#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
GJB4	127534	genome.wustl.edu	37	1	35227148	35227148	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr1:35227148G>A	ENST00000339480.1	+	2	663	c.293G>A	c.(292-294)cGc>cAc	p.R98H	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	98					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GTGGCCTACCGCGAGGAACGC	0.637																																						dbGAP											0			1											86.0	65.0	72.0					1																	35227148		2203	4300	6503	34999735	SO:0001583	missense	0				CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.293G>A	1.37:g.35227148G>A	ENSP00000345868:p.Arg98His	49	3.92	2		NA	NA	NA	34999735	69	42.15	51	B3KQ82	Missense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_SM00037,PatternScan_CONNEXINS_1,PatternScan_CONNEXINS_2,HMMPfam_Connexin_CCC	p.R98H	ENST00000339480.1	37	c.293	CCDS383.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423700	0.83559	.	.	ENSG00000189433	ENST00000339480	D	0.99129	-5.46	5.73	4.82	0.62117	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98902	0.9628	M	0.77103	2.36	0.42241	D	0.991933	D	0.76494	0.999	P	0.57204	0.815	D	0.99100	1.0843	10	0.52906	T	0.07	.	14.3259	0.66521	0.0717:0.0:0.9283:0.0	.	98	Q9NTQ9	CXB4_HUMAN	H	98	ENSP00000345868:R98H	ENSP00000345868:R98H	R	+	2	0	GJB4	34999735	0.868000	0.29978	0.878000	0.34440	0.479000	0.33129	4.164000	0.58190	1.445000	0.47624	0.655000	0.94253	CGC	-	HMMPfam_Connexin		0.637	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB4	protein_coding	OTTHUMT00000011560.1	G	NM_153212		34999735	+1	no_errors	NM_153212.1	genbank	human	validated	54_36p	missense	SNP	0.975	A
SLC9B1P2	389000	genome.wustl.edu	37	2	92076569	92076569	+	IGR	SNP	A	A	G	rs200200304		TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr2:92076569A>G								AC027612.2 (124525 upstream) : SLC9B1P2 (3928 downstream)																							ACCAAAAAGAAGTGGTTGAAA	0.259																																						dbGAP											0			2																																								91440296	SO:0001628	intergenic_variant	0																															2.37:g.92076569A>G		30	3.23	1		1	0.00	0	91440296	78	18.75	18		Missense_Mutation	SNP	HMMPfam_Na_H_Exchanger	p.L377P		37	c.1130		2																																																																																			-	HMMPfam_Na_H_Exchanger	0	0.259					LOC389000			A			91440296	-1	pseudogene	XM_371534.1	genbank	human	model	54_36p	missense	SNP	1.000	G
ZNF394	84124	genome.wustl.edu	37	7	99091249	99091249	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr7:99091249C>T	ENST00000337673.6	-	3	1792	c.1589G>A	c.(1588-1590)tGt>tAt	p.C530Y	ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000394177.3_5'Flank|ZNF789_ENST00000494186.1_Intron|ZNF394_ENST00000426306.2_3'UTR	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	530					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TCTTTCCCCACATTCAAGACA	0.448																																					Ovarian(24;589 697 9939 12704 40742)	dbGAP											0			7											182.0	177.0	178.0					7																	99091249		2203	4300	6503	98929185	SO:0001583	missense	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1589G>A	7.37:g.99091249C>T	ENSP00000337363:p.Cys530Tyr	281	6.64	20		86	52.22	94	98929185	153	37.90	94	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_SCAN,HMMSmart_SM00431,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.C530Y	ENST00000337673.6	37	c.1589	CCDS5666.1	7	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909213	0.72868	.	.	ENSG00000160908	ENST00000337673	D	0.85861	-2.04	3.58	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000094	D	0.94095	0.8107	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95322	0.8421	10	0.87932	D	0	.	13.493	0.61407	0.0:1.0:0.0:0.0	.	530	Q53GI3	ZN394_HUMAN	Y	530	ENSP00000337363:C530Y	ENSP00000337363:C530Y	C	-	2	0	ZNF394	98929185	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.638000	0.67861	2.292000	0.77174	0.655000	0.94253	TGT	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.448	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	protein_coding	OTTHUMT00000336498.1	C	NM_032164		98929185	-1	no_errors	NM_032164.2	genbank	human	provisional	54_36p	missense	SNP	1.000	T
ZC3HC1	51530	genome.wustl.edu	37	7	129666032	129666032	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr7:129666032C>T	ENST00000358303.4	-	6	826	c.742G>A	c.(742-744)Gcc>Acc	p.A248T	RP11-306G20.1_ENST00000587038.1_RNA|ZC3HC1_ENST00000360708.5_Missense_Mutation_p.A248T|RP11-306G20.1_ENST00000480018.1_RNA|RNA5SP245_ENST00000364239.1_RNA|ZC3HC1_ENST00000481503.1_Missense_Mutation_p.A248T|ZC3HC1_ENST00000311873.5_Missense_Mutation_p.A227T	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	248					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					AGAATACAGGCAGTGACGTGG	0.448																																					Melanoma(115;540 1606 16325 28853 48167)	dbGAP											0			7											210.0	186.0	194.0					7																	129666032		2203	4300	6503	129453268	SO:0001583	missense	0			AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.742G>A	7.37:g.129666032C>T	ENSP00000351052:p.Ala248Thr	62	6.06	4		13	53.57	15	129453268	47	43.68	38	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	HMMPfam_zf-C3HC	p.A248T	ENST00000358303.4	37	c.742	CCDS34753.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.420231	0.96111	.	.	ENSG00000091732	ENST00000358303;ENST00000360708;ENST00000311873;ENST00000481503	T;T;T;T	0.57273	0.41;0.41;0.41;0.64	6.06	6.06	0.98353	Nuclear-interacting partner of ALK/Rsm1-like (1);	0.000000	0.85682	D	0.000000	T	0.73567	0.3603	M	0.71581	2.175	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.982;0.999;0.998	T	0.73350	-0.4010	10	0.62326	D	0.03	-21.245	19.1921	0.93671	0.0:1.0:0.0:0.0	.	248;248;248	Q86WB0-3;Q86WB0;C9J0I9	.;NIPA_HUMAN;.	T	248;248;227;248	ENSP00000351052:A248T;ENSP00000353933:A248T;ENSP00000309301:A227T;ENSP00000418533:A248T	ENSP00000309301:A227T	A	-	1	0	ZC3HC1	129453268	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.373000	0.66162	2.871000	0.98454	0.655000	0.94253	GCC	-	NULL		0.448	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HC1	protein_coding	OTTHUMT00000349316.1	C	NM_016478		129453268	-1	no_errors	NM_016478.3	genbank	human	validated	54_36p	missense	SNP	1.000	T
PTAR1	375743	genome.wustl.edu	37	9	72347215	72347215	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr9:72347215G>A	ENST00000340434.4	-	5	485	c.482C>T	c.(481-483)aCc>aTc	p.T161I	PTAR1_ENST00000377200.5_Missense_Mutation_p.T82I	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	161					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						GTTTCCTTTGGTCACAAAGGA	0.483																																						dbGAP											0			9											115.0	107.0	110.0					9																	72347215		1934	4142	6076	71537035	SO:0001583	missense	0			BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.482C>T	9.37:g.72347215G>A	ENSP00000344299:p.Thr161Ile	97	6.73	7		7	53.33	8	71537035	97	47.31	88	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	HMMPfam_PPTA,superfamily_Prenyl_trans	p.T161I	ENST00000340434.4	37	c.482	CCDS47978.1	9	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778341	0.31502	.	.	ENSG00000188647	ENST00000377200;ENST00000340434	.	.	.	6.17	1.75	0.24633	Protein prenyltransferase (1);	0.786318	0.12701	N	0.446378	T	0.28034	0.0691	L	0.29908	0.895	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.18777	-1.0326	9	0.37606	T	0.19	-7.4057	6.6672	0.23047	0.0606:0.1715:0.5105:0.2574	.	161	Q7Z6K3	PTAR1_HUMAN	I	82;161	.	ENSP00000344299:T161I	T	-	2	0	PTAR1	71537035	0.954000	0.32549	0.967000	0.41034	0.985000	0.73830	0.142000	0.16096	0.443000	0.26582	0.655000	0.94253	ACC	-	superfamily_Prenyl_trans		0.483	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTAR1	protein_coding	OTTHUMT00000052582.4	G	NM_001099666		71537035	-1	no_errors	NM_001099666.1	genbank	human	validated	54_36p	missense	SNP	0.715	A
PLEKHH1	57475	genome.wustl.edu	37	14	68040536	68040536	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr14:68040536C>T	ENST00000329153.5	+	13	1990	c.1858C>T	c.(1858-1860)Cct>Tct	p.P620S		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	620	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CATCCGGAAACCTCAAGGCCA	0.502																																						dbGAP											0			14											87.0	84.0	85.0					14																	68040536		1918	4141	6059	67110289	SO:0001583	missense	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1858C>T	14.37:g.68040536C>T	ENSP00000330278:p.Pro620Ser	100	7.41	8		NA	NA	NA	67110289	114	37.10	69	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	HMMPfam_MyTH4,HMMSmart_SM00139,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_FERM_M,superfamily_Second domain of FERM,HMMSmart_SM00295,superfamily_PH domain-like	p.P620S	ENST00000329153.5	37	c.1858	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.165311	0.94768	.	.	ENSG00000054690	ENST00000329153	T	0.15834	2.39	5.14	5.14	0.70334	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.49898	0.1584	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	T	0.57069	-0.7874	10	0.72032	D	0.01	.	18.8052	0.92034	0.0:1.0:0.0:0.0	.	135;620	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	S	620	ENSP00000330278:P620S	ENSP00000330278:P620S	P	+	1	0	PLEKHH1	67110289	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.625000	0.83145	2.676000	0.91093	0.561000	0.74099	CCT	-	HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like		0.502	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	protein_coding	OTTHUMT00000412730.3	C	XM_031054		67110289	+1	no_errors	NM_020715.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
VASH1	22846	genome.wustl.edu	37	14	77244360	77244360	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr14:77244360C>T	ENST00000167106.4	+	6	1604	c.971C>T	c.(970-972)tCc>tTc	p.S324F	RP11-488C13.6_ENST00000553507.1_RNA|RP11-488C13.6_ENST00000556368.1_RNA|RP11-488C13.7_ENST00000553758.1_lincRNA|VASH1_ENST00000554743.1_5'UTR	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	324	Involved in heparin-binding and antiangiogenic activity.				angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		GATGTTTCTTCCCCGCAGCGG	0.612																																						dbGAP											0			14											28.0	22.0	24.0					14																	77244360		2195	4289	6484	76314113	SO:0001583	missense	0			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.971C>T	14.37:g.77244360C>T	ENSP00000167106:p.Ser324Phe	38	5.00	2		9	55.00	11	76314113	34	52.05	38	Q96H02|Q9UBF4|Q9Y629	Missense_Mutation	SNP	NULL	p.S324F	ENST00000167106.4	37	c.971	CCDS9851.1	14	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931312	0.92389	.	.	ENSG00000071246	ENST00000167106	.	.	.	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.77948	0.4207	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.81289	-0.1000	9	0.87932	D	0	0.1244	17.6214	0.88083	0.0:1.0:0.0:0.0	.	324	Q7L8A9	VASH1_HUMAN	F	324	.	ENSP00000167106:S324F	S	+	2	0	VASH1	76314113	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.166000	0.68216	0.655000	0.94253	TCC	-	NULL		0.612	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	protein_coding	OTTHUMT00000413706.1	C	NM_014909		76314113	+1	no_errors	NM_014909.4	genbank	human	validated	54_36p	missense	SNP	1.000	T
ADPGK	83440	genome.wustl.edu	37	15	73045153	73045153	+	Silent	SNP	A	A	G	rs372281721		TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr15:73045153A>G	ENST00000311669.8	-	7	1113	c.1020T>C	c.(1018-1020)tcT>tcC	p.S340S	ADPGK_ENST00000456471.2_Silent_p.S66S|ADPGK_ENST00000567733.1_5'Flank	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	341	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						AAGAGAGAGAAGAGTGAGGTC	0.507																																						dbGAP											0			15						A		1,3973		0,1,1986	74.0	72.0	73.0		1020	-11.6	0.0	15		73	0,8332		0,0,4166	no	coding-synonymous	ADPGK	NM_031284.4		0,1,6152	GG,GA,AA		0.0,0.0252,0.0081		340/497	73045153	1,12305	1987	4166	6153	70832206	SO:0001819	synonymous_variant	0			AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1020T>C	15.37:g.73045153A>G		64	4.48	3		114	52.30	125	70832206	83	41.67	60	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Silent	SNP	HMMPfam_ADP_PFK_GK,superfamily_SSF53613	p.S340	ENST00000311669.8	37	c.1020	CCDS42057.1	15																																																																																			-	HMMPfam_ADP_PFK_GK,superfamily_SSF53613		0.507	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK	protein_coding	OTTHUMT00000420434.1	A	NM_031284		70832206	-1	no_errors	NM_031284.4	genbank	human	validated	54_36p	silent	SNP	0.316	G
PDXDC1	23042	genome.wustl.edu	37	16	15083329	15083329	+	Intron	SNP	T	T	C			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr16:15083329T>C	ENST00000396410.4	+	2	118				PDXDC1_ENST00000563679.1_Intron|PDXDC1_ENST00000325823.7_Intron|PDXDC1_ENST00000569715.1_Intron|PDXDC1_ENST00000447912.2_Intron|PDXDC1_ENST00000455313.2_Intron|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000450288.2_Intron	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGTGAAGGCCTTGGGGGCTGG	0.677																																						dbGAP											0			16																																								14990830	SO:0001627	intron_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.22-8281T>C	16.37:g.15083329T>C		26	0.00	0		34	2.86	1	14990830	42	20.75	11	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Missense_Mutation	SNP	HMMPfam_DUF2152	p.K230R	ENST00000396410.4	37	c.689	CCDS32393.1	16																																																																																			-	HMMPfam_DUF2152		0.677	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728138	protein_coding	OTTHUMT00000389065.2	T	NM_015027		14990830	-1	no_errors	XM_001128282.2	genbank	human	model	54_36p	missense	SNP	0.200	C
PKD1L2	114780	genome.wustl.edu	37	16	81161616	81161616	+	RNA	SNP	C	C	A			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr16:81161616C>A	ENST00000534142.1	-	0	487				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CCTGGACCCTCACTTGACGAA	0.493																																						dbGAP											0			16											40.0	38.0	39.0					16																	81161616		1973	4158	6131	79719117			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81161616C>A		226	5.44	13		NA	NA	NA	79719117	169	44.52	138	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	HMMPfam_GPS,HMMSmart_SM00303,PatternScan_CHANNEL_COLICIN,HMMPfam_PLAT,HMMSmart_SM00308,HMMPfam_Lectin_C,HMMSmart_SM00034,superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain),HMMPfam_PKD_channel,superfamily_C-type lectin-like	p.V2036	ENST00000534142.1	37	c.6108		16																																																																																			-	HMMPfam_PKD_channel		0.493	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	PKD1L2	polymorphic_pseudogene	OTTHUMT00000387969.1	C			79719117	-1	no_errors	ENST00000299598	ensembl	human	known	54_36p	silent	SNP	1.000	A
ZNF486	90649	genome.wustl.edu	37	19	20308074	20308074	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr19:20308074A>G	ENST00000335117.8	+	4	612	c.555A>G	c.(553-555)atA>atG	p.I185M	CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA|CTC-260E6.6_ENST00000593655.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	185					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						TGAAATATATAGAAGGTGACA	0.303																																						dbGAP											0			19											39.0	43.0	41.0					19																	20308074		2042	4226	6268	20169074	SO:0001583	missense	0			BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.555A>G	19.37:g.20308074A>G	ENSP00000335042:p.Ile185Met	57	0.00	0		NA	NA	NA	20169074	68	46.46	59	Q0VG00	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_KRAB,superfamily_Krueppel-associated_box,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.I185M	ENST00000335117.8	37	c.555	CCDS46029.1	19	.	.	.	.	.	.	.	.	.	.	a	4.464	0.085918	0.08583	.	.	ENSG00000256229	ENST00000545779;ENST00000335117	T	0.28069	1.63	0.85	-1.7	0.08159	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18882	0.0453	N	0.25286	0.73	0.09310	N	1	B	0.26935	0.164	B	0.33392	0.163	T	0.36890	-0.9729	9	0.66056	D	0.02	.	3.5573	0.07869	0.6649:0.0:0.0:0.3351	.	185	Q96H40	ZN486_HUMAN	M	224;185	ENSP00000335042:I185M	ENSP00000335042:I185M	I	+	3	3	ZNF486	20169074	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-7.274000	0.00040	0.166000	0.19597	0.164000	0.16699	ATA	-	superfamily_SSF57667		0.303	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	protein_coding	OTTHUMT00000447843.2	A	NM_052852		20169074	+1	no_errors	NM_052852.2	genbank	human	provisional	54_36p	missense	SNP	0.281	G
SREBF2	6721	genome.wustl.edu	37	22	42274026	42274026	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2832-03B-01W-0728-08	TCGA-AB-2832-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	c6730725-42e7-4f23-a91d-d1c02c2812d0	d61a25b6-8cb0-4519-88fd-2995333f959c	g.chr22:42274026G>A	ENST00000361204.4	+	9	1826	c.1660G>A	c.(1660-1662)Gtg>Atg	p.V554M		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	554					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GAGCGTCTTTGTGAAGCTGCT	0.562																																						dbGAP											0			22											146.0	138.0	141.0					22																	42274026		2203	4300	6503	40603972	SO:0001583	missense	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1660G>A	22.37:g.42274026G>A	ENSP00000354476:p.Val554Met	91	6.19	6		59	54.62	71	40603972	79	38.76	50	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	HMMPfam_HLH,HMMSmart_HLH,superfamily_HLH_basic	p.V554M	ENST00000361204.4	37	c.1660	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700458	0.48307	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	T	0.11169	2.8	4.96	2.73	0.32206	.	0.402117	0.28409	N	0.015460	T	0.08626	0.0214	L	0.47190	1.495	0.58432	D	0.999999	B	0.26195	0.144	B	0.18561	0.022	T	0.14868	-1.0457	10	0.54805	T	0.06	-15.8159	4.7295	0.12957	0.2247:0.2024:0.5729:0.0	.	554	Q12772	SRBP2_HUMAN	M	554	ENSP00000354476:V554M	ENSP00000354476:V554M	V	+	1	0	SREBF2	40603972	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.087000	0.57671	1.301000	0.44836	0.549000	0.68633	GTG	-	NULL		0.562	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	G	NM_004599		40603972	+1	no_errors	NM_004599.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
