#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SMC1A	8243	genome.wustl.edu	37	X	53436078	53436078	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chrX:53436078G>C	ENST00000322213.4	-	9	1587	c.1460C>G	c.(1459-1461)gCc>gGc	p.A487G	SMC1A_ENST00000375340.6_Missense_Mutation_p.A253G	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	487					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GTCGATGCGGGCATCCCCTAG	0.567																																						dbGAP											0			X											95.0	73.0	80.0					X																	53436078		2203	4300	6503	53452803	SO:0001583	missense	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1460C>G	X.37:g.53436078G>C	ENSP00000323421:p.Ala487Gly	61	1.61	1		4	88.57	31	53452803	22	75.56	68	O14995|Q16351|Q2M228	Missense_Mutation	SNP	HMMPfam_SMC_N,HMMPfam_SMC_hinge,superfamily_SMC_hinge,superfamily_SSF52540	p.A487G	ENST00000322213.4	37	c.1460	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	G	33	5.219311	0.95139	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	D;D	0.86769	-2.17;-2.17	5.28	5.28	0.74379	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.94499	0.8229	M	0.89478	3.035	0.80722	D	1	D;D;D	0.89917	0.992;1.0;1.0	D;D;D	0.91635	0.983;0.998;0.999	D	0.95423	0.8509	10	0.87932	D	0	.	16.9938	0.86361	0.0:0.0:1.0:0.0	.	253;465;487	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	G	487;253	ENSP00000323421:A487G;ENSP00000364489:A253G	ENSP00000323421:A487G	A	-	2	0	SMC1A	53452803	1.000000	0.71417	0.999000	0.59377	0.791000	0.44710	9.791000	0.99081	2.362000	0.80069	0.600000	0.82982	GCC	-	HMMPfam_SMC_N,superfamily_SMC_hinge,superfamily_SSF52540		0.567	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	protein_coding	OTTHUMT00000056756.2	G	NM_006306		53452803	-1	no_errors	NM_006306.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MED12	9968	genome.wustl.edu	37	X	70356168	70356168	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chrX:70356168G>A	ENST00000374080.3	+	37	5095	c.5063G>A	c.(5062-5064)tGg>tAg	p.W1688*	MED12_ENST00000333646.6_Nonsense_Mutation_p.W1688*|MED12_ENST00000374102.1_Nonsense_Mutation_p.W1688*			Q93074	MED12_HUMAN	mediator complex subunit 12	1688	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					ATCTCGCCCTGGGATCTTTTT	0.517			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0			X											50.0	49.0	49.0					X																	70356168		1897	4121	6018	70272893	SO:0001587	stop_gained	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.5063G>A	X.37:g.70356168G>A	ENSP00000363193:p.Trp1688*	295	0.00	0		2	95.00	38	70272893	40	69.34	95	O15410|O75557|Q9UHV6|Q9UND7	Nonsense_Mutation	SNP	HMMPfam_Med12	p.W1688*	ENST00000374080.3	37	c.5063	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	-	45	11.927492	0.99618	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	.	.	.	4.04	4.04	0.47022	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4503	15.9747	0.80054	0.0:0.0:1.0:0.0	.	.	.	.	X	1688;1688;1688;1688;1656;433	.	ENSP00000333125:W1688X	W	+	2	0	MED12	70272893	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.597000	0.98273	2.020000	0.59435	0.436000	0.28706	TGG	-	NULL		0.517	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	protein_coding	OTTHUMT00000057105.1	G	NM_005120		70272893	+1	no_errors	NM_005120.2	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
UTS2	10911	genome.wustl.edu	37	1	7913480	7913480	+	5'Flank	SNP	G	G	A	rs147322701		TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr1:7913480G>A	ENST00000361696.5	-	0	0				UTS2_ENST00000377516.2_De_novo_Start_OutOfFrame|UTS2_ENST00000054668.5_Silent_p.N4N	NM_006786.3	NP_006777.1	O95399	UTS2_HUMAN	urotensin 2						muscle contraction (GO:0006936)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell differentiation (GO:0045597)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of heart rate (GO:0010460)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to testosterone (GO:0033574)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			kidney(1)|lung(4)|urinary_tract(1)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		GATGAAATACGTTGGTTTCCA	0.418																																						dbGAP											0			1						G		0,4406		0,0,2203	153.0	141.0	145.0		12	1.0	0.0	1	dbSNP_134	145	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	UTS2	NM_021995.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		4/140	7913480	2,13004	2203	4300	6503	7836067	SO:0001631	upstream_gene_variant	0			AF104118	CCDS90.1, CCDS91.1	1p36	2013-02-28			ENSG00000049247	ENSG00000049247		"""Endogenous ligands"""	12636	protein-coding gene	gene with protein product	"""prepro U-II"""	604097				9861051, 10499587	Standard	NM_021995		Approved	UII, U-II, UCN2, PRO1068	uc001aos.3	O95399	OTTHUMG00000001218		1.37:g.7913480G>A	Exception_encountered	162	0.00	0		NA	NA	NA	7836067	130	38.10	80	Q5H8X7|Q6UXF6|Q9UKP7	Silent	SNP	HMMPfam_Urotensin_II,PatternScan_UROTENSIN_II	p.N4	ENST00000361696.5	37	c.12	CCDS91.1	1																																																																																			-	NULL		0.418	UTS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UTS2	protein_coding	OTTHUMT00000003612.1	G	NM_006786		7836067	-1	no_errors	NM_021995.3	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
DNMT3A	1788	genome.wustl.edu	37	2	25467208	25467208	+	Splice_Site	SNP	C	C	T			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr2:25467208C>T	ENST00000264709.3	-	15	2005		c.e15-1		DNMT3A_ENST00000380746.4_Splice_Site|DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000402667.1_Splice_Site|DNMT3A_ENST00000321117.5_Splice_Site	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha						C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAAAAGCACCTGGAAGGAGA	0.617			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0			2											13.0	16.0	15.0					2																	25467208		2200	4299	6499	25320712	SO:0001630	splice_region_variant	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1668-1G>A	2.37:g.25467208C>T		12	0.00	0		7	66.67	14	25320712	10	62.96	17	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Splice_Site	SNP	-	e14-1	ENST00000264709.3	37	c.1668-1	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210946	0.79240	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0531	0.89356	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNMT3A	25320712	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.598000	0.82745	2.584000	0.87258	0.655000	0.94253	.	-	-		0.617	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	C	NM_022552	Intron	25320712	-1	no_errors	NM_022552.3	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
R3HDM1	23518	genome.wustl.edu	37	2	136409334	136409334	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr2:136409334G>A	ENST00000264160.4	+	17	2025	c.1655G>A	c.(1654-1656)aGt>aAt	p.S552N	R3HDM1_ENST00000329971.3_Missense_Mutation_p.S423N|R3HDM1_ENST00000409478.1_Missense_Mutation_p.S424N|R3HDM1_ENST00000409606.1_Missense_Mutation_p.S553N|R3HDM1_ENST00000410054.1_Missense_Mutation_p.S497N	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	552							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		AGCCACATGAGTCTTGCTCGC	0.448																																						dbGAP											0			2											191.0	175.0	181.0					2																	136409334		2203	4300	6503	136125804	SO:0001583	missense	0			D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.1655G>A	2.37:g.136409334G>A	ENSP00000264160:p.Ser552Asn	147	0.68	1		15	60.53	23	136125804	145	34.96	79	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	HMMPfam_R3H,HMMSmart_SM00393,superfamily_R3H domain	p.S552N	ENST00000264160.4	37	c.1655	CCDS2177.1	2	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980663	0.53827	.	.	ENSG00000048991	ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.68	3.84	0.44239	.	0.092388	0.85682	D	0.000000	T	0.67869	0.2939	M	0.62016	1.91	0.34926	D	0.748871	D;B;D;D	0.64830	0.994;0.287;0.993;0.993	D;B;D;D	0.70935	0.971;0.032;0.968;0.968	T	0.73652	-0.3915	10	0.28530	T	0.3	-5.3362	16.2243	0.82283	0.0:0.2487:0.7513:0.0	.	424;553;497;552	G5E9G8;E9PBB4;E9PG42;Q15032	.;.;.;R3HD1_HUMAN	N	424;552;423;497;553	ENSP00000386457:S424N;ENSP00000264160:S552N;ENSP00000331396:S423N;ENSP00000386877:S497N;ENSP00000387010:S553N	ENSP00000264160:S552N	S	+	2	0	R3HDM1	136125804	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.314000	0.51943	0.717000	0.32145	0.561000	0.74099	AGT	-	NULL		0.448	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM1	protein_coding	OTTHUMT00000254659.1	G	NM_015361		136125804	+1	no_errors	NM_015361.2	genbank	human	provisional	54_36p	missense	SNP	1.000	A
IDH1	3417	genome.wustl.edu	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	G	A	rs121913499		TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr2:209113113G>A	ENST00000415913.1	-	4	775	c.394C>T	c.(394-396)Cgt>Tgt	p.R132C	IDH1_ENST00000446179.1_Missense_Mutation_p.R132C|IDH1_ENST00000345146.2_Missense_Mutation_p.R132C	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132C(446)|p.R132G(125)|p.R132S(106)|p.G131_R132>VL(1)|p.R132V(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)	dbGAP		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	679	Substitution - Missense(678)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(280)|central_nervous_system(181)|bone(177)|biliary_tract(21)|soft_tissue(12)|large_intestine(2)|skin(2)|autonomic_ganglia(1)|endometrium(1)|NS(1)|prostate(1)	2											81.0	74.0	76.0					2																	209113113		2203	4300	6503	208821358	SO:0001583	missense	0				CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.394C>T	2.37:g.209113113G>A	ENSP00000390265:p.Arg132Cys	46	0.00	0		31	54.93	39	208821358	84	38.41	53	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R132C	ENST00000415913.1	37	c.394	CCDS2381.1	2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550898	0.86127	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.57	5.57	0.84162	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	H	0.99379	4.54	0.80722	D	1	B	0.29862	0.259	B	0.31245	0.126	D	0.94048	0.7315	10	0.87932	D	0	-20.0399	19.5341	0.95242	0.0:0.0:1.0:0.0	.	132	O75874	IDHC_HUMAN	C	132	ENSP00000260985:R132C;ENSP00000410513:R132C;ENSP00000390265:R132C;ENSP00000391075:R132C	ENSP00000260985:R132C	R	-	1	0	IDH1	208821358	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.074000	0.76791	2.616000	0.88540	0.555000	0.69702	CGT	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.398	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IDH1	protein_coding	OTTHUMT00000336672.1	G			208821358	-1	no_errors	NM_005896.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NCAPG	64151	genome.wustl.edu	37	4	17816953	17816953	+	Silent	SNP	C	C	T			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr4:17816953C>T	ENST00000251496.2	+	5	923	c.747C>T	c.(745-747)ctC>ctT	p.L249L		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	249					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		GAGTAATGCTCCTTCAACAAG	0.313																																						dbGAP											0			4											52.0	53.0	53.0					4																	17816953		2203	4298	6501	17426051	SO:0001819	synonymous_variant	0			AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.747C>T	4.37:g.17816953C>T		66	0.00	0		2	60.00	3	17426051	93	31.65	44	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Silent	SNP	superfamily_ARM-type_fold	p.L249	ENST00000251496.2	37	c.747	CCDS3424.1	4																																																																																			-	superfamily_ARM-type_fold		0.313	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	protein_coding	OTTHUMT00000250375.1	C	NM_022346		17426051	+1	no_errors	NM_022346.3	genbank	human	validated	54_36p	silent	SNP	0.982	T
AGXT2	64902	genome.wustl.edu	37	5	35037117	35037117	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr5:35037117G>T	ENST00000231420.6	-	4	616	c.416C>A	c.(415-417)aCc>aAc	p.T139N	AC010368.1_ENST00000390793.2_RNA	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	139					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GAAGAAGACGGTGCTTGTATG	0.532																																						dbGAP											0			5											111.0	107.0	108.0					5																	35037117		2203	4300	6503	35072874	SO:0001583	missense	0			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.416C>A	5.37:g.35037117G>T	ENSP00000231420:p.Thr139Asn	102	0.00	0		NA	NA	NA	35072874	186	34.95	101	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	HMMPfam_Aminotran_3,PatternScan_AA_TRANSFER_CLASS_3,superfamily_PyrdxlP-dep_Trfase_major	p.T139N	ENST00000231420.6	37	c.416	CCDS3908.1	5	.	.	.	.	.	.	.	.	.	.	G	0.541	-0.853481	0.02630	.	.	ENSG00000113492	ENST00000231420	T	0.18657	2.2	5.7	2.75	0.32379	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	1.219660	0.05567	N	0.570478	T	0.07052	0.0179	N	0.00815	-1.16	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.0;0.003;0.001	T	0.30179	-0.9987	10	0.10902	T	0.67	-18.7379	8.6427	0.33987	0.0:0.3624:0.3717:0.2659	.	47;139;139	B7Z3M3;E9PDL7;Q9BYV1	.;.;AGT2_HUMAN	N	139	ENSP00000231420:T139N	ENSP00000231420:T139N	T	-	2	0	AGXT2	35072874	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.726000	0.25984	0.730000	0.32425	0.650000	0.86243	ACC	-	HMMPfam_Aminotran_3,superfamily_PyrdxlP-dep_Trfase_major		0.532	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	protein_coding	OTTHUMT00000207574.2	G	NM_031900		35072874	-1	no_errors	NM_031900.2	genbank	human	reviewed	54_36p	missense	SNP	0.001	T
EDIL3	10085	genome.wustl.edu	37	5	83402506	83402506	+	Silent	SNP	C	C	T			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr5:83402506C>T	ENST00000296591.5	-	6	1030	c.612G>A	c.(610-612)gcG>gcA	p.A204A	EDIL3_ENST00000380138.3_Silent_p.A194A	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	204	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		CAGCTGTCCACGCATTTATAA	0.418																																						dbGAP											0			5											170.0	162.0	165.0					5																	83402506		2203	4300	6503	83438262	SO:0001819	synonymous_variant	0			U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.612G>A	5.37:g.83402506C>T		64	0.00	0		NA	NA	NA	83438262	193	16.74	39	B2R763|O43855|Q5D094|Q8N610	Silent	SNP	PatternScan_ASX_HYDROXYL,HMMPfam_F5_F8_type_C,HMMSmart_SM00231,PatternScan_FA58C_1,PatternScan_FA58C_2,HMMSmart_SM00179,HMMPfam_EGF,HMMSmart_SM00181,superfamily_Galactose-binding domain-like,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,superfamily_EGF/Laminin	p.A204	ENST00000296591.5	37	c.612	CCDS4062.1	5																																																																																			-	HMMPfam_F5_F8_type_C,HMMSmart_SM00231,PatternScan_FA58C_1,superfamily_Galactose-binding domain-like		0.418	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EDIL3	protein_coding	OTTHUMT00000239258.1	C	NM_005711		83438262	-1	no_errors	NM_005711.3	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PCDHB6	56130	genome.wustl.edu	37	5	140530312	140530312	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr5:140530312T>A	ENST00000231136.1	+	1	474	c.474T>A	c.(472-474)gaT>gaA	p.D158E	PCDHB6_ENST00000543635.1_Missense_Mutation_p.D22E	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	158	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCACACGATTTAGACACCG	0.498																																						dbGAP											0			5											145.0	155.0	152.0					5																	140530312		2203	4300	6503	140510496	SO:0001583	missense	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.474T>A	5.37:g.140530312T>A	ENSP00000231136:p.Asp158Glu	51	0.00	0		NA	NA	NA	140510496	82	43.54	64	B2R8R9	Missense_Mutation	SNP	HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin	p.D158E	ENST00000231136.1	37	c.474	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	T	14.05	2.420183	0.42918	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.80214	-1.35;1.02	4.85	2.44	0.29823	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.93426	0.7903	H	0.99368	4.535	0.27296	N	0.957717	D	0.89917	1.0	D	0.97110	1.0	D	0.85036	0.0920	9	0.87932	D	0	.	8.584	0.33646	0.0:0.2391:0.0:0.7609	.	158	Q9Y5E3	PCDB6_HUMAN	E	22;158	ENSP00000438466:D22E;ENSP00000231136:D158E	ENSP00000231136:D158E	D	+	3	2	PCDHB6	140510496	0.057000	0.20700	0.991000	0.47740	0.194000	0.23727	0.343000	0.19944	0.302000	0.22762	0.459000	0.35465	GAT	-	HMMPfam_Cadherin,HMMSmart_CA,superfamily_Cadherin		0.498	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	protein_coding	OTTHUMT00000251818.2	T	NM_018939		140510496	+1	no_errors	NM_018939.2	genbank	human	reviewed	54_36p	missense	SNP	0.982	A
GCM2	9247	genome.wustl.edu	37	6	10877388	10877388	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr6:10877388G>A	ENST00000379491.4	-	2	475	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	110			R -> W (in FIH; abolishes DNA binding ability). {ECO:0000269|PubMed:20190276, ECO:0000269|Ref.3}.		cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				TGTTTCAGCCGTGCCTTGTCG	0.562																																						dbGAP											0			6											83.0	78.0	80.0					6																	10877388		2203	4300	6503	10985374	SO:0001583	missense	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.328C>T	6.37:g.10877388G>A	ENSP00000368805:p.Arg110Trp	83	0.00	0		NA	NA	NA	10985374	88	40.67	61	D3GDV6|Q5THN5	Missense_Mutation	SNP	HMMPfam_GCM,superfamily_GCM_motif	p.R110W	ENST00000379491.4	37	c.328	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566565	0.65651	.	.	ENSG00000124827	ENST00000379491	T	0.80994	-1.44	5.69	-5.0	0.03001	.	0.000000	0.85682	D	0.000000	D	0.87204	0.6119	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88860	0.3325	10	0.87932	D	0	-21.0508	20.752	0.99720	0.0:0.0:0.2563:0.7437	.	110	O75603	GCM2_HUMAN	W	110	ENSP00000368805:R110W	ENSP00000368805:R110W	R	-	1	2	GCM2	10985374	0.973000	0.33851	0.001000	0.08648	0.840000	0.47671	1.664000	0.37439	-0.950000	0.03659	-0.175000	0.13238	CGG	-	HMMPfam_GCM,superfamily_GCM_motif		0.562	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	protein_coding	OTTHUMT00000039844.1	G			10985374	-1	no_errors	NM_004752.3	genbank	human	reviewed	54_36p	missense	SNP	0.850	A
ITPR3	3710	genome.wustl.edu	37	6	33657121	33657121	+	Silent	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr6:33657121G>A	ENST00000374316.5	+	51	7861	c.6801G>A	c.(6799-6801)gcG>gcA	p.A2267A	ITPR3_ENST00000605930.1_Silent_p.A2267A			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2267					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TCATCGTGGCGCTCATCCTGC	0.587																																						dbGAP											0			6											121.0	102.0	109.0					6																	33657121		2203	4300	6503	33765099	SO:0001819	synonymous_variant	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6801G>A	6.37:g.33657121G>A		110	0.00	0		4	42.86	3	33765099	75	35.90	42	Q14649|Q5TAQ2	Silent	SNP	HMMPfam_RYDR_ITPR,HMMPfam_MIR,superfamily_MIR,HMMPfam_Ion_trans,HMMPfam_RIH_assoc,HMMPfam_Ins145_P3_rec,HMMSmart_MIR,superfamily_SSF100909	p.A2267	ENST00000374316.5	37	c.6801	CCDS4783.1	6																																																																																			-	NULL		0.587	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	protein_coding	OTTHUMT00000040204.2	G	NM_002224		33765099	+1	no_errors	NM_002224.2	genbank	human	validated	54_36p	silent	SNP	0.185	A
TMEM200A	114801	genome.wustl.edu	37	6	130762082	130762082	+	Missense_Mutation	SNP	C	C	T	rs149308469	byFrequency	TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr6:130762082C>T	ENST00000296978.3	+	3	1386	c.515C>T	c.(514-516)aCg>aTg	p.T172M	TMEM200A_ENST00000545622.1_Missense_Mutation_p.T172M|TMEM200A_ENST00000392429.1_Missense_Mutation_p.T172M	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	172						integral component of membrane (GO:0016021)		p.T172K(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GACATTCACACGCTAAGAATC	0.413																																						dbGAP											2	Substitution - Missense(2)	lung(2)	6						C	MET/THR	0,4406		0,0,2203	101.0	92.0	95.0		515	4.7	0.8	6	dbSNP_134	95	2,8598	2.2+/-6.3	0,2,4298	yes	missense	TMEM200A	NM_052913.2	81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	172/492	130762082	2,13004	2203	4300	6503	130803775	SO:0001583	missense	0			AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.515C>T	6.37:g.130762082C>T	ENSP00000296978:p.Thr172Met	126	0.00	0		1	0.00	0	130803775	363	17.05	75	Q96PX5	Missense_Mutation	SNP	HMMPfam_DUF2371	p.T172M	ENST00000296978.3	37	c.515	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	C	14.49	2.552143	0.45487	0.0	2.33E-4	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.6	4.73	0.59995	.	0.272658	0.38720	N	0.001594	T	0.41373	0.1156	L	0.47716	1.5	0.37677	D	0.923347	D	0.67145	0.996	P	0.50791	0.65	T	0.50180	-0.8858	9	0.72032	D	0.01	.	10.1155	0.42587	0.0:0.7916:0.1365:0.0718	.	172	Q86VY9	T200A_HUMAN	M	172	.	ENSP00000296978:T172M	T	+	2	0	TMEM200A	130803775	0.997000	0.39634	0.768000	0.31515	0.838000	0.47535	2.950000	0.49081	1.369000	0.46134	-0.140000	0.14226	ACG	-	NULL		0.413	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	protein_coding	OTTHUMT00000042201.1	C	NM_052913		130803775	+1	no_errors	NM_052913.2	genbank	human	provisional	54_36p	missense	SNP	0.961	T
WRN	7486	genome.wustl.edu	37	8	31004933	31004933	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr8:31004933G>A	ENST00000298139.5	+	30	3762	c.3513G>A	c.(3511-3513)atG>atA	p.M1171I		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1171	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CCAATAAAATGGATGTTCCCC	0.343			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)	dbGAP	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0			8											102.0	102.0	102.0					8																	31004933		2203	4300	6503	31124475	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.3513G>A	8.37:g.31004933G>A	ENSP00000298139:p.Met1171Ile	47	0.00	0		45	38.36	28	31124475	294	28.61	119	A1KYY9	Missense_Mutation	SNP	HMMPfam_Helicase_C,HMMSmart_SM00490,HMMPfam_HRDC,HMMSmart_SM00341,HMMPfam_3_5_exonuc,HMMSmart_SM00474,HMMPfam_DEAD,superfamily_Ribonuclease H-like,HMMSmart_SM00487,HMMPfam_RQC,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.M1171I	ENST00000298139.5	37	c.3513	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	6.512	0.462650	0.12402	.	.	ENSG00000165392	ENST00000298139	T	0.42131	0.98	5.17	4.29	0.51040	HRDC-like (1);Helicase/RNase D C-terminal, HRDC domain (3);	0.246154	0.41500	D	0.000872	T	0.30572	0.0769	L	0.38175	1.15	0.31511	N	0.66359	B;B	0.19817	0.008;0.039	B;B	0.25506	0.011;0.061	T	0.29243	-1.0018	10	0.19590	T	0.45	-4.628	8.5578	0.33492	0.0775:0.0:0.7687:0.1538	.	581;1171	Q59F09;Q14191	.;WRN_HUMAN	I	1171	ENSP00000298139:M1171I	ENSP00000298139:M1171I	M	+	3	0	WRN	31124475	0.999000	0.42202	0.566000	0.28421	0.421000	0.31385	1.489000	0.35562	1.286000	0.44565	0.655000	0.94253	ATG	-	HMMPfam_HRDC,HMMSmart_SM00341		0.343	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	protein_coding	OTTHUMT00000376248.1	G			31124475	+1	no_errors	NM_000553.4	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
GRID1	2894	genome.wustl.edu	37	10	87379759	87379759	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr10:87379759T>A	ENST00000327946.7	-	14	2310	c.2225A>T	c.(2224-2226)gAt>gTt	p.D742V	GRID1_ENST00000536331.1_Missense_Mutation_p.D313V	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	742					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CACGGCCACATCCCACAGGAA	0.552										Multiple Myeloma(13;0.14)																												dbGAP											0			10											125.0	90.0	101.0					10																	87379759		2203	4300	6503	87369739	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2225A>T	10.37:g.87379759T>A	ENSP00000330148:p.Asp742Val	98	0.00	0		2	0.00	0	87369739	98	37.18	58	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	HMMPfam_Lig_chan,HMMSmart_SM00079,HMMPfam_ANF_receptor,PatternScan_ALDEHYDE_DEHYDR_GLU,HMMPfam_Lig_chan-Glu_bd,superfamily_Periplasmic binding protein-like I,superfamily_Periplasmic binding protein-like II	p.D742V	ENST00000327946.7	37	c.2225	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	T	25.4	4.635353	0.87760	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.19105	2.17;2.17	5.28	5.28	0.74379	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66329	-0.5951	10	0.87932	D	0	.	14.3972	0.67020	0.0:0.0:0.0:1.0	.	742	Q9ULK0	GRID1_HUMAN	V	742;313	ENSP00000330148:D742V;ENSP00000444455:D313V	ENSP00000330148:D742V	D	-	2	0	GRID1	87369739	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.004000	0.88535	1.987000	0.57996	0.459000	0.35465	GAT	-	HMMPfam_Lig_chan,HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II		0.552	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	protein_coding	OTTHUMT00000049148.3	T	XM_043613		87369739	-1	no_errors	NM_017551.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LRRC43	254050	genome.wustl.edu	37	12	122677521	122677521	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr12:122677521G>A	ENST00000339777.4	+	7	1347	c.1319G>A	c.(1318-1320)cGt>cAt	p.R440H	LRRC43_ENST00000425921.1_Missense_Mutation_p.R255H	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	440										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		TTGAGGCTGCGTATAGATCCC	0.597																																						dbGAP											0			12											44.0	48.0	47.0					12																	122677521		2007	4171	6178	121243474	SO:0001583	missense	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1319G>A	12.37:g.122677521G>A	ENSP00000344233:p.Arg440His	129	0.77	1		NA	NA	NA	121243474	42	36.36	24	Q6ZVT9	Missense_Mutation	SNP	superfamily_Outer arm dynein light chain 1	p.R440H	ENST00000339777.4	37	c.1319	CCDS45001.1	12	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941357	0.53079	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.56444	0.46;0.87	4.68	-3.94	0.04130	.	1.350510	0.04837	N	0.439821	T	0.38321	0.1036	L	0.45581	1.43	0.09310	N	1	B	0.17465	0.022	B	0.14578	0.011	T	0.26224	-1.0109	10	0.42905	T	0.14	-5.3269	0.524	0.00617	0.2624:0.127:0.2239:0.3867	.	440	Q8N309	LRC43_HUMAN	H	440;311;255	ENSP00000344233:R440H;ENSP00000416628:R255H	ENSP00000289014:R311H	R	+	2	0	LRRC43	121243474	0.000000	0.05858	0.000000	0.03702	0.849000	0.48306	-1.719000	0.01873	-0.369000	0.08028	0.561000	0.74099	CGT	-	NULL		0.597	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	protein_coding	OTTHUMT00000401589.1	G	NM_152759		121243474	+1	no_errors	NM_001098519.1	genbank	human	validated	54_36p	missense	SNP	0.000	A
LEO1	123169	genome.wustl.edu	37	15	52230383	52230383	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr15:52230383G>C	ENST00000299601.5	-	12	2031	c.1971C>G	c.(1969-1971)atC>atG	p.I657M	LEO1_ENST00000315141.5_Missense_Mutation_p.I597M	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	657					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		CTTCATCGCTGATCACATACT	0.284																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	dbGAP											0			15											180.0	148.0	159.0					15																	52230383		2194	4293	6487	50017675	SO:0001583	missense	0			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1971C>G	15.37:g.52230383G>C	ENSP00000299601:p.Ile657Met	337	0.59	2		24	45.45	20	50017675	160	39.62	105	Q96N99	Missense_Mutation	SNP	HMMPfam_Leo1	p.I657M	ENST00000299601.5	37	c.1971	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	.	16.53	3.150161	0.57151	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.19	1.09	0.20402	.	0.000000	0.85682	D	0.000000	T	0.56717	0.2004	L	0.39898	1.24	0.48185	D	0.999604	D;D	0.69078	0.997;0.997	D;D	0.83275	0.994;0.996	T	0.54476	-0.8288	9	0.66056	D	0.02	.	5.6741	0.17739	0.2828:0.0:0.589:0.1282	.	597;657	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	M	657;635;597	.	ENSP00000299601:I657M	I	-	3	3	LEO1	50017675	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.697000	0.37784	0.275000	0.22094	0.650000	0.86243	ATC	-	NULL		0.284	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	protein_coding	OTTHUMT00000254791.2	G	NM_138792		50017675	-1	no_errors	NM_138792.2	genbank	human	provisional	54_36p	missense	SNP	1.000	C
SYT17	51760	genome.wustl.edu	37	16	19236085	19236085	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr16:19236085G>C	ENST00000355377.2	+	7	1551	c.1153G>C	c.(1153-1155)Gat>Cat	p.D385H	SYT17_ENST00000568433.1_Missense_Mutation_p.D79H|SYT17_ENST00000562034.1_Missense_Mutation_p.D324H|SYT17_ENST00000562711.2_Missense_Mutation_p.D381H|SYT17_ENST00000568115.1_Missense_Mutation_p.D324H	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII	385	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						GGGCACAATTGATCCTTTCTA	0.433																																						dbGAP											0			16											132.0	128.0	129.0					16																	19236085		2197	4300	6497	19143586	SO:0001583	missense	0				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.1153G>C	16.37:g.19236085G>C	ENSP00000347538:p.Asp385His	363	0.00	0		NA	NA	NA	19143586	291	35.25	159	O43330|Q9NZ18	Missense_Mutation	SNP	HMMPfam_C2,HMMSmart_C2,superfamily_C2_CaLB	p.D385H	ENST00000355377.2	37	c.1153	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782149	0.31502	.	.	ENSG00000103528	ENST00000355377	T	0.69435	-0.4	5.29	5.29	0.74685	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000006	T	0.77705	0.4170	L	0.41961	1.31	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.79784	0.989;0.993	T	0.79759	-0.1668	10	0.87932	D	0	.	18.9333	0.92576	0.0:0.0:1.0:0.0	.	385;324	Q9BSW7;B4DJB2	SYT17_HUMAN;.	H	385	ENSP00000347538:D385H	ENSP00000347538:D385H	D	+	1	0	SYT17	19143586	1.000000	0.71417	0.979000	0.43373	0.950000	0.60333	6.542000	0.73869	2.472000	0.83506	0.561000	0.74099	GAT	-	HMMPfam_C2,HMMSmart_C2,superfamily_C2_CaLB		0.433	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	protein_coding	OTTHUMT00000254286.2	G	NM_016524		19143586	+1	no_errors	NM_016524.2	genbank	human	validated	54_36p	missense	SNP	0.989	C
TMEM231	79583	genome.wustl.edu	37	16	75576547	75576547	+	Missense_Mutation	SNP	T	T	C	rs374279951		TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr16:75576547T>C	ENST00000258173.6	-	5	693	c.617A>G	c.(616-618)tAt>tGt	p.Y206C	RP11-77K12.7_ENST00000460606.1_Missense_Mutation_p.M38V|TMEM231_ENST00000569294.1_5'UTR|TMEM231_ENST00000568377.1_Missense_Mutation_p.Y235C|TMEM231_ENST00000565067.1_Missense_Mutation_p.Y158C|RP11-77K12.8_ENST00000564489.1_RNA	NM_001077418.1	NP_001070886.1	Q9H6L2	TM231_HUMAN	transmembrane protein 231	206					cilium assembly (GO:0042384)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GTCGTAGTCATAGGCAAAGGG	0.552																																						dbGAP											0			16						T	CYS/TYR,CYS/TYR,CYS/TYR	1,4009		0,1,2004	106.0	105.0	106.0		704,617,269	-7.5	0.0	16		106	0,8346		0,0,4173	no	missense,missense,missense	TMEM231	NM_001077416.1,NM_001077418.1,NM_001077419.1	194,194,194	0,1,6177	CC,CT,TT		0.0,0.0249,0.0081	benign,benign,benign	235/346,206/317,90/201	75576547	1,12355	2005	4173	6178	74134048	SO:0001583	missense	0				CCDS45530.1	16q23.1	2014-01-28			ENSG00000205084	ENSG00000205084			37234	protein-coding gene	gene with protein product		614949				23012439	Standard	NM_001077416		Approved	FLJ22167, ALYE870, PRO1886, JBTS20, MKS11	uc002fek.4	Q9H6L2		ENST00000258173.6:c.617A>G	16.37:g.75576547T>C	ENSP00000258173:p.Tyr206Cys	127	0.00	0		2	50.00	2	74134048	51	35.80	29	A0JLU1|A6NDZ6|B3KU85|G5E9E3|Q6P450|Q6UWW5	Missense_Mutation	SNP	HMMPfam_NAcGluc_Transf	p.Y235C	ENST00000258173.6	37	c.704	CCDS45530.1	16	.	.	.	.	.	.	.	.	.	.	T	8.300	0.819780	0.16678	2.49E-4	0.0	ENSG00000205084	ENST00000258173;ENST00000398114	T;T	0.62941	-0.01;-0.01	4.33	-7.47	0.01365	.	0.566652	0.18405	N	0.142240	T	0.31389	0.0795	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.001	B;B;B	0.08055	0.003;0.002;0.002	T	0.07578	-1.0765	10	0.51188	T	0.08	26.6252	8.0951	0.30824	0.0:0.6585:0.1073:0.2342	.	235;206;235	B3KU85;Q9H6L2;G5E9E3	.;TM231_HUMAN;.	C	206;235	ENSP00000258173:Y206C;ENSP00000381184:Y235C	ENSP00000258173:Y206C	Y	-	2	0	TMEM231	74134048	0.000000	0.05858	0.000000	0.03702	0.290000	0.27261	-0.190000	0.09615	-1.328000	0.02261	0.383000	0.25322	TAT	-	HMMPfam_NAcGluc_Transf		0.552	TMEM231-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	FLJ22167	protein_coding	OTTHUMT00000435481.2	T	NM_001077416		74134048	-1	no_errors	NM_001077416.1	genbank	human	validated	54_36p	missense	SNP	0.061	C
WSCD1	23302	genome.wustl.edu	37	17	6023811	6023811	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr17:6023811G>A	ENST00000574946.1	+	9	1948	c.1558G>A	c.(1558-1560)Gtg>Atg	p.V520M	WSCD1_ENST00000574232.1_Missense_Mutation_p.V520M|WSCD1_ENST00000539421.1_Missense_Mutation_p.V520M|WSCD1_ENST00000317744.5_Missense_Mutation_p.V520M|WSCD1_ENST00000573634.1_Missense_Mutation_p.V404M			Q658N2	WSCD1_HUMAN	WSC domain containing 1	520						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						GCTGCTCTGCGTGGAGAACAA	0.642																																						dbGAP											0			17											66.0	64.0	65.0					17																	6023811		2203	4300	6503	5964535	SO:0001583	missense	0				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1558G>A	17.37:g.6023811G>A	ENSP00000460825:p.Val520Met	36	0.00	0		NA	NA	NA	5964535	87	14.71	15	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	HMMPfam_WSC,HMMSmart_WSC,superfamily_SSF52540	p.V520M	ENST00000574946.1	37	c.1558	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	G	28.9	4.959768	0.92791	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.36157	1.27;1.27	5.54	5.54	0.83059	.	0.056568	0.64402	D	0.000001	T	0.61362	0.2341	M	0.76170	2.325	0.50313	D	0.999867	D	0.89917	1.0	D	0.73380	0.98	T	0.64558	-0.6379	10	0.87932	D	0	-31.5714	16.9738	0.86308	0.0:0.0:1.0:0.0	.	520	Q658N2	WSCD1_HUMAN	M	520	ENSP00000323087:V520M;ENSP00000446032:V520M	ENSP00000323087:V520M	V	+	1	0	WSCD1	5964535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.438000	0.97539	2.606000	0.88127	0.655000	0.94253	GTG	-	superfamily_SSF52540		0.642	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	protein_coding	OTTHUMT00000438965.4	G	NM_015253		5964535	+1	no_errors	NM_015253.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
MYH4	4622	genome.wustl.edu	37	17	10360864	10360864	+	Silent	SNP	G	G	A			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr17:10360864G>A	ENST00000255381.2	-	16	1880	c.1770C>T	c.(1768-1770)gaC>gaT	p.D590D	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	590	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						CGATGTTGTAGTCCACGGTGC	0.532																																						dbGAP											0			17											122.0	121.0	121.0					17																	10360864		2203	4300	6503	10301589	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1770C>T	17.37:g.10360864G>A		58	0.00	0		NA	NA	NA	10301589	91	34.75	49		Silent	SNP	HMMSmart_IQ,HMMPfam_Myosin_head,HMMSmart_MYSc,HMMPfam_Myosin_tail_1,HMMPfam_Myosin_N,superfamily_SSF52540	p.D590	ENST00000255381.2	37	c.1770	CCDS11154.1	17																																																																																			-	HMMPfam_Myosin_head,HMMSmart_MYSc,superfamily_SSF52540		0.532	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	G	NM_017533		10301589	-1	no_errors	NM_017533.2	genbank	human	validated	54_36p	silent	SNP	1.000	A
C3P1	388503	genome.wustl.edu	37	19	10158021	10158021	+	RNA	SNP	C	C	T			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr19:10158021C>T	ENST00000495140.1	+	0	1229							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						CCCCTTTGAGCTGACAGTTAT	0.527																																						dbGAP											0			19											172.0	165.0	168.0					19																	10158021		1999	4169	6168	10019021			0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10158021C>T		414	0.00	0		NA	NA	NA	10019021	152	33.04	75		Silent	SNP	HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_A2M_comp	p.L62	ENST00000495140.1	37	c.184		19																																																																																			-	HMMPfam_A2M		0.527	C3P1-002	KNOWN	basic	processed_transcript	uc010dwx.1	pseudogene	OTTHUMT00000351284.1	C	NR_027300		10019021	+1	no_errors	ENST00000333905	ensembl	human	known	54_36p	silent	SNP	0.997	T
PRKRIRP1	728748	genome.wustl.edu	37	X	73619165	73619166	+	IGR	INS	-	-	CTTGAAGAACTGTC			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	-	-	-	CTTGAAGAACTGTC	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chrX:73619165_73619166insCTTGAAGAACTGTC								RN7SL790P (8343 upstream) : SLC16A2 (21918 downstream)																							TATTACATTATCTATAAGGACT	0.351														1957	0.518411	0.4054	0.1844	3775	,	,		12194	0.7242		0.2276	False		,,,				2504	0.3415					dbGAP											0			X																																								73535891	SO:0001628	intergenic_variant	0																															X.37:g.73619165_73619166insCTTGAAGAACTGTC		NA	NA	NA		NA	NA	NA	73535890	NA	NA	NA		RNA	INS	-	NULL		37	NULL		X																																																																																			-	-	0	0.351					LOC728748			-			73535891	-1	pseudogene	XR_037583.1	genbank	human	model	54_36p	rna	INS	1.000:0.993	CTTGAAGAACTGTC
TET2	54790	genome.wustl.edu	37	4	106156043	106156043	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AB-2822-03D-01W-0755-09	TCGA-AB-2822-11D-01W-0755-09	C	C	C	-	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	68b67026-2f30-4839-8579-7a07341b8976	55451b4d-c9af-477d-acdd-d6749bf27f2f	g.chr4:106156043delC	ENST00000540549.1	+	3	1804	c.944delC	c.(943-945)tccfs	p.S315fs	TET2_ENST00000394764.1_Frame_Shift_Del_p.S315fs|TET2_ENST00000413648.2_Frame_Shift_Del_p.S315fs|TET2_ENST00000305737.2_Frame_Shift_Del_p.S315fs|TET2_ENST00000513237.1_Frame_Shift_Del_p.S336fs|TET2_ENST00000380013.4_Frame_Shift_Del_p.S315fs|TET2_ENST00000545826.1_Frame_Shift_Del_p.S315fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	315					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.S315fs*31(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		AATACCTGTTCCTTTCAGAAA	0.448			"""Mis N, F"""		MDS																																	dbGAP		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	4											86.0	82.0	84.0					4																	106156043		2203	4300	6503	106375492	SO:0001589	frameshift_variant	0			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.944delC	4.37:g.106156043delC	ENSP00000442788:p.Ser315fs	191	1.55	3		28	30.95	13	106375492	240	36.46	140	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	NULL	p.Q317fs	ENST00000540549.1	37	c.944	CCDS47120.1	4																																																																																			-	NULL		0.448	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106375492	+1	no_errors	NM_017628.1	genbank	human	validated	54_36p	frame_shift_del	DEL	0.998	-
