1	11p11.2	2013-10-10	2013-10-10		ENSG00000176567	ENSG00000176567		"""GPCR / Class A : Olfactory receptors"""	14854	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily X, member 1"""				Standard	NM_001004726		Approved		uc010rht.2	Q8NH49	OTTHUMG00000165301	ENST00000320048.1:c.190T>G	11.37:g.48285602T>G	ENSP00000321506:p.Leu64Val	66	0		156	18	NM_001004726	0	0	0	0	0	Q6IF74	Missense_Mutation	SNP	ENST00000320048.1	37	CCDS31487.1	.	.	.	.	.	.	.	.	.	.	T	10.30	1.313474	0.23908	.	.	ENSG00000176567	ENST00000320048	T	0.00507	6.92	4.29	-3.51	0.04696	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01976	0.0062	H	0.97540	4.025	0.20403	N	0.999903	D	0.57571	0.98	P	0.56960	0.81	T	0.01084	-1.1457	9	0.87932	D	0	.	8.1735	0.31268	0.0:0.4875:0.1294:0.3831	.	64	Q8NH49	OR4X1_HUMAN	V	64	ENSP00000321506:L64V	ENSP00000321506:L64V	L	+	1	2	OR4X1	48242178	0.000000	0.05858	0.901000	0.35422	0.022000	0.10575	-2.554000	0.00926	-1.009000	0.03400	-2.821000	0.00108	TTA	.		0.493	OR4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383373.1	NM_001004726	
SLC43A3	29015	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	57182149	57182149	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:57182149G>A	ENST00000395123.2	-	11	1303	c.999C>T	c.(997-999)ccC>ccT	p.P333P	SLC43A3_ENST00000533524.1_Silent_p.P346P|SLC43A3_ENST00000529554.1_Silent_p.P333P|SLC43A3_ENST00000352187.1_Silent_p.P333P|SLC43A3_ENST00000528098.1_5'Flank|SLC43A3_ENST00000395124.1_Silent_p.P333P	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	333					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GGCCATTCCAGGGGGCACACA	0.537																																					p.P333P													.	SLC43A3-90	0			c.C999T						.						209.0	206.0	207.0					11																	57182149		2201	4296	6497	SO:0001819	synonymous_variant	29015	exon11			ATTCCAGGGGGCA	AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.999C>T	11.37:g.57182149G>A		60	1		182	63	NM_017611	0	0	0	0	0	B4DNR8|E7EQD2|Q9NSS4	Silent	SNP	ENST00000395123.2	37	CCDS7956.1																																																																																			.		0.537	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000393057.1	NM_017611	
KMT2A	4297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	118373932	118373932	+	Missense_Mutation	SNP	A	A	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:118373932A>C	ENST00000389506.5	+	27	7316	c.7316A>C	c.(7315-7317)gAa>gCa	p.E2439A	KMT2A_ENST00000534358.1_Missense_Mutation_p.E2442A|KMT2A_ENST00000354520.4_Missense_Mutation_p.E2401A			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2439					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ACTTTCAAAGAAAAGCATTCC	0.403																																					p.E2442A		.											.	MLL-1255	0			c.A7325C						.						62.0	65.0	64.0					11																	118373932		2199	4296	6495	SO:0001583	missense	4297	exon27			TCAAAGAAAAGCA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.7316A>C	11.37:g.118373932A>C	ENSP00000374157:p.Glu2439Ala	96	0		87	34	NM_001197104	0	0	0	0	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.794138	0.31777	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83591	-1.74;-1.74;-1.71	5.85	5.85	0.93711	.	0.109676	0.64402	D	0.000008	T	0.70064	0.3181	N	0.19112	0.55	0.49915	D	0.999833	P;P	0.49090	0.919;0.919	B;B	0.33339	0.162;0.162	T	0.76889	-0.2792	10	0.72032	D	0.01	.	16.2303	0.82332	1.0:0.0:0.0:0.0	.	2442;2439	E9PQG7;Q03164	.;MLL1_HUMAN	A	2442;2439;2401;1349	ENSP00000436786:E2442A;ENSP00000374157:E2439A;ENSP00000346516:E2401A	ENSP00000346516:E2401A	E	+	2	0	MLL	117879142	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.414000	0.73318	2.233000	0.73108	0.533000	0.62120	GAA	.		0.403	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
HINFP	25988	broad.mit.edu;bcgsc.ca	37	11	119001447	119001447	+	Missense_Mutation	SNP	C	C	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:119001447C>G	ENST00000350777.2	+	3	257	c.194C>G	c.(193-195)tCc>tGc	p.S65C	HINFP_ENST00000527410.1_Missense_Mutation_p.S65C|HINFP_ENST00000527354.1_3'UTR	NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	65					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						GAAGAATTCTCCTGCTTGTGG	0.498																																					p.S65C													.	HINFP-320	0			c.C194G						.						94.0	92.0	93.0					11																	119001447		2200	4295	6495	SO:0001583	missense	25988	exon4			AATTCTCCTGCTT	AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.194C>G	11.37:g.119001447C>G	ENSP00000318085:p.Ser65Cys	70	2		137	54	NM_015517	0	0	0	0	0	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	ENST00000350777.2	37	CCDS8414.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259891	0.39995	.	.	ENSG00000172273	ENST00000350777;ENST00000529988;ENST00000527410;ENST00000532312	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);	0.196552	0.53938	D	0.000047	T	0.28566	0.0707	N	0.22421	0.69	0.39422	D	0.966933	B;B	0.18610	0.029;0.013	B;B	0.17433	0.018;0.007	T	0.06006	-1.0851	10	0.54805	T	0.06	-29.6023	15.5998	0.76616	0.0:0.8631:0.1369:0.0	.	65;65	B4DTN3;Q9BQA5	.;HINFP_HUMAN	C	65	ENSP00000318085:S65C;ENSP00000431468:S65C;ENSP00000436815:S65C;ENSP00000434574:S65C	ENSP00000318085:S65C	S	+	2	0	HINFP	118506657	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.044000	0.41241	2.779000	0.95612	0.655000	0.94253	TCC	.		0.498	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388201.2	NM_015517	
SCNN1A	6337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	6457064	6457064	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:6457064G>A	ENST00000228916.2	-	13	2083	c.1985C>T	c.(1984-1986)tCc>tTc	p.S662F	SCNN1A_ENST00000360168.3_Missense_Mutation_p.S721F|SCNN1A_ENST00000543768.1_Missense_Mutation_p.S685F|SCNN1A_ENST00000540037.1_Missense_Mutation_p.S362F|SCNN1A_ENST00000396966.2_3'UTR|SCNN1A_ENST00000358945.3_Missense_Mutation_p.S684F	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	662					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	AGGACAGGTGGAGGAACTGGC	0.672																																					p.S721F		.											.	SCNN1A-90	0			c.C2162T						.						7.0	8.0	7.0					12																	6457064		2098	4115	6213	SO:0001583	missense	6337	exon12			CAGGTGGAGGAAC	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1985C>T	12.37:g.6457064G>A	ENSP00000228916:p.Ser662Phe	34	0		95	31	NM_001159576	0	0	0	0	0	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	ENST00000228916.2	37	CCDS8543.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383587	0.42207	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000540037;ENST00000228916;ENST00000543768	T;T;T;T;T	0.73258	-0.73;-0.69;-0.44;-0.63;-0.67	3.95	1.82	0.25136	.	1.972990	0.02819	N	0.125281	T	0.70090	0.3184	M	0.63428	1.95	0.09310	N	1	B;B;B	0.32693	0.38;0.38;0.226	B;B;B	0.29267	0.085;0.085;0.1	T	0.60627	-0.7226	10	0.72032	D	0.01	-0.3348	11.2996	0.49298	0.0:0.3534:0.6466:0.0	.	685;662;721	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	F	721;684;362;662;685	ENSP00000353292:S721F;ENSP00000351825:S684F;ENSP00000440876:S362F;ENSP00000228916:S662F;ENSP00000438739:S685F	ENSP00000228916:S662F	S	-	2	0	SCNN1A	6327325	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.471000	0.22100	0.933000	0.37291	0.555000	0.69702	TCC	.		0.672	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
KLRK1	22914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	10539523	10539523	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:10539523T>C	ENST00000240618.6	-	3	267	c.127A>G	c.(127-129)Aaa>Gaa	p.K43E	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Missense_Mutation_p.K43E|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	43					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						CATTTGCTTTTGACTACTGGA	0.323																																					p.K43E		.											.	.	0			c.A127G						.						207.0	186.0	193.0					12																	10539523		2203	4298	6501	SO:0001583	missense	0	exon8			TGCTTTTGACTAC	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.127A>G	12.37:g.10539523T>C	ENSP00000240618:p.Lys43Glu	47	0		85	32	NM_001199805	0	0	0	0	0	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	37	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.445773	0.25987	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01474	4.85;4.85	4.24	1.81	0.25067	.	0.304503	0.23859	N	0.043877	T	0.01661	0.0053	L	0.36672	1.1	0.09310	N	1	B;B;B	0.26775	0.056;0.159;0.081	B;B;B	0.29524	0.029;0.103;0.028	T	0.46527	-0.9185	10	0.34782	T	0.22	.	4.666	0.12666	0.1788:0.0:0.2431:0.5781	.	43;24;43	Q8WZ67;Q1HEA1;P26718	.;.;NKG2D_HUMAN	E	43	ENSP00000240618:K43E;ENSP00000446003:K43E	ENSP00000240618:K43E	K	-	1	0	KLRK1	10430790	0.005000	0.15991	0.001000	0.08648	0.025000	0.11179	0.895000	0.28363	0.250000	0.21479	0.455000	0.32223	AAA	.		0.323	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
PTPRO	5800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	15673198	15673198	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:15673198G>A	ENST00000281171.4	+	10	2173	c.1843G>A	c.(1843-1845)Gat>Aat	p.D615N	PTPRO_ENST00000348962.2_Missense_Mutation_p.D615N	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	615	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GACGTGGGGAGATCCAGAATT	0.478																																					p.D615N		.											.	PTPRO-271	0			c.G1843A						.						138.0	124.0	129.0					12																	15673198		2203	4300	6503	SO:0001583	missense	5800	exon10			TGGGGAGATCCAG	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1843G>A	12.37:g.15673198G>A	ENSP00000281171:p.Asp615Asn	96	0		262	78	NM_002848	0	0	0	0	0	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956744	0.92726	.	.	ENSG00000151490	ENST00000281171;ENST00000348962	T;T	0.53640	3.8;0.61	5.2	5.2	0.72013	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.249218	0.27922	N	0.017316	T	0.41558	0.1164	N	0.19112	0.55	0.80722	D	1	P;P	0.41188	0.741;0.624	B;B	0.43658	0.426;0.245	T	0.44952	-0.9294	10	0.72032	D	0.01	.	17.0929	0.86627	0.0:0.0:1.0:0.0	.	615;615	Q16827-2;Q16827	.;PTPRO_HUMAN	N	615	ENSP00000281171:D615N;ENSP00000343434:D615N	ENSP00000281171:D615N	D	+	1	0	PTPRO	15564465	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.851000	0.92205	2.689000	0.91719	0.655000	0.94253	GAT	.		0.478	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
DDN	23109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49391677	49391677	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:49391677C>T	ENST00000421952.2	-	2	1003	c.982G>A	c.(982-984)Ggt>Agt	p.G328S	RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	328						cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						CTGTCGCTACCACTGTTCAGG	0.677																																					p.G328S		.											.	DDN-90	0			c.G982A						.						46.0	53.0	51.0					12																	49391677		2203	4299	6502	SO:0001583	missense	23109	exon2			CGCTACCACTGTT	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.982G>A	12.37:g.49391677C>T	ENSP00000390590:p.Gly328Ser	20	0		53	11	NM_015086	0	0	0	0	0		Missense_Mutation	SNP	ENST00000421952.2	37	CCDS31791.2	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658359	0.67586	.	.	ENSG00000181418	ENST00000421952	T	0.44881	0.91	3.88	2.05	0.26809	.	0.148751	0.31601	N	0.007378	T	0.21387	0.0515	N	0.24115	0.695	0.09310	N	1	P	0.40909	0.732	B	0.31191	0.125	T	0.10776	-1.0615	10	0.42905	T	0.14	-3.234	7.9639	0.30087	0.0:0.798:0.0:0.202	.	328	O94850	DEND_HUMAN	S	328	ENSP00000390590:G328S	ENSP00000390590:G328S	G	-	1	0	DDN	47677944	0.000000	0.05858	0.001000	0.08648	0.743000	0.42351	0.617000	0.24359	0.617000	0.30160	0.561000	0.74099	GGT	.		0.677	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
METAP2	10988	broad.mit.edu	37	12	95867964	95867964	+	Silent	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:95867964T>G	ENST00000323666.5	+	1	238	c.9T>G	c.(7-9)ggT>ggG	p.G3G	METAP2_ENST00000261220.9_Silent_p.G3G|METAP2_ENST00000550777.1_Silent_p.G3G|METAP2_ENST00000551840.1_Silent_p.G3G|METAP2_ENST00000546753.1_Silent_p.G3G	NM_006838.3	NP_006829.1			methionyl aminopeptidase 2											endometrium(3)|large_intestine(2)|lung(7)|prostate(1)	13						ACATGGCGGGTGTGGAGGAGG	0.652																																					p.G3G													.	METAP2-90	0			c.T9G						.						34.0	42.0	39.0					12																	95867964		2203	4297	6500	SO:0001819	synonymous_variant	10988	exon1			GGCGGGTGTGGAG	U13261	CCDS9052.1	12q22	2014-09-04			ENSG00000111142		3.4.11.18		16672	protein-coding gene	gene with protein product	"""Peptidase M"""	601870				7644482, 8858118	Standard	NM_006838		Approved	MNPEP, p67, MAP2	uc001tec.3	P50579	OTTHUMG00000170280	ENST00000323666.5:c.9T>G	12.37:g.95867964T>G		41	4		166	27	NM_006838	0	0	1	1	0		Silent	SNP	ENST00000323666.5	37	CCDS9052.1																																																																																			.		0.652	METAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408296.1	NM_006838	
FAM216A	29902	hgsc.bcm.edu	37	12	110906786	110906786	+	Missense_Mutation	SNP	C	C	T	rs202079205	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:110906786C>T	ENST00000377673.5	+	1	618	c.106C>T	c.(106-108)Ccg>Tcg	p.P36S	GPN3_ENST00000228827.3_5'Flank|GPN3_ENST00000543199.1_5'Flank|GPN3_ENST00000552180.1_5'UTR|GPN3_ENST00000537466.2_5'Flank	NM_013300.2	NP_037432.2	Q8WUB2	F216A_HUMAN	family with sequence similarity 216, member A	36																	TTCTGCAGAGCCGCCCGCTGT	0.771													C|||	12	0.00239617	0.0091	0.0	5008	,	,		13111	0.0		0.0	False		,,,				2504	0.0				p.P36S		.											.	.	0			c.C106T						.	C	SER/PRO	24,3054		0,24,1515	2.0	2.0	2.0		106	3.3	0.1	12		2	0,6186		0,0,3093	yes	missense	C12orf24	NM_013300.2	74	0,24,4608	TT,TC,CC		0.0,0.7797,0.2591	probably-damaging	36/274	110906786	24,9240	1539	3093	4632	SO:0001583	missense	29902	exon1			GCAGAGCCGCCCG	U79274	CCDS31899.1	12q24.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000204856	ENSG00000204856			30180	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 24"""	C12orf24			Standard	NM_013300		Approved	HSU79274	uc001tqu.4	Q8WUB2	OTTHUMG00000169526	ENST00000377673.5:c.106C>T	12.37:g.110906786C>T	ENSP00000366901:p.Pro36Ser	1	0		25	12	NM_013300	0	0	0	1	1	A6NH30|Q99776	Missense_Mutation	SNP	ENST00000377673.5	37	CCDS31899.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.171608	0.78452	0.007797	0.0	ENSG00000204856	ENST00000377673;ENST00000538285	T	0.51071	0.72	4.16	3.27	0.37495	.	0.000000	0.39544	N	0.001336	T	0.32645	0.0836	L	0.56769	1.78	0.27811	N	0.942126	B;B	0.30709	0.291;0.129	B;B	0.26693	0.072;0.031	T	0.41645	-0.9497	10	0.87932	D	0	-0.6948	9.2806	0.37727	0.0:0.8974:0.0:0.1026	.	36;36	F5GZE4;Q8WUB2	.;CL024_HUMAN	S	36	ENSP00000366901:P36S	ENSP00000366901:P36S	P	+	1	0	C12orf24	109391169	0.943000	0.32029	0.132000	0.22025	0.895000	0.52256	2.944000	0.49034	1.096000	0.41439	0.462000	0.41574	CCG	.		0.771	FAM216A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404616.1	NM_013300	
PPTC7	160760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	110969392	110969392	+	3'UTR	SNP	A	A	G	rs139110749	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:110969392A>G	ENST00000354300.3	-	0	6653				RAD9B_ENST00000409246.1_3'UTR|RAD9B_ENST00000409778.3_Missense_Mutation_p.K311R|RAD9B_ENST00000409300.1_3'UTR|RAD9B_ENST00000392672.4_Silent_p.K416K|RAD9B_ENST00000409425.1_3'UTR	NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						GCTGCAGGAAAGAATTTAATG	0.353																																					p.K416K		.											.	RAD9B-228	0			c.A1248G						.						94.0	83.0	87.0					12																	110969392		1566	3582	5148	SO:0001624	3_prime_UTR_variant	144715	exon12			CAGGAAAGAATTT	AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.*5450T>C	12.37:g.110969392A>G		12	0		27	9	NM_152442	0	0	4	4	0	B3KWC5|Q68DZ7|Q6UY82	Silent	SNP	ENST00000354300.3	37	CCDS9149.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.352501	0.41700	.	.	ENSG00000151164	ENST00000409778	T	0.19250	2.16	4.49	2.08	0.27032	.	155.184000	0.02530	U	0.093532	T	0.15609	0.0376	.	.	.	0.09310	N	1	B	0.26635	0.155	B	0.23574	0.047	T	0.21211	-1.0252	9	0.40728	T	0.16	14.2473	4.9792	0.14157	0.6246:0.1916:0.0:0.1837	.	311	B4DYM6	.	R	311	ENSP00000386697:K311R	ENSP00000386697:K311R	K	+	2	0	RAD9B	109453775	0.009000	0.17119	0.001000	0.08648	0.372000	0.29890	1.856000	0.39389	0.343000	0.23821	0.397000	0.26171	AAG	.		0.353	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404635.1	NM_139283	
RBM19	9904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	114385205	114385205	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:114385205G>A	ENST00000545145.2	-	11	1419	c.1341C>T	c.(1339-1341)ttC>ttT	p.F447F	RBM19_ENST00000261741.5_Silent_p.F447F|RBM19_ENST00000392561.3_Silent_p.F447F	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	447	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TGAAGGTGATGAATGCAAAAC	0.602																																					p.F447F		.											.	RBM19-95	0			c.C1341T						.						144.0	122.0	130.0					12																	114385205		2203	4300	6503	SO:0001819	synonymous_variant	9904	exon11			GGTGATGAATGCA	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1341C>T	12.37:g.114385205G>A		73	0		278	64	NM_001146699	0	0	0	3	3	A8K5X9|Q9BPY6|Q9UFN5	Silent	SNP	ENST00000545145.2	37	CCDS9172.1																																																																																			.		0.602	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
BRI3BP	140707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	125509640	125509640	+	Silent	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:125509640C>A	ENST00000341446.8	+	3	511	c.420C>A	c.(418-420)tcC>tcA	p.S140S		NM_080626.5	NP_542193.3			BRI3 binding protein											large_intestine(1)|lung(8)|ovary(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.35e-05)|Epithelial(86;0.000426)|all cancers(50;0.00576)		GGTTCTTGTCCCTGACCCTGG	0.632																																					p.S140S		.											.	BRI3BP-91	0			c.C420A						.						100.0	83.0	89.0					12																	125509640		2203	4300	6503	SO:0001819	synonymous_variant	140707	exon3			CTTGTCCCTGACC	AF284094	CCDS9262.1	12q24.1	2008-08-04			ENSG00000184992	ENSG00000184992			14251	protein-coding gene	gene with protein product		615627				11860200, 17765869	Standard	NM_080626		Approved	BNAS1, KG19, HCCR-2	uc001uha.1	Q8WY22	OTTHUMG00000168548	ENST00000341446.8:c.420C>A	12.37:g.125509640C>A		25	0		85	32	NM_080626	0	0	8	15	7		Silent	SNP	ENST00000341446.8	37	CCDS9262.1																																																																																			.		0.632	BRI3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400200.2	NM_080626	
N6AMT2	221143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	21306119	21306119	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr13:21306119T>C	ENST00000382758.1	-	4	416	c.369A>G	c.(367-369)ccA>ccG	p.P123P	N6AMT2_ENST00000382754.4_Silent_p.P123P			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	123						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GTAAGTCCAATGGATTATTGT	0.378																																					p.P123P		.											.	N6AMT2-68	0			c.A369G						.						121.0	116.0	118.0					13																	21306119		2203	4300	6503	SO:0001819	synonymous_variant	221143	exon4			GTCCAATGGATTA	AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.369A>G	13.37:g.21306119T>C		83	0		82	37	NM_174928	0	0	0	4	4	B5G4V1	Silent	SNP	ENST00000382758.1	37	CCDS9293.1																																																																																			.		0.378	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044083.1	NM_174928	
FARP1	10160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	99092299	99092299	+	Splice_Site	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr13:99092299T>A	ENST00000319562.6	+	22	2781		c.e22+2		FARP1_ENST00000376586.2_Splice_Site|FARP1_ENST00000595437.1_Splice_Site	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)						dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGCCGCCAGGTAACTCGGGAG	0.627																																					.		.											.	FARP1-290	0			c.2516+2T>A						.						103.0	116.0	112.0					13																	99092299		2203	4300	6503	SO:0001630	splice_region_variant	10160	exon22			GCCAGGTAACTCG	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2516+2T>A	13.37:g.99092299T>A		27	0		70	13	NM_005766	0	0	0	1	1	Q5JVI9|Q6IQ29	Splice_Site	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843475	0.91197	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0308	0.64615	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	FARP1	97890300	1.000000	0.71417	0.999000	0.59377	0.910000	0.53928	5.986000	0.70563	1.917000	0.55516	0.533000	0.62120	.	.		0.627	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	Intron
ARHGEF40	55701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	21543565	21543565	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr14:21543565G>C	ENST00000298694.4	+	4	1652	c.1525G>C	c.(1525-1527)Gac>Cac	p.D509H	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.D509H			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	509						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						AGGAAAAGGGGACAACATTCC	0.557																																					p.D509H		.											.	ARHGEF40-228	0			c.G1525C						.						131.0	127.0	128.0					14																	21543565		2203	4300	6503	SO:0001583	missense	55701	exon4			AAAGGGGACAACA		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.1525G>C	14.37:g.21543565G>C	ENSP00000298694:p.Asp509His	108	0		227	62	NM_018071	0	0	0	0	0	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	37	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	G	0.307	-0.970175	0.02232	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02472	4.34;4.28	5.12	2.29	0.28610	.	0.113584	0.39210	N	0.001427	T	0.02230	0.0069	N	0.22421	0.69	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.44329	-0.9335	10	0.40728	T	0.16	.	7.8371	0.29376	0.0851:0.308:0.6069:0.0	.	509;509	Q8TER5;G3V3N2	ARH40_HUMAN;.	H	509	ENSP00000298694:D509H;ENSP00000298693:D509H	ENSP00000298693:D509H	D	+	1	0	ARHGEF40	20613405	0.142000	0.22610	0.001000	0.08648	0.002000	0.02628	1.389000	0.34453	0.272000	0.22027	-0.225000	0.12378	GAC	.		0.557	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
CIPC	85457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	14	77580238	77580238	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr14:77580238C>T	ENST00000361786.2	+	4	1094	c.777C>T	c.(775-777)ttC>ttT	p.F259F	RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		259					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		GTCTGACCTTCGCTTCCCCCG	0.572																																					p.F259F		.											.	KIAA1737-90	0			c.C777T						.						84.0	68.0	74.0					14																	77580238		2203	4300	6503	SO:0001819	synonymous_variant	85457	exon4			GACCTTCGCTTCC																												ENST00000361786.2:c.777C>T	14.37:g.77580238C>T		26	0		48	24	NM_033426	0	0	0	0	0	B2RCI1|Q8N389|Q8NDZ1	Silent	SNP	ENST00000361786.2	37	CCDS9855.1																																																																																			.		0.572	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414278.1		
ITPK1	3705	hgsc.bcm.edu	37	14	93408017	93408017	+	Silent	SNP	C	C	T	rs563090061	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr14:93408017C>T	ENST00000267615.6	-	11	1307	c.1134G>A	c.(1132-1134)gcG>gcA	p.A378A	ITPK1_ENST00000556603.2_Silent_p.A378A|ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000555495.1_Silent_p.A259A			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	378					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		CGGTGCCGCCCGCGTCGGCCT	0.736													C|||	4	0.000798722	0.0008	0.0014	5008	,	,		13386	0.001		0.0	False		,,,				2504	0.001				p.A378A		.											.	ITPK1-115	0			c.G1134A						.						3.0	3.0	3.0					14																	93408017		1665	3314	4979	SO:0001819	synonymous_variant	3705	exon11			GCCGCCCGCGTCG	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.1134G>A	14.37:g.93408017C>T		0	0		14	12	NM_001142593	0	0	0	1	1	Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	37	CCDS9907.1																																																																																			.		0.736	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
CASC5	57082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40915310	40915310	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:40915310G>T	ENST00000346991.5	+	11	3316	c.2926G>T	c.(2926-2928)Gtt>Ttt	p.V976F	CASC5_ENST00000399668.2_Missense_Mutation_p.V950F|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	976	2 X 104 AA approximate repeats.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGATAATCATGTTGAACTAGA	0.378																																					p.V976F		.											.	CASC5-660	0			c.G2926T						.						92.0	86.0	88.0					15																	40915310		1860	4104	5964	SO:0001583	missense	57082	exon11			AATCATGTTGAAC	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.2926G>T	15.37:g.40915310G>T	ENSP00000335463:p.Val976Phe	58	0		88	21	NM_170589	0	0	0	0	0	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	37	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757693	0.31137	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.16897	2.31;2.31	4.64	0.322	0.15888	.	0.547984	0.17535	N	0.170730	T	0.07503	0.0189	N	0.08118	0	0.09310	N	1	B;B;P	0.39352	0.101;0.009;0.669	B;B;B	0.34652	0.053;0.001;0.187	T	0.24621	-1.0155	10	0.62326	D	0.03	.	9.0014	0.36083	0.436:0.0:0.564:0.0	.	950;976;950	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	F	976;950;950	ENSP00000335463:V976F;ENSP00000382576:V950F	ENSP00000260369:V950F	V	+	1	0	CASC5	38702602	0.000000	0.05858	0.020000	0.16555	0.900000	0.52787	-0.061000	0.11693	0.051000	0.15978	0.557000	0.71058	GTT	.		0.378	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
HDC	3067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	50535435	50535435	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:50535435C>T	ENST00000267845.3	-	11	1549	c.1147G>A	c.(1147-1149)Gaa>Aaa	p.E383K	HDC_ENST00000543581.1_Missense_Mutation_p.E350K|RN7SL494P_ENST00000461517.2_RNA	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TTAGCCATTTCAGTACCCTGG	0.403																																					p.E383K	GBM(95;1627 1936 6910 9570)	.											.	HDC-156	0			c.G1147A						.						65.0	65.0	65.0					15																	50535435		2196	4295	6491	SO:0001583	missense	3067	exon11			CCATTTCAGTACC		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1147G>A	15.37:g.50535435C>T	ENSP00000267845:p.Glu383Lys	106	0		155	62	NM_002112	0	0	0	0	0		Missense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043666	0.55003	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.39592	1.07;1.07	5.82	4.9	0.64082	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.280579	0.41605	N	0.000857	T	0.37972	0.1023	L	0.28694	0.88	0.58432	D	0.999998	P;P	0.35894	0.526;0.526	B;B	0.43508	0.422;0.307	T	0.10200	-1.0640	10	0.18276	T	0.48	-10.5182	14.7799	0.69756	0.0:0.9307:0.0:0.0693	.	350;383	B7ZM01;P19113	.;DCHS_HUMAN	K	383;350	ENSP00000267845:E383K;ENSP00000440252:E350K	ENSP00000267845:E383K	E	-	1	0	HDC	48322727	0.999000	0.42202	0.897000	0.35233	0.970000	0.65996	3.899000	0.56288	1.462000	0.47948	0.467000	0.42956	GAA	.		0.403	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
MYO5C	55930	hgsc.bcm.edu	37	15	52500781	52500781	+	Silent	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:52500781G>T	ENST00000261839.7	-	36	4517	c.4356C>A	c.(4354-4356)ctC>ctA	p.L1452L	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1452	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TCAGGCAATTGAGAAAATGAC	0.438											OREG0023129	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1452L		.											.	MYO5C-145	0			c.C4356A						.						105.0	107.0	106.0					15																	52500781		1889	4099	5988	SO:0001819	synonymous_variant	55930	exon36			GCAATTGAGAAAA	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4356C>A	15.37:g.52500781G>T		58	0	985	108	9	NM_018728	0	0	0	0	0	Q6P1W8	Silent	SNP	ENST00000261839.7	37	CCDS42036.1																																																																																			.		0.438	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
CSPG4	1464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75982866	75982866	+	Silent	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:75982866G>C	ENST00000308508.5	-	3	632	c.540C>G	c.(538-540)ctC>ctG	p.L180L		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	180	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GAGGCCGGAGGAGGCTGCGGC	0.647																																					p.L180L		.											.	CSPG4-229	0			c.C540G						.						35.0	40.0	38.0					15																	75982866		2147	4173	6320	SO:0001819	synonymous_variant	1464	exon3			CCGGAGGAGGCTG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.540C>G	15.37:g.75982866G>C		43	0		62	20	NM_001897	0	0	0	0	0	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	37	CCDS10284.1																																																																																			.		0.647	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
MEF2A	4205	hgsc.bcm.edu	37	15	100211761	100211761	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:100211761C>T	ENST00000354410.5	+	5	924	c.295C>T	c.(295-297)Cca>Tca	p.P99S	MEF2A_ENST00000557942.1_Intron|MEF2A_ENST00000453228.2_Intron|MEF2A_ENST00000338042.6_Intron|MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000557785.1_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	99					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.P99S(3)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GTGCGACAGCCCAGACCCTGA	0.333																																					p.P99S		.											.	MEF2A-455	3	Substitution - Missense(3)	lung(1)|kidney(1)|central_nervous_system(1)	c.C295T						.						82.0	69.0	73.0					15																	100211761		1843	4079	5922	SO:0001583	missense	4205	exon5			GACAGCCCAGACC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.295C>T	15.37:g.100211761C>T	ENSP00000346389:p.Pro99Ser	23	0		37	7	NM_005587	0	0	2	2	0	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.814941	0.90790	.	.	ENSG00000068305	ENST00000354410	T	0.63255	-0.03	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.000000	0.85682	D	0.000000	D	0.82866	0.5130	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85220	0.1026	10	0.72032	D	0.01	-16.5447	19.5673	0.95398	0.0:1.0:0.0:0.0	.	99;99	Q02078;Q02078-5	MEF2A_HUMAN;.	S	99	ENSP00000346389:P99S	ENSP00000346389:P99S	P	+	1	0	MEF2A	98029284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.706000	0.92434	0.462000	0.41574	CCA	.		0.333	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000415980.1		
HMOX2	3163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	4557977	4557977	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:4557977C>T	ENST00000570646.1	+	4	1073	c.468C>T	c.(466-468)cgC>cgT	p.R156R	HMOX2_ENST00000414777.1_Silent_p.R156R|HMOX2_ENST00000406590.2_Silent_p.R156R|HMOX2_ENST00000575120.1_Silent_p.R127R|HMOX2_ENST00000219700.6_Silent_p.R156R|HMOX2_ENST00000398595.3_Silent_p.R156R|HMOX2_ENST00000458134.3_Silent_p.R156R	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	156					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						CATACACCCGCTACATGGGGG	0.617																																					p.R156R		.											.	HMOX2-90	0			c.C468T						.						39.0	43.0	41.0					16																	4557977		2197	4300	6497	SO:0001819	synonymous_variant	3163	exon4			CACCCGCTACATG		CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.468C>T	16.37:g.4557977C>T		80	0		216	85	NM_001127205	0	0	43	107	64	A8MT35|D3DUD5|I3L430|O60605	Silent	SNP	ENST00000570646.1	37	CCDS10517.1																																																																																			.		0.617	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251636.2		
RRN3	54700	broad.mit.edu	37	16	15188060	15188060	+	Missense_Mutation	SNP	G	G	A	rs201504364		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:15188060G>A	ENST00000198767.6	-	1	114	c.31C>T	c.(31-33)Ccg>Tcg	p.P11S	RP11-72I8.1_ENST00000569858.1_RNA|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000563559.1_Missense_Mutation_p.P11S|RRN3_ENST00000564131.1_Missense_Mutation_p.P11S|RRN3_ENST00000429751.2_Missense_Mutation_p.P11S|RRN3_ENST00000327307.7_5'Flank	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	11					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P11S(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GCATCTCCCGGCAAACGCGTG	0.637																																					p.P11S													.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C31T						.						15.0	14.0	14.0					16																	15188060		2193	4294	6487	SO:0001583	missense	54700	exon1			CTCCCGGCAAACG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.31C>T	16.37:g.15188060G>A	ENSP00000198767:p.Pro11Ser	36	0		187	13	NM_018427	0	0	0	0	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323150	0.24080	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.46819	1.02;0.86	3.13	0.948	0.19561	.	.	.	.	.	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.26538	-1.0100	9	0.06494	T	0.89	.	3.8332	0.08883	0.1556:0.2546:0.5898:0.0	.	11;11;11	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	S	11	ENSP00000198767:P11S;ENSP00000402027:P11S	ENSP00000198767:P11S	P	-	1	0	RRN3	15095561	0.001000	0.12720	0.003000	0.11579	0.038000	0.13279	0.733000	0.26087	0.121000	0.18284	0.305000	0.20034	CCG	G|0.997;A|0.003		0.637	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
RRN3	54700	broad.mit.edu	37	16	15188066	15188066	+	Missense_Mutation	SNP	G	G	A	rs200006712		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:15188066G>A	ENST00000198767.6	-	1	108	c.25C>T	c.(25-27)Cgt>Tgt	p.R9C	RP11-72I8.1_ENST00000569858.1_RNA|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000563559.1_Missense_Mutation_p.R9C|RRN3_ENST00000564131.1_Missense_Mutation_p.R9C|RRN3_ENST00000429751.2_Missense_Mutation_p.R9C|RRN3_ENST00000327307.7_5'Flank	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	9					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R9C(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CCCGGCAAACGCGTGTGAAGC	0.642																																					p.R9C													.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C25T						.						15.0	13.0	14.0					16																	15188066		2194	4290	6484	SO:0001583	missense	54700	exon1			GCAAACGCGTGTG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.25C>T	16.37:g.15188066G>A	ENSP00000198767:p.Arg9Cys	34	0		180	11	NM_018427	0	0	0	0	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	18.86	3.712820	0.68730	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.59906	0.68;0.23	3.13	3.13	0.36017	.	.	.	.	.	T	0.59032	0.2164	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.988;0.99;0.982	T	0.62627	-0.6814	9	0.87932	D	0	.	9.8894	0.41281	0.0:0.0:1.0:0.0	.	9;9;9	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	C	9	ENSP00000198767:R9C;ENSP00000402027:R9C	ENSP00000198767:R9C	R	-	1	0	RRN3	15095567	1.000000	0.71417	0.965000	0.40720	0.035000	0.12851	2.717000	0.47227	1.752000	0.51891	0.305000	0.20034	CGT	G|0.997;A|0.003		0.642	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
LAT	27040	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	28996234	28996234	+	5'Flank	SNP	G	G	A	rs572112079	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:28996234G>A	ENST00000360872.5	+	0	0				LAT_ENST00000395461.3_Missense_Mutation_p.A18T|LAT_ENST00000564277.1_5'Flank|LAT_ENST00000354453.4_5'Flank|LAT_ENST00000395456.2_5'Flank|LAT_ENST00000454369.2_5'Flank|LAT_ENST00000566177.1_5'Flank|RP11-264B17.3_ENST00000569969.1_RNA			O43561	LAT_HUMAN	linker for activation of T cells						blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CTTGGGGGGGGCCAGCAGACC	0.731																																					p.A18T		.											.	LAT-44	0			c.G52A						.						7.0	8.0	8.0					16																	28996234		690	1584	2274	SO:0001631	upstream_gene_variant	27040	exon1			GGGGGGGCCAGCA	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761		16.37:g.28996234G>A	Exception_encountered	16	0		91	29	NM_001014989	0	0	0	0	0	B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	ENST00000360872.5	37	CCDS10647.1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.247385	0.22880	.	.	ENSG00000213658	ENST00000395461	.	.	.	2.5	-1.56	0.08532	.	.	.	.	.	T	0.16128	0.0388	N	0.08118	0	0.19300	N	0.999973	B	0.02656	0.0	B	0.01281	0.0	T	0.21655	-1.0239	8	0.87932	D	0	-0.7971	3.9972	0.09564	0.1852:0.4888:0.326:0.0	.	18	B7WPI0	.	T	18	.	ENSP00000378845:A18T	A	+	1	0	LAT	28903735	0.000000	0.05858	0.002000	0.10522	0.036000	0.12997	-0.751000	0.04803	-0.063000	0.13065	-0.264000	0.10439	GCC	.		0.731	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
PRRT2	112476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	29825753	29825753	+	Missense_Mutation	SNP	A	A	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:29825753A>C	ENST00000358758.7	+	3	1262	c.979A>C	c.(979-981)Atc>Ctc	p.I327L	PAGR1_ENST00000320330.6_5'Flank|AC009133.14_ENST00000569981.1_RNA|PRRT2_ENST00000300797.6_3'UTR|AC009133.20_ENST00000569039.1_RNA|PAGR1_ENST00000609618.1_5'Flank|PRRT2_ENST00000567659.1_Missense_Mutation_p.I327L	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	327					neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						GGGAGTCCTCATCATCATCGC	0.642																																					p.I327L		.											.	PRRT2-68	0			c.A979C						.						73.0	81.0	78.0					16																	29825753		2197	4300	6497	SO:0001583	missense	112476	exon3			GTCCTCATCATCA	BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.979A>C	16.37:g.29825753A>C	ENSP00000351608:p.Ile327Leu	18	0		59	18	NM_001256442	0	0	0	1	1	A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Missense_Mutation	SNP	ENST00000358758.7	37	CCDS10654.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.815687	0.70912	.	.	ENSG00000167371	ENST00000358758	D	0.85339	-1.97	3.71	3.71	0.42584	.	0.745808	0.12408	N	0.471504	D	0.86410	0.5926	N	0.25380	0.74	0.80722	D	1	D;D	0.63046	0.992;0.99	D;D	0.76071	0.987;0.978	T	0.82796	-0.0280	10	0.40728	T	0.16	-8.8013	10.7234	0.46052	1.0:0.0:0.0:0.0	.	327;327	Q7Z6L0;Q7Z6L0-2	PRRT2_HUMAN;.	L	327	ENSP00000351608:I327L	ENSP00000351608:I327L	I	+	1	0	PRRT2	29733254	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.922000	0.48860	1.481000	0.48307	0.372000	0.22366	ATC	.		0.642	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255161.3	NM_145239	
ESRP2	80004	broad.mit.edu	37	16	68267896	68267896	+	Splice_Site	SNP	C	C	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:68267896C>G	ENST00000565858.1	-	3	528		c.e3+1		RP11-96D1.6_ENST00000564147.1_RNA|ESRP2_ENST00000473183.2_Splice_Site	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2						mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						CAGGAGCATACCTTCCTGGAG	0.617																																					.													.	ESRP2-91	0			c.441+1G>C						.						47.0	46.0	46.0					16																	68267896		2198	4300	6498	SO:0001630	splice_region_variant	80004	exon4			AGCATACCTTCCT	AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.441+1G>C	16.37:g.68267896C>G		44	2		98	28	NM_024939	0	0	0	0	0	Q8N6H8|Q8WZ15|Q9H6I4	Splice_Site	SNP	ENST00000565858.1	37		.	.	.	.	.	.	.	.	.	.	C	20.9	4.072387	0.76415	.	.	ENSG00000103067	ENST00000473183	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5613	0.87908	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ESRP2	66825397	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.127000	0.77210	2.663000	0.90544	0.655000	0.94253	.	.		0.617	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000433083.1	NM_024939	Intron
DHX38	9785	broad.mit.edu	37	16	72141342	72141342	+	Missense_Mutation	SNP	G	G	A	rs374391366		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:72141342G>A	ENST00000268482.3	+	20	3213	c.2704G>A	c.(2704-2706)Ggg>Agg	p.G902R	DHX38_ENST00000536867.1_Missense_Mutation_p.G214R	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	902	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				CAAGTCCCTCGGGGTGCAGGA	0.597																																					p.G902R	Melanoma(97;711 1442 7855 13832 28836)												.	DHX38-227	0			c.G2704A						.	G	ARG/GLY	2,4394	4.2+/-10.8	0,2,2196	42.0	37.0	38.0		2704	5.3	1.0	16		38	0,8600		0,0,4300	no	missense	DHX38	NM_014003.3	125	0,2,6496	AA,AG,GG		0.0,0.0455,0.0154	possibly-damaging	902/1228	72141342	2,12994	2198	4300	6498	SO:0001583	missense	9785	exon20			TCCCTCGGGGTGC	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2704G>A	16.37:g.72141342G>A	ENSP00000268482:p.Gly902Arg	25	0		118	5	NM_014003	0	0	5	5	0	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	37	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651253	0.88056	4.55E-4	0.0	ENSG00000140829	ENST00000268482;ENST00000536867	T;T	0.04156	3.69;3.69	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.125696	0.52532	D	0.000067	T	0.14743	0.0356	M	0.85462	2.755	0.80722	D	1	D;P	0.53885	0.963;0.936	B;P	0.45449	0.429;0.481	T	0.01604	-1.1314	10	0.72032	D	0.01	.	18.7055	0.91637	0.0:0.0:1.0:0.0	.	214;902	B4DVG8;Q92620	.;PRP16_HUMAN	R	902;214	ENSP00000268482:G902R;ENSP00000437898:G214R	ENSP00000268482:G902R	G	+	1	0	DHX38	70698843	1.000000	0.71417	0.966000	0.40874	0.973000	0.67179	9.190000	0.94934	2.745000	0.94114	0.655000	0.94253	GGG	.		0.597	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
TAF1C	9013	broad.mit.edu	37	16	84214979	84214979	+	Silent	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:84214979C>A	ENST00000567759.1	-	10	1379	c.1197G>T	c.(1195-1197)gtG>gtT	p.V399V	TAF1C_ENST00000570117.1_Silent_p.V67V|TAF1C_ENST00000378541.4_Silent_p.V399V|TAF1C_ENST00000341690.6_Silent_p.V306V|TAF1C_ENST00000541676.1_Silent_p.V306V|TAF1C_ENST00000566732.1_Silent_p.V373V	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	399					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CCACGGTCAGCACCCGAGGGT	0.667																																					p.V399V													.	TAF1C-91	0			c.G1197T						.						45.0	44.0	44.0					16																	84214979		2200	4299	6499	SO:0001819	synonymous_variant	9013	exon10			GGTCAGCACCCGA	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1197G>T	16.37:g.84214979C>A		15	0		147	8	NM_005679	0	0	0	0	0	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	CCDS32496.1																																																																																			.		0.667	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
TNK1	8711	hgsc.bcm.edu	37	17	7287558	7287558	+	Silent	SNP	T	T	C	rs17853470	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:7287558T>C	ENST00000576812.1	+	6	1221	c.852T>C	c.(850-852)ccT>ccC	p.P284P	TNK1_ENST00000570896.1_Silent_p.P284P|TNK1_ENST00000311668.2_Silent_p.P284P	NM_001251902.1	NP_001238831.1			tyrosine kinase, non-receptor, 1											central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(2)|pancreas(1)	16		Prostate(122;0.157)				GGCCCCGCCCTATCCCCTACG	0.746													.|||	51	0.0101837	0.0008	0.0317	5008	,	,		12772	0.0		0.0239	False		,,,				2504	0.0041				p.P284P		.											.	TNK1-547	0			c.T852C						.	C		2,2808		0,2,1403	2.0	2.0	2.0		852	2.0	1.0	17	dbSNP_123	2	22,6184		0,22,3081	no	coding-synonymous	TNK1	NM_003985.3		0,24,4484	CC,CT,TT		0.3545,0.0712,0.2662		284/662	7287558	24,8992	1405	3103	4508	SO:0001819	synonymous_variant	8711	exon6			CCGCCCTATCCCC	U43408	CCDS45602.1, CCDS58510.1	17p13.1	2005-09-22				ENSG00000174292			11940	protein-coding gene	gene with protein product		608076				8632913	Standard	NM_003985		Approved		uc002ggi.4	Q13470		ENST00000576812.1:c.852T>C	17.37:g.7287558T>C		0	0		9	4	NM_003985	0	0	0	0	0		Silent	SNP	ENST00000576812.1	37	CCDS58510.1																																																																																			T|0.979;C|0.021		0.746	TNK1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440832.2	NM_003985	
LYZL6	57151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	34263772	34263772	+	Missense_Mutation	SNP	C	C	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:34263772C>G	ENST00000585556.1	-	4	698	c.364G>C	c.(364-366)Ggg>Cgg	p.G122R	LYZL6_ENST00000394523.3_Missense_Mutation_p.G122R|LYZL6_ENST00000293274.4_Missense_Mutation_p.G122R|LYZL6_ENST00000492340.2_5'UTR			O75951	LYZL6_HUMAN	lysozyme-like 6	122					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTGTTCATCCCCCGTGCTCCG	0.572																																					p.G122R		.											.	LYZL6-90	0			c.G364C						.						114.0	103.0	107.0					17																	34263772		2203	4300	6503	SO:0001583	missense	57151	exon3			TCATCCCCCGTGC	AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.364G>C	17.37:g.34263772C>G	ENSP00000468094:p.Gly122Arg	20	0		115	61	NM_020426	0	0	0	0	0	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	37	CCDS11302.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733915	0.30684	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.75589	-0.95;-0.95	4.89	3.9	0.45041	Lysozyme-like domain (1);	0.000000	0.64402	D	0.000001	D	0.88273	0.6392	M	0.93462	3.42	0.09310	N	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.81048	-0.1109	10	0.87932	D	0	-6.5656	10.8134	0.46559	0.1893:0.8107:0.0:0.0	.	122	O75951	LYZL6_HUMAN	R	122	ENSP00000293274:G122R;ENSP00000378031:G122R	ENSP00000293274:G122R	G	-	1	0	LYZL6	31287885	0.102000	0.21896	0.008000	0.14137	0.071000	0.16799	1.597000	0.36729	1.168000	0.42723	0.561000	0.74099	GGG	.		0.572	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		0	0		12	12	NM_001199417	0	0	0	0	0		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274238	39274238	+	Silent	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:39274238A>G	ENST00000391413.2	-	1	368	c.330T>C	c.(328-330)tgT>tgC	p.C110C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	110	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agctggggcgacagcagctgg	0.652																																					p.C110C		.											.	.	0			c.T330C						.						5.0	9.0	8.0					17																	39274238		657	1550	2207	SO:0001819	synonymous_variant	653240	exon1			GGGGCGACAGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.330T>C	17.37:g.39274238A>G		27	0		116	14	NM_033059	0	0	0	0	0	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																			.		0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-6	81871	hgsc.bcm.edu	37	17	39296467	39296467	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:39296467T>C	ENST00000345847.4	-	1	272	c.273A>G	c.(271-273)agA>agG	p.R91R		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	91	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						AGCACTGGGGTCTGCAGCAGC	0.657																																					p.R91R		.											.	.	0			c.A273G						.																																			SO:0001819	synonymous_variant	81871	exon1			CTGGGGTCTGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.273A>G	17.37:g.39296467T>C		15	0		131	9	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.		0.657	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
KRTAP4-3	85290	bcgsc.ca	37	17	39324104	39324104	+	Silent	SNP	A	A	G	rs368619075		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:39324104A>G	ENST00000391356.2	-	1	320	c.321T>C	c.(319-321)tcT>tcC	p.S107S		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	107	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].		Missing (in allele KAP3-v2). {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S107S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGCAGCAACTAGAAATGCAGC	0.597																																					p.S107S													.	KRTAP4-3-22	1	Substitution - coding silent(1)	large_intestine(1)	c.T321C						.						18.0	23.0	21.0					17																	39324104		2109	4252	6361	SO:0001819	synonymous_variant	85290	exon1			GCAACTAGAAATG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.321T>C	17.37:g.39324104A>G		34	0		317	20	NM_033187	0	0	0	0	0		Silent	SNP	ENST00000391356.2	37	CCDS42331.1																																																																																			.		0.597	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
TTC25	83538	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40113444	40113444	+	RNA	SNP	A	A	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:40113444A>T	ENST00000591658.1	+	0	1359							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				AACTGAGGAAAACCAACTACG	0.468																																					.													.	TTC25-23	0			.						.						49.0	49.0	49.0					17																	40113444		1884	4113	5997			83538	.			GAGGAAAACCAAC	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40113444A>T		49	0		145	59	.	0	0	0	1	1	Q6NX40|Q6PJ04|Q9H0K5	Missense_Mutation	SNP	ENST00000591658.1	37																																																																																				.		0.468	TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	NM_031421	
TUBG1	7283	broad.mit.edu;bcgsc.ca	37	17	40765685	40765685	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:40765685C>T	ENST00000251413.3	+	7	689	c.627C>T	c.(625-627)gcC>gcT	p.A209A		NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	209					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.A209A(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	ACAACACAGCCCTGAACCGGA	0.562																																					p.A209A	Colon(20;114 698 11420 22864)												.	TUBG1-91	1	Substitution - coding silent(1)	large_intestine(1)	c.C627T						.						176.0	166.0	169.0					17																	40765685		2203	4300	6503	SO:0001819	synonymous_variant	7283	exon7			CACAGCCCTGAAC	BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.627C>T	17.37:g.40765685C>T		65	0		200	8	NM_001070	0	0	33	33	0	Q53X79|Q9BW59	Silent	SNP	ENST00000251413.3	37	CCDS11433.1																																																																																			.		0.562	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450548.1	NM_001070	
SOST	50964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41835944	41835944	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:41835944T>C	ENST00000301691.2	-	1	212	c.166A>G	c.(166-168)Atg>Gtg	p.M56V		NM_025237.2	NP_079513.1	Q9BQB4	SOST_HUMAN	sclerostin	56					cellular response to parathyroid hormone stimulus (GO:0071374)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|response to mechanical stimulus (GO:0009612)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)	6		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		GCCCGGTTCATGGTCTTGTTG	0.597																																					p.M56V		.											.	SOST-90	0			c.A166G						.						57.0	54.0	55.0					17																	41835944		2203	4300	6503	SO:0001583	missense	50964	exon1			GGTTCATGGTCTT	AF326736	CCDS11468.1	17q12-q21	2014-06-28	2010-04-28			ENSG00000167941			13771	protein-coding gene	gene with protein product		605740	"""sclerosteosis"""			11179006, 11181578	Standard	NM_025237		Approved	VBCH	uc002iec.1	Q9BQB4		ENST00000301691.2:c.166A>G	17.37:g.41835944T>C	ENSP00000301691:p.Met56Val	22	0		87	26	NM_025237	0	0	0	0	0	Q495N9	Missense_Mutation	SNP	ENST00000301691.2	37	CCDS11468.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155167	0.57259	.	.	ENSG00000167941	ENST00000301691	T	0.76578	-1.03	4.26	3.15	0.36227	.	0.404445	0.25642	N	0.029277	T	0.67702	0.2921	L	0.55481	1.735	0.35701	D	0.815622	B	0.33171	0.4	B	0.24394	0.053	T	0.69756	-0.5059	10	0.48119	T	0.1	-0.6649	8.7222	0.34447	0.1693:0.0:0.0:0.8307	.	56	Q9BQB4	SOST_HUMAN	V	56	ENSP00000301691:M56V	ENSP00000301691:M56V	M	-	1	0	SOST	39191470	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.993000	0.49425	0.648000	0.30732	0.454000	0.30748	ATG	.		0.597	SOST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453502.1	NM_025237	
HDAC5	10014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42171119	42171119	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:42171119G>A	ENST00000393622.2	-	4	509	c.178C>T	c.(178-180)Cgg>Tgg	p.R60W	HDAC5_ENST00000586802.1_Missense_Mutation_p.R60W|HDAC5_ENST00000336057.5_Missense_Mutation_p.R60W|HDAC5_ENST00000225983.6_Missense_Mutation_p.R61W	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	60					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		AGAGCCCCCCGTAGCTCCACA	0.667																																					p.R61W		.											.	HDAC5-227	0			c.C181T						.						13.0	15.0	15.0					17																	42171119		2197	4295	6492	SO:0001583	missense	10014	exon4			CCCCCCGTAGCTC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.178C>T	17.37:g.42171119G>A	ENSP00000377244:p.Arg60Trp	26	0		156	73	NM_001015053	0	0	0	0	0	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	ENST00000393622.2	37	CCDS45696.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604577	0.66445	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.50001	0.78;0.78;0.76	4.14	4.14	0.48551	.	0.240511	0.26859	N	0.022121	T	0.56891	0.2016	L	0.32530	0.975	0.42561	D	0.993142	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.69654	0.965;0.924;0.965;0.924	T	0.63189	-0.6693	10	0.87932	D	0	-23.2017	15.156	0.72743	0.0:0.0:1.0:0.0	.	60;60;61;60	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	W	61;60;60	ENSP00000225983:R61W;ENSP00000377244:R60W;ENSP00000337290:R60W	ENSP00000225983:R61W	R	-	1	2	HDAC5	39526645	0.996000	0.38824	0.992000	0.48379	0.875000	0.50365	3.362000	0.52314	1.858000	0.53909	0.462000	0.41574	CGG	.		0.667	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
NPB	256933	hgsc.bcm.edu	37	17	79860378	79860378	+	Silent	SNP	A	A	G	rs182909729	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:79860378A>G	ENST00000333383.7	+	1	394	c.225A>G	c.(223-225)caA>caG	p.Q75Q	NPB_ENST00000573081.1_Silent_p.Q75Q|PCYT2_ENST00000538936.2_3'UTR	NM_148896.3	NP_683694.1	Q8NG41	NPB_HUMAN	neuropeptide B	75					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)						all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CGGAGCTGCAACTGCACCCCA	0.776													A|||	48	0.00958466	0.0363	0.0	5008	,	,		8657	0.0		0.0	False		,,,				2504	0.0				p.Q75Q		.											.	.	0			c.A225G						.	A		56,2216		0,56,1080	1.0	2.0	2.0		225	-0.5	0.0	17		2	0,5066		0,0,2533	no	coding-synonymous	NPB	NM_148896.3		0,56,3613	GG,GA,AA		0.0,2.4648,0.7632		75/126	79860378	56,7282	1136	2533	3669	SO:0001819	synonymous_variant	256933	exon1			GCTGCAACTGCAC		CCDS11790.1	17q25.3	2013-02-26			ENSG00000183979	ENSG00000183979		"""Endogenous ligands"""	30099	protein-coding gene	gene with protein product	"""prepro-NPB"""	607996				12118011, 12401809	Standard	NM_148896		Approved	PPL7, PPNPB	uc002kcd.3	Q8NG41	OTTHUMG00000177983	ENST00000333383.7:c.225A>G	17.37:g.79860378A>G		1	0		14	6	NM_148896	0	0	1	3	2	A0AUX9|A6NJD6|B9EJC3	Silent	SNP	ENST00000333383.7	37	CCDS11790.1																																																																																			A|0.994;G|0.006		0.776	NPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440109.2	NM_148896	
UTS2R	2837	broad.mit.edu	37	17	80333066	80333066	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:80333066C>A	ENST00000313135.2	+	1	914	c.866C>A	c.(865-867)gCg>gAg	p.A289E		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	289					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			GCCCCGCTGGCGCCGCGGACG	0.672																																					p.A289E													.	UTS2R-153	0			c.C866A						.																																			SO:0001583	missense	2837	exon1			CGCTGGCGCCGCG	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.866C>A	17.37:g.80333066C>A	ENSP00000323516:p.Ala289Glu	16	1		217	16	NM_018949	0	0	0	0	0	B2RMV8	Missense_Mutation	SNP	ENST00000313135.2	37	CCDS11810.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313287	0.40996	.	.	ENSG00000181408	ENST00000313135	T	0.72051	-0.62	4.95	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.338048	0.28257	U	0.016009	T	0.61375	0.2342	N	0.17723	0.515	0.09310	N	1	P	0.42973	0.796	P	0.50791	0.65	T	0.55711	-0.8098	10	0.07644	T	0.81	.	14.9821	0.71319	0.0:0.5448:0.4552:0.0	.	289	Q9UKP6	UR2R_HUMAN	E	289	ENSP00000323516:A289E	ENSP00000323516:A289E	A	+	2	0	UTS2R	77926355	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.380000	0.20602	0.518000	0.28383	0.637000	0.83480	GCG	.		0.672	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
ZNF516	9658	broad.mit.edu	37	18	74154244	74154244	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr18:74154244G>T	ENST00000443185.2	-	3	1084	c.767C>A	c.(766-768)gCc>gAc	p.A256D	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A256D(2)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGGCTGAAGGCCTGGCCACA	0.687																																					p.A256D													.	ZNF516-69	2	Substitution - Missense(2)	kidney(2)	c.C767A						.						17.0	20.0	19.0					18																	74154244		2007	4189	6196	SO:0001583	missense	9658	exon3			CTGAAGGCCTGGC	D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.767C>A	18.37:g.74154244G>T	ENSP00000394757:p.Ala256Asp	19	2		113	6	NM_014643	0	0	0	0	0		Missense_Mutation	SNP	ENST00000443185.2	37		.	.	.	.	.	.	.	.	.	.	G	18.16	3.562224	0.65538	.	.	ENSG00000101493	ENST00000443185	T	0.52295	0.67	4.52	4.52	0.55395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.074994	0.53938	D	0.000047	T	0.65637	0.2710	.	.	.	0.37315	D	0.909299	D	0.76494	0.999	D	0.73708	0.981	T	0.72924	-0.4144	9	0.87932	D	0	-8.9982	11.3066	0.49338	0.084:0.0:0.916:0.0	.	256	Q92618	ZN516_HUMAN	D	256	ENSP00000394757:A256D	ENSP00000394757:A256D	A	-	2	0	ZNF516	72283232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.515000	0.67049	2.508000	0.84585	0.650000	0.86243	GCC	.		0.687	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding		NM_014643	
WDR18	57418	hgsc.bcm.edu	37	19	991962	991962	+	Silent	SNP	C	C	T	rs200830437	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:991962C>T	ENST00000251289.5	+	8	962	c.939C>T	c.(937-939)gtC>gtT	p.V313V	WDR18_ENST00000587001.2_Silent_p.V313V	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	313					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGCCCAGTCACCAATGCCG	0.716													c|||	2	0.000399361	0.0015	0.0	5008	,	,		7424	0.0		0.0	False		,,,				2504	0.0				p.V313V		.											.	WDR18-91	0			c.C939T						.	C		6,4168		0,6,2081	7.0	9.0	8.0		939	0.7	1.0	19		8	0,8224		0,0,4112	no	coding-synonymous	WDR18	NM_024100.3		0,6,6193	TT,TC,CC		0.0,0.1437,0.0484		313/433	991962	6,12392	2087	4112	6199	SO:0001819	synonymous_variant	57418	exon8			CCCAGTCACCAAT		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.939C>T	19.37:g.991962C>T		1	0		42	9	NM_024100	0	0	0	0	0	O60390|Q9BWR2	Silent	SNP	ENST00000251289.5	37	CCDS12051.1																																																																																			C|0.999;T|0.001		0.716	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
DOT1L	84444	hgsc.bcm.edu	37	19	2210451	2210451	+	Missense_Mutation	SNP	C	C	G	rs138206172	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:2210451C>G	ENST00000398665.3	+	13	1094	c.1058C>G	c.(1057-1059)gCg>gGg	p.A353G	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	353					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAGCAACGCGGCCACGCCC	0.726													C|||	3	0.000599042	0.0	0.0014	5008	,	,		14189	0.0		0.002	False		,,,				2504	0.0				p.A353G		.											.	DOT1L-132	0			c.C1058G						.						7.0	10.0	9.0					19																	2210451		1904	4036	5940	SO:0001583	missense	84444	exon13			GCAACGCGGCCAC	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1058C>G	19.37:g.2210451C>G	ENSP00000381657:p.Ala353Gly	3	1		52	11	NM_032482	0	0	0	0	0	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	3|3	0.0013736263736263737|0.0013736263736263737	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	3|3	0.00395778364116095|0.00395778364116095	C|C	14.57|14.57	2.574930|2.574930	0.45902|0.45902	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000398665;ENST00000221482|ENST00000440640	T|.	0.23147|.	1.92|.	4.64|4.64	4.64|4.64	0.57946|0.57946	.|.	0.153320|.	0.56097|.	D|.	0.000025|.	T|T	0.43523|0.43523	0.1251|0.1251	N|N	0.22421|0.22421	0.69|0.69	0.31975|0.31975	N|N	0.606602|0.606602	P|.	0.36683|.	0.565|.	B|.	0.40864|.	0.342|.	T|T	0.49153|0.49153	-0.8969|-0.8969	10|5	0.87932|.	D|.	0|.	-12.8566|-12.8566	16.8583|16.8583	0.86011|0.86011	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	353|.	Q8TEK3-2|.	.|.	G|G	353|140	ENSP00000381657:A353G|.	ENSP00000221482:A353G|.	A|R	+|+	2|1	0|2	DOT1L|DOT1L	2161451|2161451	0.996000|0.996000	0.38824|0.38824	0.523000|0.523000	0.27875|0.27875	0.003000|0.003000	0.03518|0.03518	3.247000|3.247000	0.51422|0.51422	2.280000|2.280000	0.76307|0.76307	0.561000|0.561000	0.74099|0.74099	GCG|CGG	C|0.999;G|0.001		0.726	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
OR7E24	26648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9362181	9362181	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:9362181G>C	ENST00000456448.1	+	1	576	c.462G>C	c.(460-462)atG>atC	p.M154I		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						GAATCATCATGAACCCACGCC	0.443																																					p.M154I		.											.	OR7E24-47	0			c.G462C						.						130.0	144.0	139.0					19																	9362181		2193	4296	6489	SO:0001583	missense	26648	exon1			CATCATGAACCCA	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.462G>C	19.37:g.9362181G>C	ENSP00000387523:p.Met154Ile	51	0		124	36	NM_001079935	0	0	0	0	0	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	ENST00000456448.1	37	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	g	10.46	1.356506	0.24598	.	.	ENSG00000237521	ENST00000456448	T	0.00551	6.65	2.39	2.39	0.29439	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00906	0.0030	M	0.80847	2.515	0.28275	N	0.924234	B	0.19706	0.038	B	0.16289	0.015	T	0.12293	-1.0553	9	0.66056	D	0.02	.	11.6917	0.51519	0.0:0.0:1.0:0.0	.	154	Q6IFN5	O7E24_HUMAN	I	154	ENSP00000387523:M154I	ENSP00000387523:M154I	M	+	3	0	OR7E24	9223181	0.999000	0.42202	0.492000	0.27490	0.028000	0.11728	2.571000	0.45990	1.353000	0.45828	0.436000	0.28706	ATG	.		0.443	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
MAN2B1	4125	broad.mit.edu;bcgsc.ca	37	19	12760979	12760979	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:12760979G>A	ENST00000456935.2	-	17	2144	c.2104C>T	c.(2104-2106)Cgc>Tgc	p.R702C	CTD-2192J16.22_ENST00000597692.1_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.R701C	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	702					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGGTACAGGCGAACCACCTGG	0.627																																					p.R702C													.	MAN2B1-94	0			c.C2104T						.						132.0	111.0	118.0					19																	12760979		2203	4300	6503	SO:0001583	missense	4125	exon17			ACAGGCGAACCAC		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2104C>T	19.37:g.12760979G>A	ENSP00000395473:p.Arg702Cys	43	0		166	8	NM_000528	0	0	75	78	3	G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	ENST00000456935.2	37	CCDS32919.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667589	0.88348	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.86097	-2.07;-2.07	4.91	4.91	0.64330	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.45126	D	0.000392	D	0.94565	0.8249	H	0.95328	3.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95872	0.8892	10	0.87932	D	0	-28.1246	15.638	0.76970	0.0:0.0:1.0:0.0	.	701;702	G5E928;O00754	.;MA2B1_HUMAN	C	702;641;701	ENSP00000395473:R702C;ENSP00000221363:R701C	ENSP00000221363:R701C	R	-	1	0	MAN2B1	12621979	1.000000	0.71417	0.999000	0.59377	0.834000	0.47266	7.042000	0.76565	2.564000	0.86499	0.555000	0.69702	CGC	.		0.627	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
ZNF571	51276	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	38056037	38056037	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:38056037G>A	ENST00000328550.2	-	4	1392	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	ZNF571_ENST00000451802.2_Silent_p.G431G|ZNF571_ENST00000593133.1_Silent_p.G431G|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571_ENST00000590751.1_Intron|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF540_ENST00000592533.1_Intron|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571_ENST00000358744.3_Silent_p.G431G			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAAGTTGTTTGCCACAAATAA	0.363																																					p.G431G		.											.	ZNF571-90	0			c.C1293T						.						48.0	52.0	51.0					19																	38056037		2203	4299	6502	SO:0001819	synonymous_variant	51276	exon4			TTGTTTGCCACAA	AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.1293C>T	19.37:g.38056037G>A		66	0		34	20	NM_016536	0	0	0	0	0	Q2HIY0|Q3ZCU3|Q9NZX7	Silent	SNP	ENST00000328550.2	37	CCDS12505.1																																																																																			.		0.363	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458669.1	NM_016536	
CAPN12	147968	hgsc.bcm.edu	37	19	39226803	39226803	+	Silent	SNP	G	G	A	rs201698633	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:39226803G>A	ENST00000328867.4	-	12	1838	c.1530C>T	c.(1528-1530)ggC>ggT	p.G510G	CAPN12_ENST00000601953.1_Silent_p.G361G|CTD-2540F13.2_ENST00000602255.1_RNA	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	510	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CAGCCTCGTCGCCGGCGTGGG	0.731													G|||	57	0.0113818	0.0431	0.0	5008	,	,		4562	0.0		0.0	False		,,,				2504	0.0				p.G510G		.											.	CAPN12-91	0			c.C1530T						.	G		90,3020		0,90,1465	5.0	7.0	6.0		1530	0.0	0.0	19		6	3,5705		0,3,2851	no	coding-synonymous	CAPN12	NM_144691.3		0,93,4316	AA,AG,GG		0.0526,2.8939,1.0547		510/720	39226803	93,8725	1555	2854	4409	SO:0001819	synonymous_variant	147968	exon12			CTCGTCGCCGGCG	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1530C>T	19.37:g.39226803G>A		1	0		37	5	NM_144691	0	0	0	0	0		Silent	SNP	ENST00000328867.4	37	CCDS12519.1																																																																																			G|0.992;A|0.008		0.731	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
GLTSCR1	29998	hgsc.bcm.edu	37	19	48183862	48183862	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:48183862G>C	ENST00000396720.3	+	6	1629	c.1435G>C	c.(1435-1437)Gcg>Ccg	p.A479P	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	479										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		TGGCGCCCCGGCGGTCCAGCT	0.692																																					p.A479P		.											.	GLTSCR1-48	0			c.G1435C						.						16.0	21.0	19.0					19																	48183862		2061	4175	6236	SO:0001583	missense	29998	exon6			GCCCCGGCGGTCC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.1435G>C	19.37:g.48183862G>C	ENSP00000379946:p.Ala479Pro	1	0		44	12	NM_015711	0	0	0	0	0	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	G	2.717	-0.267452	0.05754	.	.	ENSG00000063169	ENST00000396720	T	0.38722	1.12	4.7	-0.598	0.11649	.	.	.	.	.	T	0.40862	0.1134	L	0.38531	1.155	0.27198	N	0.960237	D	0.53885	0.963	P	0.56042	0.79	T	0.32295	-0.9912	9	0.31617	T	0.26	.	6.572	0.22543	0.2611:0.0:0.6073:0.1316	.	479	Q9NZM4	GSCR1_HUMAN	P	479	ENSP00000379946:A479P	ENSP00000379946:A479P	A	+	1	0	GLTSCR1	52875674	0.160000	0.22878	0.002000	0.10522	0.054000	0.15201	0.417000	0.21214	0.077000	0.16863	0.491000	0.48974	GCG	.		0.692	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
PRR12	57479	hgsc.bcm.edu	37	19	50100554	50100554	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:50100554G>A	ENST00000418929.2	+	4	2974	c.2962G>A	c.(2962-2964)Gat>Aat	p.D988N		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCCTGCTTATGATCCCTATGG	0.736																																					p.D988N		.											.	PRR12-70	0			c.G2962A						.						3.0	4.0	4.0					19																	50100554		1585	3699	5284	SO:0001583	missense	57479	exon4			GCTTATGATCCCT	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2962G>A	19.37:g.50100554G>A	ENSP00000394510:p.Asp988Asn	0	0		36	26	NM_020719	0	0	0	0	0	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231566	0.39399	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	T	0.24350	1.86	4.79	4.79	0.61399	.	0.000000	0.45126	D	0.000382	T	0.37571	0.1008	L	0.38175	1.15	0.45690	D	0.998604	D	0.89917	1.0	D	0.87578	0.998	T	0.03473	-1.1033	10	0.13108	T	0.6	-21.245	14.8476	0.70272	0.0:0.0:1.0:0.0	.	988	Q9ULL5-3	.	N	988;168;168	ENSP00000394510:D988N	ENSP00000246798:D168N	D	+	1	0	PRR12	54792366	0.986000	0.35501	0.979000	0.43373	0.599000	0.36880	2.157000	0.42320	2.476000	0.83614	0.491000	0.48974	GAT	.		0.736	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
IGLON5	402665	hgsc.bcm.edu	37	19	51831097	51831097	+	Silent	SNP	C	C	A	rs200107403	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:51831097C>A	ENST00000270642.8	+	7	879	c.879C>A	c.(877-879)gcC>gcA	p.A293A		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	293	Ig-like C2-type 3.					extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						CGTGTCGCGCCGCCAACCGAC	0.716													C|||	76	0.0151757	0.0166	0.0072	5008	,	,		8555	0.0208		0.005	False		,,,				2504	0.0235				p.A293A		.											.	.	0			c.C879A						.	C		51,3629		0,51,1789	9.0	10.0	10.0		879	-10.1	0.9	19		10	25,7827		1,23,3902	no	coding-synonymous	IGLON5	NM_001101372.1		1,74,5691	AA,AC,CC		0.3184,1.3859,0.659		293/337	51831097	76,11456	1840	3926	5766	SO:0001819	synonymous_variant	402665	exon7			TCGCGCCGCCAAC		CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.879C>A	19.37:g.51831097C>A		0	0		60	21	NM_001101372	0	0	0	0	0		Silent	SNP	ENST00000270642.8	37	CCDS46158.1																																																																																			C|0.991;A|0.009		0.716	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372	
NRXN1	9378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	50850682	50850682	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:50850682G>T	ENST00000406316.2	-	6	2380	c.904C>A	c.(904-906)Caa>Aaa	p.Q302K	NRXN1_ENST00000404971.1_Missense_Mutation_p.Q335K|NRXN1_ENST00000405472.3_Missense_Mutation_p.Q302K|NRXN1_ENST00000401669.2_Missense_Mutation_p.Q302K|NRXN1_ENST00000406859.3_Missense_Mutation_p.Q302K|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000402717.3_Missense_Mutation_p.Q302K	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	302	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGCTGCTTTGAATGGGGTTT	0.393																																					p.Q335K		.											.	NRXN1-92	0			c.C1003A						.						138.0	129.0	132.0					2																	50850682		1869	4095	5964	SO:0001583	missense	9378	exon7			TGCTTTGAATGGG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.904C>A	2.37:g.50850682G>T	ENSP00000384311:p.Gln302Lys	66	0		79	34	NM_001135659	0	0	0	0	0	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378078	0.61735	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.19;-1.24;-1.19;-1.24	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	L	0.38175	1.15	0.49389	D	0.999783	D;P	0.56035	0.974;0.946	P;D	0.68353	0.793;0.957	T	0.73933	-0.3826	10	0.09084	T	0.74	.	19.2231	0.93806	0.0:0.0:1.0:0.0	.	335;302	Q9ULB1-3;F8WB18	.;.	K	335;302;302;302;336;302;302	ENSP00000385142:Q335K;ENSP00000384311:Q302K;ENSP00000434015:Q302K;ENSP00000385017:Q302K;ENSP00000385434:Q302K;ENSP00000385681:Q302K	ENSP00000385017:Q302K	Q	-	1	0	NRXN1	50704186	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.776000	0.95493	0.650000	0.86243	CAA	.		0.393	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
C2orf81	388963	hgsc.bcm.edu	37	2	74642235	74642235	+	Missense_Mutation	SNP	C	C	T	rs533816628	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:74642235C>T	ENST00000517883.1	-	1	1475	c.784G>A	c.(784-786)Gat>Aat	p.D262N	C2orf81_ENST00000290390.5_Missense_Mutation_p.D330N			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	323										endometrium(3)|kidney(1)	4						AGCCGCACATCCGAGTGCCCG	0.741													c|||	15	0.00299521	0.0098	0.0014	5008	,	,		12968	0.0		0.001	False		,,,				2504	0.0				p.D330N		.											.	.	0			c.G988A						.						6.0	10.0	9.0					2																	74642235		686	1580	2266	SO:0001583	missense	388963	exon4			GCACATCCGAGTG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.784G>A	2.37:g.74642235C>T	ENSP00000431103:p.Asp262Asn	2	0		95	50	NM_001145054	0	0	0	0	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	c	14.86	2.660528	0.47572	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.47	0.838	0.18902	.	2.319490	0.02081	N	0.052394	T	0.35828	0.0945	L	0.36672	1.1	0.09310	N	1	P	0.36535	0.557	B	0.36289	0.221	T	0.27536	-1.0071	9	0.25751	T	0.34	-1.2556	9.5353	0.39218	0.1338:0.4358:0.4304:0.0	.	330	G3XAA6	.	N	262;330	.	ENSP00000290390:D330N	D	-	1	0	C2orf81	74495743	0.001000	0.12720	0.000000	0.03702	0.080000	0.17528	1.156000	0.31712	0.211000	0.20683	0.506000	0.49869	GAT	.		0.741	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
ANKRD30BL	554226	broad.mit.edu	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																					.													.	.	0			.						.																																			SO:0001819	synonymous_variant	554226	.			TGTCGTCTTCTTC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T		67	0		146	10	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				C|0.991;T|0.009		0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	broad.mit.edu	37	2	132919171	132919171	+	Silent	SNP	A	A	G	rs199695856		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:132919171A>G	ENST00000409867.1	-	1	357	c.108T>C	c.(106-108)caT>caC	p.H36H	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	36										endometrium(1)|kidney(3)	4						TGAGATCCCCATGGTGAATCA	0.582																																					.													.	.	0			.						.																																			SO:0001819	synonymous_variant	554226	.			ATCCCCATGGTGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.108T>C	2.37:g.132919171A>G		103	1		356	20	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				.		0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
ANKRD30BL	554226	broad.mit.edu	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.													.	.	0			.						.																																			SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A		103	1		384	15	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				.		0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331353.2	NR_027019	
SPOPL	339745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	139322375	139322375	+	Missense_Mutation	SNP	A	A	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:139322375A>G	ENST00000280098.4	+	9	1314	c.935A>G	c.(934-936)cAc>cGc	p.H312R		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	312					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		GCAGATTTGCACAGTGCAGAA	0.413																																					p.H312R		.											.	SPOPL-92	0			c.A935G						.						170.0	161.0	164.0					2																	139322375		2203	4300	6503	SO:0001583	missense	339745	exon9			ATTTGCACAGTGC		CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.935A>G	2.37:g.139322375A>G	ENSP00000280098:p.His312Arg	80	0		176	29	NM_001001664	0	0	0	0	0		Missense_Mutation	SNP	ENST00000280098.4	37	CCDS33298.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.545679	0.86022	.	.	ENSG00000144228	ENST00000280098	T	0.76316	-1.01	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.88749	0.6521	M	0.89353	3.025	0.80722	D	1	D	0.71674	0.998	P	0.62813	0.907	D	0.90622	0.4560	9	.	.	.	-9.3536	15.6521	0.77104	1.0:0.0:0.0:0.0	.	312	Q6IQ16	SPOPL_HUMAN	R	312	ENSP00000280098:H312R	.	H	+	2	0	SPOPL	139038845	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.287000	0.95975	2.161000	0.67846	0.533000	0.62120	CAC	.		0.413	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331897.1		
SCN9A	6335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	167055820	167055820	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:167055820C>T	ENST00000409435.1	-	26	5328	c.5329G>A	c.(5329-5331)Gat>Aat	p.D1777N	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.D1778N|SCN9A_ENST00000409672.1_Missense_Mutation_p.D1766N|SCN9A_ENST00000375387.4_Missense_Mutation_p.D1778N			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1777					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCAAAGTCATCCTCACTCAGA	0.428																																					p.D1766N		.											.	SCN9A-181	0			c.G5296A						.						121.0	125.0	123.0					2																	167055820		2203	4300	6503	SO:0001583	missense	6335	exon27			AGTCATCCTCACT	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5329G>A	2.37:g.167055820C>T	ENSP00000386330:p.Asp1777Asn	142	0		189	10	NM_002977	0	0	0	0	0	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837192	0.91117	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000006	T	0.48169	0.1485	H	0.94847	3.59	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.61028	-0.7145	10	0.87932	D	0	.	20.1802	0.98196	0.0:1.0:0.0:0.0	.	1766	E7EUN6	.	N	1766;1778;1778;1777	ENSP00000386306:D1766N;ENSP00000364536:D1778N;ENSP00000304748:D1778N;ENSP00000386330:D1777N	ENSP00000304748:D1778N	D	-	1	0	SCN9A	166764066	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.689000	0.84165	2.777000	0.95525	0.655000	0.94253	GAT	.		0.428	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
TTN	7273	broad.mit.edu	37	2	179499952	179499952	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:179499952G>C	ENST00000591111.1	-	178	37265	c.37041C>G	c.(37039-37041)atC>atG	p.I12347M	TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I5115M|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.I13988M|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I5048M|TTN_ENST00000460472.2_Missense_Mutation_p.I4923M|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.I11420M|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12347					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCCTCTGAGATTTCTGCAT	0.388																																					p.I13988M													.	TTN-636	0			c.C41964G						.						183.0	168.0	172.0					2																	179499952		1877	4107	5984	SO:0001583	missense	7273	exon228			CTCTGAGATTTCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37041C>G	2.37:g.179499952G>C	ENSP00000465570:p.Ile12347Met	73	0		147	5	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	8.922	0.961252	0.18583	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.85	3.71	0.42584	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56455	0.1986	M	0.83603	2.65	0.39403	D	0.966611	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	T	0.61118	-0.7127	9	0.87932	D	0	.	5.0	0.14259	0.2192:0.0:0.5207:0.2601	.	4923;5048;5115;12347	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	11420;4923;5115;5048;4923	ENSP00000343764:I11420M;ENSP00000434586:I4923M;ENSP00000340554:I5115M;ENSP00000352154:I5048M	ENSP00000340554:I5115M	I	-	3	3	TTN	179208197	0.996000	0.38824	1.000000	0.80357	0.996000	0.88848	0.435000	0.21510	1.453000	0.47775	0.655000	0.94253	ATC	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GIGYF2	26058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233671361	233671361	+	Silent	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:233671361T>A	ENST00000409547.1	+	17	2111	c.1800T>A	c.(1798-1800)ccT>ccA	p.P600P	GIGYF2_ENST00000409196.3_Silent_p.P594P|GIGYF2_ENST00000373563.4_Silent_p.P600P|GIGYF2_ENST00000409480.1_Silent_p.P622P|GIGYF2_ENST00000452341.2_Silent_p.P431P|GIGYF2_ENST00000373566.3_Silent_p.P622P|GIGYF2_ENST00000409451.3_Silent_p.P621P	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	600					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CTCCCCCTCCTCATATGGTAA	0.433																																					p.P621P		.											.	GIGYF2-28	0			c.T1863A						.						111.0	108.0	109.0					2																	233671361		2203	4300	6503	SO:0001819	synonymous_variant	26058	exon17			CCCTCCTCATATG	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1800T>A	2.37:g.233671361T>A		39	0		54	35	NM_001103147	0	0	0	0	0	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	ENST00000409547.1	37	CCDS33401.1																																																																																			.		0.433	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
IQCA1	79781	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	237272540	237272540	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr2:237272540C>T	ENST00000409907.3	-	15	2026	c.1752G>A	c.(1750-1752)ctG>ctA	p.L584L	IQCA1_ENST00000431676.2_Silent_p.L543L|IQCA1_ENST00000309507.5_Silent_p.L581L	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	584							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TGGCATGGACCAGCATTTTCT	0.512																																					p.L592L													.	IQCA1-23	0			c.G1776A						.						167.0	165.0	166.0					2																	237272540		1994	4155	6149	SO:0001819	synonymous_variant	79781	exon15			ATGGACCAGCATT	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1752G>A	2.37:g.237272540C>T		94	1		187	100	NM_001270585	0	0	0	0	0	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Silent	SNP	ENST00000409907.3	37	CCDS46549.1																																																																																			.		0.512	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
LRRN4	164312	hgsc.bcm.edu	37	20	6033147	6033147	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:6033147T>C	ENST00000378858.4	-	2	523	c.299A>G	c.(298-300)cAg>cGg	p.Q100R		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	100					long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						CACCTGCAGCTGCTCCAGGTG	0.731																																					p.Q100R		.											.	LRRN4-93	0			c.A299G						.						6.0	8.0	7.0					20																	6033147		2113	4185	6298	SO:0001583	missense	164312	exon2			TGCAGCTGCTCCA	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.299A>G	20.37:g.6033147T>C	ENSP00000368135:p.Gln100Arg	0	0		31	13	NM_152611	0	0	0	0	0	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	CCDS13097.1	.	.	.	.	.	.	.	.	.	.	T	1.702	-0.501239	0.04261	.	.	ENSG00000125872	ENST00000378858	T	0.04406	3.63	5.37	0.364	0.16124	.	0.918843	0.09178	N	0.837822	T	0.02970	0.0088	N	0.16233	0.39	0.18873	N	0.999982	B;B	0.06786	0.001;0.001	B;B	0.04013	0.0;0.001	T	0.48399	-0.9039	10	0.25751	T	0.34	-6.0721	4.5538	0.12126	0.2133:0.256:0.0:0.5307	.	100;100	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	R	100	ENSP00000368135:Q100R	ENSP00000368135:Q100R	Q	-	2	0	LRRN4	5981147	0.002000	0.14202	0.402000	0.26371	0.002000	0.02628	-0.227000	0.09126	-0.136000	0.11475	-0.516000	0.04426	CAG	.		0.731	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q													.	NCOA6-292	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		40	1		103	3	NM_014071	0	0	0	0	0	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
RIMS4	140730	broad.mit.edu	37	20	43378866	43378866	+	IGR	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:43378866G>T	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Missense_Mutation_p.S127I	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)		p.S127I(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				ACTTTCCAGAGCCTGGGCGAA	0.672																																					p.S127I													.	KCNK15-90	1	Substitution - Missense(1)	lung(1)	c.G380T						.						32.0	29.0	30.0					20																	43378866		2203	4300	6503	SO:0001628	intergenic_variant	60598	exon2			TCCAGAGCCTGGG		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43378866G>T		13	0		165	5	NM_022358	0	0	2	2	0	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	ENST00000372851.3	37	CCDS13338.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238768	0.79800	.	.	ENSG00000124249	ENST00000372861	D	0.97850	-4.57	4.08	3.13	0.36017	Ion transport 2 (1);	0.050837	0.85682	U	0.000000	D	0.98254	0.9422	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98505	1.0616	10	0.87932	D	0	.	11.7315	0.51739	0.0863:0.0:0.9137:0.0	.	127	Q9H427	KCNKF_HUMAN	I	127	ENSP00000361952:S127I	ENSP00000361952:S127I	S	+	2	0	KCNK15	42812280	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.543000	0.98089	0.927000	0.37143	-0.136000	0.14681	AGC	.		0.672	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101027.2	NM_182970	
ARFGAP1	55738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61918934	61918934	+	Missense_Mutation	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:61918934T>G	ENST00000370283.4	+	13	1070	c.930T>G	c.(928-930)agT>agG	p.S310R	ARFGAP1_ENST00000547204.1_Missense_Mutation_p.S244R|ARFGAP1_ENST00000519604.1_Missense_Mutation_p.S265R|ARFGAP1_ENST00000519273.2_Missense_Mutation_p.S197R|ARFGAP1_ENST00000370275.4_Missense_Mutation_p.V390G|ARFGAP1_ENST00000518794.2_3'UTR|MIR4326_ENST00000582203.1_RNA|ARFGAP1_ENST00000353546.3_Missense_Mutation_p.S318R	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	310					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGGGCCACAGTTATCAGAACA	0.542																																					p.S318R		.											.	ARFGAP1-91	0			c.T954G						.						44.0	45.0	44.0					20																	61918934		2201	4299	6500	SO:0001583	missense	55738	exon14			CCACAGTTATCAG	AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.930T>G	20.37:g.61918934T>G	ENSP00000359306:p.Ser310Arg	35	0		76	26	NM_175609	0	0	0	10	10	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Missense_Mutation	SNP	ENST00000370283.4	37	CCDS13515.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.23|13.23	2.173905|2.173905	0.38413|0.38413	.|.	.|.	ENSG00000101199|ENSG00000101199	ENST00000370283;ENST00000547204;ENST00000549047;ENST00000523460;ENST00000519604;ENST00000519273;ENST00000353546|ENST00000370275	T;T;T;T;T;T|T	0.50001|0.38560	1.39;0.77;0.85;0.78;0.76;1.41|1.13	4.81|4.81	-0.361|-0.361	0.12564|0.12564	.|.	0.782541|.	0.12772|.	N|.	0.440467|.	T|T	0.36663|0.36663	0.0975|0.0975	L|L	0.60455|0.60455	1.87|1.87	0.49798|0.49798	D|D	0.999824|0.999824	D;D;P;P|B	0.60160|0.26318	0.958;0.987;0.859;0.913|0.146	P;P;P;P|B	0.57960|0.24974	0.663;0.83;0.556;0.742|0.057	T|T	0.33548|0.33548	-0.9864|-0.9864	10|9	0.32370|0.87932	T|D	0.25|0	-9.8078|-9.8078	9.7438|9.7438	0.40435|0.40435	0.0:0.6144:0.0:0.3856|0.0:0.6144:0.0:0.3856	.|.	197;265;310;318|390	B7Z8H8;E7EV62;Q8N6T3;Q8N6T3-2|B7ZBI2	.;.;ARFG1_HUMAN;.|.	R|G	310;244;236;66;265;197;318|390	ENSP00000359306:S310R;ENSP00000449800:S244R;ENSP00000447037:S236R;ENSP00000430500:S265R;ENSP00000443716:S197R;ENSP00000314615:S318R|ENSP00000359298:V390G	ENSP00000314615:S318R|ENSP00000359298:V390G	S|V	+|+	3|2	2|0	ARFGAP1|ARFGAP1	61389379|61389379	1.000000|1.000000	0.71417|0.71417	0.316000|0.316000	0.25252|0.25252	0.180000|0.180000	0.23129|0.23129	1.634000|1.634000	0.37123|0.37123	0.106000|0.106000	0.17784|0.17784	0.379000|0.379000	0.24179|0.24179	AGT|GTT	.		0.542	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209	
HELZ2	85441	hgsc.bcm.edu	37	20	62197379	62197379	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:62197379G>A	ENST00000467148.1	-	8	2865	c.2796C>T	c.(2794-2796)atC>atT	p.I932I	HELZ2_ENST00000427522.2_Silent_p.I363I	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	932	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CGCACTCACGGATGAAGCTCT	0.701																																					p.I932I		.											.	.	0			c.C2796T						.						16.0	16.0	16.0					20																	62197379		2174	4285	6459	SO:0001819	synonymous_variant	85441	exon9			CTCACGGATGAAG	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.2796C>T	20.37:g.62197379G>A		5	0		78	32	NM_001037335	0	0	0	0	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
ADAMTS5	11096	hgsc.bcm.edu	37	21	28338045	28338045	+	Silent	SNP	A	A	T	rs369445782	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:28338045A>T	ENST00000284987.5	-	1	787	c.666T>A	c.(664-666)gcT>gcA	p.A222A		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	222					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TGTGCGCCGGAGCATGCTCGT	0.716													A|||	4	0.000798722	0.0023	0.0	5008	,	,		14660	0.0		0.001	False		,,,				2504	0.0				p.A222A	Esophageal Squamous(53;683 1080 10100 14424 45938)	.											.	ADAMTS5-229	0			c.T666A						.	A		15,4337		0,15,2161	9.0	12.0	11.0		666	-4.4	0.0	21		11	2,8476		0,2,4237	no	coding-synonymous	ADAMTS5	NM_007038.3		0,17,6398	TT,TA,AA		0.0236,0.3447,0.1325		222/931	28338045	17,12813	2176	4239	6415	SO:0001819	synonymous_variant	11096	exon1			CGCCGGAGCATGC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.666T>A	21.37:g.28338045A>T		0	0		73	33	NM_007038	0	0	0	0	0	Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	37	CCDS13579.1																																																																																			.		0.716	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
TTC3	7267	hgsc.bcm.edu;bcgsc.ca	37	21	38519809	38519809	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:38519809G>A	ENST00000399017.2	+	22	4669	c.1922G>A	c.(1921-1923)tGc>tAc	p.C641Y	TTC3_ENST00000354749.2_Missense_Mutation_p.C641Y|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000540756.1_Missense_Mutation_p.C331Y|TTC3_ENST00000355666.1_Missense_Mutation_p.C641Y	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	641					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GTTGAAGAATGCAAGTTCCCT	0.323																																					p.C641Y	Ovarian(38;194 1649 35661)	.											.	TTC3-590	0			c.G1922A						.						111.0	108.0	109.0					21																	38519809		2203	4300	6503	SO:0001583	missense	7267	exon22			AAGAATGCAAGTT	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1922G>A	21.37:g.38519809G>A	ENSP00000381981:p.Cys641Tyr	38	0		56	4	NM_001001894	0	0	0	0	0	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.0|20.0	3.930568|3.930568	0.73327|0.73327	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000414818|ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	.|T;T;T;T;T;T;T	.|0.53640	.|2.42;0.66;2.43;2.72;0.61;2.72;2.72	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	.|0.294582	.|0.30020	.|N	.|0.010617	T|T	0.57227|0.57227	0.2039|0.2039	N|N	0.20986|0.20986	0.625|0.625	0.58432|0.58432	D|D	0.999993|0.999993	.|D;D	.|0.76494	.|0.998;0.999	.|D;D	.|0.83275	.|0.994;0.996	T|T	0.63589|0.63589	-0.6603|-0.6603	5|10	.|0.87932	.|D	.|0	-11.1008|-11.1008	17.997|17.997	0.89187|0.89187	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|331;641	.|B4DSZ9;P53804	.|.;TTC3_HUMAN	T|Y	39|641;641;623;641;331;641;641	.|ENSP00000403943:C641Y;ENSP00000408456:C641Y;ENSP00000391891:C623Y;ENSP00000347889:C641Y;ENSP00000442875:C331Y;ENSP00000381981:C641Y;ENSP00000346791:C641Y	.|ENSP00000346791:C641Y	A|C	+|+	1|2	0|0	TTC3|TTC3	37441679|37441679	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	7.912000|7.912000	0.87465|0.87465	2.409000|2.409000	0.81822|0.81822	0.650000|0.650000	0.86243|0.86243	GCA|TGC	.		0.323	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
PRDM15	63977	hgsc.bcm.edu	37	21	43221434	43221434	+	Missense_Mutation	SNP	G	G	A	rs147616045		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:43221434G>A	ENST00000269844.3	-	31	4600	c.4490C>T	c.(4489-4491)gCg>gTg	p.A1497V	PRDM15_ENST00000398548.1_Missense_Mutation_p.A1168V|PRDM15_ENST00000538201.1_Missense_Mutation_p.A1151V|PRDM15_ENST00000447207.2_Missense_Mutation_p.A1131V|PRDM15_ENST00000422911.1_Missense_Mutation_p.A1188V|PRDM15_ENST00000470586.1_5'UTR	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CTGCTGCTCCGCCTGCACCTG	0.637													g|||	1	0.000199681	0.0008	0.0	5008	,	,		15122	0.0		0.0	False		,,,				2504	0.0				p.A1497V		.											.	PRDM15-90	0			c.C4490T						.		VAL/ALA,VAL/ALA	5,4369		0,5,2182	33.0	38.0	36.0		3503,4490	3.7	0.0	21	dbSNP_134	36	2,8498		0,2,4248	yes	missense,missense	PRDM15	NM_001040424.1,NM_022115.3	64,64	0,7,6430	AA,AG,GG		0.0235,0.1143,0.0544	possibly-damaging,possibly-damaging	1168/1179,1497/1508	43221434	7,12867	2187	4250	6437	SO:0001583	missense	63977	exon31			TGCTCCGCCTGCA	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4490C>T	21.37:g.43221434G>A	ENSP00000269844:p.Ala1497Val	0	0		24	10	NM_022115	0	0	0	0	0	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	37	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	g	13.53	2.264687	0.40095	0.001143	2.35E-4	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.08546	3.16;3.17;3.17;3.16;3.08	4.56	3.65	0.41850	.	.	.	.	.	T	0.04952	0.0133	N	0.14661	0.345	0.09310	N	1	P;B;B	0.35226	0.491;0.043;0.043	B;B;B	0.22753	0.041;0.012;0.007	T	0.33420	-0.9869	9	0.72032	D	0.01	-4.2914	10.8161	0.46575	0.0:0.0:0.6437:0.3563	.	1497;1188;1168	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	V	1188;1168;1151;1131;1497	ENSP00000408592:A1188V;ENSP00000381556:A1168V;ENSP00000444044:A1151V;ENSP00000390245:A1131V;ENSP00000269844:A1497V	ENSP00000269844:A1497V	A	-	2	0	PRDM15	42094503	0.050000	0.20438	0.003000	0.11579	0.735000	0.41995	2.502000	0.45398	0.847000	0.35167	0.558000	0.71614	GCG	G|1.000;A|0.000		0.637	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
KRTAP10-7	386675	broad.mit.edu	37	21	46020576	46020576	+	Missense_Mutation	SNP	G	G	A	rs587669788		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:46020576G>A	ENST00000380102.2	+	1	80	c.55G>A	c.(55-57)Gtc>Atc	p.V19I	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	19						keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CGGCAGCCGCGTCTGCCTTCC	0.642																																					p.V19I													.	.	0			c.G55A						.						36.0	46.0	42.0					21																	46020576		2057	4186	6243	SO:0001583	missense	386675	exon1			AGCCGCGTCTGCC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.55G>A	21.37:g.46020576G>A	ENSP00000369445:p.Val19Ile	38	0		200	9	NM_198689	0	0	0	1	1	Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	ENST00000380102.2	37		.	.	.	.	.	.	.	.	.	.	g	3.948	-0.012856	0.07727	.	.	ENSG00000205441	ENST00000380102	T	0.00648	5.99	4.54	2.71	0.32032	.	.	.	.	.	T	0.00666	0.0022	L	0.43701	1.375	0.09310	N	1	B	0.28470	0.213	B	0.22753	0.041	T	0.44892	-0.9298	9	0.12766	T	0.61	.	7.0396	0.25013	0.2171:0.0:0.7829:0.0	.	19	P60409-2	.	I	19	ENSP00000369445:V19I	ENSP00000369445:V19I	V	+	1	0	KRTAP10-7	44845004	0.003000	0.15002	0.076000	0.20297	0.112000	0.19704	-0.474000	0.06607	0.369000	0.24510	0.467000	0.42956	GTC	.		0.642	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
GSC2	2928	hgsc.bcm.edu	37	22	19137290	19137290	+	Silent	SNP	G	G	A	rs201641909	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr22:19137290G>A	ENST00000086933.2	-	2	398	c.399C>T	c.(397-399)ttC>ttT	p.F133F		NM_005315.1	NP_005306.1	O15499	GSC2_HUMAN	goosecoid homeobox 2	133					anatomical structure morphogenesis (GO:0009653)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	Colorectal(54;0.0993)					GCTCTTCGCTGAAGATGGTGC	0.716													g|||	8	0.00159744	0.0053	0.0014	5008	,	,		8606	0.0		0.0	False		,,,				2504	0.0				p.F133F		.											.	GSC2-68	0			c.C399T						.			4,4216		0,4,2106	8.0	10.0	10.0		399	3.5	1.0	22		10	0,8348		0,0,4174	no	coding-synonymous	GSC2	NM_005315.1		0,4,6280	AA,AG,GG		0.0,0.0948,0.0318		133/206	19137290	4,12564	2110	4174	6284	SO:0001819	synonymous_variant	2928	exon2			TTCGCTGAAGATG		CCDS13757.1	22q11.21	2011-06-20	2007-08-28	2007-08-28	ENSG00000063515	ENSG00000063515		"""Homeoboxes / PRD class"""	4613	protein-coding gene	gene with protein product		601845	"""goosecoid-like"""	GSCL		9150167	Standard	NM_005315		Approved		uc011ags.2	O15499	OTTHUMG00000150122	ENST00000086933.2:c.399C>T	22.37:g.19137290G>A		1	0		17	5	NM_005315	0	0	0	0	0		Silent	SNP	ENST00000086933.2	37	CCDS13757.1																																																																																			G|0.999;A|0.001		0.716	GSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316440.2	NM_005315	
PTPRG	5793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	62189090	62189090	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:62189090G>C	ENST00000474889.1	+	12	1998	c.1621G>C	c.(1621-1623)Gcc>Ccc	p.A541P	PTPRG_ENST00000295874.10_Missense_Mutation_p.A541P	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	541					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CCTCCCGACGGCCGCCTCAGC	0.687																																					p.A541P		.											.	PTPRG-419	0			c.G1621C						.						17.0	15.0	16.0					3																	62189090		2203	4297	6500	SO:0001583	missense	5793	exon12			CCGACGGCCGCCT	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1621G>C	3.37:g.62189090G>C	ENSP00000418112:p.Ala541Pro	32	0		99	67	NM_002841	0	0	0	0	0	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	G	9.459	1.092688	0.20471	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.55760	0.57;0.5	4.39	3.51	0.40186	.	0.179080	0.48286	D	0.000192	T	0.58836	0.2150	L	0.57536	1.79	0.09310	N	1	D;P	0.61080	0.989;0.93	P;P	0.58266	0.836;0.462	T	0.50750	-0.8791	10	0.59425	D	0.04	.	6.385	0.21556	0.0862:0.0:0.5861:0.3277	.	541;541	P23470-2;P23470	.;PTPRG_HUMAN	P	541	ENSP00000418112:A541P;ENSP00000295874:A541P	ENSP00000295874:A541P	A	+	1	0	PTPRG	62164130	0.995000	0.38212	0.010000	0.14722	0.036000	0.12997	4.014000	0.57145	0.959000	0.37980	0.591000	0.81541	GCC	.		0.687	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
KIAA2018	205717	hgsc.bcm.edu;ucsc.edu	37	3	113376122	113376122	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:113376122C>T	ENST00000478658.1	-	5	4424	c.4407G>A	c.(4405-4407)caG>caA	p.Q1469Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q1469Q			Q68DE3	K2018_HUMAN	KIAA2018	1469	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gctgctgctgctgctgctgct	0.498																																					p.Q1469Q		.											.	KIAA2018-93	0			c.G4407A						.						55.0	66.0	62.0					3																	113376122		2188	4278	6466	SO:0001819	synonymous_variant	205717	exon7			CTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4407G>A	3.37:g.113376122C>T		24	0		98	17	NM_001009899	0	0	32	32	0	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376128	113376128	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:113376128C>T	ENST00000478658.1	-	5	4418	c.4401G>A	c.(4399-4401)caG>caA	p.Q1467Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q1467Q			Q68DE3	K2018_HUMAN	KIAA2018	1467	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gctgctgctgctgctgctgct	0.493																																					p.Q1467Q		.											.	KIAA2018-93	0			c.G4401A						.						52.0	61.0	58.0					3																	113376128		2177	4283	6460	SO:0001819	synonymous_variant	205717	exon7			CTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4401G>A	3.37:g.113376128C>T		21	0		93	22	NM_001009899	0	0	911	924	13	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.493	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ROPN1B	152015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	125690910	125690910	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:125690910G>T	ENST00000514116.1	+	3	328	c.13G>T	c.(13-15)Gat>Tat	p.D5Y	ROPN1B_ENST00000251776.4_Missense_Mutation_p.D5Y|ROPN1B_ENST00000511862.1_3'UTR|ROPN1B_ENST00000504401.1_Missense_Mutation_p.D5Y			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	5					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		GGCTCAGACAGATAAGCCAAC	0.517																																					p.D5Y		.											.	ROPN1B-90	0			c.G13T						.						54.0	56.0	56.0					3																	125690910		2203	4300	6503	SO:0001583	missense	152015	exon2			CAGACAGATAAGC	AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.13G>T	3.37:g.125690910G>T	ENSP00000426271:p.Asp5Tyr	30	0		86	26	NM_001012337	0	0	0	0	0	D3DNA6|Q96BM7	Missense_Mutation	SNP	ENST00000514116.1	37	CCDS33841.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986274	0.35036	.	.	ENSG00000114547	ENST00000514116;ENST00000251776;ENST00000504401;ENST00000513830;ENST00000508088;ENST00000509879	T;T;T;T	0.50548	1.7;1.7;1.3;0.74	3.37	2.48	0.30137	cAMP-dependent protein kinase, regulatory subunit, type I/II alpha/beta (1);	0.169791	0.40222	N	0.001160	T	0.59224	0.2178	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.995;0.998	T	0.57900	-0.7731	10	0.87932	D	0	-2.9193	7.0352	0.24989	0.1362:0.0:0.8638:0.0	.	5;5	B7Z7H1;Q9BZX4	.;ROP1B_HUMAN	Y	5	ENSP00000426271:D5Y;ENSP00000251776:D5Y;ENSP00000425548:D5Y;ENSP00000423058:D5Y	ENSP00000251776:D5Y	D	+	1	0	ROPN1B	127173600	0.992000	0.36948	0.966000	0.40874	0.278000	0.26855	2.272000	0.43373	0.510000	0.28216	0.305000	0.20034	GAT	.		0.517	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369931.1	NM_001012337	
PPP2R3A	5523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	135825108	135825108	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:135825108T>C	ENST00000264977.3	+	13	3890	c.3273T>C	c.(3271-3273)gcT>gcC	p.A1091A	PPP2R3A_ENST00000469270.1_3'UTR|PPP2R3A_ENST00000490467.1_Silent_p.A355A|PPP2R3A_ENST00000334546.2_Silent_p.A470A	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	1091					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GGTTTGCCGCTGAGGAGTATG	0.453																																					p.A1091A		.											.	PPP2R3A-662	0			c.T3273C						.						74.0	76.0	75.0					3																	135825108		2203	4300	6503	SO:0001819	synonymous_variant	5523	exon13			TGCCGCTGAGGAG	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.3273T>C	3.37:g.135825108T>C		69	0		126	41	NM_002718	0	0	8	9	1	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	ENST00000264977.3	37	CCDS3087.1																																																																																			.		0.453	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
ERICH6	131831	broad.mit.edu	37	3	150421590	150421590	+	Silent	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:150421590T>C	ENST00000295910.6	-	1	148	c.96A>G	c.(94-96)gaA>gaG	p.E32E	RP11-103G8.2_ENST00000475393.1_RNA|RP11-103G8.2_ENST00000471093.1_RNA|FAM194A_ENST00000491361.1_5'UTR	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						cctccacctcttcctcctcct	0.632																																					p.E32E													.	FAM194A-93	0			c.A96G						.						71.0	65.0	67.0					3																	150421590		2203	4300	6503	SO:0001819	synonymous_variant	131831	exon1			CACCTCTTCCTCC																												ENST00000295910.6:c.96A>G	3.37:g.150421590T>C		25	2		128	12	NM_152394	0	0	0	1	1		Silent	SNP	ENST00000295910.6	37	CCDS3151.2																																																																																			.		0.632	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
YEATS2	55689	broad.mit.edu	37	3	183525842	183525842	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:183525842G>T	ENST00000305135.5	+	29	4231	c.4036G>T	c.(4036-4038)Gca>Tca	p.A1346S	YEATS2-AS1_ENST00000609195.1_RNA|YEATS2-AS1_ENST00000609871.1_RNA|YEATS2-AS1_ENST00000425008.3_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1346					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCAGCCCGTGGCACTCCACAG	0.572																																					p.A1346S													.	YEATS2-138	0			c.G4036T						.						44.0	46.0	45.0					3																	183525842		2006	4162	6168	SO:0001583	missense	55689	exon29			CCCGTGGCACTCC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.4036G>T	3.37:g.183525842G>T	ENSP00000306983:p.Ala1346Ser	42	0		140	6	NM_018023	0	0	7	7	0	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	ENST00000305135.5	37	CCDS43175.1	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732056	0.69189	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.22134	1.97	5.53	4.63	0.57726	.	0.290196	0.31347	N	0.007819	T	0.12817	0.0311	N	0.08118	0	0.32028	N	0.599863	B	0.20368	0.044	B	0.15870	0.014	T	0.04991	-1.0913	10	0.59425	D	0.04	-14.0042	15.0579	0.71930	0.0:0.1431:0.8569:0.0	.	1346	Q9ULM3	YETS2_HUMAN	S	1346	ENSP00000306983:A1346S	ENSP00000306983:A1346S	A	+	1	0	YEATS2	185008536	1.000000	0.71417	0.918000	0.36340	0.889000	0.51656	5.256000	0.65468	1.291000	0.44653	0.561000	0.74099	GCA	.		0.572	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346507.2	NM_018023	
DGKG	1608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	185960324	185960324	+	Nonsense_Mutation	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:185960324T>A	ENST00000265022.3	-	20	2334	c.1795A>T	c.(1795-1797)Aga>Tga	p.R599*	DGKG_ENST00000544847.1_Nonsense_Mutation_p.R540*|DGKG_ENST00000344484.4_Nonsense_Mutation_p.R574*|DGKG_ENST00000382164.4_Nonsense_Mutation_p.R560*	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	599					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGTTTCTCTCTCATCACATGG	0.547											OREG0015965	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R599X		.											.	DGKG-714	0			c.A1795T						.						100.0	87.0	92.0					3																	185960324		2203	4300	6503	SO:0001587	stop_gained	1608	exon20			TCTCTCTCATCAC	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1795A>T	3.37:g.185960324T>A	ENSP00000265022:p.Arg599*	27	0	2003	111	31	NM_001346	0	0	0	0	0	B2RAH4|Q2M1H4|Q5FWG1	Nonsense_Mutation	SNP	ENST00000265022.3	37	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	T	46	12.295792	0.99654	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	.	.	.	5.38	-0.167	0.13347	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3395	0.66617	0.0:0.0:0.4781:0.5218	.	.	.	.	X	599;574;560;540;563	.	ENSP00000265022:R599X	R	-	1	2	DGKG	187443018	0.993000	0.37304	1.000000	0.80357	0.992000	0.81027	0.192000	0.17096	0.099000	0.17552	0.533000	0.62120	AGA	.		0.547	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
MUC20	200958	broad.mit.edu	37	3	195447900	195447900	+	Missense_Mutation	SNP	G	G	A	rs397844010	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:195447900G>A	ENST00000447234.2	+	1	148	c.22G>A	c.(22-24)Gct>Act	p.A8T	MUC20_ENST00000485430.1_3'UTR|MUC20_ENST00000320736.6_Missense_Mutation_p.A8T|MUC20_ENST00000436408.1_Missense_Mutation_p.A8T	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	8					activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTGGGGTCTGGCTCTGCCCCT	0.622																																					p.A8T													.	.	0			c.G22A						.																																			SO:0001583	missense	200958	exon1			GGTCTGGCTCTGC	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.22G>A	3.37:g.195447900G>A	ENSP00000414350:p.Ala8Thr	39	0		92	5	NM_152673	0	0	0	0	0	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	ENST00000447234.2	37		.	.	.	.	.	.	.	.	.	.	G	13.78	2.339003	0.41398	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408	T;T;T	0.23552	1.9;2.15;2.03	2.77	0.921	0.19403	.	.	.	.	.	T	0.17195	0.0413	L	0.29908	0.895	0.09310	N	0.999999	P	0.40332	0.713	B	0.40410	0.328	T	0.14090	-1.0485	9	0.52906	T	0.07	-6.0E-4	4.005	0.09597	0.1435:0.2477:0.6088:0.0	.	8	E9PH32	.	T	8	ENSP00000414350:A8T;ENSP00000325431:A8T;ENSP00000396774:A8T	ENSP00000325431:A8T	A	+	1	0	MUC20	196933571	0.005000	0.15991	0.270000	0.24601	0.793000	0.44817	0.154000	0.16343	0.221000	0.20879	0.462000	0.41574	GCT	.		0.622	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
MUC4	4585	broad.mit.edu	37	3	195505794	195505794	+	Silent	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:195505794T>G	ENST00000463781.3	-	2	13116	c.12657A>C	c.(12655-12657)acA>acC	p.T4219T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T4219T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGGCGTGACCTGTGGATGCTG	0.587																																					p.T4219T													.	MUC4-90	0			c.A12657C						.						29.0	32.0	31.0					3																	195505794		1208	2197	3405	SO:0001819	synonymous_variant	4585	exon2			GTGACCTGTGGAT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12657A>C	3.37:g.195505794T>G		149	2		616	22	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195507237	195507237	+	Silent	SNP	G	G	A	rs199776180|rs74187968		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:195507237G>A	ENST00000463781.3	-	2	11673	c.11214C>T	c.(11212-11214)tcC>tcT	p.S3738S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S3738S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGTGACCTGTGGATGCTGAGG	0.577																																					p.S3738S													.	MUC4-90	0			c.C11214T						.						29.0	30.0	29.0					3																	195507237		650	1581	2231	SO:0001819	synonymous_variant	4585	exon2			ACCTGTGGATGCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11214C>T	3.37:g.195507237G>A		171	0		720	24	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	broad.mit.edu	37	3	195509340	195509340	+	Silent	SNP	G	G	A	rs200269750		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:195509340G>A	ENST00000463781.3	-	2	9570	c.9111C>T	c.(9109-9111)caC>caT	p.H3037H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.H3037H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	978					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCGGGGTGGCGTGACCGGTGG	0.602																																					p.H3037H													.	MUC4-90	0			c.C9111T						.						11.0	8.0	9.0					3																	195509340		642	1528	2170	SO:0001819	synonymous_variant	4585	exon2			GGTGGCGTGACCG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9111C>T	3.37:g.195509340G>A		149	0		760	9	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	broad.mit.edu	37	3	195512487	195512487	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr3:195512487G>A	ENST00000463781.3	-	2	6423	c.5964C>T	c.(5962-5964)acC>acT	p.T1988T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T1988T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGCGTCGGTGACAGGAA	0.607																																					p.T1988T													.	MUC4-90	0			c.C5964T						.																																			SO:0001819	synonymous_variant	4585	exon2			AGCGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5964C>T	3.37:g.195512487G>A		110	0		458	13	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
PPP2R2C	5522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	6335365	6335365	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:6335365T>C	ENST00000382599.4	-	7	1100	c.884A>G	c.(883-885)tAc>tGc	p.Y295C	PPP2R2C_ENST00000506140.1_Missense_Mutation_p.Y288C|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.Y295C|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.Y288C|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.Y278C			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	295					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						GGTGAGCATGTAGCGGCCGCT	0.572											OREG0016071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y295C		.											.	PPP2R2C-1084	0			c.A884G						.						110.0	105.0	107.0					4																	6335365		2203	4300	6503	SO:0001583	missense	5522	exon7			AGCATGTAGCGGC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.884A>G	4.37:g.6335365T>C	ENSP00000372042:p.Tyr295Cys	59	0	633	128	77	NM_181876	0	0	0	3	3	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	T	16.16	3.044169	0.55110	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	4.11	1.24	0.21308	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.286388	0.35320	N	0.003299	T	0.59636	0.2208	H	0.94222	3.51	0.80722	D	1	D;D;D;D	0.67145	0.994;0.987;0.996;0.977	D;D;D;P	0.67900	0.933;0.926;0.954;0.87	T	0.66228	-0.5976	10	0.87932	D	0	.	9.1465	0.36937	0.3036:0.0:0.0:0.6964	.	288;295;278;295	B7Z3Y1;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;2ABG_HUMAN;.;.	C	295;288;278;295;288	ENSP00000335083:Y295C;ENSP00000423649:Y288C;ENSP00000422374:Y278C;ENSP00000372042:Y295C;ENSP00000425247:Y288C	ENSP00000335083:Y295C	Y	-	2	0	PPP2R2C	6386266	1.000000	0.71417	0.995000	0.50966	0.715000	0.41141	5.431000	0.66507	0.586000	0.29626	0.402000	0.26972	TAC	.		0.572	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
ATP10D	57205	broad.mit.edu	37	4	47593174	47593174	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:47593174G>T	ENST00000273859.3	+	23	4326	c.4057G>T	c.(4057-4059)Gct>Tct	p.A1353S		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1353					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GTGGAGAGGGGCTGGAAAGAT	0.468																																					p.A1353S													.	ATP10D-93	0			c.G4057T						.						107.0	108.0	108.0					4																	47593174		2203	4300	6503	SO:0001583	missense	57205	exon23			AGAGGGGCTGGAA	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4057G>T	4.37:g.47593174G>T	ENSP00000273859:p.Ala1353Ser	77	0		90	4	NM_020453	0	0	0	0	0	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305821	0.40795	.	.	ENSG00000145246	ENST00000273859	T	0.38401	1.14	4.62	-2.03	0.07365	.	0.657993	0.13943	N	0.352047	T	0.20981	0.0505	L	0.51422	1.61	0.19775	N	0.999953	B	0.13145	0.007	B	0.08055	0.003	T	0.34576	-0.9823	10	0.09590	T	0.72	-0.9921	1.5641	0.02601	0.337:0.1313:0.3977:0.1341	.	1353	Q9P241	AT10D_HUMAN	S	1353	ENSP00000273859:A1353S	ENSP00000273859:A1353S	A	+	1	0	ATP10D	47287931	0.000000	0.05858	0.000000	0.03702	0.410000	0.31052	-0.016000	0.12613	-0.789000	0.04498	0.460000	0.39030	GCT	.		0.468	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
DSPP	1834	bcgsc.ca	37	4	88536238	88536238	+	Silent	SNP	T	T	C	rs555978267	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:88536238T>C	ENST00000282478.7	+	4	2457	c.2424T>C	c.(2422-2424)gaT>gaC	p.D808D	DSPP_ENST00000399271.1_Silent_p.D808D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	808	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagtgata	0.488																																					p.D808D													.	DSPP-90	0			c.T2424C						.						98.0	115.0	109.0					4																	88536238		1660	2960	4620	SO:0001819	synonymous_variant	1834	exon5			CAGTGATAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2424T>C	4.37:g.88536238T>C		193	2		500	32	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	hgsc.bcm.edu	37	4	88536436	88536436	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr4:88536436C>T	ENST00000282478.7	+	4	2655	c.2622C>T	c.(2620-2622)agC>agT	p.S874S	DSPP_ENST00000399271.1_Silent_p.S874S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	874	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaacagcagtg	0.502																																					p.S874S		.											.	DSPP-90	0			c.C2622T						.						70.0	85.0	79.0					4																	88536436		1641	2936	4577	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCAACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2622C>T	4.37:g.88536436C>T		131	0		371	30	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PLEKHG4B	153478	broad.mit.edu	37	5	169688	169688	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:169688G>T	ENST00000283426.6	+	12	2692	c.2642G>T	c.(2641-2643)gGc>gTc	p.G881V		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	881	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TTGGCCGTGGGCCGCAGTTTC	0.647																																					p.G881V													.	PLEKHG4B-228	0			c.G2642T						.						54.0	56.0	55.0					5																	169688		2203	4300	6503	SO:0001583	missense	153478	exon12			CCGTGGGCCGCAG	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.2642G>T	5.37:g.169688G>T	ENSP00000283426:p.Gly881Val	24	1		64	4	NM_052909	0	0	0	0	0		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.847182	0.51164	.	.	ENSG00000153404	ENST00000283426	T	0.38401	1.14	3.55	3.55	0.40652	Dbl homology (DH) domain (5);	.	.	.	.	T	0.70245	0.3202	H	0.97465	4.01	0.58432	D	0.999997	D	0.67145	0.996	D	0.67231	0.95	T	0.81243	-0.1021	9	0.87932	D	0	.	12.6189	0.56592	0.0:0.0:1.0:0.0	.	881	Q96PX9	PKH4B_HUMAN	V	881	ENSP00000283426:G881V	ENSP00000283426:G881V	G	+	2	0	PLEKHG4B	222688	1.000000	0.71417	0.059000	0.19551	0.536000	0.34869	6.237000	0.72345	1.514000	0.48869	0.467000	0.42956	GGC	.		0.647	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
SLC9A3	6550	broad.mit.edu	37	5	475168	475168	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:475168G>A	ENST00000264938.3	-	16	2340	c.2331C>T	c.(2329-2331)ccC>ccT	p.P777P	CTD-2228K2.5_ENST00000510714.1_5'Flank|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.7_ENST00000607286.1_RNA|SLC9A3_ENST00000514375.1_Silent_p.P768P|CTD-2228K2.7_ENST00000606288.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	777					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CCGTCTCCCCGGGAGACAGCC	0.677																																					p.P777P													.	SLC9A3-90	0			c.C2331T						.						25.0	32.0	30.0					5																	475168		2202	4298	6500	SO:0001819	synonymous_variant	6550	exon16			CTCCCCGGGAGAC		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2331C>T	5.37:g.475168G>A		20	0		169	4	NM_004174	0	0	0	0	0	B7ZKR2|E9PF67|Q3MIW3	Silent	SNP	ENST00000264938.3	37	CCDS3855.1																																																																																			.		0.677	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
FAM105A	54491	broad.mit.edu;bcgsc.ca	37	5	14601482	14601482	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:14601482G>A	ENST00000274217.3	+	4	399	c.279G>A	c.(277-279)gaG>gaA	p.E93E		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	93										large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TGGAGGCAGAGGTTGATTTAC	0.423																																					p.E93E													.	FAM105A-91	0			c.G279A						.						90.0	85.0	87.0					5																	14601482		2203	4300	6503	SO:0001819	synonymous_variant	54491	exon4			GGCAGAGGTTGAT		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.279G>A	5.37:g.14601482G>A		96	2		212	47	NM_019018	0	0	0	0	0	Q53H50|Q9H037	Silent	SNP	ENST00000274217.3	37	CCDS3884.1																																																																																			.		0.423	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
SHROOM1	134549	hgsc.bcm.edu	37	5	132161622	132161622	+	Missense_Mutation	SNP	C	C	G	rs201865788	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:132161622C>G	ENST00000378679.3	-	4	1015	c.211G>C	c.(211-213)Ggc>Cgc	p.G71R	SHROOM1_ENST00000378676.1_Missense_Mutation_p.G71R|SHROOM1_ENST00000488072.1_5'Flank|SHROOM1_ENST00000319854.3_Missense_Mutation_p.G71R	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	71					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ggggcggggcccgggccgccc	0.761													C|||	30	0.00599042	0.0197	0.0058	5008	,	,		9659	0.0		0.0	False		,,,				2504	0.0				p.G71R		.											.	SHROOM1-91	0			c.G211C						.	C	ARG/GLY,ARG/GLY	47,3713		0,47,1833	3.0	5.0	4.0		211,211	-0.3	0.0	5		4	6,7770		0,6,3882	yes	missense,missense	SHROOM1	NM_001172700.1,NM_133456.2	125,125	0,53,5715	GG,GC,CC		0.0772,1.25,0.4594	probably-damaging,probably-damaging	71/853,71/848	132161622	53,11483	1880	3888	5768	SO:0001583	missense	134549	exon1			CGGGGCCCGGGCC	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.211G>C	5.37:g.132161622C>G	ENSP00000367950:p.Gly71Arg	1	0		33	17	NM_133456	0	0	0	0	0	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Missense_Mutation	SNP	ENST00000378679.3	37	CCDS54902.1	.	.	.	.	.	.	.	.	.	.	C	9.057	0.993651	0.19043	0.0125	7.72E-4	ENSG00000164403	ENST00000378679;ENST00000319854;ENST00000378676;ENST00000440118	T;T;T;T	0.46063	1.88;1.88;1.88;0.88	3.95	-0.277	0.12898	.	1.015780	0.07909	N	0.973959	T	0.18841	0.0452	N	0.19112	0.55	0.09310	N	1	P;P	0.47677	0.899;0.838	B;B	0.42522	0.39;0.218	T	0.12451	-1.0547	10	0.54805	T	0.06	-0.006	2.8428	0.05534	0.2105:0.4294:0.0:0.3601	.	71;71	Q2M3G4-2;Q2M3G4	.;SHRM1_HUMAN	R	71	ENSP00000367950:G71R;ENSP00000324245:G71R;ENSP00000367947:G71R;ENSP00000388049:G71R	ENSP00000324245:G71R	G	-	1	0	SHROOM1	132189521	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.865000	0.04250	0.025000	0.15241	0.407000	0.27541	GGC	.		0.761	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
NR3C1	2908	broad.mit.edu	37	5	142678363	142678363	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:142678363G>T	ENST00000343796.2	-	6	2755	c.1762C>A	c.(1762-1764)Cac>Aac	p.H588N	NR3C1_ENST00000394466.2_Missense_Mutation_p.H589N|NR3C1_ENST00000415690.2_Missense_Mutation_p.H588N|NR3C1_ENST00000504572.1_Missense_Mutation_p.H589N|NR3C1_ENST00000416954.2_Missense_Mutation_p.H191N|NR3C1_ENST00000394464.2_Missense_Mutation_p.H588N|NR3C1_ENST00000503201.1_Missense_Mutation_p.H588N|NR3C1_ENST00000504336.1_5'Flank|NR3C1_ENST00000231509.3_Missense_Mutation_p.H589N|NR3C1_ENST00000424646.2_Missense_Mutation_p.H562N	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	588	Interaction with CLOCK.|Interaction with CRY1.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	TCATCCAGGTGTAAGTTCCTG	0.423																																					p.H589N													.	NR3C1-92	0			c.C1765A						.						103.0	95.0	98.0					5																	142678363		2203	4300	6503	SO:0001583	missense	2908	exon6			CCAGGTGTAAGTT	X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.1762C>A	5.37:g.142678363G>T	ENSP00000343205:p.His588Asn	53	0		90	4	NM_001024094	0	0	0	0	0	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350242	0.82132	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000416954;ENST00000503201	D;D;D;D;D;D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01;-4.01;-4.01;-4.01;-4.01;-4.01	5.88	5.88	0.94601	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.045994	0.85682	D	0.000000	D	0.97458	0.9168	M	0.76938	2.355	0.80722	D	1	P;P;P	0.39782	0.632;0.559;0.688	P;B;P	0.49683	0.619;0.257;0.563	D	0.97432	1.0016	10	0.66056	D	0.02	.	20.2314	0.98350	0.0:0.0:1.0:0.0	.	588;588;589	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	N	588;588;588;562;589;589;589;191;588	ENSP00000377977:H588N;ENSP00000343205:H588N;ENSP00000387672:H588N;ENSP00000405282:H562N;ENSP00000422518:H589N;ENSP00000377979:H589N;ENSP00000231509:H589N;ENSP00000404218:H191N;ENSP00000427672:H588N	ENSP00000231509:H589N	H	-	1	0	NR3C1	142658556	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.967000	0.87967	2.789000	0.95967	0.591000	0.81541	CAC	.		0.423	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
TLX3	30012	hgsc.bcm.edu	37	5	170736390	170736390	+	Silent	SNP	G	G	A	rs537348276		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:170736390G>A	ENST00000296921.5	+	1	103	c.21G>A	c.(19-21)gcG>gcA	p.A7A		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	7					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCGCCAGCGCGCAGACCCCGC	0.771			T	BCL11B	T-ALL																																p.A7A	Esophageal Squamous(33;43 807 3116 3348 30094)	.		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	.	TLX3-658	0			c.G21A						.						11.0	13.0	12.0					5																	170736390		2176	4263	6439	SO:0001819	synonymous_variant	30012	exon1			CAGCGCGCAGACC	AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.21G>A	5.37:g.170736390G>A		0	0		45	21	NM_021025	0	0	0	0	0	Q96AD3	Silent	SNP	ENST00000296921.5	37	CCDS34288.1																																																																																			.		0.771	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
DBN1	1627	broad.mit.edu	37	5	176885609	176885609	+	Missense_Mutation	SNP	G	G	A	rs369597152		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr5:176885609G>A	ENST00000309007.5	-	12	1445	c.1226C>T	c.(1225-1227)gCg>gTg	p.A409V	DBN1_ENST00000512501.1_Missense_Mutation_p.A141V|DBN1_ENST00000393563.4_Missense_Mutation_p.A141V|DBN1_ENST00000393565.1_Missense_Mutation_p.A455V|DBN1_ENST00000292385.5_Missense_Mutation_p.A411V	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	409					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGGGGAGGCGCCTGTGCCTG	0.687																																					p.A411V													.	DBN1-587	0			c.C1232T						.	G	VAL/ALA,VAL/ALA	0,4390		0,0,2195	18.0	22.0	21.0		1232,1226	-2.0	0.0	5		21	1,8593		0,1,4296	no	missense,missense	DBN1	NM_080881.2,NM_004395.3	64,64	0,1,6491	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	411/652,409/650	176885609	1,12983	2195	4297	6492	SO:0001583	missense	1627	exon13			GGAGGCGCCTGTG		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1226C>T	5.37:g.176885609G>A	ENSP00000308532:p.Ala409Val	23	0		129	4	NM_080881	0	0	8	8	0	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	G	2.283	-0.364221	0.05103	0.0	1.16E-4	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563	T;T;T;T;T	0.32753	1.49;1.48;1.49;1.44;1.49	4.77	-2.02	0.07388	.	1.821730	0.02661	N	0.107568	T	0.14830	0.0358	N	0.08118	0	0.09310	N	1	B;B;B;B	0.09022	0.0;0.002;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.20538	-1.0272	10	0.49607	T	0.09	-6.766	2.1505	0.03798	0.4484:0.0767:0.133:0.3419	.	359;455;409;411	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	V	409;411;455;141;141	ENSP00000308532:A409V;ENSP00000292385:A411V;ENSP00000377195:A455V;ENSP00000423208:A141V;ENSP00000377193:A141V	ENSP00000292385:A411V	A	-	2	0	DBN1	176818215	0.000000	0.05858	0.015000	0.15790	0.035000	0.12851	-0.219000	0.09228	-0.099000	0.12263	-1.744000	0.00683	GCG	.		0.687	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
OR10C1	442194	hgsc.bcm.edu;broad.mit.edu	37	6	29408232	29408232	+	Missense_Mutation	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:29408232C>T	ENST00000444197.2	+	1	1150	c.440C>T	c.(439-441)gCg>gTg	p.A147V	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCTGGGTCGGCGTGGGCCTGT	0.622																																					p.A147V		.											.	OR10C1-22	0			c.C440T						.						80.0	91.0	87.0					6																	29408232		1509	2709	4218	SO:0001583	missense	442194	exon1			GGTCGGCGTGGGC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.440C>T	6.37:g.29408232C>T	ENSP00000419119:p.Ala147Val	26	0		61	4	NM_013941	0	0	0	0	0	Q5SUN7|Q96R18	Missense_Mutation	SNP	ENST00000444197.2	37	CCDS34364.1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434952	0.43224	.	.	ENSG00000206474	ENST00000444197	T	0.34859	1.34	3.53	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38897	N	0.001526	T	0.29028	0.0721	N	0.16708	0.43	0.09310	N	1	D	0.67145	0.996	D	0.67725	0.953	T	0.18650	-1.0330	10	0.87932	D	0	.	14.9009	0.70678	0.0:1.0:0.0:0.0	.	147	Q96KK4	O10C1_HUMAN	V	147	ENSP00000419119:A147V	ENSP00000419119:A147V	A	+	2	0	OR10C1	29516211	0.000000	0.05858	0.027000	0.17364	0.033000	0.12548	-1.281000	0.02802	1.805000	0.52779	0.508000	0.49915	GCG	.		0.622	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076415.2		
TUBB	203068	broad.mit.edu	37	6	30692075	30692075	+	Missense_Mutation	SNP	G	G	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:30692075G>C	ENST00000327892.8	+	4	1542	c.1236G>C	c.(1234-1236)gaG>gaC	p.E412D	TUBB_ENST00000435534.1_Missense_Mutation_p.E211D|TUBB_ENST00000396384.1_Missense_Mutation_p.E340D|TUBB_ENST00000330914.3_Missense_Mutation_p.E340D|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000396389.1_Missense_Mutation_p.E394D	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	412					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	CCGAGGCTGAGAGCAACATGA	0.587																																					p.E412D													.	TUBB-91	0			c.G1236C						.						78.0	71.0	74.0					6																	30692075		2202	4300	6502	SO:0001583	missense	203068	exon4			GGCTGAGAGCAAC	AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.1236G>C	6.37:g.30692075G>C	ENSP00000339001:p.Glu412Asp	56	0		132	9	NM_178014	0	0	1395	1395	0	P05218|Q8WUC1|Q9CY33	Missense_Mutation	SNP	ENST00000327892.8	37	CCDS4687.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329595	0.60743	.	.	ENSG00000196230	ENST00000327892;ENST00000422827;ENST00000435534;ENST00000330914;ENST00000396389;ENST00000396384	T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84	4.62	3.75	0.43078	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80476	0.4630	M	0.80332	2.49	0.25294	N	0.989331	D;B	0.62365	0.991;0.418	D;B	0.83275	0.996;0.346	T	0.74112	-0.3770	10	0.87932	D	0	.	11.9247	0.52812	0.0:0.0:0.8249:0.1751	.	412;412	P07437;F8VW92	TBB5_HUMAN;.	D	412;321;211;340;394;340	ENSP00000339001:E412D;ENSP00000391672:E211D;ENSP00000365578:E340D;ENSP00000379672:E394D;ENSP00000379668:E340D	ENSP00000339001:E412D	E	+	3	2	TUBB	30800054	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.175000	0.71949	1.166000	0.42689	-0.230000	0.12252	GAG	.		0.587	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076074.2	NM_178014	
ABCC10	89845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	43412898	43412898	+	Missense_Mutation	SNP	A	A	G	rs200602946	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:43412898A>G	ENST00000372530.4	+	14	3091	c.2876A>G	c.(2875-2877)aAt>aGt	p.N959S	ABCC10_ENST00000244533.3_Missense_Mutation_p.N931S	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	959	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GCTGCCCCCAATGGCTCCTCA	0.592													A|||	2	0.000399361	0.0008	0.0	5008	,	,		17616	0.0		0.0	False		,,,				2504	0.001				p.N959S		.											.	ABCC10-96	0			c.A2876G						.	A	SER/ASN,SER/ASN	3,4403	6.2+/-15.9	0,3,2200	120.0	98.0	105.0		2876,2792	5.1	1.0	6		105	0,8600		0,0,4300	no	missense,missense	ABCC10	NM_001198934.1,NM_033450.2	46,46	0,3,6500	GG,GA,AA		0.0,0.0681,0.0231	benign,benign	959/1493,931/1465	43412898	3,13003	2203	4300	6503	SO:0001583	missense	89845	exon14			CCCCCAATGGCTC	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2876A>G	6.37:g.43412898A>G	ENSP00000361608:p.Asn959Ser	70	0		674	260	NM_001198934	0	0	3	7	4	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	19.68	3.873050	0.72180	6.81E-4	0.0	ENSG00000124574	ENST00000372530;ENST00000244533	D;D	0.89875	-2.58;-2.58	5.08	5.08	0.68730	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.055422	0.64402	D	0.000002	T	0.80454	0.4626	N	0.21373	0.66	0.53005	D	0.999967	B;P	0.52170	0.39;0.951	B;P	0.54544	0.257;0.755	T	0.80099	-0.1524	10	0.07813	T	0.8	-0.0074	14.8585	0.70359	1.0:0.0:0.0:0.0	.	931;959	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	S	959;931	ENSP00000361608:N959S;ENSP00000244533:N931S	ENSP00000244533:N931S	N	+	2	0	ABCC10	43520876	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.580000	0.60942	1.911000	0.55334	0.379000	0.24179	AAT	A|0.999;G|0.000		0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
CD2AP	23607	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	47471115	47471115	+	Missense_Mutation	SNP	A	A	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:47471115A>T	ENST00000359314.5	+	2	560	c.104A>T	c.(103-105)gAa>gTa	p.E35V		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	35	Interaction with ANLN and localization to the midbody.|SH3 1; truncated. {ECO:0000255|PROSITE- ProRule:PRU00192}.				mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			CTACAGGAGGAAGGGTGGCTG	0.378																																					p.E35V		.											.	CD2AP-92	0			c.A104T						.						139.0	134.0	135.0					6																	47471115		2203	4300	6503	SO:0001583	missense	23607	exon2			AGGAGGAAGGGTG	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.104A>T	6.37:g.47471115A>T	ENSP00000352264:p.Glu35Val	51	0		384	30	NM_012120	0	0	0	0	0	A6NL34|Q5VYA3|Q9UG97	Missense_Mutation	SNP	ENST00000359314.5	37	CCDS34472.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024553	0.75390	.	.	ENSG00000198087	ENST00000359314	T	0.54071	0.59	4.68	4.68	0.58851	Src homology-3 domain (4);	0.560263	0.21123	N	0.079786	T	0.63698	0.2533	M	0.75264	2.295	0.48452	D	0.999652	D	0.89917	1.0	D	0.83275	0.996	T	0.64935	-0.6290	10	0.38643	T	0.18	-17.8438	14.1476	0.65360	1.0:0.0:0.0:0.0	.	35	Q9Y5K6	CD2AP_HUMAN	V	35	ENSP00000352264:E35V	ENSP00000352264:E35V	E	+	2	0	CD2AP	47579074	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.530000	0.73816	1.735000	0.51646	0.533000	0.62120	GAA	.		0.378	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		
PTCHD4	442213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	48036108	48036108	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:48036108T>C	ENST00000339488.4	-	1	317	c.284A>G	c.(283-285)gAc>gGc	p.D95G	PTCHD4_ENST00000543600.1_Missense_Mutation_p.D78G	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	95						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TTTGGACTGGTCCAGGGGGAA	0.627																																					p.D95G		.											.	.	0			c.A284G						.						72.0	79.0	77.0					6																	48036108		1946	4139	6085	SO:0001583	missense	442213	exon1			GACTGGTCCAGGG		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.284A>G	6.37:g.48036108T>C	ENSP00000341914:p.Asp95Gly	41	0		377	19	NM_001013732	0	0	2	2	0	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	T	18.19	3.569479	0.65765	.	.	ENSG00000244694	ENST00000339488;ENST00000543600	D;T	0.92397	-3.03;0.62	4.88	4.88	0.63580	.	0.103230	0.64402	D	0.000006	D	0.91088	0.7195	L	0.51422	1.61	0.80722	D	1	P;D	0.67145	0.826;0.996	B;P	0.57620	0.438;0.824	D	0.90227	0.4276	10	0.34782	T	0.22	.	14.4665	0.67488	0.0:0.0:0.0:1.0	.	95;78	Q6ZW05;B0QZ29	CF138_HUMAN;.	G	95;78	ENSP00000341914:D95G;ENSP00000439864:D78G	ENSP00000341914:D95G	D	-	2	0	C6orf138	48144067	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.602000	0.82796	1.813000	0.52934	0.460000	0.39030	GAC	.		0.627	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
ZNF451	26036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	56989656	56989656	+	Splice_Site	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:56989656G>A	ENST00000370706.4	+	4	555	c.311G>A	c.(310-312)aGa>aAa	p.R104K	ZNF451_ENST00000357489.3_Splice_Site_p.R104K|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|ZNF451_ENST00000491832.2_Splice_Site_p.R104K	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AGAGCATTCAGAGTATGTGCT	0.289																																					p.R104K		.											.	ZNF451-93	0			c.G311A						.						35.0	33.0	34.0					6																	56989656		2203	4298	6501	SO:0001630	splice_region_variant	26036	exon4			CATTCAGAGTATG	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.312+1G>A	6.37:g.56989656G>A		102	0		253	16	NM_001031623	0	0	0	0	0	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456326	0.26161	.	.	ENSG00000112200	ENST00000510483;ENST00000370706;ENST00000357489;ENST00000491832	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	5.37	5.37	0.77165	.	0.061002	0.64402	D	0.000003	T	0.01156	0.0038	N	0.17082	0.46	0.80722	D	1	B;B;B;B	0.20887	0.049;0.037;0.027;0.037	B;B;B;B	0.15484	0.013;0.008;0.008;0.008	T	0.43360	-0.9396	10	0.06625	T	0.88	-16.7164	7.7021	0.28630	0.2013:0.0:0.7987:0.0	.	104;104;104;104	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	K	76;104;104;104	ENSP00000427558:R76K;ENSP00000359740:R104K;ENSP00000350083:R104K;ENSP00000421645:R104K	ENSP00000350083:R104K	R	+	2	0	ZNF451	57097615	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	4.870000	0.63035	2.665000	0.90641	0.655000	0.94253	AGA	.		0.289	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	Missense_Mutation
PHF3	23469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	64394128	64394128	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:64394128G>A	ENST00000262043.3	+	4	845	c.505G>A	c.(505-507)Gct>Act	p.A169T	PHF3_ENST00000393387.1_Missense_Mutation_p.A169T|PHF3_ENST00000509330.1_Missense_Mutation_p.A169T			Q92576	PHF3_HUMAN	PHD finger protein 3	169					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TGTATCTACTGCTAAAGCAGG	0.418																																					p.A169T	GBM(135;136 1820 29512 34071 46235)	.											.	PHF3-229	0			c.G505A						.						176.0	182.0	180.0					6																	64394128		2203	4300	6503	SO:0001583	missense	23469	exon3			TCTACTGCTAAAG	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.505G>A	6.37:g.64394128G>A	ENSP00000262043:p.Ala169Thr	139	0		233	92	NM_015153	0	0	0	0	0	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	G	7.135	0.580718	0.13686	.	.	ENSG00000118482	ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387;ENST00000514822	T;T;T;T;T	0.41758	2.0;2.31;1.99;0.99;2.31	5.92	2.2	0.27929	.	1.243890	0.06006	N	0.648726	T	0.05686	0.0149	N	0.03608	-0.345	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29941	-0.9995	10	0.21540	T	0.41	-2.6584	2.9393	0.05825	0.1274:0.5534:0.1251:0.1941	.	169;169	Q92576;D6R9X2	PHF3_HUMAN;.	T	81;169;122;169;169;99	ENSP00000425227:A81T;ENSP00000262043:A169T;ENSP00000424078:A122T;ENSP00000422841:A169T;ENSP00000377048:A169T	ENSP00000262043:A169T	A	+	1	0	PHF3	64452087	0.066000	0.20996	0.643000	0.29450	0.707000	0.40811	0.935000	0.28924	0.120000	0.18254	-0.139000	0.14373	GCT	.		0.418	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
IBTK	25998	hgsc.bcm.edu;broad.mit.edu	37	6	82883139	82883139	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:82883139T>C	ENST00000306270.7	-	27	4291	c.3742A>G	c.(3742-3744)Acc>Gcc	p.T1248A	IBTK_ENST00000510291.1_Missense_Mutation_p.T1233A|IBTK_ENST00000503631.1_Missense_Mutation_p.T1047A	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	1248					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		GGTCCTGGGGTACCATGGGTA	0.373																																					p.T1248A		.											.	IBTK-92	0			c.A3742G						.						126.0	126.0	126.0					6																	82883139		2203	4300	6503	SO:0001583	missense	25998	exon27			CTGGGGTACCATG	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.3742A>G	6.37:g.82883139T>C	ENSP00000305721:p.Thr1248Ala	34	0		52	3	NM_015525	0	0	3	3	0	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	37	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.994795	0.00435	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.26518	2.06;1.73;2.06	5.41	0.249	0.15531	.	0.949376	0.08860	N	0.883161	T	0.06826	0.0174	L	0.46157	1.445	0.09310	N	1	B;B;B;B	0.13145	0.007;0.0;0.004;0.0	B;B;B;B	0.15484	0.007;0.0;0.013;0.0	T	0.42207	-0.9465	10	0.22109	T	0.4	1.4624	5.9681	0.19336	0.1213:0.1927:0.0:0.686	.	1047;1233;199;1248	E9PDR5;E7EPI0;B3KX60;Q9P2D0	.;.;.;IBTK_HUMAN	A	1248;1047;1233	ENSP00000305721:T1248A;ENSP00000422762:T1047A;ENSP00000426405:T1233A	ENSP00000305721:T1248A	T	-	1	0	IBTK	82939858	0.180000	0.23148	0.001000	0.08648	0.009000	0.06853	1.043000	0.30316	-0.339000	0.08401	-1.937000	0.00501	ACC	.		0.373	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
MAP3K5	4217	hgsc.bcm.edu	37	6	137113272	137113272	+	Silent	SNP	G	G	A	rs142989545	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:137113272G>A	ENST00000359015.4	-	1	384	c.24C>T	c.(22-24)ggC>ggT	p.G8G		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	8					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AGAAAGTGATGCCCTCGTCCG	0.751													G|||	47	0.00938498	0.0325	0.0058	5008	,	,		8970	0.0		0.0	False		,,,				2504	0.0				p.G8G		.											.	MAP3K5-982	0			c.C24T						.	G		74,3452		1,72,1690	4.0	5.0	5.0		24	3.8	1.0	6	dbSNP_134	5	2,6840		0,2,3419	no	coding-synonymous	MAP3K5	NM_005923.3		1,74,5109	AA,AG,GG		0.0292,2.0987,0.733		8/1375	137113272	76,10292	1763	3421	5184	SO:0001819	synonymous_variant	4217	exon1			AGTGATGCCCTCG	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.24C>T	6.37:g.137113272G>A		0	0		40	16	NM_005923	0	0	0	0	0	A6NIA0|B4DGB2|Q5THN3|Q99461	Silent	SNP	ENST00000359015.4	37	CCDS5179.1																																																																																			G|0.988;A|0.012		0.751	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
GPR126	57211	broad.mit.edu	37	6	142741042	142741042	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:142741042C>T	ENST00000230173.6	+	22	3596	c.3120C>T	c.(3118-3120)ttC>ttT	p.F1040F	GPR126_ENST00000296932.8_Silent_p.F1012F|GPR126_ENST00000367608.2_Silent_p.F1012F|GPR126_ENST00000367609.3_Silent_p.F1040F	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	1040					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TTGCCATGTTCATTGTGGTAA	0.428																																					p.F1040F													.	GPR126-91	0			c.C3120T						.						259.0	237.0	244.0					6																	142741042		1927	4143	6070	SO:0001819	synonymous_variant	57211	exon22			CATGTTCATTGTG	AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.3120C>T	6.37:g.142741042C>T		112	0		190	3	NM_198569	0	0	0	0	0	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Silent	SNP	ENST00000230173.6	37	CCDS47490.1																																																																																			.		0.428	GPR126-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042487.2		
MAP3K4	4216	hgsc.bcm.edu	37	6	161413041	161413041	+	Silent	SNP	G	G	A	rs78823261	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:161413041G>A	ENST00000392142.4	+	1	226	c.78G>A	c.(76-78)ccG>ccA	p.P26P	RP3-428L16.2_ENST00000608721.1_RNA|MAP3K4_ENST00000366919.2_Silent_p.P26P|MAP3K4_ENST00000366920.2_Silent_p.P26P|MAP3K4_ENST00000348824.7_Silent_p.P26P	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	26	Poly-Pro.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AGGAgccgccgccaccgccgc	0.741													G|||	94	0.01877	0.0303	0.0202	5008	,	,		9039	0.004		0.0129	False		,,,				2504	0.0235				p.P26P		.											.	MAP3K4-548	0			c.G78A						.						2.0	4.0	3.0					6																	161413041		1452	3068	4520	SO:0001819	synonymous_variant	4216	exon1			GCCGCCGCCACCG	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.78G>A	6.37:g.161413041G>A		0	0		21	10	NM_006724	0	0	0	0	0	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	ENST00000392142.4	37	CCDS34565.1																																																																																			.		0.741	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
UNC93A	54346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	167709627	167709627	+	Missense_Mutation	SNP	C	C	T	rs538293568		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:167709627C>T	ENST00000230256.3	+	3	552	c.377C>T	c.(376-378)gCg>gTg	p.A126V	UNC93A_ENST00000366830.2_3'UTR|UNC93A_ENST00000366829.2_Missense_Mutation_p.A126V	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCAGAGAAGGCGGGAAAGCGT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		22340	0.001		0.0	False		,,,				2504	0.0				p.A126V		.											.	UNC93A-90	0			c.C377T						.						224.0	203.0	210.0					6																	167709627		2203	4300	6503	SO:0001583	missense	54346	exon3			AGAAGGCGGGAAA	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.377C>T	6.37:g.167709627C>T	ENSP00000230256:p.Ala126Val	105	0		270	109	NM_018974	0	0	0	2	2	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	37	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	C	5.524	0.281564	0.10458	.	.	ENSG00000112494	ENST00000503433;ENST00000230256;ENST00000366829	T;T;T	0.30981	1.51;3.54;3.52	5.53	-3.43	0.04810	Major facilitator superfamily domain, general substrate transporter (1);	1.006790	0.07968	N	0.983528	T	0.04634	0.0126	N	0.17723	0.515	0.09310	N	1	B;B	0.16166	0.016;0.006	B;B	0.13407	0.009;0.009	T	0.37244	-0.9714	10	0.25106	T	0.35	-1.2474	4.3328	0.11071	0.3325:0.2722:0.0:0.3953	.	126;126	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	V	126	ENSP00000421484:A126V;ENSP00000230256:A126V;ENSP00000355794:A126V	ENSP00000230256:A126V	A	+	2	0	UNC93A	167629617	0.020000	0.18652	0.000000	0.03702	0.018000	0.09664	1.103000	0.31062	-1.274000	0.02421	-0.890000	0.02929	GCG	.		0.547	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
PDCD2	5134	hgsc.bcm.edu	37	6	170893454	170893454	+	Silent	SNP	C	C	T	rs200023629	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:170893454C>T	ENST00000541970.1	-	1	294	c.216G>A	c.(214-216)ccG>ccA	p.P72P	PDCD2_ENST00000443345.2_Silent_p.P39P|PDCD2_ENST00000392090.2_Silent_p.P39P|PDCD2_ENST00000453163.2_Silent_p.P72P|PDCD2_ENST00000542896.1_Silent_p.P72P|PDCD2_ENST00000537445.1_Silent_p.P39P	NM_001199462.1|NM_002598.3	NP_001186391.1|NP_002589.2	Q16342	PDCD2_HUMAN	programmed cell death 2	72					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(5)	9		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		GGAAGGCGTCCGGGCGGCCAG	0.751													.|||	27	0.00539137	0.0204	0.0	5008	,	,		10592	0.0		0.0	False		,,,				2504	0.0				p.P72P	Colon(60;1476 1726 39478)	.											.	PDCD2-227	0			c.G216A						.	C	,,,,,	21,3659		0,21,1819	13.0	15.0	14.0		216,117,117,117,216,216	-6.7	0.0	6		14	0,7658		0,0,3829	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PDCD2	NM_001199461.1,NM_001199462.1,NM_001199463.1,NM_001199464.1,NM_002598.3,NM_144781.2	,,,,,	0,21,5648	TT,TC,CC		0.0,0.5707,0.1852	,,,,,	72/222,39/312,39/196,39/189,72/345,72/229	170893454	21,11317	1840	3829	5669	SO:0001819	synonymous_variant	5134	exon1			GGCGTCCGGGCGG	AJ420535	CCDS5316.1, CCDS47521.1, CCDS56460.1, CCDS56461.1, CCDS56462.1, CCDS75557.1	6q27	2008-02-05			ENSG00000071994	ENSG00000071994		"""Zinc fingers, MYND-type"""	8762	protein-coding gene	gene with protein product		600866				7606924	Standard	NM_002598		Approved	ZMYND7, RP8	uc003qxw.3	Q16342	OTTHUMG00000016083	ENST00000541970.1:c.216G>A	6.37:g.170893454C>T		0	0		50	21	NM_002598	0	0	0	0	0	E9PCU7|F5GYS7|Q58HM9|Q58HN0|Q9UH12	Silent	SNP	ENST00000541970.1	37	CCDS5316.1																																																																																			C|0.997;T|0.003		0.751	PDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043269.2	NM_002598	
TRA2A	29896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	23547073	23547073	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:23547073G>A	ENST00000297071.4	-	5	823	c.607C>T	c.(607-609)Cca>Tca	p.P203S	TRA2A_ENST00000538367.1_Missense_Mutation_p.P102S|TRA2A_ENST00000474586.1_5'UTR|TRA2A_ENST00000392502.4_Missense_Mutation_p.P102S	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	203	Linker.				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						CCTGGTGTTGGTGTGTGCGCT	0.413																																					p.P203S	Pancreas(121;2137 2973 46590)	.											.	TRA2A-91	0			c.C607T						.						249.0	237.0	241.0					7																	23547073		2203	4300	6503	SO:0001583	missense	29896	exon5			GTGTTGGTGTGTG	U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.607C>T	7.37:g.23547073G>A	ENSP00000297071:p.Pro203Ser	40	0		102	37	NM_013293	0	0	6	6	0	B4DUA9	Missense_Mutation	SNP	ENST00000297071.4	37	CCDS5383.1	.	.	.	.	.	.	.	.	.	.	G	34	5.300909	0.95601	.	.	ENSG00000164548	ENST00000297071;ENST00000392502;ENST00000538367	T;T;T	0.74106	-0.81;-0.81;-0.81	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.87293	0.6141	M	0.88906	2.99	0.80722	D	1	D	0.55800	0.973	P	0.58577	0.841	D	0.88826	0.3302	10	0.59425	D	0.04	-12.1484	19.5178	0.95171	0.0:0.0:1.0:0.0	.	203	Q13595	TRA2A_HUMAN	S	203;102;102	ENSP00000297071:P203S;ENSP00000376290:P102S;ENSP00000441116:P102S	ENSP00000297071:P203S	P	-	1	0	TRA2A	23513598	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.831000	0.99420	2.615000	0.88500	0.650000	0.86243	CCA	.		0.413	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1	NM_013293	
VWC2	375567	hgsc.bcm.edu	37	7	49815181	49815181	+	Silent	SNP	C	C	T	rs201551578	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:49815181C>T	ENST00000340652.4	+	2	706	c.150C>T	c.(148-150)caC>caT	p.H50H		NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	50					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						AGCGTGAGCACGCCTCTCGGG	0.726													C|||	32	0.00638978	0.0227	0.0029	5008	,	,		8632	0.0		0.0	False		,,,				2504	0.0				p.H50H		.											.	VWC2-514	0			c.C150T						.	C		89,4175		1,87,2044	9.0	8.0	8.0		150	4.8	1.0	7		8	3,8303		0,3,4150	no	coding-synonymous	VWC2	NM_198570.3		1,90,6194	TT,TC,CC		0.0361,2.0872,0.7319		50/326	49815181	92,12478	2132	4153	6285	SO:0001819	synonymous_variant	375567	exon2			TGAGCACGCCTCT	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.150C>T	7.37:g.49815181C>T		0	0		41	25	NM_198570	0	0	0	0	0	Q6UXE2	Silent	SNP	ENST00000340652.4	37	CCDS5508.1																																																																																			C|0.997;T|0.003		0.726	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570	
ARPC1B	10095	hgsc.bcm.edu	37	7	98990335	98990335	+	Silent	SNP	C	C	T	rs530272604	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:98990335C>T	ENST00000451682.1	+	10	1134	c.825C>T	c.(823-825)gcC>gcT	p.A275A	ARPC1B_ENST00000252725.5_Silent_p.A275A|PDAP1_ENST00000496335.1_5'UTR			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	275					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ATGACGCCGCCGCGGGGATGC	0.697													C|||	4	0.000798722	0.003	0.0	5008	,	,		13061	0.0		0.0	False		,,,				2504	0.0				p.A275A		.											.	ARPC1B-90	0			c.C825T						.						4.0	5.0	4.0					7																	98990335		1777	3378	5155	SO:0001819	synonymous_variant	10095	exon8			CGCCGCCGCGGGG	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.825C>T	7.37:g.98990335C>T		5	0		147	84	NM_005720	0	0	259	650	391	Q9BU00	Silent	SNP	ENST00000451682.1	37	CCDS5661.1																																																																																			.		0.697	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335894.1	NM_005720	
FAM185A	222234	broad.mit.edu	37	7	102389716	102389716	+	Missense_Mutation	SNP	G	G	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:102389716G>T	ENST00000413034.2	+	1	62	c.62G>T	c.(61-63)cGa>cTa	p.R21L	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Missense_Mutation_p.R21L	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	21										kidney(1)	1						CGTCAGGTCCGACTGTGGGCT	0.667																																					p.R21L													.	.	0			c.G62T						.						5.0	8.0	7.0					7																	102389716		670	1558	2228	SO:0001583	missense	222234	exon1			AGGTCCGACTGTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.62G>T	7.37:g.102389716G>T	ENSP00000395340:p.Arg21Leu	19	0		266	6	NM_001145269	0	0	0	0	0	A8MUR7|B4DQD3|C9IZ91	Missense_Mutation	SNP	ENST00000413034.2	37	CCDS47676.1	.	.	.	.	.	.	.	.	.	.	G	6.754	0.508050	0.12883	.	.	ENSG00000222011	ENST00000409231;ENST00000418198;ENST00000413034	T;T;T	0.76839	-1.05;-1.05;-1.05	3.12	1.11	0.20524	.	0.743493	0.10850	U	0.627294	T	0.68796	0.3040	L	0.54323	1.7	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.61108	-0.7129	10	0.87932	D	0	1.3838	3.7857	0.08700	0.1414:0.0:0.6212:0.2374	.	21;21	Q8N0U4-3;Q8N0U4	.;F185A_HUMAN	L	21	ENSP00000387066:R21L;ENSP00000410034:R21L;ENSP00000395340:R21L	ENSP00000387066:R21L	R	+	2	0	FAM185A	102176952	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.029000	0.13666	0.479000	0.27511	-0.399000	0.06403	CGA	.		0.667	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349482.1	NM_001145268	
OPN1SW	611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128415147	128415147	+	Silent	SNP	C	C	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:128415147C>T	ENST00000249389.2	-	2	413	c.414G>A	c.(412-414)aaG>aaA	p.K138K		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	138					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						TGCCGAAGGGCTTACAGATGA	0.547																																					p.K138K		.											.	OPN1SW-68	0			c.G414A						.						96.0	75.0	82.0					7																	128415147		2203	4300	6503	SO:0001819	synonymous_variant	611	exon2			GAAGGGCTTACAG	U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.414G>A	7.37:g.128415147C>T		62	0		197	54	NM_001708	0	0	0	0	0	Q13877	Silent	SNP	ENST00000249389.2	37	CCDS5806.1																																																																																			.		0.547	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350655.1	NM_001708	
CLEC2L	154790	hgsc.bcm.edu	37	7	139208786	139208786	+	Missense_Mutation	SNP	C	C	A	rs111447865	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:139208786C>A	ENST00000422142.2	+	1	185	c.113C>A	c.(112-114)gCc>gAc	p.A38D		NM_001080511.2	NP_001073980.2	P0C7M8	CLC2L_HUMAN	C-type lectin domain family 2, member L	38						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|kidney(2)|lung(1)	5	Melanoma(164;0.233)					GAGGCTGAGGCCCGCGGCCCC	0.831													C|||	64	0.0127796	0.0454	0.0043	5008	,	,		4163	0.0		0.001	False		,,,				2504	0.0				p.A38D		.											.	.	0			c.C113A						.						1.0	3.0	2.0					7																	139208786		285	1021	1306	SO:0001583	missense	154790	exon1			CTGAGGCCCGCGG	AK057548	CCDS47724.1	7q34	2011-05-18			ENSG00000236279	ENSG00000236279		"""C-type lectin domain containing"""	21969	protein-coding gene	gene with protein product							Standard	NM_001080511		Approved	FLJ32986	uc010lnd.3	P0C7M8	OTTHUMG00000164900	ENST00000422142.2:c.113C>A	7.37:g.139208786C>A	ENSP00000390661:p.Ala38Asp	0	0		23	10	NM_001080511	0	0	0	0	0		Missense_Mutation	SNP	ENST00000422142.2	37	CCDS47724.1	.	.	.	.	.	.	.	.	.	.	c	11.60	1.686495	0.29962	.	.	ENSG00000236279	ENST00000422142	T	0.03889	3.77	2.96	-1.4	0.08968	.	.	.	.	.	T	0.02571	0.0078	N	0.08118	0	0.28054	N	0.933269	B	0.22414	0.069	B	0.14023	0.01	T	0.46541	-0.9184	9	0.18710	T	0.47	.	11.9064	0.52715	0.0:0.7171:0.2829:0.0	.	38	P0C7M8	CLC2L_HUMAN	D	38	ENSP00000390661:A38D	ENSP00000390661:A38D	A	+	2	0	CLEC2L	138859326	1.000000	0.71417	0.768000	0.31515	0.245000	0.25701	0.831000	0.27476	-0.490000	0.06707	0.283000	0.19423	GCC	A|1.000;|0.000		0.831	CLEC2L-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380878.1	NM_001080511	
AGAP3	116988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	150839014	150839014	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:150839014G>A	ENST00000463381.1	+	12	1337	c.841G>A	c.(841-843)Gtg>Atg	p.V281M	AGAP3_ENST00000397238.2_Missense_Mutation_p.V612M	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	576	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						ATTTGTGGTGGTGTCCCTCAC	0.612																																					p.V612M		.											.	AGAP3-92	0			c.G1834A						.						94.0	112.0	106.0					7																	150839014		2150	4240	6390	SO:0001583	missense	116988	exon14			GTGGTGGTGTCCC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.841G>A	7.37:g.150839014G>A	ENSP00000418016:p.Val281Met	88	0		327	124	NM_031946	0	0	12	16	4	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.553104|4.553104	0.86127|0.86127	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000463381;ENST00000397232;ENST00000397238;ENST00000335355|ENST00000461065	T;T|.	0.19394|.	2.15;2.15|.	4.24|4.24	4.24|4.24	0.50183|0.50183	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.64402|.	D|.	0.000008|.	T|.	0.74558|.	0.3732|.	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D;D;D;P|.	0.89917|.	1.0;0.999;0.999;0.95|.	D;D;D;P|.	0.97110|.	1.0;0.981;0.964;0.755|.	T|.	0.75977|.	-0.3127|.	10|.	0.72032|.	D|.	0.01|.	.|.	16.1835|16.1835	0.81929|0.81929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	576;111;612;281|.	Q96P47;E7ETI2;Q96P47-4;B3KNZ8|.	AGAP3_HUMAN;.;.;.|.	M|X	281;111;612;576|104	ENSP00000418016:V281M;ENSP00000380413:V612M|.	ENSP00000334157:V576M|.	V|W	+|+	1|3	0|0	AGAP3|AGAP3	150469947|150469947	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	7.458000|7.458000	0.80787|0.80787	2.346000|2.346000	0.79739|0.79739	0.655000|0.655000	0.94253|0.94253	GTG|TGG	.		0.612	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946	
RHEB	6009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	151188050	151188050	+	Missense_Mutation	SNP	A	A	T			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:151188050A>T	ENST00000262187.5	-	2	515	c.103T>A	c.(103-105)Tac>Aac	p.Y35N	RHEB_ENST00000472642.1_5'UTR|RHEB_ENST00000496004.1_5'UTR	NM_005614.3	NP_005605.1	Q15382	RHEB_HUMAN	Ras homolog enriched in brain	35					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|positive regulation of TOR signaling (GO:0032008)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)	p.Y35N(1)		breast(3)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)	14			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)		GTTGGATCGTAGGAGTCCACA	0.358																																					p.Y35N	Pancreas(98;671 892 8111 15140 36556 39178 39939 44184)	.											.	RHEB-910	1	Substitution - Missense(1)	kidney(1)	c.T103A						.						103.0	100.0	101.0					7																	151188050		2203	4300	6503	SO:0001583	missense	6009	exon2			GATCGTAGGAGTC	D78132	CCDS5927.1	7q36	2014-05-09	2003-07-14	2003-07-14	ENSG00000106615	ENSG00000106615			10011	protein-coding gene	gene with protein product		601293	"""Ras homolog enriched in brain 2"""	RHEB2		8661031	Standard	NM_005614		Approved		uc003wkh.1	Q15382	OTTHUMG00000157330	ENST00000262187.5:c.103T>A	7.37:g.151188050A>T	ENSP00000262187:p.Tyr35Asn	48	0		87	5	NM_005614	0	0	6	6	0	B3KWN6|D3DX13|Q53Y56|Q99444	Missense_Mutation	SNP	ENST00000262187.5	37	CCDS5927.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.708820	0.89018	.	.	ENSG00000106615	ENST00000262187	T	0.81247	-1.47	5.42	5.42	0.78866	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91841	0.7418	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93659	0.6980	10	0.87932	D	0	.	13.3975	0.60863	1.0:0.0:0.0:0.0	.	35	Q15382	RHEB_HUMAN	N	35	ENSP00000262187:Y35N	ENSP00000262187:Y35N	Y	-	1	0	RHEB	150818983	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.143000	0.89621	2.051000	0.60960	0.533000	0.62120	TAC	.		0.358	RHEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348468.2	NM_005614	
SGK223	157285	broad.mit.edu	37	8	8239069	8239069	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr8:8239069C>A	ENST00000520004.1	-	2	453	c.189G>T	c.(187-189)agG>agT	p.R63S	SGK223_ENST00000330777.4_Missense_Mutation_p.R63S			Q86YV5	SG223_HUMAN		63							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGTTCTCAGGCCTGGGAGGCA	0.657																																					p.R63S	GBM(34;731 755 10259 33573 33867)												.	.	0			c.G189T						.						48.0	49.0	49.0					8																	8239069		2004	4157	6161	SO:0001583	missense	0	exon1			CTCAGGCCTGGGA																												ENST00000520004.1:c.189G>T	8.37:g.8239069C>A	ENSP00000428054:p.Arg63Ser	14	0		129	9	NM_001080826	0	0	0	0	0	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236881	0.39498	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.59083	0.29;0.29	4.49	2.69	0.31865	.	0.226672	0.30658	N	0.009160	T	0.41696	0.1170	L	0.38531	1.155	0.27832	N	0.941416	B	0.31968	0.349	B	0.24701	0.055	T	0.44802	-0.9304	10	0.72032	D	0.01	.	8.2345	0.31618	0.0:0.7459:0.0:0.2541	.	63	Q86YV5	SG223_HUMAN	S	63	ENSP00000330930:R63S;ENSP00000428054:R63S	ENSP00000330930:R63S	R	-	3	2	AC068353.1	8276479	1.000000	0.71417	0.887000	0.34795	0.775000	0.43874	0.980000	0.29513	1.272000	0.44329	-0.230000	0.12252	AGG	.		0.657	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
ADAM18	8749	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	39550201	39550201	+	Splice_Site	SNP	T	T	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr8:39550201T>A	ENST00000265707.5	+	17	1947		c.e17+2		ADAM18_ENST00000379866.1_Splice_Site|ADAM18_ENST00000541111.1_Splice_Site|ADAM18_ENST00000523755.1_Splice_Site	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GGGAAAGGGGTAAGTCACTTT	0.348																																					.													.	ADAM18-228	0			c.1902+2T>A						.						93.0	96.0	95.0					8																	39550201		2203	4299	6502	SO:0001630	splice_region_variant	8749	exon17			AAGGGGTAAGTCA	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1902+2T>A	8.37:g.39550201T>A		119	1		189	67	NM_014237	0	0	0	0	0	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Splice_Site	SNP	ENST00000265707.5	37	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.798603	0.50208	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000541111	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5062	0.39048	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM18	39669358	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	3.170000	0.50816	2.023000	0.59567	0.455000	0.32223	.	.		0.348	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	Intron
LRRCC1	85444	ucsc.edu	37	8	86057688	86057688	+	Missense_Mutation	SNP	T	T	C			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr8:86057688T>C	ENST00000360375.3	+	19	3190	c.3041T>C	c.(3040-3042)aTg>aCg	p.M1014T	LRRCC1_ENST00000414626.2_Missense_Mutation_p.M994T	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	1014					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						AAAAAAACAATGGAAGCAAAA	0.299																																					p.M1014T													.	LRRCC1-90	0			c.T3041C						.						53.0	51.0	51.0					8																	86057688		1810	4061	5871	SO:0001583	missense	85444	exon19			AAACAATGGAAGC	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.3041T>C	8.37:g.86057688T>C	ENSP00000353538:p.Met1014Thr	258	0		363	2	NM_033402	0	0	16	16	0	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.618150	0.46736	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.35048	1.33;1.33	5.12	5.12	0.69794	.	0.000000	0.43260	D	0.000600	T	0.50360	0.1611	M	0.65498	2.005	0.80722	D	1	D;D;P	0.62365	0.991;0.989;0.841	P;P;B	0.58266	0.805;0.836;0.313	T	0.45234	-0.9275	10	0.13470	T	0.59	-9.9528	15.0645	0.71983	0.0:0.0:0.0:1.0	.	994;921;1014	Q9C099-2;E9PE41;Q9C099	.;.;LRCC1_HUMAN	T	1014;994	ENSP00000353538:M1014T;ENSP00000394695:M994T	ENSP00000353538:M1014T	M	+	2	0	LRRCC1	86244940	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	6.443000	0.73447	2.138000	0.66242	0.402000	0.26972	ATG	.		0.299	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	
TRAPPC9	83696	hgsc.bcm.edu	37	8	140744445	140744445	+	Splice_Site	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr8:140744445T>G	ENST00000438773.2	-	22	3189	c.3056A>C	c.(3055-3057)gAt>gCt	p.D1019A	TRAPPC9_ENST00000389328.4_Splice_Site_p.D1117A|TRAPPC9_ENST00000389327.3_Splice_Site_p.D1010A|TRAPPC9_ENST00000522504.1_5'UTR	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	1019					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CACCAGCACATCTGTAAGGGA	0.677																																					p.D1117A		.											.	TRAPPC9-228	0			c.A3350C						.						13.0	15.0	14.0					8																	140744445		2197	4283	6480	SO:0001630	splice_region_variant	83696	exon22			AGCACATCTGTAA	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.3056-1A>C	8.37:g.140744445T>G		0	0		27	12	NM_031466	0	0	0	0	0	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.420212	0.62622	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.64360	0.2591	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.995;0.996	T	0.64241	-0.6454	9	0.39692	T	0.17	.	13.8481	0.63479	0.0:0.0:0.0:1.0	.	1019;1117	Q96Q05;Q96Q05-2	TPPC9_HUMAN;.	A	1117;1010;1019	.	ENSP00000373978:D1010A	D	-	2	0	TRAPPC9	140813627	1.000000	0.71417	0.999000	0.59377	0.853000	0.48598	7.220000	0.78008	1.911000	0.55334	0.533000	0.62120	GAT	.		0.677	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	Missense_Mutation
C9orf66	157983	hgsc.bcm.edu	37	9	214741	214741	+	Missense_Mutation	SNP	C	C	T	rs200440314	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:214741C>T	ENST00000382387.2	-	1	1152	c.656G>A	c.(655-657)cGa>cAa	p.R219Q	DOCK8_ENST00000453981.1_5'Flank|DOCK8_ENST00000432829.2_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	219	Arg-rich.									central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		ACGCCCTCCTCGCCCGCCGCT	0.766													C|||	3	0.000599042	0.0023	0.0	5008	,	,		10580	0.0		0.0	False		,,,				2504	0.0				p.R219Q		.											.	C9orf66-514	0			c.G656A						.						2.0	3.0	3.0					9																	214741		1384	2827	4211	SO:0001583	missense	157983	exon1			CCTCCTCGCCCGC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.656G>A	9.37:g.214741C>T	ENSP00000371824:p.Arg219Gln	0	0		14	10	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	7	0.003205128205128205	7	0.014227642276422764	0	0.0	0	0.0	0	0.0	.	10.68	1.417416	0.25552	.	.	ENSG00000183784	ENST00000382387	T	0.23147	1.92	3.25	1.33	0.21861	.	.	.	.	.	T	0.06872	0.0175	N	0.08118	0	0.09310	N	1	P	0.42649	0.786	B	0.33620	0.167	T	0.15065	-1.0450	9	0.87932	D	0	.	4.4837	0.11780	0.0:0.637:0.2315:0.1315	.	219	Q5T8R8	CI066_HUMAN	Q	219	ENSP00000371824:R219Q	ENSP00000371824:R219Q	R	-	2	0	C9orf66	204741	0.003000	0.15002	0.054000	0.19295	0.561000	0.35649	0.910000	0.28571	0.367000	0.24454	0.484000	0.47621	CGA	C|0.997;T|0.003		0.766	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
PTPRD	5789	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	8504321	8504321	+	Missense_Mutation	SNP	G	G	A	rs200847027	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:8504321G>A	ENST00000381196.4	-	20	2305	c.1762C>T	c.(1762-1764)Cgc>Tgc	p.R588C	PTPRD_ENST00000397611.3_Missense_Mutation_p.R585C|PTPRD_ENST00000397617.3_Missense_Mutation_p.R578C|PTPRD_ENST00000360074.4_Missense_Mutation_p.R575C|PTPRD_ENST00000537002.1_Missense_Mutation_p.R585C|PTPRD_ENST00000540109.1_Missense_Mutation_p.R588C|PTPRD_ENST00000397606.3_Missense_Mutation_p.R578C|PTPRD_ENST00000486161.1_Missense_Mutation_p.R588C|PTPRD_ENST00000355233.5_Missense_Mutation_p.R588C|PTPRD_ENST00000356435.5_Missense_Mutation_p.R588C|PTPRD_ENST00000358503.5_Missense_Mutation_p.R575C	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	588	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TGAGGGGAGCGTGCAGCCAGA	0.458										TSP Lung(15;0.13)			G|||	2	0.000399361	0.0	0.0	5008	,	,		19317	0.001		0.001	False		,,,				2504	0.0				p.R588C		.											.	PTPRD-912	0			c.C1762T						.						253.0	220.0	231.0					9																	8504321		2203	4300	6503	SO:0001583	missense	5789	exon12			GGGAGCGTGCAGC	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1762C>T	9.37:g.8504321G>A	ENSP00000370593:p.Arg588Cys	76	0		139	8	NM_130392	0	0	0	0	0	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	20.8	4.057013	0.76074	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	5.53	5.53	0.82687	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74550	0.3731	M	0.62154	1.92	0.80722	D	1	D;D;D;D;B;D;D;D;D	0.89917	0.997;0.999;1.0;0.999;0.052;0.998;1.0;1.0;1.0	P;D;D;P;B;P;D;D;D	0.79784	0.849;0.959;0.993;0.892;0.055;0.886;0.96;0.969;0.976	T	0.72653	-0.4228	9	.	.	.	.	19.4728	0.94969	0.0:0.0:1.0:0.0	.	578;582;588;588;585;585;575;588;588	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	C	588;588;575;575;588;578;585;585;588;588;588;578	ENSP00000370593:R588C;ENSP00000348812:R588C;ENSP00000353187:R575C;ENSP00000351293:R575C;ENSP00000347373:R588C;ENSP00000380741:R578C;ENSP00000380735:R585C;ENSP00000440515:R585C;ENSP00000438164:R588C;ENSP00000417093:R588C;ENSP00000380731:R578C	.	R	-	1	0	PTPRD	8494321	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	6.250000	0.72435	2.602000	0.87976	0.467000	0.42956	CGC	G|0.999;A|0.000		0.458	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
FRMPD1	22844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	37745145	37745145	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:37745145G>A	ENST00000539465.1	+	16	3709	c.3116G>A	c.(3115-3117)gGa>gAa	p.G1039E	FRMPD1_ENST00000377765.3_Missense_Mutation_p.G1039E|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1039						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GTCTCTCAAGGAGACACACTA	0.488																																					p.G1039E		.											.	FRMPD1-159	0			c.G3116A						.						75.0	81.0	79.0					9																	37745145		2202	4299	6501	SO:0001583	missense	22844	exon16			CTCAAGGAGACAC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3116G>A	9.37:g.37745145G>A	ENSP00000444411:p.Gly1039Glu	33	0		47	18	NM_014907	0	0	0	0	0	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702580	0.68501	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07908	3.15;3.15	5.17	3.32	0.38043	.	3.748350	0.00496	N	0.000156	T	0.08358	0.0208	N	0.24115	0.695	0.80722	D	1	B	0.12630	0.006	B	0.15052	0.012	T	0.17592	-1.0364	10	0.46703	T	0.11	-5.6669	7.1991	0.25871	0.0943:0.1842:0.7215:0.0	.	1039	Q5SYB0	FRPD1_HUMAN	E	1039	ENSP00000366995:G1039E;ENSP00000444411:G1039E	ENSP00000366995:G1039E	G	+	2	0	FRMPD1	37735145	0.009000	0.17119	0.861000	0.33841	0.973000	0.67179	0.191000	0.17076	0.557000	0.29117	0.462000	0.41574	GGA	.		0.488	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PRKACG	5568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	71628295	71628295	+	Silent	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:71628295G>A	ENST00000377276.2	-	1	744	c.714C>T	c.(712-714)ccC>ccT	p.P238P		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						CGGCGTAGAAGGGTGGGAAGC	0.597																																					p.P238P	Esophageal Squamous(110;2236 2623 32146)	.											.	PRKACG-1061	0			c.C714T						.						70.0	68.0	69.0					9																	71628295		2203	4300	6503	SO:0001819	synonymous_variant	5568	exon1			GTAGAAGGGTGGG	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.714C>T	9.37:g.71628295G>A		35	0		96	34	NM_002732	0	0	0	0	0	O60850|Q5VZ02|Q86YI1	Silent	SNP	ENST00000377276.2	37	CCDS6625.1																																																																																			.		0.597	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1		
SPATA31C1	441452	hgsc.bcm.edu;ucsc.edu	37	9	90534184	90534184	+	RNA	SNP	C	C	T	rs374457389|rs368404840	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:90534184C>T	ENST00000602681.1	+	0	930							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ATCTTGTCTCCCAGCGTCATC	0.612													.|||	47	0.00938498	0.0348	0.0014	5008	,	,		14138	0.0		0.0	False		,,,				2504	0.0				p.S68S		.											.	.	0			c.C204T						.	C		44,1340		0,44,648	140.0	113.0	121.0		204	0.1	0.0	9		121	0,3182		0,0,1591	no	coding-synonymous	FAM75C1	NM_001145124.1		0,44,2239	TT,TC,CC		0.0,3.1792,0.9636		68/1189	90534184	44,4522	692	1591	2283			441452	exon2			TGTCTCCCAGCGT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90534184C>T		120	0		499	149	NM_001145124	0	0	0	0	0		Silent	SNP	ENST00000602681.1	37																																																																																				.		0.612	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
NIPSNAP3A	25934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	107521616	107521616	+	Missense_Mutation	SNP	A	A	C	rs546236502	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:107521616A>C	ENST00000374767.4	+	6	846	c.741A>C	c.(739-741)aaA>aaC	p.K247N		NM_015469.1	NP_056284.1	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A (C. elegans)	247						cytoplasm (GO:0005737)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	8						CACCACTGAAATAGTTTTCTA	0.358																																					p.K247N		.											.	NIPSNAP3A-90	0			c.A741C						.						105.0	97.0	100.0					9																	107521616		2203	4300	6503	SO:0001583	missense	25934	exon6			ACTGAAATAGTTT	BC005935	CCDS6760.1	9q31.3	2003-11-27			ENSG00000136783	ENSG00000136783			23619	protein-coding gene	gene with protein product		608871				12477932	Standard	NM_015469		Approved	DKFZp564D177, FLJ13953, HSPC299, MGC14553		Q9UFN0	OTTHUMG00000020413	ENST00000374767.4:c.741A>C	9.37:g.107521616A>C	ENSP00000363899:p.Lys247Asn	63	0		85	24	NM_015469	0	0	3	3	0	A6NM55|Q5VX32|Q9BRV7|Q9H843|Q9P083	Missense_Mutation	SNP	ENST00000374767.4	37	CCDS6760.1	.	.	.	.	.	.	.	.	.	.	A	17.18	3.325054	0.60634	.	.	ENSG00000136783	ENST00000374767	T	0.73047	-0.71	3.97	2.82	0.32997	Dimeric alpha-beta barrel (1);	0.047557	0.85682	D	0.000000	T	0.80166	0.4573	M	0.81239	2.535	0.37125	D	0.901004	D	0.76494	0.999	D	0.71656	0.974	T	0.80739	-0.1248	10	0.87932	D	0	.	4.8972	0.13757	0.6882:0.0:0.3118:0.0	.	247	Q9UFN0	NPS3A_HUMAN	N	247	ENSP00000363899:K247N	ENSP00000363899:K247N	K	+	3	2	NIPSNAP3A	106561437	0.997000	0.39634	1.000000	0.80357	0.978000	0.69477	0.441000	0.21611	0.697000	0.31718	0.482000	0.46254	AAA	.		0.358	NIPSNAP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053484.1	NM_015469	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	113233740	113233740	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:113233740C>A	ENST00000401783.2	-	16	3238	c.2902G>T	c.(2902-2904)Gca>Tca	p.A968S	SVEP1_ENST00000302728.8_Missense_Mutation_p.A968S|SVEP1_ENST00000374469.1_Missense_Mutation_p.A945S|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	968					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ATTTCTGATGCAAGCTGAAAG	0.428																																					p.A968S		.											.	SVEP1-75	0			c.G2902T						.						122.0	112.0	115.0					9																	113233740		1855	4107	5962	SO:0001583	missense	79987	exon16			CTGATGCAAGCTG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.2902G>T	9.37:g.113233740C>A	ENSP00000384917:p.Ala968Ser	88	0		152	16	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	7.630	0.678635	0.14841	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.78246	-1.01;-1.02;-1.16	5.49	5.49	0.81192	.	0.158375	0.56097	D	0.000024	T	0.56834	0.2012	N	0.08118	0	0.27524	N	0.951309	B;B	0.17268	0.021;0.012	B;B	0.15052	0.012;0.012	T	0.37033	-0.9723	10	0.10902	T	0.67	.	12.9639	0.58473	0.283:0.717:0.0:0.0	.	968;968	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	S	968;945;968	ENSP00000384917:A968S;ENSP00000363593:A945S;ENSP00000304118:A968S	ENSP00000304118:A968S	A	-	1	0	SVEP1	112273561	1.000000	0.71417	0.854000	0.33618	0.607000	0.37147	2.741000	0.47426	2.583000	0.87209	0.650000	0.86243	GCA	.		0.428	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MED27	9442	hgsc.bcm.edu;broad.mit.edu	37	9	134735980	134735980	+	Missense_Mutation	SNP	G	G	A	rs557626461	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:134735980G>A	ENST00000292035.5	-	8	944	c.881C>T	c.(880-882)cCg>cTg	p.P294L	MED27_ENST00000357028.2_Missense_Mutation_p.P258L	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	294					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)	p.P294L(4)|p.P294fs*>18(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		CCTCCATGTCGGGGGAAGGCC	0.597													G|||	40	0.00798722	0.003	0.0072	5008	,	,		18345	0.0		0.0169	False		,,,				2504	0.0143				p.P294L	Colon(41;784 923 6932 42329 52483)	.											.	MED27-69	5	Substitution - Missense(4)|Deletion - Frameshift(1)	endometrium(2)|kidney(2)|large_intestine(1)	c.C881T						.						30.0	29.0	29.0					9																	134735980		2203	4300	6503	SO:0001583	missense	9442	exon8			CATGTCGGGGGAA	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.881C>T	9.37:g.134735980G>A	ENSP00000292035:p.Pro294Leu	46	0		145	9	NM_004269	0	0	33	33	0	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095595	0.94197	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.84014	0.5379	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	D	0.86894	0.2050	9	0.87932	D	0	-0.1478	16.105	0.81213	0.0:0.0:1.0:0.0	.	258;294	Q6P2C8-2;Q6P2C8	.;MED27_HUMAN	L	294;220;258	.	ENSP00000292035:P294L	P	-	2	0	MED27	133725801	1.000000	0.71417	0.949000	0.38748	0.987000	0.75469	7.762000	0.85270	2.472000	0.83506	0.655000	0.94253	CCG	.		0.597	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
SDCCAG3	10807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139302279	139302279	+	Splice_Site	SNP	T	T	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:139302279T>G	ENST00000357365.3	-	4	530	c.401A>C	c.(400-402)aAg>aCg	p.K134T	SDCCAG3_ENST00000371725.3_Splice_Site_p.K61T|PMPCA_ENST00000371720.1_5'Flank|PMPCA_ENST00000371717.3_5'Flank|SDCCAG3_ENST00000298537.7_Splice_Site_p.K111T|SDCCAG3_ENST00000461693.1_5'Flank|PMPCA_ENST00000399219.3_5'Flank	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	134						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		TGGATTTACCTTTGCATAAAT	0.522																																					p.K134T		.											.	SDCCAG3-90	0			c.A401C						.						117.0	127.0	124.0					9																	139302279		1996	4158	6154	SO:0001630	splice_region_variant	10807	exon4			TTTACCTTTGCAT	AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.402+1A>C	9.37:g.139302279T>G		28	0		43	11	NM_001039707	0	0	0	0	0	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	ENST00000357365.3	37	CCDS43904.1	.	.	.	.	.	.	.	.	.	.	T	14.76	2.632253	0.46944	.	.	ENSG00000165689	ENST00000357365;ENST00000298537;ENST00000371725;ENST00000371723	T;T;T;T	0.39406	2.24;2.31;2.29;1.08	5.34	5.34	0.76211	.	0.221148	0.38837	N	0.001555	T	0.58366	0.2117	M	0.63843	1.955	0.42845	D	0.994066	D;D;D	0.76494	0.99;0.997;0.999	P;D;D	0.68353	0.864;0.928;0.957	T	0.59627	-0.7419	10	0.45353	T	0.12	-23.4229	11.7031	0.51581	0.0:0.0:0.0:1.0	.	61;111;134	Q96C92-4;Q96C92-2;Q96C92	.;.;SDCG3_HUMAN	T	134;111;61;84	ENSP00000349929:K134T;ENSP00000298537:K111T;ENSP00000360790:K61T;ENSP00000360788:K84T	ENSP00000298537:K111T	K	-	2	0	SDCCAG3	138422100	1.000000	0.71417	0.628000	0.29241	0.117000	0.20001	4.054000	0.57434	2.012000	0.59069	0.528000	0.53228	AAG	.		0.522	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055060.2	NM_006643	Missense_Mutation
PRPS2	5634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	12840843	12840843	+	Missense_Mutation	SNP	C	C	G			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:12840843C>G	ENST00000380668.5	+	7	1013	c.885C>G	c.(883-885)atC>atG	p.I295M	PRPS2_ENST00000398491.2_Missense_Mutation_p.I298M	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	295					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						TTTCCATGATCTTGGCCGAAG	0.453																																					p.I298M		.											.	PRPS2-130	0			c.C894G						.						174.0	117.0	136.0					X																	12840843		2203	4300	6503	SO:0001583	missense	5634	exon7			CATGATCTTGGCC	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.885C>G	X.37:g.12840843C>G	ENSP00000370043:p.Ile295Met	90	0		232	69	NM_001039091	0	0	0	0	0	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Missense_Mutation	SNP	ENST00000380668.5	37	CCDS14150.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.559940	0.27827	.	.	ENSG00000101911	ENST00000380668;ENST00000398491;ENST00000461630;ENST00000460220	T;T;T	0.73363	-0.74;-0.74;-0.74	5.12	-0.0434	0.13859	.	0.000000	0.85682	D	0.000000	T	0.58018	0.2093	N	0.25485	0.75	0.80722	D	1	B;B	0.20164	0.042;0.012	B;B	0.37451	0.25;0.238	T	0.21586	-1.0241	10	0.12103	T	0.63	-23.1539	4.2961	0.10902	0.2341:0.3845:0.0:0.3814	.	295;298	P11908;P11908-2	PRPS2_HUMAN;.	M	295;298;150;127	ENSP00000370043:I295M;ENSP00000381504:I298M;ENSP00000418911:I150M	ENSP00000370043:I295M	I	+	3	3	PRPS2	12750764	0.945000	0.32115	0.987000	0.45799	0.993000	0.82548	0.139000	0.16036	0.131000	0.18576	0.513000	0.50165	ATC	.		0.453	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
PHKA2	5256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	18919658	18919658	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:18919658C>A	ENST00000379942.4	-	27	3637	c.2972G>T	c.(2971-2973)gGa>gTa	p.G991V		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	991					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TTTGGTGACTCCGGTATGGCC	0.547																																					p.G991V		.											.	PHKA2-131	0			c.G2972T						.						180.0	139.0	153.0					X																	18919658		2203	4300	6503	SO:0001583	missense	5256	exon27			GTGACTCCGGTAT		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2972G>T	X.37:g.18919658C>A	ENSP00000369274:p.Gly991Val	53	0		186	65	NM_000292	0	0	0	1	1	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573963	0.86542	.	.	ENSG00000044446	ENST00000379942	D	0.90955	-2.76	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.94798	0.8320	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.93740	0.7049	10	0.41790	T	0.15	-16.0545	19.5104	0.95139	0.0:1.0:0.0:0.0	.	991	P46019	KPB2_HUMAN	V	991	ENSP00000369274:G991V	ENSP00000369274:G991V	G	-	2	0	PHKA2	18829579	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	7.400000	0.79949	2.562000	0.86427	0.600000	0.82982	GGA	.		0.547	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
BRWD3	254065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	80001213	80001213	+	Missense_Mutation	SNP	G	G	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:80001213G>A	ENST00000373275.4	-	7	662	c.446C>T	c.(445-447)gCc>gTc	p.A149V		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	149					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TAATTGCCTGGCAGAGGTGAT	0.343																																					p.A149V		.											.	BRWD3-134	0			c.C446T						.						36.0	33.0	34.0					X																	80001213		2203	4298	6501	SO:0001583	missense	254065	exon7			TGCCTGGCAGAGG		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.446C>T	X.37:g.80001213G>A	ENSP00000362372:p.Ala149Val	204	0		303	98	NM_153252	0	0	0	0	0	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873392	0.91664	.	.	ENSG00000165288	ENST00000373275	T	0.29397	1.57	4.96	4.08	0.47627	.	0.065291	0.64402	D	0.000010	T	0.46580	0.1400	M	0.64997	1.995	0.49798	D	0.999826	D	0.67145	0.996	P	0.57911	0.829	T	0.42832	-0.9428	9	.	.	.	-1.3369	14.4752	0.67541	0.0:0.144:0.856:0.0	.	149	Q6RI45	BRWD3_HUMAN	V	149	ENSP00000362372:A149V	.	A	-	2	0	BRWD3	79887869	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.170000	0.64990	1.065000	0.40693	0.544000	0.68410	GCC	.		0.343	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
SH3BGRL	6451	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	80532507	80532507	+	Missense_Mutation	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:80532507C>A	ENST00000373212.5	+	2	328	c.70C>A	c.(70-72)Ctt>Att	p.L24I	SH3BGRL_ENST00000481106.1_3'UTR	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	24					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				ACAAGATGTGCTTGGTTTCCT	0.358																																					p.L24I													.	SH3BGRL-131	0			c.C70A						.						50.0	47.0	48.0					X																	80532507		2203	4299	6502	SO:0001583	missense	6451	exon2			GATGTGCTTGGTT	AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.70C>A	X.37:g.80532507C>A	ENSP00000362308:p.Leu24Ile	164	2		244	79	NM_003022	0	0	0	2	2	Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Missense_Mutation	SNP	ENST00000373212.5	37	CCDS14449.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153276	0.57259	.	.	ENSG00000131171	ENST00000373212	T	0.76709	-1.04	5.7	4.66	0.58398	Thioredoxin-like fold (2);	0.052265	0.85682	D	0.000000	D	0.82728	0.5100	L	0.57536	1.79	0.46981	D	0.999275	B;P	0.43973	0.225;0.823	P;P	0.57244	0.456;0.816	T	0.82159	-0.0595	10	0.44086	T	0.13	-7.3431	12.2228	0.54443	0.0:0.8504:0.0:0.1496	.	23;24	D3DTE6;O75368	.;SH3L1_HUMAN	I	24	ENSP00000362308:L24I	ENSP00000362308:L24I	L	+	1	0	SH3BGRL	80419163	0.986000	0.35501	0.998000	0.56505	0.840000	0.47671	1.248000	0.32827	2.380000	0.81148	0.600000	0.82982	CTT	.		0.358	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057350.1	NM_003022	
HS6ST2	90161	hgsc.bcm.edu	37	X	132092310	132092310	+	Silent	SNP	C	C	A	rs201640022		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:132092310C>A	ENST00000370836.2	-	2	736	c.321G>T	c.(319-321)ctG>ctT	p.L107L	HS6ST2_ENST00000521489.1_Silent_p.L107L|HS6ST2_ENST00000370833.2_5'Flank	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	107					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					AGAGGGAGCCCAGGTCCCAGC	0.716													C|||	14	0.00370861	0.0091	0.0029	3775	,	,		9470	0.0		0.0	False		,,,				2504	0.0				p.L107L		.											.	HS6ST2-130	0			c.G321T						.	C	,	48,3096		0,40,8,1258,540	7.0	9.0	8.0		321,321	3.4	1.0	X		8	1,6306		0,1,0,2292,1721	no	coding-synonymous,coding-synonymous	HS6ST2	NM_001077188.1,NM_147175.3	,	0,41,8,3550,2261	AA,AC,A,CC,C		0.0159,1.5267,0.5185	,	107/646,107/606	132092310	49,9402	1846	4014	5860	SO:0001819	synonymous_variant	90161	exon2			GGAGCCCAGGTCC	AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.321G>T	X.37:g.132092310C>A		0	0		33	16	NM_001077188	0	0	0	0	0	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Silent	SNP	ENST00000370836.2	37	CCDS48169.1																																																																																			C|0.996;A|0.004		0.716	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058332.3	NM_147174	
PNCK	139728	broad.mit.edu	37	X	152938523	152938523	+	Silent	SNP	C	C	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:152938523C>A	ENST00000370150.1	-	2	187	c.9G>T	c.(7-9)ctG>ctT	p.L3L	PNCK_ENST00000370145.4_Silent_p.L20L|PNCK_ENST00000447676.2_Silent_p.L86L|PNCK_ENST00000370142.1_Silent_p.L3L|PNCK_ENST00000393831.2_Silent_p.L3L|PNCK_ENST00000475172.1_5'UTR|PNCK_ENST00000340888.3_Silent_p.L3L			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	3						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTTTCTTCAGCAGCAGCATGT	0.667																																					p.L86L													.	PNCK-207	0			c.G258T						.						56.0	39.0	45.0					X																	152938523		2203	4297	6500	SO:0001819	synonymous_variant	139728	exon2			CTTCAGCAGCAGC	BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.9G>T	X.37:g.152938523C>A		46	0		227	5	NM_001039582	0	0	0	0	0	B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Silent	SNP	ENST00000370150.1	37																																																																																				.		0.667	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000061044.2	NM_198452	
BRINP2	57795	broad.mit.edu;bcgsc.ca	37	1	177242681	177242690	+	Frame_Shift_Del	DEL	GTCAGTTCTG	GTCAGTTCTG	-	rs138487282		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	GTCAGTTCTG	GTCAGTTCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:177242681_177242690delGTCAGTTCTG	ENST00000361539.4	+	5	1039_1048	c.727_736delGTCAGTTCTG	c.(727-738)gtcagttctgtcfs	p.VSSV243fs	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	243	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											TCTGGACTCAGTCAGTTCTGTCTTGGTACA	0.443																																					p.243_246del													.	FAM5B-28	0			c.727_736del						.																																			SO:0001589	frameshift_variant	57795	exon5			GACTCAGTCAGTT		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.727_736delGTCAGTTCTG	1.37:g.177242681_177242690delGTCAGTTCTG	ENSP00000354481:p.Val243fs	127	0		186	18	NM_021165	0	0	0	0	0	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Frame_Shift_Del	DEL	ENST00000361539.4	37	CCDS1320.1																																																																																			.		0.443	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
DLAT	1737	broad.mit.edu	37	11	111904183	111904183	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr11:111904183delA	ENST00000280346.6	+	5	1375	c.716delA	c.(715-717)gaafs	p.E239fs	DLAT_ENST00000537636.1_Intron|RNU6-893P_ENST00000458841.1_RNA|DLAT_ENST00000393051.1_Intron	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase	239	Lipoyl-binding 2. {ECO:0000255|PROSITE- ProRule:PRU01066}.				cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		CAGAGATGGGAAAAAAAAGTG	0.433																																					p.E239fs													.	DLAT-226	0			c.716delA						.						76.0	76.0	76.0					11																	111904183		2201	4297	6498	SO:0001589	frameshift_variant	1737	exon5			GATGGGAAAAAAA	Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.716delA	11.37:g.111904183delA	ENSP00000280346:p.Glu239fs	120	0		209	7	NM_001931	0	0	0	0	0	Q16783|Q53EP3	Frame_Shift_Del	DEL	ENST00000280346.6	37	CCDS8354.1																																																																																			.		0.433	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258167.1	NM_001931	
TCP11L2	255394	broad.mit.edu	37	12	106729801	106729811	+	Splice_Site	DEL	ATATGTTAGAC	ATATGTTAGAC	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	ATATGTTAGAC	ATATGTTAGAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:106729801_106729811delATATGTTAGAC	ENST00000299045.3	+	8	1134_1136	c.960_962delATATGTTAGAC	c.(958-963)gaatat>gat	p.EY320fs		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	320										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						ttttaaataaatatGTTAGACACTTATGACA	0.327																																					p.321_321del													.	TCP11L2-93	0			c.961_962del						.																																			SO:0001630	splice_region_variant	255394	exon8			AAATAAATATGTT	BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.961-1ATATGTTAGAC>-	12.37:g.106729801_106729811delATATGTTAGAC		23	0		18	7	NM_152772	0	0	0	0	0	B2RA65|G3V1Y9	Frame_Shift_Del	DEL	ENST00000299045.3	37	CCDS9104.1																																																																																			.		0.327	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407206.1	NM_152772	Frame_Shift_Del
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu	37	16	72923790	72923790	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr16:72923790delG	ENST00000268489.5	-	4	3960	c.3288delC	c.(3286-3288)tccfs	p.S1096fs	ZFHX3_ENST00000397992.5_Frame_Shift_Del_p.S182fs	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1096					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGGCCTTGGTGGAGTAGTTGC	0.557																																					p.S1096fs		.											.	ZFHX3-72	0			c.3288delC						.						107.0	75.0	86.0					16																	72923790		2198	4300	6498	SO:0001589	frameshift_variant	463	exon4			.	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.3288delC	16.37:g.72923790delG	ENSP00000268489:p.Ser1096fs	16	0		42	14	NM_006885	0	0	0	0	0	D3DWS8|O15101|Q13719	Frame_Shift_Del	DEL	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.557	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
PHB	5245	hgsc.bcm.edu;bcgsc.ca	37	17	47489082	47489082	+	Frame_Shift_Del	DEL	G	G	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr17:47489082delG	ENST00000300408.3	-	3	280	c.208delC	c.(208-210)cgtfs	p.R70fs	PHB_ENST00000511832.1_Frame_Shift_Del_p.R70fs|RP11-81K2.1_ENST00000576461.1_Intron|PHB_ENST00000508009.1_Intron	NM_001281496.1|NM_001281715.1|NM_002634.2	NP_001268425.1|NP_001268644.1|NP_002625.1	P35232	PHB_HUMAN	prohibitin	70					cellular response to interleukin-6 (GO:0071354)|DNA replication (GO:0006260)|histone deacetylation (GO:0016575)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone receptor signaling pathway (GO:0050847)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|transcription regulatory region DNA binding (GO:0044212)			endometrium(4)|large_intestine(2)|lung(4)	10	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			GGTCGAGAACGGCAGTCAAAG	0.488																																					p.R70fs		.											.	PHB-90	0			c.208delC						.						96.0	69.0	78.0					17																	47489082		2203	4300	6503	SO:0001589	frameshift_variant	5245	exon3			.		CCDS11548.1, CCDS62244.1	17q21	2010-11-25			ENSG00000167085	ENSG00000167085			8912	protein-coding gene	gene with protein product		176705				10376528, 8244394	Standard	NM_001281496		Approved	PHB1	uc002iox.1	P35232	OTTHUMG00000134271	ENST00000300408.3:c.208delC	17.37:g.47489082delG	ENSP00000300408:p.Arg70fs	78	0		245	74	NM_002634	0	0	0	0	0	B4DY47|Q4VBQ0	Frame_Shift_Del	DEL	ENST00000300408.3	37	CCDS11548.1																																																																																			.		0.488	PHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258826.1	NM_002634	
KCTD1	284252	hgsc.bcm.edu	37	18	24128223	24128225	+	Intron	DEL	TCC	TCC	-	rs143299522	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr18:24128223_24128225delTCC	ENST00000408011.3	-	1	545				KCTD1_ENST00000417602.1_In_Frame_Del_p.92_93EE>E|KCTD1_ENST00000580059.1_5'Flank|KCTD1_ENST00000317932.7_Intron|KCTD1_ENST00000579973.1_Intron	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			ctcctcctcttcctcctcctcct	0.655														134	0.0267572	0.0673	0.0086	5008	,	,		6875	0.0		0.008	False		,,,				2504	0.0317				p.92_93del		.											.	KCTD1-91	0			c.276_278del						.		,,	187,3139		43,101,1519					,,	-0.1	1.0		dbSNP_134	4	78,6614		13,52,3281	no	intron,coding,intron	KCTD1	NM_198991.2,NM_001142730.1,NM_001136205.1	,,	56,153,4800	A1A1,A1R,RR		1.1656,5.6224,2.6452	,,	,,		265,9753				SO:0001627	intron_variant	284252	exon1			.	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.14+629GGA>-	18.37:g.24128232_24128234delTCC		0	0		11	10	NM_001142730	0	0	0	0	0	A8K1F5	In_Frame_Del	DEL	ENST00000408011.3	37	CCDS11888.1																																																																																			TCC|0.976;-|0.024		0.655	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000446265.1	XM_209091	
B9D2	80776	hgsc.bcm.edu;broad.mit.edu	37	19	41869392	41869392	+	Frame_Shift_Del	DEL	T	T	-	rs2241714	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr19:41869392delT	ENST00000243578.3	-	2	252	c.33delA	c.(31-33)atafs	p.I11fs	TMEM91_ENST00000413014.2_5'Flank|TMEM91_ENST00000604123.1_Intron|B9D2_ENST00000601597.1_5'UTR|CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000539627.1_Intron	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2	11	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.		I -> M (in dbSNP:rs2241714). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.		cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)			large_intestine(1)|ovary(1)	2						CGCTGGCCCCTATGATCTGCC	0.537																																					p.I11fs		.											.	B9D2-69	0			c.33delA						.						69.0	58.0	62.0					19																	41869392		2203	4300	6503	SO:0001589	frameshift_variant	80776	exon2			.	BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9		ENST00000243578.3:c.33delA	19.37:g.41869392delT	ENSP00000243578:p.Ile11fs	72	0		124	67	NM_030578	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000243578.3	37	CCDS12579.1																																																																																			.		0.537	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463489.1	NM_030578	
PPP4R1L	55370	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	56813334	56813337	+	3'UTR	DEL	AAAG	AAAG	-	rs530133150		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	AAAG	AAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr20:56813334_56813337delAAAG	ENST00000334187.8	-	0	2105_2108							Q9P1A2	PP4RL_HUMAN	protein phosphatase 4, regulatory subunit 1-like																		TGAAGCTGATAAAGATAGTCTCTC	0.333																																					.		.											.	PPP4R1L-226	0			.						.																																			SO:0001624	3_prime_UTR_variant	55370	.			.	AF119843		20q13.32	2013-03-28			ENSG00000124224	ENSG00000124224			15755	other	unknown				C20orf192		14702039, 11780052	Standard	NR_003505		Approved	bA196N14.4, bA196N14.5	uc002xyy.1	Q9P1A2	OTTHUMG00000032838	ENST00000334187.8:c.*847CTTT>-	20.37:g.56813334_56813337delAAAG		28	0		46	22	.	0	0	0	0	0	B4DRM4|Q96LY6|Q9BZ17|Q9BZ18	RNA	DEL	ENST00000334187.8	37																																																																																				.		0.333	PPP4R1L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_003505	
OLIG1	116448	broad.mit.edu	37	21	34442709	34442717	+	In_Frame_Del	DEL	TCCTCCACT	TCCTCCACT	-	rs367752518		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	TCCTCCACT	TCCTCCACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr21:34442709_34442717delTCCTCCACT	ENST00000382348.1	+	1	260_268	c.157_165delTCCTCCACT	c.(157-165)tcctccactdel	p.SST53del	OLIG1_ENST00000333063.5_In_Frame_Del_p.SST37del|AP000282.2_ENST00000454622.1_RNA|AP000282.2_ENST00000420356.1_RNA	NM_138983.2	NP_620450.2	Q8TAK6	OLIG1_HUMAN	oligodendrocyte transcription factor 1	53	Ser-rich.				neuron fate commitment (GO:0048663)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)	1						ctcctccacctcctccacttcctcctcct	0.746																																					p.53_55del													.	OLIG1-446	0			c.157_165del						.			209,2581		57,95,1243						1.0	0.2			4	188,5876		52,84,2896	no	coding	OLIG1	NM_138983.2		109,179,4139	A1A1,A1R,RR		3.1003,7.491,4.4838				397,8457				SO:0001651	inframe_deletion	116448	exon1			TCCACCTCCTCCA	AP000109	CCDS42920.1, CCDS42920.2	21q22.11	2013-05-21			ENSG00000184221	ENSG00000184221		"""Basic helix-loop-helix proteins"""	16983	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 1"", ""oligodendrocyte lineage transcription factor 1"", ""basic domain, helix-loop-helix protein, class B, 6"""	606385				11526205	Standard	NM_138983		Approved	BHLHB6, bHLHe21	uc002yqz.3	Q8TAK6	OTTHUMG00000065064	ENST00000382348.1:c.157_165delTCCTCCACT	21.37:g.34442709_34442717delTCCTCCACT	ENSP00000371785:p.Ser53_Thr55del	4	0		16	7	NM_138983	0	0	0	0	0	Q7RTS0	In_Frame_Del	DEL	ENST00000382348.1	37	CCDS42920.2																																																																																			.		0.746	OLIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139730.1	NM_138983	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	51890186	51890186	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:51890186delC	ENST00000371117.3	-	32	4697	c.4422delG	c.(4420-4422)gggfs	p.G1474fs	PKHD1_ENST00000340994.4_Frame_Shift_Del_p.G1474fs	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1474	IPT/TIG 9.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAGTGCAATTCCCCTGACACT	0.542																																					p.G1474fs		.											.	PKHD1-603	0			c.4422delG						.						57.0	52.0	54.0					6																	51890186		2203	4300	6503	SO:0001589	frameshift_variant	5314	exon32			.	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.4422delG	6.37:g.51890186delC	ENSP00000360158:p.Gly1474fs	40	0		239	53	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Frame_Shift_Del	DEL	ENST00000371117.3	37	CCDS4935.1																																																																																			.		0.542	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
LRRC1	55227	broad.mit.edu	37	6	53764574	53764575	+	Frame_Shift_Del	DEL	TT	TT	-	rs550591899		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr6:53764574_53764575delTT	ENST00000370888.1	+	8	949_950	c.672_673delTT	c.(670-675)tgtttafs	p.L225fs		NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	225						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		ACCTGCTGTGTTTAGATGTCTC	0.391																																					p.224_225del													.	LRRC1-91	0			c.672_673del						.																																			SO:0001589	frameshift_variant	55227	exon8			GCTGTGTTTAGAT	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.672_673delTT	6.37:g.53764574_53764575delTT	ENSP00000359925:p.Leu225fs	83	0		412	32	NM_018214	0	0	0	0	0	Q5TGN3|Q9HAC0|Q9NVF1	Frame_Shift_Del	DEL	ENST00000370888.1	37	CCDS4953.2																																																																																			.		0.391	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040970.2	NM_025168	
AGR3	155465	broad.mit.edu	37	7	16901068	16901068	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:16901068delC	ENST00000310398.2	-	6	377	c.307delG	c.(307-309)gaafs	p.E103fs	AGR3_ENST00000402239.3_Frame_Shift_Del_p.E103fs	NM_176813.3	NP_789783.1	Q8TD06	AGR3_HUMAN	anterior gradient 3	103						extracellular region (GO:0005576)	dystroglycan binding (GO:0002162)			central_nervous_system(1)|kidney(8)|lung(2)|skin(1)|stomach(1)	13	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		TCAGTGGTTTCATGCTAGCAG	0.323																																					p.E103fs													.	AGR3-90	0			c.307delG						.						110.0	109.0	109.0					7																	16901068		2203	4295	6498	SO:0001589	frameshift_variant	155465	exon6			TGGTTTCATGCTA	AY069977	CCDS5365.1	7p21.1	2013-07-31	2013-07-31		ENSG00000173467	ENSG00000173467		"""Protein disulfide isomerases"""	24167	protein-coding gene	gene with protein product	"""breast cancer membrane protein 11"", ""protein disulfide isomerase family A, member 18"""	609482	"""anterior gradient 3 homolog (Xenopus laevis)"""			12592373, 12477722	Standard	NM_176813		Approved	HAG3, hAG-3, BCMP11, PDIA18	uc003sts.3	Q8TD06	OTTHUMG00000128411	ENST00000310398.2:c.307delG	7.37:g.16901068delC	ENSP00000308606:p.Glu103fs	116	0		207	9	NM_176813	0	0	0	0	0	A4D120	Frame_Shift_Del	DEL	ENST00000310398.2	37	CCDS5365.1																																																																																			.		0.323	AGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250191.2	NM_176813	
KIAA1324L	222223	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	86577110	86577110	+	Frame_Shift_Del	DEL	A	A	-	rs536741266		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:86577110delA	ENST00000450689.2	-	3	624	c.439delT	c.(439-441)tctfs	p.S147fs	KIAA1324L_ENST00000416314.1_Intron|KIAA1324L_ENST00000444627.1_Frame_Shift_Del_p.S147fs	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	147						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GCGATGTTAGAAAATCCTGCC	0.473																																					p.S147fs		.											.	KIAA1324L-97	0			c.439delT						.						124.0	101.0	108.0					7																	86577110		692	1591	2283	SO:0001589	frameshift_variant	222223	exon3			.	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.439delT	7.37:g.86577110delA	ENSP00000413445:p.Ser147fs	73	0		178	64	NM_001142749	0	0	0	0	0	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Frame_Shift_Del	DEL	ENST00000450689.2	37	CCDS47632.1																																																																																			.		0.473	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	152012386	152012386	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr7:152012386delT	ENST00000262189.6	-	4	645	c.427delA	c.(427-429)agtfs	p.S144fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.S144fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	144					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTAAGGAACTTTTTTCCCCA	0.378																																					p.S143fs		.											.	MLL3-1398	0			c.427delA						.						136.0	126.0	129.0					7																	152012386		2203	4300	6503	SO:0001589	frameshift_variant	58508	exon4			.	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.427delA	7.37:g.152012386delT	ENSP00000262189:p.Ser144fs	87	0		144	52	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	ENST00000262189.6	37	CCDS5931.1																																																																																			.		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
CIZ1	25792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	130947865	130947865	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr9:130947865delT	ENST00000393608.1	-	5	751	c.549delA	c.(547-549)aaafs	p.K183fs	CIZ1_ENST00000325721.8_Frame_Shift_Del_p.K159fs|CIZ1_ENST00000372948.3_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000372938.5_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000372954.1_Frame_Shift_Del_p.K159fs|CIZ1_ENST00000541172.1_Frame_Shift_Del_p.K82fs|CIZ1_ENST00000277465.4_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000538431.1_Frame_Shift_Del_p.K183fs|CIZ1_ENST00000357558.5_Frame_Shift_Del_p.K183fs	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	183					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						TCCGGGCCTGTTTCTGGGGGT	0.637																																					p.K213fs		.											.	CIZ1-92	0			c.639delA						.						67.0	68.0	68.0					9																	130947865		2203	4300	6503	SO:0001589	frameshift_variant	25792	exon5			.	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.549delA	9.37:g.130947865delT	ENSP00000377232:p.Lys183fs	45	0		118	36	NM_001257975	0	0	0	0	0	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Frame_Shift_Del	DEL	ENST00000393608.1	37	CCDS6894.1																																																																																			.		0.637	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
GABRQ	55879	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	151808889	151808890	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:151808889_151808890delTG	ENST00000370306.2	+	2	220_221	c.200_201delTG	c.(199-201)ctgfs	p.L67fs		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	67					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GACAGGGTGCTGTCAAGATACG	0.47																																					p.67_67del		.											.	GABRQ-133	0			c.200_201del						.																																			SO:0001589	frameshift_variant	55879	exon2			.	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.200_201delTG	X.37:g.151808889_151808890delTG	ENSP00000359329:p.Leu67fs	70	0		159	56	NM_018558	0	0	0	0	0	A6NFN1|Q32MB4|Q9NZK8	Frame_Shift_Del	DEL	ENST00000370306.2	37	CCDS14707.1																																																																																			.		0.470	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
CUX2	23316	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	111785758	111785759	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr12:111785758_111785759insA	ENST00000261726.6	+	22	4244_4245	c.4090_4091insA	c.(4090-4092)caafs	p.Q1364fs		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	1364	Pro-rich.				cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						ACTTCATCCCCAACAGGAGAGT	0.604																																					p.Q1364fs		.											.	CUX2-140	0			c.4090_4091insA						.																																			SO:0001589	frameshift_variant	23316	exon22			.	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.4092dupA	12.37:g.111785760_111785760dupA	ENSP00000261726:p.Gln1364fs	40	0		69	24	NM_015267	0	0	0	0	0	A7E2Y4	Frame_Shift_Ins	INS	ENST00000261726.6	37	CCDS41837.1																																																																																			.		0.604	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
GPR112	139378	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	135475736	135475737	+	Frame_Shift_Ins	INS	-	-	AAAAT			TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chrX:135475736_135475737insAAAAT	ENST00000394143.1	+	18	8368_8369	c.8077_8078insAAAAT	c.(8077-8079)aatfs	p.-2692fs	GPR112_ENST00000370652.1_Frame_Shift_Ins_p.-2692fs|GPR112_ENST00000412101.1_Frame_Shift_Ins_p.-2487fs|GPR112_ENST00000394141.1_Frame_Shift_Ins_p.-2487fs|GPR112_ENST00000287534.4_Frame_Shift_Ins_p.-2445fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTTTGAGAATAATAGTAAGTAT	0.371																																					p.N2693fs		.											.	GPR112-183	0			c.8077_8078insAAAAT						.																																			SO:0001589	frameshift_variant	139378	exon18			.	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	Exception_encountered	X.37:g.135475736_135475737insAAAAT	ENSP00000377699:p.Asn2692fs	52	0		58	16	NM_153834	0	0	0	0	0	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Ins	INS	ENST00000394143.1	37	CCDS35409.1																																																																																			.		0.371	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
TGM7	116179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43585144	43585145	+	Missense_Mutation	DNP	GC	GC	TT	rs267604217		TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr15:43585144_43585145GC>TT	ENST00000452443.2	-	3	205_206	c.201_202GC>AA	c.(199-204)aaGCcg>aaAAcg	p.P68T		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	68					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	AGCTCTGACGGCTTGGGTCCTG	0.559																																					p.P68T		.											.	TGM7-92	0			c.G201A						.																																			SO:0001583	missense	116179	exon3			TGACGGCTTGGGT	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.201_202delinsTT	15.37:g.43585144_43585145delinsTT	ENSP00000389466:p.Pro68Thr	44.0	0.0		62.0	14.0	NM_052955	0	0	0	0	0		Missense_Mutation	DNP	ENST00000452443.2	37	CCDS32213.1																																																																																			.		0.559	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
RERE	473	hgsc.bcm.edu	37	1	8419867	8419868	+	Missense_Mutation	DNP	CG	CG	TT	rs538667090|rs147985313|rs557606465	byFrequency	TCGA-Q2-A5QZ-01A-11D-A28G-10	TCGA-Q2-A5QZ-10A-01D-A28G-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b249fd0e-a8a3-4d18-b3a2-16901434f261	1b6d1224-f192-4682-9d71-3c30ffcd4589	g.chr1:8419867_8419868CG>TT	ENST00000337907.3	-	20	4208_4209	c.3574_3575CG>AA	c.(3574-3576)CGg>AAg	p.R1192K	RERE_ENST00000400908.2_Missense_Mutation_p.R1192K|RERE_ENST00000377464.1_Missense_Mutation_p.R924K|RERE_ENST00000476556.1_Missense_Mutation_p.R638K|RERE_ENST00000400907.2_Intron	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1192	Arg/Glu-rich (mixed charge).				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E1191_R1192insKE(1)		central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		ctcccgctcccgctccttctcc	0.683																																					p.R1192K		.											.	RERE-515	1	Insertion - In frame(1)	ovary(1)	c.C3574A						.																																			SO:0001583	missense	473	exon20			GCTCCCGCTCCTT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.3574_3575delinsTT	1.37:g.8419867_8419868delinsTT	ENSP00000338629:p.Arg1192Lys	15.0	0.0		45.0	4.0	NM_012102	0	0	0	0	0	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	DNP	ENST00000337907.3	37	CCDS95.1																																																																																			.		0.683	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
