#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	X	91931647	91931647	+	IGR	SNP	C	C	T			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chrX:91931647C>T								PCDH11X (53418 upstream) : NAP1L3 (994281 downstream)																							TGATAACCACCTTGCTGGGGT	0.453																																						dbGAP											0			X																																								91818303	SO:0001628	intergenic_variant	0																															X.37:g.91931647C>T		74	1.30	1		128	0.00	0	91818303	36	47.83	33		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.453					LOC392501			C			91818303	-1	pseudogene	XR_016267.2	genbank	human	model	54_36p	rna	SNP	1.000	T
SPEN	23013	genome.wustl.edu	37	1	16254684	16254684	+	Missense_Mutation	SNP	A	A	C			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	A	A	A	C	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr1:16254684A>C	ENST00000375759.3	+	11	2153	c.1949A>C	c.(1948-1950)tAt>tCt	p.Y650S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	650	Arg-rich.|Tyr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AGGCGGGACTATCCAGCTCGA	0.458																																						dbGAP											0			1											98.0	99.0	99.0					1																	16254684		2203	4300	6503	16127271	SO:0001583	missense	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1949A>C	1.37:g.16254684A>C	ENSP00000364912:p.Tyr650Ser	108	0.92	1		26	38.10	16	16127271	104	35.00	56	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_RRM,HMMPfam_SPOC,superfamily_SPOC-like,superfamily_SSF54928	p.Y650S	ENST00000375759.3	37	c.1949	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621553	0.46736	.	.	ENSG00000065526	ENST00000375759	T	0.09723	2.95	4.54	4.54	0.55810	.	.	.	.	.	T	0.20981	0.0505	L	0.34521	1.04	0.58432	D	0.999997	D	0.89917	1.0	D	0.69307	0.963	T	0.01262	-1.1402	9	0.41790	T	0.15	-4.1593	14.3397	0.66617	1.0:0.0:0.0:0.0	.	650	Q96T58	MINT_HUMAN	S	650	ENSP00000364912:Y650S	ENSP00000364912:Y650S	Y	+	2	0	SPEN	16127271	1.000000	0.71417	0.988000	0.46212	0.964000	0.63967	6.792000	0.75125	2.034000	0.60081	0.460000	0.39030	TAT	-	NULL		0.458	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	protein_coding	OTTHUMT00000025993.1	A	NM_015001		16127271	+1	no_errors	NM_015001.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CATSPER4	378807	genome.wustl.edu	37	1	26524486	26524486	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr1:26524486C>A	ENST00000456354.2	+	5	663	c.596C>A	c.(595-597)cCc>cAc	p.P199H		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	199					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		GCGGTGGAGCCCCTCGCCCGG	0.637																																						dbGAP											0			1											132.0	121.0	125.0					1																	26524486		2203	4300	6503	26397073	SO:0001583	missense	0			BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.596C>A	1.37:g.26524486C>A	ENSP00000390423:p.Pro199His	202	0.49	1		NA	NA	NA	26397073	106	22.06	30	A1A4W6|Q5VY71	Missense_Mutation	SNP	HMMPfam_Ion_trans,superfamily_Voltage-gated potassium channels	p.P199H	ENST00000456354.2	37	c.596	CCDS30645.1	1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496506	0.64186	.	.	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.98313	-4.86;-4.86	5.0	3.08	0.35506	Ion transport (1);	0.000000	0.51477	D	0.000094	D	0.98194	0.9403	M	0.68952	2.095	0.29745	N	0.836801	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.991	D	0.95199	0.8315	10	0.87932	D	0	-25.2338	6.8342	0.23927	0.0:0.7254:0.1774:0.0972	.	199;199	Q7RTX7;Q7RTX7-2	CTSR4_HUMAN;.	H	199	ENSP00000341006:P199H;ENSP00000390423:P199H	ENSP00000341006:P199H	P	+	2	0	CATSPER4	26397073	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	1.978000	0.40598	0.480000	0.27534	0.563000	0.77884	CCC	-	HMMPfam_Ion_trans,superfamily_Voltage-gated potassium channels		0.637	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER4	protein_coding	OTTHUMT00000019849.2	C	NM_198137		26397073	+1	no_errors	NM_198137.1	genbank	human	validated	54_36p	missense	SNP	0.993	A
LRBA	987	genome.wustl.edu	37	4	151821353	151821353	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr4:151821353T>C	ENST00000357115.3	-	14	2015	c.1772A>G	c.(1771-1773)tAt>tGt	p.Y591C	LRBA_ENST00000507224.1_Missense_Mutation_p.Y591C|LRBA_ENST00000535741.1_Missense_Mutation_p.Y591C|LRBA_ENST00000510413.1_Missense_Mutation_p.Y591C	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	591						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CAGATAAGTATAGAGCATCAG	0.393																																						dbGAP											0			4											101.0	95.0	97.0					4																	151821353		2203	4300	6503	152040803	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1772A>G	4.37:g.151821353T>C	ENSP00000349629:p.Tyr591Cys	197	1.01	2		22	40.54	15	152040803	101	26.81	37	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	HMMPfam_Beach,superfamily_BEACH domain,HMMSmart_SM00320,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_DUF1088,superfamily_WD40 repeat-like,superfamily_ARM repeat,HMMPfam_WD40,superfamily_PH domain-like	p.Y591C	ENST00000357115.3	37	c.1772	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	T	22.6	4.309937	0.81247	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	5.59	5.59	0.84812	Armadillo-type fold (1);	0.000000	0.64402	D	0.000007	T	0.55561	0.1928	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	T	0.62445	-0.6853	10	0.87932	D	0	.	15.7574	0.78046	0.0:0.0:0.0:1.0	.	591;591;591	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	C	591	ENSP00000446299:Y591C;ENSP00000421552:Y591C;ENSP00000349629:Y591C;ENSP00000422180:Y591C	ENSP00000349629:Y591C	Y	-	2	0	LRBA	152040803	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.991000	0.88244	2.112000	0.64535	0.533000	0.62120	TAT	-	superfamily_ARM repeat		0.393	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	T			152040803	-1	no_errors	NM_006726.2	genbank	human	validated	54_36p	missense	SNP	1.000	C
PHACTR1	221692	genome.wustl.edu	37	6	13206329	13206329	+	Missense_Mutation	SNP	T	T	G			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr6:13206329T>G	ENST00000379350.1	+	7	1076	c.947T>G	c.(946-948)cTc>cGc	p.L316R	PHACTR1_ENST00000457702.2_Missense_Mutation_p.L171R|PHACTR1_ENST00000379345.2_Intron|PHACTR1_ENST00000332995.7_Missense_Mutation_p.L316R			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	316					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			ATAGACGAGCTCAACAAAACG	0.647																																						dbGAP											0			6											18.0	20.0	19.0					6																	13206329		2017	4176	6193	13314308	SO:0001583	missense	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.947T>G	6.37:g.13206329T>G	ENSP00000368655:p.Leu316Arg	110	0.00	0		6	14.29	1	13314308	159	19.70	39	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	HMMPfam_RPEL,HMMSmart_SM00707	p.L316R	ENST00000379350.1	37	c.947		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.4|20.4	3.991190|3.991190	0.74703|0.74703	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000379350;ENST00000332995;ENST00000432934;ENST00000457702|ENST00000415087	T;T;T|.	0.60171|.	0.21;0.49;0.53|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.39200|0.39200	0.1069|0.1069	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.999;0.998;0.999|.	D;D;D|.	0.83275|.	0.988;0.99;0.996|.	T|T	0.33420|0.33420	-0.9869|-0.9869	10|5	0.72032|.	D|.	0.01|.	-10.2039|-10.2039	13.7771|13.7771	0.63059|0.63059	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	385;316;316|.	E7ESR5;Q9C0D0;Q9C0D0-2|.	.;PHAR1_HUMAN;.|.	R|A	316;316;385;171|151	ENSP00000368655:L316R;ENSP00000329880:L316R;ENSP00000397669:L171R|.	ENSP00000329880:L316R|.	L|S	+|+	2|1	0|0	PHACTR1|PHACTR1	13314308|13314308	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.203000|7.203000	0.77864|0.77864	2.026000|2.026000	0.59711|0.59711	0.459000|0.459000	0.35465|0.35465	CTC|TCA	-	NULL		0.647	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	protein_coding	OTTHUMT00000039876.1	T	XM_166420		13314308	+1	no_errors	NM_030948.1	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF783	100289678	genome.wustl.edu	37	7	148964299	148964299	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr7:148964299G>A	ENST00000434415.1	+	4	822	c.659G>A	c.(658-660)aGg>aAg	p.R220K		NM_001195220.1	NP_001182149.1	Q6ZMS7	ZN783_HUMAN	zinc finger family member 783	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)	22	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.0014)			GGACGTCCAAGGATGATGGGC	0.597																																						dbGAP											0			7											57.0	57.0	57.0					7																	148964299		2063	4195	6258	148595232	SO:0001583	missense	0			AK131504	CCDS56519.1	7q36.1	2013-01-08	2008-05-28		ENSG00000204946	ENSG00000204946		"""Zinc fingers, C2H2-type"", ""-"""	27222	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001195220		Approved	DKFZp667J212	uc011kuo.2	Q6ZMS7	OTTHUMG00000158969	ENST00000434415.1:c.659G>A	7.37:g.148964299G>A	ENSP00000410890:p.Arg220Lys	291	0.34	1		28	36.36	16	148595232	248	29.34	103	C9J9J2	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_KRAB,superfamily_Krueppel-associated_box	p.R220K	ENST00000434415.1	37	c.659	CCDS56519.1	7	.	.	.	.	.	.	.	.	.	.	G	1.098	-0.662069	0.03454	.	.	ENSG00000204946	ENST00000434415	T	0.05081	3.5	4.76	1.01	0.19927	.	1.270870	0.05844	N	0.619831	T	0.03220	0.0094	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.43556	-0.9384	8	0.09084	T	0.74	-6.5046	3.5705	0.07916	0.3676:0.0:0.4636:0.1687	.	.	.	.	K	220	ENSP00000410890:R220K	ENSP00000367291:R220K	R	+	2	0	ZNF783	148595232	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.653000	0.24902	0.011000	0.14865	0.555000	0.69702	AGG	-	NULL		0.597	ZNF783-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF783	protein_coding	OTTHUMT00000352715.1	G	NM_001195220		148595232	+1	no_errors	ENST00000378052	ensembl	human	known	54_36p	missense	SNP	0.002	A
LZTS1	11178	genome.wustl.edu	37	8	20110868	20110868	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr8:20110868G>C	ENST00000381569.1	-	3	931	c.574C>G	c.(574-576)Cag>Gag	p.Q192E	LZTS1_ENST00000522290.1_Missense_Mutation_p.Q192E|LZTS1_ENST00000265801.6_Missense_Mutation_p.Q192E			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	192					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGGTCCAGCTGGTAGCTGCTG	0.647																																						dbGAP											0			8											42.0	50.0	47.0					8																	20110868		2203	4300	6503	20155148	SO:0001583	missense	0			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.574C>G	8.37:g.20110868G>C	ENSP00000370981:p.Gln192Glu	91	0.00	0		NA	NA	NA	20155148	97	34.90	52	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	HMMPfam_Fez1	p.Q192E	ENST00000381569.1	37	c.574	CCDS6015.1	8	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344175	0.82022	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.22539	2.28;2.28;1.95	5.93	5.93	0.95920	.	0.173838	0.53938	D	0.000042	T	0.30696	0.0773	L	0.38175	1.15	0.58432	D	0.999999	D;D	0.76494	0.999;0.996	P;P	0.61533	0.89;0.836	T	0.01326	-1.1384	10	0.02654	T	1	-54.1362	18.9075	0.92469	0.0:0.0:1.0:0.0	.	192;192	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	E	192	ENSP00000370981:Q192E;ENSP00000265801:Q192E;ENSP00000429263:Q192E	ENSP00000265801:Q192E	Q	-	1	0	LZTS1	20155148	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.842000	0.86851	2.815000	0.96918	0.561000	0.74099	CAG	-	NULL		0.647	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	protein_coding	OTTHUMT00000214122.1	G	NM_021020		20155148	-1	no_errors	NM_021020.2	genbank	human	validated	54_36p	missense	SNP	1.000	C
MROH5	389690	genome.wustl.edu	37	8	142486214	142486214	+	RNA	SNP	C	C	T			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr8:142486214C>T	ENST00000430863.1	-	0	1559					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GGAGCTGAGACTTCCTTTCCA	0.612																																						dbGAP											0			8											23.0	28.0	26.0					8																	142486214		2039	4198	6237	142555396			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142486214C>T		55	0.00	0		NA	NA	NA	142555396	120	20.00	30		Silent	SNP	HMMPfam_HEAT,superfamily_ARM repeat	p.K493	ENST00000430863.1	37	c.1479		8																																																																																			-	NULL		0.612	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	polymorphic_pseudogene	OTTHUMT00000342412.4	C	NM_207414		142555396	-1	pseudogene	NM_207414.2	genbank	human	validated	54_36p	silent	SNP	0.033	T
EPPK1	83481	genome.wustl.edu	37	8	144940290	144940290	+	Missense_Mutation	SNP	C	C	G	rs201976887		TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr8:144940290C>G	ENST00000525985.1	-	2	7203	c.7132G>C	c.(7132-7134)Gac>Cac	p.D2378H				P58107	EPIPL_HUMAN	epiplakin 1	2378						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCGCTGGGGTCGGCCAGGACG	0.682																																						dbGAP											0			8						C	HIS/ASP	51,4341	20.2+/-43.8	0,51,2145	315.0	292.0	300.0		7132	3.6	0.8	8		300	22,8530	7.1+/-27.0	0,22,4254	no	missense	EPPK1	NM_031308.1	81	0,73,6399	GG,GC,CC		0.2572,1.1612,0.564	probably-damaging	2378/2420	144940290	73,12871	2196	4276	6472	145012278	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7132G>C	8.37:g.144940290C>G	ENSP00000436337:p.Asp2378His	11	0.00	0		19	9.52	2	145012278	33	23.26	10	Q76E58|Q9NSU9	Missense_Mutation	SNP	HMMPfam_Plectin,HMMSmart_SM00250,superfamily_Plakin repeat	p.D2353H	ENST00000525985.1	37	c.7057		8	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279155	0.80692	0.011612	0.002572	ENSG00000227184	ENST00000525985	T	0.74737	-0.87	4.43	3.56	0.40772	.	.	.	.	.	D	0.83133	0.5188	M	0.89785	3.06	0.42176	D	0.991666	D	0.89917	1.0	D	0.91635	0.999	D	0.86316	0.1689	9	0.62326	D	0.03	.	10.4012	0.44231	0.0:0.9038:0.0:0.0962	.	2378	E9PPU0	.	H	2378	ENSP00000436337:D2378H	ENSP00000436337:D2378H	D	-	1	0	EPPK1	145012278	1.000000	0.71417	0.773000	0.31616	0.942000	0.58702	7.555000	0.82223	1.223000	0.43536	0.591000	0.81541	GAC	-	HMMPfam_Plectin,superfamily_Plakin repeat		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	protein_coding	OTTHUMT00000382675.1	C	NM_031308		145012278	-1	no_stop_codon:bad_bp_length_for_coding_region	NM_031308.1	genbank	human	provisional	54_36p	missense	SNP	1.000	G
STK33	65975	genome.wustl.edu	37	11	8474453	8474453	+	Splice_Site	SNP	C	C	A			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr11:8474453C>A	ENST00000447869.1	-	7	1705	c.787G>T	c.(787-789)Gtg>Ttg	p.V263L	STK33_ENST00000396672.1_Splice_Site_p.V263L|STK33_ENST00000534493.1_Splice_Site_p.V222L|STK33_ENST00000358872.3_Splice_Site_p.V76L|STK33_ENST00000315204.1_Splice_Site_p.V263L|STK33_ENST00000396673.1_Splice_Site_p.V263L|STK33_ENST00000473980.1_5'UTR			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		AAATCAGTCACCTGGGAGAAG	0.443																																						dbGAP											0			11											111.0	116.0	114.0					11																	8474453		2201	4296	6497	8431029	SO:0001630	splice_region_variant	0			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.787-1G>T	11.37:g.8474453C>A		131	0.00	0		NA	NA	NA	8431029	169	26.52	61	Q658S6|Q8NEF5	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase	p.V263L	ENST00000447869.1	37	c.787	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621255	0.46736	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000396673;ENST00000444064;ENST00000534493;ENST00000524760	T;T;T;T;T;T;T;T	0.15952	2.55;2.55;2.55;2.55;2.55;2.55;2.55;2.38	5.22	5.22	0.72569	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.09468	0.0233	N	0.00960	-1.095	0.58432	D	0.999999	B	0.27910	0.193	B	0.38378	0.272	T	0.44436	-0.9328	10	0.52906	T	0.07	.	15.6882	0.77426	0.0:1.0:0.0:0.0	.	263	Q9BYT3	STK33_HUMAN	L	263;263;263;76;263;18;222;175	ENSP00000416750:V263L;ENSP00000320754:V263L;ENSP00000379905:V263L;ENSP00000351743:V76L;ENSP00000379906:V263L;ENSP00000415688:V18L;ENSP00000436418:V222L;ENSP00000436905:V175L	ENSP00000320754:V263L	V	-	1	0	STK33	8431029	1.000000	0.71417	1.000000	0.80357	0.583000	0.36354	5.753000	0.68736	2.443000	0.82685	0.491000	0.48974	GTG	-	HMMSmart_SM00219,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase		0.443	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	protein_coding	OTTHUMT00000276819.2	C	NM_030906	Missense_Mutation	8431029	-1	no_errors	NM_030906.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
C1RL	51279	genome.wustl.edu	37	12	7249465	7249465	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr12:7249465C>T	ENST00000266542.4	-	6	1078	c.986G>A	c.(985-987)cGt>cAt	p.R329H	C1RL_ENST00000544702.1_3'UTR|C1RL_ENST00000504702.2_Intron|C1RL_ENST00000545280.1_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	329	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CTCATTCTGACGGTAGTCGGG	0.587																																						dbGAP											0			12											168.0	132.0	144.0					12																	7249465		2203	4300	6503	7140607	SO:0001583	missense	0			AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.986G>A	12.37:g.7249465C>T	ENSP00000266542:p.Arg329His	172	0.00	0		20	35.48	11	7140607	129	27.93	50	Q53GX9	Missense_Mutation	SNP	HMMPfam_CUB,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain,HMMPfam_Trypsin,HMMSmart_SM00020,superfamily_Trypsin-like serine proteases,PatternScan_TRYPSIN_SER	p.R329H	ENST00000266542.4	37	c.986	CCDS8573.1	12	.	.	.	.	.	.	.	.	.	.	C	12.03	1.815570	0.32145	.	.	ENSG00000139178	ENST00000266542;ENST00000396661	D	0.88975	-2.45	4.98	1.16	0.20824	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.409080	0.25514	N	0.030153	T	0.80138	0.4568	L	0.33137	0.985	0.09310	N	0.999998	B	0.25441	0.126	B	0.22386	0.039	T	0.65376	-0.6183	10	0.31617	T	0.26	.	8.7566	0.34650	0.0:0.6009:0.0:0.3991	.	329	Q9NZP8	C1RL_HUMAN	H	329	ENSP00000266542:R329H	ENSP00000266542:R329H	R	-	2	0	C1RL	7140607	0.001000	0.12720	0.108000	0.21378	0.785000	0.44390	-0.104000	0.10923	0.043000	0.15746	0.511000	0.50034	CGT	-	HMMPfam_Trypsin,HMMSmart_SM00020,superfamily_Trypsin-like serine proteases		0.587	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1RL	protein_coding	OTTHUMT00000398367.1	C	NM_016546		7140607	-1	no_errors	NM_016546.1	genbank	human	provisional	54_36p	missense	SNP	0.357	T
RFX4	5992	genome.wustl.edu	37	12	107075813	107075813	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr12:107075813G>A	ENST00000392842.1	+	5	772	c.358G>A	c.(358-360)Ggg>Agg	p.G120R	RFX4_ENST00000229387.5_5'Flank|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Missense_Mutation_p.G129R|RP11-482D24.2_ENST00000547531.1_RNA	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	120					cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						CAGAAGACTCGGGACCCGAGG	0.522																																						dbGAP											0			12											140.0	129.0	132.0					12																	107075813		2203	4300	6503	105599943	SO:0001583	missense	0			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.358G>A	12.37:g.107075813G>A	ENSP00000376585:p.Gly120Arg	163	0.00	0		NA	NA	NA	105599943	194	25.10	65	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	HMMPfam_RFX_DNA_binding,superfamily_SSF46785	p.G120R	ENST00000392842.1	37	c.358	CCDS9106.1	12	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817751	0.90790	.	.	ENSG00000111783	ENST00000392842;ENST00000549040;ENST00000357881;ENST00000266774;ENST00000551640	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	5.43	4.54	0.55810	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.045370	0.85682	N	0.000000	D	0.97374	0.9141	M	0.88704	2.975	0.80722	D	1	B;D;D	0.76494	0.14;0.995;0.999	B;D;D	0.70487	0.031;0.923;0.969	D	0.98095	1.0411	10	0.87932	D	0	-25.0318	14.4982	0.67704	0.0709:0.0:0.9291:0.0	.	129;129;120	Q33E94-2;Q33E94-4;Q33E94	.;.;RFX4_HUMAN	R	120;37;129;129;65	ENSP00000376585:G120R;ENSP00000447735:G37R;ENSP00000350552:G129R;ENSP00000448694:G65R	ENSP00000266774:G129R	G	+	1	0	RFX4	105599943	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.291000	0.96070	1.422000	0.47177	0.609000	0.83330	GGG	-	HMMPfam_RFX_DNA_binding,superfamily_SSF46785		0.522	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	protein_coding	OTTHUMT00000402707.1	G	NM_032491		105599943	+1	no_errors	NM_213594.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CSPG4	1464	genome.wustl.edu	37	15	75982058	75982058	+	Missense_Mutation	SNP	T	T	A	rs147116973	byFrequency	TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr15:75982058T>A	ENST00000308508.5	-	3	1440	c.1348A>T	c.(1348-1350)Agg>Tgg	p.R450W		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	450	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGCACATGCCTCCACTCAAGC	0.647																																						dbGAP											0			15											53.0	52.0	53.0					15																	75982058		2197	4293	6490	73769113	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1348A>T	15.37:g.75982058T>A	ENSP00000312506:p.Arg450Trp	20	0.00	0		NA	NA	NA	73769113	12	25.00	4	D3DW77|Q92675	Missense_Mutation	SNP	HMMSmart_SM00282,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,PatternScan_ATPASE_ALPHA_BETA	p.R450W	ENST00000308508.5	37	c.1348	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	10.03	1.238374	0.22711	.	.	ENSG00000173546	ENST00000308508	T	0.20332	2.08	5.26	3.18	0.36537	.	0.318723	0.26328	N	0.025018	T	0.24044	0.0582	M	0.65498	2.005	0.22330	N	0.999195	D	0.55800	0.973	B	0.43754	0.43	T	0.16541	-1.0399	10	0.87932	D	0	.	9.1439	0.36921	0.0:0.1134:0.5474:0.3393	.	450	Q6UVK1	CSPG4_HUMAN	W	450	ENSP00000312506:R450W	ENSP00000312506:R450W	R	-	1	2	CSPG4	73769113	0.968000	0.33430	0.998000	0.56505	0.385000	0.30292	1.547000	0.36190	1.229000	0.43630	-0.238000	0.12139	AGG	-	NULL		0.647	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	protein_coding	OTTHUMT00000286472.1	T	NM_001897		73769113	-1	no_errors	NM_001897.4	genbank	human	reviewed	54_36p	missense	SNP	0.098	A
AC012322.1	0	genome.wustl.edu	37	16	64294657	64294657	+	lincRNA	SNP	G	G	T			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr16:64294657G>T	ENST00000561657.1	-	0	584																											CACTCTGGGAGGAAGGTCATC	0.488																																						dbGAP											0			16																																								62852158			0																															16.37:g.64294657G>T		165	0.00	0		34	0.00	0	62852158	138	25.81	48		RNA	SNP	-	NULL	ENST00000561657.1	37	NULL		16																																																																																			-	-		0.488	AC012322.1-001	KNOWN	basic	lincRNA	LOC729217	lincRNA	OTTHUMT00000420578.1	G			62852158	-1	pseudogene	XR_015483.2	genbank	human	model	54_36p	rna	SNP	1.000	T
ZC3H18	124245	genome.wustl.edu	37	16	88666346	88666346	+	Missense_Mutation	SNP	A	A	G	rs374973909		TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr16:88666346A>G	ENST00000301011.5	+	6	1278	c.1078A>G	c.(1078-1080)Aga>Gga	p.R360G	ZC3H18_ENST00000452588.2_Missense_Mutation_p.R384G	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	360						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GAGAGATGTCAGAGACACAGT	0.542																																					Ovarian(121;375 2276 20373 38669)	dbGAP											0			16						A	GLY/ARG	1,4395	2.1+/-5.4	0,1,2197	84.0	92.0	89.0		1078	2.3	1.0	16		89	0,8600		0,0,4300	no	missense	ZC3H18	NM_144604.3	125	0,1,6497	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	360/954	88666346	1,12995	2198	4300	6498	87193847	SO:0001583	missense	0			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1078A>G	16.37:g.88666346A>G	ENSP00000301011:p.Arg360Gly	35	0.00	0		61	39.60	40	87193847	64	27.27	24	Q96DG4|Q96MP7	Missense_Mutation	SNP	HMMPfam_zf-CCCH,HMMSmart_SM00356	p.R360G	ENST00000301011.5	37	c.1078	CCDS10967.1	16	.	.	.	.	.	.	.	.	.	.	A	12.16	1.853726	0.32791	2.27E-4	0.0	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588;ENST00000545404	T;T	0.34472	1.38;1.36	4.67	2.33	0.28932	.	0.049004	0.85682	D	0.000000	T	0.53334	0.1790	M	0.63843	1.955	0.51012	D	0.999903	D;D;D	0.61080	0.989;0.989;0.989	D;D;D	0.75020	0.985;0.985;0.985	T	0.47355	-0.9124	10	0.40728	T	0.16	-19.2761	12.8033	0.57598	0.3748:0.6252:0.0:0.0	.	384;384;360	E7ERS3;B4DTK7;Q86VM9	.;.;ZCH18_HUMAN	G	360;384;384;243	ENSP00000301011:R360G;ENSP00000416951:R384G	ENSP00000289509:R384G	R	+	1	2	ZC3H18	87193847	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	0.660000	0.25009	0.218000	0.20820	0.459000	0.35465	AGA	-	NULL		0.542	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	protein_coding	OTTHUMT00000269168.1	A	NM_144604		87193847	+1	no_errors	NM_144604.2	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578555	7578555	+	Splice_Site	SNP	C	C	T			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr17:7578555C>T	ENST00000269305.4	-	5	565		c.e5-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(39)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGGAGTACTGTAGGAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Unknown(39)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	ovary(9)|pancreas(6)|bone(5)|upper_aerodigestive_tract(4)|liver(4)|lung(4)|breast(4)|large_intestine(3)|central_nervous_system(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|endometrium(1)|urinary_tract(1)|autonomic_ganglia(1)	17											42.0	42.0	42.0					17																	7578555		2203	4300	6503	7519280	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1G>A	17.37:g.7578555C>T		281	0.00	0		5	50.00	5	7519280	97	45.20	80	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4-1	ENST00000269305.4	37	c.376-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431133	0.62844	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.87	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4246	0.50003	0.0:0.9094:0.0:0.0906	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519280	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.639000	0.83342	1.359000	0.45940	0.655000	0.94253	.	-	-		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	Intron	7519280	-1	no_errors	NM_000546.4	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
SLC25A52	147407	genome.wustl.edu	37	18	29339843	29339843	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr18:29339843C>T	ENST00000579441.2	-	1	781	c.782G>A	c.(781-783)cGg>cAg	p.R261Q	SLC25A52_ENST00000269205.5_Missense_Mutation_p.R271Q			Q3SY17	S2552_HUMAN	solute carrier family 25, member 52	261					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											TTTTCTGTCCCGTTCCAGCCA	0.408																																						dbGAP											0			18											24.0	26.0	25.0					18																	29339843		2183	4251	6434	27593841	SO:0001583	missense	0				CCDS32812.1, CCDS32812.2	18q12.1	2013-07-15	2012-03-29	2012-03-29	ENSG00000141437	ENSG00000141437		"""Solute carriers"""	23324	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 2"""	MCART2			Standard	NM_001034172		Approved		uc002kxa.3	Q3SY17	OTTHUMG00000179617	ENST00000579441.2:c.782G>A	18.37:g.29339843C>T	ENSP00000462754:p.Arg261Gln	70	0.00	0		1	0.00	0	27593841	54	36.47	31		Missense_Mutation	SNP	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.R261Q	ENST00000579441.2	37	c.782		18	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279213	0.80692	.	.	ENSG00000141437	ENST00000269205;ENST00000535708	T	0.78481	-1.18	1.75	-0.525	0.11917	Mitochondrial carrier domain (2);	0.072812	0.52532	N	0.000076	D	0.84964	0.5589	M	0.86268	2.805	0.51233	D	0.999918	D	0.89917	1.0	D	0.79784	0.993	T	0.80665	-0.1281	10	0.56958	D	0.05	.	5.9079	0.19010	0.0:0.6854:0.0:0.3146	.	261	Q3SY17	MCAR2_HUMAN	Q	271;261	ENSP00000372612:R271Q	ENSP00000372612:R271Q	R	-	2	0	MCART2	27593841	1.000000	0.71417	0.142000	0.22268	0.886000	0.51366	4.925000	0.63425	-0.333000	0.08476	0.505000	0.49811	CGG	-	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr		0.408	SLC25A52-201	KNOWN	basic|appris_principal	protein_coding	MCART2	protein_coding		C	XM_084000		27593841	-1	no_errors	NM_001034172.2	genbank	human	validated	54_36p	missense	SNP	1.000	T
PLEKHG2	64857	genome.wustl.edu	37	19	39913763	39913763	+	Missense_Mutation	SNP	C	C	T	rs370446591		TCGA-AB-2868-03B-01W-0728-08	TCGA-AB-2868-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	865e8aa5-ec81-46af-acbc-e3becd24a1dd	10afa5bd-b1eb-4f78-8ae2-5e7df48d2c6e	g.chr19:39913763C>T	ENST00000409794.3	+	18	2919	c.2069C>T	c.(2068-2070)tCc>tTc	p.S690F	PLEKHG2_ENST00000409797.2_Intron|PLEKHG2_ENST00000378550.1_Intron|PLEKHG2_ENST00000458508.2_Missense_Mutation_p.S631F|PLEKHG2_ENST00000425673.1_Missense_Mutation_p.S661F|CTB-60E11.4_ENST00000601124.1_lincRNA	NM_022835.2	NP_073746.2	Q9H7P9	PKHG2_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 2	690					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|pancreas(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	40	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCCACCCTCTCCTGTGACTCC	0.567																																						dbGAP											0			19						C	PHE/SER	0,4406		0,0,2203	80.0	90.0	87.0		2069	4.3	0.9	19		87	1,8597		0,1,4298	no	missense	PLEKHG2	NM_022835.2	155	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	690/1387	39913763	1,13003	2203	4299	6502	44605603	SO:0001583	missense	0			AK024429	CCDS33022.2	19q13.2	2013-01-11			ENSG00000090924	ENSG00000090924		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	29515	protein-coding gene	gene with protein product		611893				11839748, 18045877	Standard	NM_022835		Approved	CLG, FLJ00018, ARHGEF42	uc010xuz.2	Q9H7P9	OTTHUMG00000152570	ENST00000409794.3:c.2069C>T	19.37:g.39913763C>T	ENSP00000386733:p.Ser690Phe	214	0.00	0		25	10.71	3	44605603	272	19.53	66	B8ZZK6|C9J0Y4|Q6DHV6|Q96BU2|Q96D18|Q9H699	Missense_Mutation	SNP	HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_DBL homology domain (DH-domain),HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like	p.S648F	ENST00000409794.3	37	c.1943	CCDS33022.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.604|9.604	1.129412|1.129412	0.21041|0.21041	0.0|0.0	1.16E-4|1.16E-4	ENSG00000090924|ENSG00000090924	ENST00000205135|ENST00000409794;ENST00000425673;ENST00000458508	.|T;T;T	.|0.70164	.|-0.33;-0.33;-0.46	5.4|5.4	4.31|4.31	0.51392|0.51392	.|.	.|0.154150	.|0.30911	.|N	.|0.008622	T|T	0.45915|0.45915	0.1366|0.1366	N|N	0.08118|0.08118	0|0	0.28633|0.28633	N|N	0.90754|0.90754	.|P;P;P	.|0.42620	.|0.785;0.553;0.553	.|B;B;B	.|0.38056	.|0.264;0.135;0.135	T|T	0.54761|0.54761	-0.8245|-0.8245	5|10	.|0.87932	.|D	.|0	.|.	13.8912|13.8912	0.63740|0.63740	0.1525:0.8475:0.0:0.0|0.1525:0.8475:0.0:0.0	.|.	.|661;690;631	.|Q9H7P9-3;Q9H7P9;E7ESZ3	.|.;PKHG2_HUMAN;.	S|F	558|690;661;631	.|ENSP00000386733:S690F;ENSP00000392906:S661F;ENSP00000408857:S631F	.|ENSP00000386733:S690F	P|S	+|+	1|2	0|0	PLEKHG2|PLEKHG2	44605603|44605603	0.879000|0.879000	0.30193|0.30193	0.900000|0.900000	0.35374|0.35374	0.287000|0.287000	0.27160|0.27160	2.576000|2.576000	0.46033|0.46033	2.694000|2.694000	0.91930|0.91930	0.655000|0.655000	0.94253|0.94253	CCT|TCC	-	NULL		0.567	PLEKHG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG2	protein_coding	OTTHUMT00000326802.1	C	NM_022835		44605603	+1	no_errors	NM_022835.2	genbank	human	validated	54_36p	missense	SNP	0.098	T
