#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ATP2B3	492	genome.wustl.edu	37	X	152814259	152814259	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chrX:152814259G>T	ENST00000349466.2	+	9	1611	c.1285G>T	c.(1285-1287)Gtc>Ttc	p.V429F	ATP2B3_ENST00000370181.2_Missense_Mutation_p.V415F|ATP2B3_ENST00000393842.1_Missense_Mutation_p.V415F|ATP2B3_ENST00000359149.3_Missense_Mutation_p.V429F|ATP2B3_ENST00000263519.4_Missense_Mutation_p.V429F|ATP2B3_ENST00000370186.1_Missense_Mutation_p.V415F			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	429					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGTCGTGGCTGTCCCAGAGGG	0.498																																						dbGAP											0			X											166.0	107.0	127.0					X																	152814259		2203	4300	6503	152467453	SO:0001583	missense	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1285G>T	X.37:g.152814259G>T	ENSP00000343886:p.Val429Phe	58	4.92	3		NA	NA	NA	152467453	175	37.10	105	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,HMMPfam_Hydrolase,HMMPfam_Cation_ATPase_C,HMMPfam_E1-E2_ATPase,PatternScan_ATPASE_E1_E2,superfamily_HAD-like,superfamily_Calcium ATPase transduction domain A,superfamily_Metal cation-transporting ATPase ATP-binding domain N,superfamily_Calcium ATPase transmembrane domain M	p.V429F	ENST00000349466.2	37	c.1285	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.626901	0.87560	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06;-3.06	4.73	4.73	0.59995	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.97021	0.9027	M	0.93978	3.48	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.98225	1.0480	10	0.87932	D	0	-47.8674	15.9103	0.79467	0.0:0.0:1.0:0.0	.	429;429	Q16720;Q16720-2	AT2B3_HUMAN;.	F	415;429;415;429;429;415	ENSP00000359205:V415F;ENSP00000343886:V429F;ENSP00000377425:V415F;ENSP00000352062:V429F;ENSP00000263519:V429F;ENSP00000359200:V415F	ENSP00000263519:V429F	V	+	1	0	ATP2B3	152467453	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	9.768000	0.98965	2.091000	0.63221	0.517000	0.50305	GTC	-	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transmembrane domain M		0.498	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	protein_coding	OTTHUMT00000060957.1	G	NM_021949		152467453	+1	no_errors	NM_001001344.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZBTB7B	51043	genome.wustl.edu	37	1	154987446	154987446	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr1:154987446G>A	ENST00000368426.3	+	3	447	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	ZBTB7B_ENST00000417934.2_Missense_Mutation_p.E138K|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.E104K|ZBTB7B_ENST00000487542.1_3'UTR|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.E104K	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	104	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CGCCCTCCTTGAATTTGCCTA	0.647																																						dbGAP											0			1											25.0	29.0	27.0					1																	154987446		2202	4300	6502	153254070	SO:0001583	missense	0			AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.310G>A	1.37:g.154987446G>A	ENSP00000357411:p.Glu104Lys	24	0.00	0		133	50.19	134	153254070	172	36.16	98	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	HMMSmart_BTB,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.E104K	ENST00000368426.3	37	c.310	CCDS1081.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525432	0.85600	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	3.66	3.66	0.41972	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.071587	0.53938	D	0.000048	T	0.76328	0.3972	M	0.74546	2.27	0.45554	D	0.998502	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.62382	0.901;0.901;0.901	T	0.80264	-0.1455	10	0.72032	D	0.01	.	12.8864	0.58047	0.0:0.0:1.0:0.0	.	104;104;138	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	K	104;104;138;104	ENSP00000438647:E104K;ENSP00000357411:E104K;ENSP00000406286:E138K;ENSP00000292176:E104K	ENSP00000292176:E104K	E	+	1	0	ZBTB7B	153254070	1.000000	0.71417	0.996000	0.52242	0.882000	0.50991	9.560000	0.98139	1.867000	0.54127	0.455000	0.32223	GAA	-	HMMSmart_BTB,superfamily_BTB/POZ_fold,HMMPfam_BTB		0.647	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB7B	protein_coding	OTTHUMT00000091083.1	G	NM_015872		153254070	+1	no_errors	NM_015872.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
ARHGEF4	50649	genome.wustl.edu	37	2	131674642	131674642	+	Intron	SNP	C	C	T			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr2:131674642C>T	ENST00000326016.5	+	1	411				ARHGEF4_ENST00000392953.3_Intron|ARHGEF4_ENST00000525839.1_5'Flank|ARHGEF4_ENST00000428230.2_5'UTR|ARHGEF4_ENST00000409359.1_Silent_p.Y711Y	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GCGGTAGGTACCTACCTTCAG	0.582																																						dbGAP											0			2																																								131391112	SO:0001627	intron_variant	0			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.-109+8C>T	2.37:g.131674642C>T		7	0.00	0		NA	NA	NA	131391112	37	44.12	30	Q9HDC6|Q9UPP0	Silent	SNP	NULL	p.Y1041	ENST00000326016.5	37	c.3123	CCDS2165.1	2																																																																																			-	NULL		0.582	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	LOC730032	protein_coding	OTTHUMT00000254554.4	C			131391112	+1	no_errors	XM_001132160.2	genbank	human	model	54_36p	silent	SNP	0.000	T
AFF4	27125	genome.wustl.edu	37	5	132228777	132228777	+	Missense_Mutation	SNP	T	T	G			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr5:132228777T>G	ENST00000265343.5	-	12	2720	c.2341A>C	c.(2341-2343)Aaa>Caa	p.K781Q	AFF4_ENST00000378595.3_Missense_Mutation_p.K781Q	NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	781					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTTTTGGGTTTCTTGCTCTCA	0.418																																					Ovarian(126;889 1733 2942 10745 11605)	dbGAP											0			5											398.0	372.0	381.0					5																	132228777		2203	4300	6503	132256676	SO:0001583	missense	0			AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.2341A>C	5.37:g.132228777T>G	ENSP00000265343:p.Lys781Gln	75	1.32	1		13	51.85	14	132256676	89	33.81	47	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	HMMPfam_AF-4	p.K781Q	ENST00000265343.5	37	c.2341	CCDS4164.1	5	.	.	.	.	.	.	.	.	.	.	T	15.16	2.751167	0.49257	.	.	ENSG00000072364	ENST00000265343;ENST00000378595	T;T	0.69435	-0.4;-0.4	5.18	5.18	0.71444	.	0.272836	0.37483	N	0.002065	T	0.78547	0.4300	M	0.63843	1.955	0.52099	D	0.999941	P;D	0.62365	0.826;0.991	B;D	0.76071	0.341;0.987	T	0.78795	-0.2064	10	0.46703	T	0.11	-14.0242	13.7575	0.62946	0.0:0.0:0.0:1.0	.	781;781	Q9UHB7-2;Q9UHB7	.;AFF4_HUMAN	Q	781	ENSP00000265343:K781Q;ENSP00000367858:K781Q	ENSP00000265343:K781Q	K	-	1	0	AFF4	132256676	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	6.184000	0.72008	2.182000	0.69389	0.460000	0.39030	AAA	-	HMMPfam_AF-4		0.418	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF4	protein_coding	OTTHUMT00000133049.1	T	NM_014423		132256676	-1	no_errors	NM_014423.3	genbank	human	validated	54_36p	missense	SNP	1.000	G
WEE2	494551	genome.wustl.edu	37	7	141429357	141429357	+	Missense_Mutation	SNP	A	A	T			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	A	A	A	T	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr7:141429357A>T	ENST00000397541.2	+	11	1968	c.1562A>T	c.(1561-1563)cAg>cTg	p.Q521L	WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|RNU1-82P_ENST00000390851.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000471512.1_RNA|WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000462383.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	521					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					CAGCAGGCCCAGTCACCCCAG	0.502																																						dbGAP											0			7											82.0	81.0	81.0					7																	141429357		1857	4111	5968	141075826	SO:0001583	missense	0			AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.1562A>T	7.37:g.141429357A>T	ENSP00000380675:p.Gln521Leu	73	3.95	3		NA	NA	NA	141075826	116	36.22	67		Missense_Mutation	SNP	PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,HMMPfam_Pkinase	p.Q521L	ENST00000397541.2	37	c.1562	CCDS43660.1	7	.	.	.	.	.	.	.	.	.	.	A	11.94	1.790014	0.31685	.	.	ENSG00000214102	ENST00000397541	T	0.57273	0.41	5.77	-2.61	0.06171	Protein kinase-like domain (1);	0.910282	0.09272	U	0.825022	T	0.40448	0.1117	L	0.56769	1.78	0.09310	N	1	B	0.20887	0.049	B	0.12156	0.007	T	0.28073	-1.0055	10	0.25106	T	0.35	.	4.2872	0.10860	0.5292:0.0:0.2515:0.2193	.	521	P0C1S8	WEE2_HUMAN	L	521	ENSP00000380675:Q521L	ENSP00000380675:Q521L	Q	+	2	0	WEE2	141075826	0.000000	0.05858	0.004000	0.12327	0.946000	0.59487	0.013000	0.13310	-0.610000	0.05716	0.533000	0.62120	CAG	-	NULL		0.502	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE2	protein_coding	OTTHUMT00000349091.1	A	NM_001105558		141075826	+1	no_errors	NM_001105558.1	genbank	human	validated	54_36p	missense	SNP	0.043	T
KCNU1	157855	genome.wustl.edu	37	8	36666296	36666296	+	Silent	SNP	G	G	A			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr8:36666296G>A	ENST00000399881.3	+	7	754	c.717G>A	c.(715-717)gcG>gcA	p.A239A		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	239					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TCACAGCTGCGGGATTCATTC	0.448																																						dbGAP											0			8											124.0	117.0	119.0					8																	36666296		1888	4127	6015	36785454	SO:0001819	synonymous_variant	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.717G>A	8.37:g.36666296G>A		64	2.99	2		NA	NA	NA	36785454	143	34.10	74		Silent	SNP	HMMPfam_BK_channel_a,HMMPfam_Ion_trans,superfamily_NAD(P)-bd,superfamily_SSF81324	p.A239	ENST00000399881.3	37	c.717	CCDS55220.1	8																																																																																			-	HMMPfam_Ion_trans,superfamily_SSF81324		0.448	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	protein_coding	OTTHUMT00000376631.1	G	NM_001031836		36785454	+1	no_errors	NM_001031836.2	genbank	human	validated	54_36p	silent	SNP	1.000	A
SLC25A5P8	392301	genome.wustl.edu	37	9	32333505	32333505	+	IGR	SNP	C	C	T			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr9:32333505C>T								RNA5SP281 (39815 upstream) : ACO1 (51112 downstream)																							AAAGCACCACCCATGCCTCTG	0.433																																						dbGAP											0			9																																								32323505	SO:0001628	intergenic_variant	0																															9.37:g.32333505C>T		89	6.32	6		53	0.00	0	32323505	280	36.84	168		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.433					LOC392301			C			32323505	-1	pseudogene	XR_017331.2	genbank	human	model	54_36p	rna	SNP	1.000	T
KCNE3	10008	genome.wustl.edu	37	11	74168526	74168526	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr11:74168526T>C	ENST00000310128.4	-	3	502	c.83A>G	c.(82-84)aAt>aGt	p.N28S	KCNE3_ENST00000525550.1_Missense_Mutation_p.N28S|RP11-702H23.4_ENST00000533008.1_RNA|RP11-702H23.6_ENST00000530510.1_RNA	NM_005472.4	NP_005463.1	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related family, member 3	28					regulation of potassium ion transport (GO:0043266)	integral component of membrane (GO:0016021)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			cervix(1)|large_intestine(1)|lung(1)|ovary(1)	4	Breast(11;2.86e-06)					GCAGAGCAAATTGCTGTGAAG	0.562																																						dbGAP											0			11											80.0	74.0	76.0					11																	74168526		2200	4293	6493	73846174	SO:0001583	missense	0			AF076531	CCDS8232.1	11q13.4	2014-09-17				ENSG00000175538		"""Potassium channels"""	6243	protein-coding gene	gene with protein product		604433				10219239	Standard	NM_005472		Approved	MiRP2, HOKPP	uc001ovc.3	Q9Y6H6		ENST00000310128.4:c.83A>G	11.37:g.74168526T>C	ENSP00000310557:p.Asn28Ser	38	2.56	1		20	44.44	16	73846174	77	30.09	34		Missense_Mutation	SNP	NULL	p.N28S	ENST00000310128.4	37	c.83	CCDS8232.1	11	.	.	.	.	.	.	.	.	.	.	T	6.314	0.426031	0.11987	.	.	ENSG00000175538	ENST00000310128;ENST00000525550;ENST00000532569;ENST00000531854;ENST00000529425	D;D;D;T;T	0.85556	-2.0;-2.0;-2.0;-1.03;-0.62	5.01	3.89	0.44902	.	0.597000	0.16923	N	0.194007	T	0.60843	0.2300	N	0.03608	-0.345	0.22366	N	0.999163	B	0.02656	0.0	B	0.04013	0.001	T	0.51803	-0.8659	10	0.06365	T	0.9	-6.1159	5.6393	0.17554	0.0:0.1812:0.0:0.8188	.	28	Q9Y6H6	KCNE3_HUMAN	S	28	ENSP00000310557:N28S;ENSP00000433633:N28S;ENSP00000431739:N28S;ENSP00000433697:N28S;ENSP00000434890:N28S	ENSP00000310557:N28S	N	-	2	0	KCNE3	73846174	0.386000	0.25180	1.000000	0.80357	0.129000	0.20672	0.525000	0.22956	2.220000	0.72140	0.459000	0.35465	AAT	-	NULL		0.562	KCNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNE3	protein_coding	OTTHUMT00000385531.1	T	NM_005472		73846174	-1	no_errors	NM_005472.4	genbank	human	reviewed	54_36p	missense	SNP	0.512	C
CKAP4	10970	genome.wustl.edu	37	12	106633326	106633326	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr12:106633326G>A	ENST00000378026.4	-	2	1421	c.1285C>T	c.(1285-1287)Cgc>Tgc	p.R429C	CKAP4_ENST00000552828.1_5'Flank	NM_006825.3	NP_006816.2	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	429						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|pancreas(1)|urinary_tract(1)	20						TCGGTCTGGCGCGCAGAAGCC	0.662																																						dbGAP											0			12											46.0	49.0	48.0					12																	106633326		2203	4300	6503	105157456	SO:0001583	missense	0			X69910	CCDS9103.1	12q23.3	2006-06-23				ENSG00000136026			16991	protein-coding gene	gene with protein product						8314870	Standard	NM_006825		Approved	P63, CLIMP-63, ERGIC-63	uc001tlk.3	Q07065		ENST00000378026.4:c.1285C>T	12.37:g.106633326G>A	ENSP00000367265:p.Arg429Cys	14	0.00	0		25	28.57	10	105157456	65	15.58	12	Q504S5|Q53ES6	Missense_Mutation	SNP	NULL	p.R429C	ENST00000378026.4	37	c.1285	CCDS9103.1	12	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153312	0.38021	.	.	ENSG00000136026	ENST00000378026	T	0.78816	-1.21	5.95	4.01	0.46588	.	0.961040	0.08746	N	0.899837	T	0.80407	0.4617	M	0.65975	2.015	0.09310	N	1	D	0.69078	0.997	P	0.46975	0.533	T	0.69705	-0.5073	10	0.66056	D	0.02	-8.5826	12.8386	0.57788	0.0:0.0:0.7055:0.2945	.	429	Q07065	CKAP4_HUMAN	C	429	ENSP00000367265:R429C	ENSP00000367265:R429C	R	-	1	0	CKAP4	105157456	0.001000	0.12720	0.005000	0.12908	0.490000	0.33462	1.188000	0.32102	1.500000	0.48636	0.655000	0.94253	CGC	-	NULL		0.662	CKAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP4	protein_coding	OTTHUMT00000407196.1	G			105157456	-1	no_errors	NM_006825.3	genbank	human	validated	54_36p	missense	SNP	0.000	A
FLT3	2322	genome.wustl.edu	37	13	28592642	28592642	+	Missense_Mutation	SNP	C	C	G	rs121913486|rs121913488		TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr13:28592642C>G	ENST00000241453.7	-	20	2584	c.2503G>C	c.(2503-2505)Gat>Cat	p.D835H	FLT3_ENST00000380982.4_Missense_Mutation_p.D835H|FLT3_ENST00000537084.1_Intron	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	835	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> E (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608, ECO:0000269|PubMed:14504097}.|D -> H (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608, ECO:0000269|PubMed:11442493, ECO:0000269|PubMed:14504097}.|D -> N (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608}.|D -> V (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608}.|D -> Y (in acute lymphoblastic leukemia patients and in acute myelogenous leukemia patients; somatic mutation; constitutively activated). {ECO:0000269|PubMed:11290608, ECO:0000269|PubMed:11442493, ECO:0000269|PubMed:14504097}.		B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.D835Y(190)|p.D835H(30)|p.?(23)|p.D835N(6)|p.D835del(1)|p.R834_D835del(1)|p.D835F(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCATGATATCTCGAGCCAAT	0.453			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	252	Substitution - Missense(227)|Unknown(23)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(252)	13											187.0	141.0	156.0					13																	28592642		2203	4300	6503	27490642	SO:0001583	missense	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2503G>C	13.37:g.28592642C>G	ENSP00000241453:p.Asp835His	44	0.00	0		401	43.78	313	27490642	100	30.46	46	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	p.D835H	ENST00000241453.7	37	c.2503	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006191	0.93287	.	.	ENSG00000122025	ENST00000241453;ENST00000380982	D;D	0.83837	-1.77;-1.77	5.84	5.84	0.93424	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.074843	0.56097	D	0.000030	D	0.89378	0.6698	L	0.47016	1.485	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89468	0.3741	10	0.87932	D	0	.	20.221	0.98325	0.0:1.0:0.0:0.0	.	835	P36888	FLT3_HUMAN	H	835	ENSP00000241453:D835H;ENSP00000370369:D835H	ENSP00000241453:D835H	D	-	1	0	FLT3	27490642	1.000000	0.71417	0.960000	0.40013	0.940000	0.58332	7.815000	0.86186	2.792000	0.96026	0.556000	0.70494	GAT	-	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,superfamily_Kinase_like		0.453	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	protein_coding	OTTHUMT00000044319.2	C			27490642	-1	no_errors	NM_004119.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MBTPS1	8720	genome.wustl.edu	37	16	84101360	84101360	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr16:84101360C>T	ENST00000343411.3	-	16	2635	c.2140G>A	c.(2140-2142)Gtg>Atg	p.V714M	MBTPS1_ENST00000569770.1_5'Flank	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	714					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CCGTTGTCCACGTCCCTCCGG	0.473																																						dbGAP											0			16											119.0	99.0	106.0					16																	84101360		2200	4300	6500	82658861	SO:0001583	missense	0			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.2140G>A	16.37:g.84101360C>T	ENSP00000344223:p.Val714Met	29	3.33	1		39	40.00	26	82658861	84	38.41	53	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	HMMPfam_Peptidase_S8,PatternScan_SUBTILASE_ASP,PatternScan_SUBTILASE_HIS,PatternScan_SUBTILASE_SER,superfamily_Pept_S8_S53	p.V714M	ENST00000343411.3	37	c.2140	CCDS10941.1	16	.	.	.	.	.	.	.	.	.	.	C	17.75	3.467255	0.63625	.	.	ENSG00000140943	ENST00000343411;ENST00000347334	T	0.51325	0.71	5.91	3.94	0.45596	.	0.209160	0.49916	D	0.000132	T	0.65101	0.2659	M	0.79475	2.455	0.45161	D	0.99817	D	0.65815	0.995	P	0.61592	0.891	T	0.70880	-0.4752	10	0.72032	D	0.01	-14.9766	13.0968	0.59197	0.0:0.8689:0.0:0.1311	.	714	Q14703	MBTP1_HUMAN	M	714;159	ENSP00000344223:V714M	ENSP00000344223:V714M	V	-	1	0	MBTPS1	82658861	0.999000	0.42202	0.947000	0.38551	0.465000	0.32709	3.732000	0.55021	1.500000	0.48636	0.655000	0.94253	GTG	-	NULL		0.473	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS1	protein_coding	OTTHUMT00000269080.2	C	NM_003791		82658861	-1	no_errors	NM_003791.2	genbank	human	reviewed	54_36p	missense	SNP	0.992	T
CIC	23152	genome.wustl.edu	37	19	42791518	42791518	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr19:42791518G>A	ENST00000575354.2	+	4	539	c.499G>A	c.(499-501)Gga>Aga	p.G167R	CIC_ENST00000572681.2_Missense_Mutation_p.G1076R|CIC_ENST00000160740.3_Missense_Mutation_p.G167R	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	167					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				TCTACCGCCCGGAAAACGTCG	0.607			"""Mis, F, S"""		oligodendroglioma																																	dbGAP		Rec	yes		19	19q13.2	23152	capicua homolog		O	0			19											115.0	112.0	113.0					19																	42791518		2203	4300	6503	47483358	SO:0001583	missense	0			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.499G>A	19.37:g.42791518G>A	ENSP00000458663:p.Gly167Arg	30	3.23	1		47	58.26	67	47483358	91	28.91	37	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	HMMPfam_HMG_box,HMMSmart_HMG,superfamily_HMG-box	p.G167R	ENST00000575354.2	37	c.499	CCDS12601.1	19	.	.	.	.	.	.	.	.	.	.	G	15.72	2.918253	0.52546	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.36	3.33	0.38152	.	.	.	.	.	T	0.40886	0.1135	N	0.19112	0.55	0.38927	D	0.957858	B	0.21520	0.057	B	0.13407	0.009	T	0.40905	-0.9538	8	0.87932	D	0	-7.3609	10.0287	0.42087	0.099:0.0:0.901:0.0	.	167	Q96RK0	CIC_HUMAN	R	167	.	ENSP00000160740:G167R	G	+	1	0	CIC	47483358	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	6.470000	0.73558	1.080000	0.41073	0.555000	0.69702	GGA	-	NULL		0.607	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	protein_coding	OTTHUMT00000438532.2	G			47483358	+1	no_errors	NM_015125.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
ARHGAP40	343578	genome.wustl.edu	37	20	37257579	37257579	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr20:37257579T>C	ENST00000373345.4	+	4	577	c.409T>C	c.(409-411)Tca>Cca	p.S137P		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	137					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						GAAAATGTCGTCAGAGAATGG	0.527																																						dbGAP											0			20											62.0	60.0	61.0					20																	37257579		692	1591	2283	36690993	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.409T>C	20.37:g.37257579T>C	ENSP00000362442:p.Ser137Pro	320	1.84	6		NA	NA	NA	36690993	399	31.98	189		Missense_Mutation	SNP	HMMPfam_RhoGAP,HMMSmart_SM00324,superfamily_GTPase activation domain GAP	p.S137P	ENST00000373345.4	37	c.409		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.008|5.008	0.187141|0.187141	0.09547|0.09547	.|.	.|.	ENSG00000124143|ENSG00000124143	ENST00000373345|ENST00000243967	T|.	0.24908|.	1.83|.	3.93|3.93	1.44|1.44	0.22558|0.22558	.|.	.|.	.|.	.|.	.|.	T|T	0.16981|0.16981	0.0408|0.0408	N|N	0.12182|0.12182	0.205|0.205	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.21415|0.21415	-1.0246|-1.0246	7|5	0.27785|.	T|.	0.31|.	.|.	3.2756|3.2756	0.06897|0.06897	0.0:0.1341:0.2446:0.6212|0.0:0.1341:0.2446:0.6212	.|.	.|.	.|.	.|.	P|A	137|77	ENSP00000362442:S137P|.	ENSP00000362442:S137P|.	S|V	+|+	1|2	0|0	ARHGAP40|ARHGAP40	36690993|36690993	0.221000|0.221000	0.23642|0.23642	0.275000|0.275000	0.24674|0.24674	0.068000|0.068000	0.16541|0.16541	0.341000|0.341000	0.19909|0.19909	0.693000|0.693000	0.31634|0.31634	0.456000|0.456000	0.33151|0.33151	TCA|GTC	-	NULL		0.527	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	C20orf95	protein_coding		T	XM_293123		36690993	+1	no_errors	XM_293123.1	genbank	human	model	54_36p	missense	SNP	0.003	C
TTC3	7267	genome.wustl.edu	37	21	38538290	38538290	+	Silent	SNP	C	C	T	rs138345072	byFrequency	TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr21:38538290C>T	ENST00000399017.2	+	33	6521	c.3774C>T	c.(3772-3774)tcC>tcT	p.S1258S	TTC3_ENST00000355666.1_Silent_p.S1258S|TTC3_ENST00000354749.2_Silent_p.S1258S|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1258					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				AACCAGTATCCGACAATTCTT	0.448													C|||	4	0.000798722	0.003	0.0	5008	,	,		18248	0.0		0.0	False		,,,				2504	0.0				Ovarian(38;194 1649 35661)	dbGAP											0			21						C	,	13,4393	16.8+/-37.8	0,13,2190	63.0	70.0	68.0		3774,3774	-7.7	0.0	21	dbSNP_134	68	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TTC3	NM_001001894.1,NM_003316.3	,	0,13,6490	TT,TC,CC		0.0,0.2951,0.1	,	1258/2026,1258/2026	38538290	13,12993	2203	4300	6503	37460160	SO:0001819	synonymous_variant	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3774C>T	21.37:g.38538290C>T		37	5.13	2		29	61.84	47	37460160	89	37.24	54	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	HMMPfam_TPR_1,HMMSmart_RING,HMMPfam_zf-C3HC4,HMMSmart_TPR,superfamily_Spectrin,superfamily_SSF48452,superfamily_SSF57850	p.S1258	ENST00000399017.2	37	c.3774	CCDS13651.1	21																																																																																			-	superfamily_Spectrin,superfamily_SSF48452		0.448	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	protein_coding	OTTHUMT00000194776.1	C			37460160	+1	no_errors	NM_001001894.1	genbank	human	validated	54_36p	silent	SNP	0.000	T
ATF7IP	55729	genome.wustl.edu	37	12	14619468	14619471	+	Frame_Shift_Del	DEL	ACAA	ACAA	-			TCGA-AB-2910-03A-01W-0745-08	TCGA-AB-2910-11A-01W-0745-08	ACAA	ACAA	ACAA	-	ACAA	ACAA	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	14873dc1-e10c-4d0f-b047-6ff5eb91f6fa	8dd5ac8c-f1e2-418b-b7a8-6c6ea3eb1f31	g.chr12:14619468_14619471delACAA	ENST00000540793.1	+	9	2961_2964	c.2806_2809delACAA	c.(2806-2811)acaaacfs	p.TN936fs	ATF7IP_ENST00000543189.1_Frame_Shift_Del_p.TN935fs|ATF7IP_ENST00000261168.4_Frame_Shift_Del_p.TN936fs|ATF7IP_ENST00000536444.1_Frame_Shift_Del_p.TN935fs|ATF7IP_ENST00000544627.1_Frame_Shift_Del_p.TN944fs			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	936					DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AGAAAACCAGACAAACAAAACAAT	0.299																																						dbGAP											0			12																																								14510738	SO:0001589	frameshift_variant	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2806_2809delACAA	12.37:g.14619472_14619475delACAA	ENSP00000444589:p.Thr936fs	NA	NA	NA		NA	NA	NA	14510735	NA	NA	NA	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Frame_Shift_Del	DEL	HMMPfam_fn3,superfamily_Fibronectin type III	p.N937fs	ENST00000540793.1	37	c.2806_2809	CCDS8663.1	12																																																																																			-	NULL		0.299	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	protein_coding	OTTHUMT00000401400.1	ACAA	NM_018179		14510738	+1	no_errors	NM_018179.3	genbank	human	validated	54_36p	frame_shift_del	DEL	0.999:0.994:0.986:0.999	-
