#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CLDN2	9075	genome.wustl.edu	37	X	106145381	106145381	+	Intron	SNP	G	G	A			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chrX:106145381G>A	ENST00000541806.1	+	1	341				RIPPLY1_ENST00000411805.1_Intron|RIPPLY1_ENST00000276173.4_Silent_p.L74L	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2						calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						AAATCCACCAGCTTCCTCATC	0.537																																						dbGAP											0			X											79.0	76.0	77.0					X																	106145381		2026	4161	6187	106032037	SO:0001627	intron_variant	0			AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.-179+1647G>A	X.37:g.106145381G>A		124	4.62	6		NA	NA	NA	106032037	40	69.50	98	B2R6B9	Silent	SNP	NULL	p.L74	ENST00000541806.1	37	c.220	CCDS14524.1	X																																																																																			-	NULL		0.537	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPPLY1	protein_coding	OTTHUMT00000057815.1	G			106032037	-1	no_errors	NM_138382.1	genbank	human	provisional	54_36p	silent	SNP	0.000	A
EPHA10	284656	genome.wustl.edu	37	1	38186502	38186502	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr1:38186502T>C	ENST00000373048.4	-	12	2160	c.2161A>G	c.(2161-2163)Att>Gtt	p.I721V	EPHA10_ENST00000540011.1_3'UTR|EPHA10_ENST00000330210.7_Missense_Mutation_p.I216V|EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000427468.2_Missense_Mutation_p.I721V	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	721	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TCGGTGACAATCATCAAGGTG	0.592																																						dbGAP											0			1											72.0	80.0	78.0					1																	38186502		2040	4180	6220	37959089	SO:0001583	missense	0			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2161A>G	1.37:g.38186502T>C	ENSP00000362139:p.Ile721Val	164	1.79	3		NA	NA	NA	37959089	61	41.35	43	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	HMMPfam_Ephrin_lbd,HMMSmart_SM00615,HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,PatternScan_RECEPTOR_TYR_KIN_V_1,PatternScan_RECEPTOR_TYR_KIN_V_2,HMMPfam_SAM_1,HMMSmart_SM00454,HMMSmart_SM00220,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,superfamily_Galactose-binding domain-like,superfamily_SAM/Pointed domain,superfamily_Protein kinase-like (PK-like),PatternScan_EGF_2	p.I721V	ENST00000373048.4	37	c.2161	CCDS41305.1	1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.221922	0.58560	.	.	ENSG00000183317	ENST00000330210;ENST00000427468;ENST00000373048	D;D;D	0.83992	-1.79;-1.79;-1.79	4.57	4.57	0.56435	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33813	N	0.004534	D	0.82595	0.5071	L	0.39633	1.23	0.80722	D	1	P	0.48294	0.908	P	0.51079	0.658	D	0.84880	0.0830	10	0.87932	D	0	.	13.4352	0.61079	0.0:0.0:0.0:1.0	.	721	Q5JZY3	EPHAA_HUMAN	V	216;721;721	ENSP00000330379:I216V;ENSP00000397746:I721V;ENSP00000362139:I721V	ENSP00000330379:I216V	I	-	1	0	EPHA10	37959089	1.000000	0.71417	0.985000	0.45067	0.798000	0.45092	7.948000	0.87774	1.832000	0.53329	0.482000	0.46254	ATT	-	HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like)		0.592	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	protein_coding	OTTHUMT00000012497.2	T	NM_173641		37959089	-1	no_errors	NM_001099439.1	genbank	human	validated	54_36p	missense	SNP	1.000	C
DNMT3A	1788	genome.wustl.edu	37	2	25463307	25463307	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr2:25463307C>T	ENST00000264709.3	-	19	2523	c.2186G>A	c.(2185-2187)cGg>cAg	p.R729Q	DNMT3A_ENST00000402667.1_Missense_Mutation_p.R506Q|DNMT3A_ENST00000474887.1_5'UTR|DNMT3A_ENST00000380746.4_Missense_Mutation_p.R540Q|DNMT3A_ENST00000321117.5_Missense_Mutation_p.R729Q	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	729	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAGAAGAGCCGGCCAGTGCC	0.612			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0			2											55.0	56.0	56.0					2																	25463307		2203	4300	6503	25316811	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2186G>A	2.37:g.25463307C>T	ENSP00000264709:p.Arg729Gln	77	2.53	2		19	44.12	15	25316811	34	48.48	32	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	HMMPfam_PWWP,HMMSmart_SM00293,HMMPfam_DNA_methylase,superfamily_FYVE/PHD zinc finger,PatternScan_C5_MTASE_1,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,superfamily_Tudor/PWWP/MBT	p.R729Q	ENST00000264709.3	37	c.2186	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.316268	0.95655	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.87067	0.6085	L	0.33668	1.02	0.80722	D	1	D;D	0.89917	0.985;1.0	P;D	0.85130	0.473;0.997	D	0.87440	0.2394	10	0.51188	T	0.08	-10.1334	17.6755	0.88229	0.0:1.0:0.0:0.0	.	729;540	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	Q	540;729;729;506	ENSP00000370122:R540Q;ENSP00000324375:R729Q;ENSP00000264709:R729Q;ENSP00000384237:R506Q	ENSP00000264709:R729Q	R	-	2	0	DNMT3A	25316811	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.540000	0.85666	0.561000	0.74099	CGG	-	HMMPfam_DNA_methylase,superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.612	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	C	NM_022552		25316811	-1	no_errors	NM_022552.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DNMT3A	1788	genome.wustl.edu	37	2	25467022	25467022	+	Splice_Site	SNP	A	A	G			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr2:25467022A>G	ENST00000264709.3	-	15	2189		c.e15+1		DNMT3A_ENST00000402667.1_Splice_Site|DNMT3A_ENST00000474887.1_Splice_Site|DNMT3A_ENST00000380746.4_Splice_Site|DNMT3A_ENST00000321117.5_Splice_Site	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha						C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCAGCACTCACAAATTCCTG	0.647			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0			2											31.0	36.0	35.0					2																	25467022		2203	4300	6503	25320526	SO:0001630	splice_region_variant	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1851+1T>C	2.37:g.25467022A>G		55	5.17	3		0	100.00	7	25320526	44	34.78	24	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Splice_Site	SNP	-	e14+2	ENST00000264709.3	37	c.1851+2	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	A	21.8	4.205852	0.79127	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4285	0.61039	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNMT3A	25320526	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.320000	0.96346	1.907000	0.55213	0.533000	0.62120	.	-	-		0.647	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	A	NM_022552	Intron	25320526	-1	no_errors	NM_022552.3	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	G
BSN	8927	genome.wustl.edu	37	3	49701907	49701907	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr3:49701907A>G	ENST00000296452.4	+	9	11774	c.11660A>G	c.(11659-11661)cAg>cGg	p.Q3887R		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3887					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCCGCCGGCCAGCCAGGTGCC	0.622																																						dbGAP											0			3											52.0	62.0	59.0					3																	49701907		2203	4300	6503	49676911	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.11660A>G	3.37:g.49701907A>G	ENSP00000296452:p.Gln3887Arg	52	3.70	2		NA	NA	NA	49676911	43	30.16	19	O43161|Q7LGH3	Missense_Mutation	SNP	HMMPfam_zf-piccolo,superfamily_FYVE_PHD_ZnF	p.Q3887R	ENST00000296452.4	37	c.11660	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	A	14.32	2.500042	0.44455	.	.	ENSG00000164061	ENST00000296452	T	0.23754	1.89	4.88	4.88	0.63580	.	0.142319	0.47455	D	0.000228	T	0.43787	0.1263	L	0.53249	1.67	0.54753	D	0.999986	D	0.76494	0.999	D	0.63488	0.915	T	0.40534	-0.9558	10	0.72032	D	0.01	-14.0702	14.1734	0.65525	1.0:0.0:0.0:0.0	.	3887	Q9UPA5	BSN_HUMAN	R	3887	ENSP00000296452:Q3887R	ENSP00000296452:Q3887R	Q	+	2	0	BSN	49676911	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	6.968000	0.76086	1.831000	0.53308	0.459000	0.35465	CAG	-	NULL		0.622	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	A	NM_003458		49676911	+1	no_errors	NM_003458.3	genbank	human	validated	54_36p	missense	SNP	1.000	G
GABRB1	2560	genome.wustl.edu	37	4	47405449	47405449	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr4:47405449C>T	ENST00000295454.3	+	6	951	c.659C>T	c.(658-660)tCt>tTt	p.S220F	GABRB1_ENST00000538619.1_Missense_Mutation_p.S150F	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	220					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAGATGGTGTCTAAGAAGGTG	0.413																																						dbGAP											0			4											122.0	116.0	118.0					4																	47405449		2203	4300	6503	47100206	SO:0001583	missense	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.659C>T	4.37:g.47405449C>T	ENSP00000295454:p.Ser220Phe	447	3.40	16		0	100.00	1	47100206	146	31.36	69	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	HMMPfam_Neur_chan_memb,superfamily_Neu_channel_TM,HMMPfam_Neur_chan_LBD,superfamily_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL	p.S220F	ENST00000295454.3	37	c.659	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026743	0.93518	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	T;T	0.77620	-1.11;-1.11	5.43	5.43	0.79202	Neurotransmitter-gated ion-channel ligand-binding (3);	0.075833	0.53938	D	0.000043	D	0.87645	0.6229	M	0.67517	2.055	0.80722	D	1	P;D	0.76494	0.899;0.999	P;D	0.87578	0.673;0.998	D	0.87759	0.2597	10	0.66056	D	0.02	-19.7617	19.428	0.94751	0.0:1.0:0.0:0.0	.	150;220	F5GXV5;P18505	.;GBRB1_HUMAN	F	220;150	ENSP00000295454:S220F;ENSP00000440330:S150F	ENSP00000295454:S220F	S	+	2	0	GABRB1	47100206	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.824000	0.97209	0.655000	0.94253	TCT	-	HMMPfam_Neur_chan_LBD,superfamily_Neur_chan_LBD		0.413	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	protein_coding	OTTHUMT00000216896.1	C			47100206	+1	no_errors	NM_000812.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CUL9	23113	genome.wustl.edu	37	6	43166449	43166449	+	Missense_Mutation	SNP	G	G	A	rs145736095	byFrequency	TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr6:43166449G>A	ENST00000252050.4	+	12	2990	c.2906G>A	c.(2905-2907)cGt>cAt	p.R969H	CUL9_ENST00000354495.3_Missense_Mutation_p.R859H|CUL9_ENST00000372647.2_Missense_Mutation_p.R969H	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	969					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GACTTGGAGCGTGTGCTGTGC	0.637																																						dbGAP											0			6						G	HIS/ARG	0,4406		0,0,2203	101.0	105.0	103.0		2906	1.1	0.3	6	dbSNP_134	103	3,8597	3.0+/-9.4	0,3,4297	no	missense	CUL9	NM_015089.2	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	969/2518	43166449	3,13003	2203	4300	6503	43274427	SO:0001583	missense	0			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2906G>A	6.37:g.43166449G>A	ENSP00000252050:p.Arg969His	361	2.96	11		31	40.38	21	43274427	116	44.50	93	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	"HMMPfam_Cullin,HMMPfam_IBR,HMMSmart_SM00647,HMMPfam_APC10,superfamily_Galactose-binding domain-like,superfamily_ARM repeat,PatternScan_CULLIN_1,superfamily_Cullin homology domain,PatternScan_ZF_RING_1,PatternScan_CYTOCHROME_P450,superfamily_""Winged helix"" DNA-binding domain,superfamily_RING/U-box"	p.R969H	ENST00000252050.4	37	c.2906	CCDS4890.1	6	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370092	0.24771	0.0	3.49E-4	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.74947	-0.88;-0.89;-0.78	5.28	1.12	0.20585	Armadillo-type fold (1);	0.755542	0.12633	N	0.452046	T	0.44371	0.1290	L	0.48642	1.525	0.30173	N	0.801117	B;B;B	0.17268	0.021;0.003;0.003	B;B;B	0.17433	0.018;0.003;0.003	T	0.23332	-1.0191	10	0.49607	T	0.09	-10.9358	4.5832	0.12269	0.2897:0.1599:0.5504:0.0	.	859;969;969	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	H	969;859;969	ENSP00000252050:R969H;ENSP00000346490:R859H;ENSP00000361730:R969H	ENSP00000252050:R969H	R	+	2	0	CUL9	43274427	0.984000	0.35163	0.262000	0.24481	0.496000	0.33645	2.055000	0.41345	0.191000	0.20236	0.555000	0.69702	CGT	-	superfamily_ARM repeat		0.637	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	protein_coding	OTTHUMT00000040582.2	G	NM_015089		43274427	+1	no_errors	NM_015089.2	genbank	human	validated	54_36p	missense	SNP	0.201	A
CCL21	6366	genome.wustl.edu	37	9	34710059	34710059	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr9:34710059G>A	ENST00000259607.2	-	1	62	c.5C>T	c.(4-6)gCt>gTt	p.A2V	CCL21_ENST00000378792.1_Missense_Mutation_p.A2V	NM_002989.2	NP_002980.1	O00585	CCL21_HUMAN	chemokine (C-C motif) ligand 21	2					activation of Rho GTPase activity (GO:0032862)|cell chemotaxis (GO:0060326)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|dendritic cell chemotaxis (GO:0002407)|dendritic cell dendrite assembly (GO:0097026)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|immunological synapse formation (GO:0001771)|inflammatory response (GO:0006954)|mesangial cell-matrix adhesion (GO:0035759)|negative regulation of dendritic cell dendrite assembly (GO:2000548)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of leukocyte tethering or rolling (GO:1903237)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of chemotaxis (GO:0050921)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process (GO:0010560)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myeloid dendritic cell chemotaxis (GO:2000529)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of T cell migration (GO:2000406)|release of sequestered calcium ion into cytosol (GO:0051209)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)|T cell costimulation (GO:0031295)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR7 chemokine receptor binding (GO:0031732)|chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)			large_intestine(4)	4	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CAGTGACTGAGCCATGTCTGT	0.607																																						dbGAP											0			9											52.0	46.0	48.0					9																	34710059		2203	4300	6503	34700059	SO:0001583	missense	0			AB002409	CCDS6571.1	9p13	2014-05-16	2002-08-22	2002-08-23	ENSG00000137077	ENSG00000137077		"""Chemokine ligands"", ""Endogenous ligands"""	10620	protein-coding gene	gene with protein product	"""beta chemokine exodus-2"", ""secondary lymphoid tissue chemokine"", ""Efficient Chemoattractant for Lymphocytes"""	602737	"""small inducible cytokine subfamily A (Cys-Cys), member 21"""	SCYA21		9235955	Standard	NM_002989		Approved	SLC, exodus-2, TCA4, CKb9, 6Ckine, ECL	uc003zvo.4	O00585	OTTHUMG00000019838	ENST00000259607.2:c.5C>T	9.37:g.34710059G>A	ENSP00000259607:p.Ala2Val	293	2.96	9		NA	NA	NA	34700059	231	38.44	148		Missense_Mutation	SNP	HMMPfam_IL8,HMMSmart_SM00199,superfamily_Interleukin 8-like chemokines	p.A2V	ENST00000259607.2	37	c.5	CCDS6571.1	9	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005856	0.74932	.	.	ENSG00000137077	ENST00000259607;ENST00000378792	T;T	0.03212	4.01;4.07	5.59	4.67	0.58626	.	1.914730	0.02511	N	0.091549	T	0.07638	0.0192	L	0.56769	1.78	0.29859	N	0.827811	B	0.30793	0.295	B	0.31686	0.134	T	0.52071	-0.8624	10	0.15499	T	0.54	-1.7629	12.5625	0.56291	0.0:0.1673:0.8327:0.0	.	2	O00585	CCL21_HUMAN	V	2	ENSP00000259607:A2V;ENSP00000368069:A2V	ENSP00000259607:A2V	A	-	2	0	CCL21	34700059	1.000000	0.71417	0.999000	0.59377	0.625000	0.37756	4.347000	0.59373	1.434000	0.47414	0.655000	0.94253	GCT	-	NULL		0.607	CCL21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL21	protein_coding	OTTHUMT00000052245.1	G	NM_002989		34700059	-1	no_errors	NM_002989.2	genbank	human	reviewed	54_36p	missense	SNP	0.983	A
FANCC	2176	genome.wustl.edu	37	9	98011446	98011446	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr9:98011446T>C	ENST00000289081.3	-	2	382	c.128A>G	c.(127-129)gAg>gGg	p.E43G	FANCC_ENST00000375305.1_Missense_Mutation_p.E43G	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	43					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				CCTTAGGAACTCCTGGAACTG	0.433			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0			9											118.0	110.0	113.0					9																	98011446		2203	4300	6503	97051267	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.128A>G	9.37:g.98011446T>C	ENSP00000289081:p.Glu43Gly	263	2.21	6		9	30.77	4	97051267	167	35.63	93	B1ALR8	Missense_Mutation	SNP	HMMPfam_Fanconi_C	p.E43G	ENST00000289081.3	37	c.128	CCDS35071.1	9	.	.	.	.	.	.	.	.	.	.	T	18.79	3.698449	0.68386	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.56611	0.45;0.45;0.45	5.13	3.99	0.46301	.	0.288736	0.38663	N	0.001608	T	0.50854	0.1640	M	0.61703	1.905	0.34598	D	0.71625	B;B	0.29162	0.235;0.235	B;B	0.32465	0.146;0.146	T	0.63283	-0.6672	10	0.62326	D	0.03	-7.7197	10.88	0.46933	0.0:0.0735:0.0:0.9265	.	43;43	B1ALR7;Q00597	.;FANCC_HUMAN	G	43	ENSP00000289081:E43G;ENSP00000364454:E43G;ENSP00000406908:E43G	ENSP00000289081:E43G	E	-	2	0	FANCC	97051267	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.065000	0.30592	1.086000	0.41228	0.528000	0.53228	GAG	-	HMMPfam_Fanconi_C		0.433	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	protein_coding	OTTHUMT00000053219.1	T	NM_000136		97051267	-1	no_errors	NM_000136.2	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
AK8	158067	genome.wustl.edu	37	9	135698683	135698683	+	Silent	SNP	C	C	T	rs142140228		TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr9:135698683C>T	ENST00000298545.3	-	9	1319	c.798G>A	c.(796-798)ccG>ccA	p.P266P	AK8_ENST00000477396.1_5'UTR	NM_152572.2	NP_689785.1	Q96MA6	KAD8_HUMAN	adenylate kinase 8	266					nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|kidney(2)|large_intestine(4)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(2)	23						TCGGGGTGAACGGGGCATTAG	0.557																																						dbGAP											0			9						C		0,4406		0,0,2203	132.0	146.0	141.0		798	-8.9	0.6	9	dbSNP_134	141	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AK8	NM_152572.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		266/480	135698683	1,13005	2203	4300	6503	134688504	SO:0001819	synonymous_variant	0			AK093446	CCDS6954.1	9q34.13	2013-04-29	2010-12-07	2010-12-07	ENSG00000165695	ENSG00000165695	2.7.4.3	"""Adenylate kinases"""	26526	protein-coding gene	gene with protein product		615365	"""chromosome 9 open reading frame 98"""	C9orf98		21080915	Standard	NM_152572		Approved	FLJ32704	uc004cbu.1	Q96MA6	OTTHUMG00000021009	ENST00000298545.3:c.798G>A	9.37:g.135698683C>T		189	3.00	6		NA	NA	NA	134688504	144	30.48	64	A8K821|Q8N9W9	Silent	SNP	"HMMPfam_ADK,superfamily_Microbial and mitochondrial ADK insert ""zinc finger"" domain,superfamily_P-loop containing nucleoside triphosphate hydrolases"	p.P266	ENST00000298545.3	37	c.798	CCDS6954.1	9																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.557	AK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf98	protein_coding	OTTHUMT00000055413.1	C	NM_152572		134688504	-1	no_errors	NM_152572.2	genbank	human	validated	54_36p	silent	SNP	0.982	T
MAP6	4135	genome.wustl.edu	37	11	75316878	75316878	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr11:75316878T>A	ENST00000304771.3	-	3	2041	c.1291A>T	c.(1291-1293)Aac>Tac	p.N431Y	MAP6_ENST00000434603.2_Missense_Mutation_p.N431Y|MAP6_ENST00000526740.1_Missense_Mutation_p.N102Y	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	431					dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)		p.N431H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					AGTTTATTGTTCATCTCTTTG	0.488																																					Esophageal Squamous(181;1115 2007 8647 17065 22697)	dbGAP											1	Substitution - Missense(1)	prostate(1)	11											166.0	139.0	148.0					11																	75316878		2200	4293	6493	74994526	SO:0001583	missense	0			AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.1291A>T	11.37:g.75316878T>A	ENSP00000307093:p.Asn431Tyr	382	3.27	13		NA	NA	NA	74994526	106	39.77	70	A7E2A1|Q6P3T0|Q6ZWB8	Missense_Mutation	SNP	HMMPfam_STOP	p.N431Y	ENST00000304771.3	37	c.1291	CCDS31641.1	11	.	.	.	.	.	.	.	.	.	.	T	23.7	4.448456	0.84101	.	.	ENSG00000171533	ENST00000304771;ENST00000526740;ENST00000545476;ENST00000434603	T;T	0.53640	0.61;0.69	5.39	5.39	0.77823	.	0.000000	0.52532	D	0.000073	T	0.59280	0.2182	M	0.64997	1.995	0.49213	D	0.999762	D	0.89917	1.0	D	0.69142	0.962	T	0.58651	-0.7599	10	0.02654	T	1	-21.1195	14.5299	0.67917	0.0:0.0:0.0:1.0	.	431	Q96JE9	MAP6_HUMAN	Y	431;102;102;431	ENSP00000307093:N431Y;ENSP00000415108:N431Y	ENSP00000307093:N431Y	N	-	1	0	MAP6	74994526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.162000	0.67917	0.533000	0.62120	AAC	-	HMMPfam_STOP		0.488	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP6	protein_coding	OTTHUMT00000383527.1	T	NM_033063		74994526	-1	no_errors	NM_033063.1	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
C11orf70	85016	genome.wustl.edu	37	11	101953911	101953911	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr11:101953911G>A	ENST00000434758.2	+	7	813	c.785G>A	c.(784-786)gGt>gAt	p.G262D		NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	262										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		CACTGTTATGGTGTGGGAGAC	0.323																																						dbGAP											0			11											196.0	183.0	187.0					11																	101953911		2203	4299	6502	101459121	SO:0001583	missense	0			AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.785G>A	11.37:g.101953911G>A	ENSP00000414390:p.Gly262Asp	243	2.39	6		NA	NA	NA	101459121	65	38.68	41	E9PJU1	Missense_Mutation	SNP	NULL	p.G224D	ENST00000434758.2	37	c.671	CCDS8313.2	11	.	.	.	.	.	.	.	.	.	.	G	16.93	3.259090	0.59321	.	.	ENSG00000137691	ENST00000434758;ENST00000423732	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.83473	0.5262	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85522	0.1204	9	0.87932	D	0	-18.6337	17.2222	0.86960	0.0:0.0:1.0:0.0	.	262	Q9BRQ4	CK070_HUMAN	D	262;224	.	ENSP00000392150:G224D	G	+	2	0	C11orf70	101459121	1.000000	0.71417	0.976000	0.42696	0.077000	0.17291	7.714000	0.84703	2.668000	0.90789	0.591000	0.81541	GGT	-	NULL		0.323	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf70	protein_coding	OTTHUMT00000394144.1	G	NM_032930		101459121	+1	no_errors	NM_032930.1	genbank	human	predicted	54_36p	missense	SNP	1.000	A
ETV6	2120	genome.wustl.edu	37	12	12038959	12038959	+	Splice_Site	SNP	A	A	G			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr12:12038959A>G	ENST00000396373.4	+	7	1526	c.1252A>G	c.(1252-1254)Agg>Ggg	p.R418G		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	418					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GCTTTTGTTCAGGTAGCACTT	0.443			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	dbGAP		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	0			12											111.0	111.0	111.0					12																	12038959		2203	4300	6503	11930226	SO:0001630	splice_region_variant	0			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1253+1A>G	12.37:g.12038959A>G		255	5.84	16		2	95.24	40	11930226	55	54.47	67	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	"HMMPfam_Ets,HMMSmart_SM00413,PatternScan_ETS_DOMAIN_2,HMMPfam_SAM_PNT,HMMSmart_SM00251,superfamily_SAM/Pointed domain,superfamily_""Winged helix"" DNA-binding domain"	p.R418G	ENST00000396373.4	37	c.1252	CCDS8643.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.84|12.84	2.059353|2.059353	0.36373|0.36373	.|.	.|.	ENSG00000139083|ENSG00000139083	ENST00000266427|ENST00000396373	.|T	.|0.17691	.|2.26	4.95|4.95	4.95|4.95	0.65309|0.65309	.|Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.47544|0.47544	0.1451|0.1451	M|M	0.87097|0.87097	2.86|2.86	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.56848|0.56848	-0.7911|-0.7911	5|10	.|0.87932	.|D	.|0	.|.	14.5783|14.5783	0.68265|0.68265	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|418	.|P41212	.|ETV6_HUMAN	R|G	30|418	.|ENSP00000379658:R418G	.|ENSP00000379658:R418G	Q|R	+|+	2|1	0|2	ETV6|ETV6	11930226|11930226	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.288000|7.288000	0.78691|0.78691	1.992000|1.992000	0.58205|0.58205	0.533000|0.533000	0.62120|0.62120	CAG|AGG	-	"HMMPfam_Ets,HMMSmart_SM00413,superfamily_""Winged helix"" DNA-binding domain"		0.443	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	protein_coding	OTTHUMT00000400130.2	A	NM_001987	Missense_Mutation	11930226	+1	no_errors	NM_001987.4	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CLPX	10845	genome.wustl.edu	37	15	65456447	65456447	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr15:65456447T>C	ENST00000300107.3	-	5	781	c.593A>G	c.(592-594)tAt>tGt	p.Y198C		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	198					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						TATTCTCTTATAATGATTGTA	0.358																																						dbGAP											0			15											93.0	97.0	96.0					15																	65456447		2202	4299	6501	63243500	SO:0001583	missense	0			AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.593A>G	15.37:g.65456447T>C	ENSP00000300107:p.Tyr198Cys	172	3.33	6		23	61.02	36	63243500	77	34.75	41	A1L428|A8K8F1|B9EGI8|Q9H4D9	Missense_Mutation	SNP	HMMSmart_SM00382,HMMPfam_AAA_2,HMMPfam_ClpB_D2-small,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Y198C	ENST00000300107.3	37	c.593	CCDS10202.1	15	.	.	.	.	.	.	.	.	.	.	T	22.6	4.315905	0.81469	.	.	ENSG00000166855	ENST00000300107;ENST00000546194	T	0.27890	1.64	6.06	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.55049	0.1896	M	0.82517	2.595	0.80722	D	1	D;P	0.89917	1.0;0.951	D;P	0.83275	0.996;0.701	T	0.54316	-0.8312	10	0.22706	T	0.39	.	12.5085	0.55995	0.0:0.066:0.0:0.934	.	198;198	Q9H072;O76031	.;CLPX_HUMAN	C	198	ENSP00000300107:Y198C	ENSP00000300107:Y198C	Y	-	2	0	CLPX	63243500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.323000	0.78572	0.528000	0.53228	TAT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.358	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPX	protein_coding	OTTHUMT00000256828.2	T	NM_006660		63243500	-1	no_errors	NM_006660.3	genbank	human	provisional	54_36p	missense	SNP	1.000	C
IDH2	3418	genome.wustl.edu	37	15	90631934	90631934	+	Missense_Mutation	SNP	C	C	T	rs121913502		TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr15:90631934C>T	ENST00000330062.3	-	4	532	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	IDH2_ENST00000539790.1_Missense_Mutation_p.R10Q|IDH2_ENST00000559482.1_Intron|IDH2_ENST00000540499.2_Missense_Mutation_p.R88Q	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	140	Substrate binding. {ECO:0000250}.		R -> G (in D2HGA2). {ECO:0000269|PubMed:20847235}.|R -> Q (in D2HGA2). {ECO:0000269|PubMed:20847235}.		2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R140Q(292)|p.R140L(8)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTTCCGGATAGTTCC	0.537			M		GBM																																	dbGAP		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	300	Substitution - Missense(300)	haematopoietic_and_lymphoid_tissue(300)	15											103.0	103.0	103.0					15																	90631934		2200	4298	6498	88432938	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.419G>A	15.37:g.90631934C>T	ENSP00000331897:p.Arg140Gln	180	4.23	8		220	47.99	203	88432938	78	43.88	61	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R140Q	ENST00000330062.3	37	c.419	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604397	0.66445	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.87179	-2.22;-2.22;-2.22	5.67	4.75	0.60458	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	H	0.96833	3.89	0.48185	D	0.999601	D	0.89917	1.0	D	0.87578	0.998	D	0.96254	0.9185	10	0.87932	D	0	.	12.4459	0.55651	0.0:0.9189:0.0:0.0811	.	140	P48735	IDHP_HUMAN	Q	140;10;88	ENSP00000331897:R140Q;ENSP00000438457:R10Q;ENSP00000446147:R88Q	ENSP00000331897:R140Q	R	-	2	0	IDH2	88432938	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.797000	0.85911	1.397000	0.46682	-0.258000	0.10820	CGG	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.537	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	protein_coding	OTTHUMT00000313426.1	C			88432938	-1	no_errors	NM_002168.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PDCD2L	84306	genome.wustl.edu	37	19	34900370	34900370	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2891-03A-01W-0733-08	TCGA-AB-2891-11A-01W-0732-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	28b7dbc1-ed11-48c8-965f-460700b005d3	c23c8e94-494f-402f-a61e-c38bb20ec809	g.chr19:34900370A>G	ENST00000246535.3	+	4	688	c.641A>G	c.(640-642)tAt>tGt	p.Y214C	PDCD2L_ENST00000587065.2_Intron	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	214					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			CTGAGGGACTATCAGCAGAGA	0.527																																						dbGAP											0			19											121.0	111.0	114.0					19																	34900370		2203	4300	6503	39592210	SO:0001583	missense	0			BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.641A>G	19.37:g.34900370A>G	ENSP00000246535:p.Tyr214Cys	549	3.97	23		2	0.00	0	39592210	107	44.04	85		Missense_Mutation	SNP	HMMPfam_PDCD2_C	p.Y214C	ENST00000246535.3	37	c.641	CCDS12438.1	19	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950231	0.73787	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.86	5.86	0.93980	Programmed cell death protein 2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84800	0.5552	M	0.91612	3.225	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.87234	0.2262	9	0.52906	T	0.07	-20.2242	13.7901	0.63135	1.0:0.0:0.0:0.0	.	214	Q9BRP1	PDD2L_HUMAN	C	214	.	ENSP00000246535:Y214C	Y	+	2	0	PDCD2L	39592210	1.000000	0.71417	0.971000	0.41717	0.961000	0.63080	6.019000	0.70818	2.240000	0.73641	0.533000	0.62120	TAT	-	HMMPfam_PDCD2_C		0.527	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD2L	protein_coding	OTTHUMT00000459251.3	A	NM_032346		39592210	+1	no_errors	NM_032346.1	genbank	human	provisional	54_36p	missense	SNP	0.998	G
