#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
WLS	79971	genome.wustl.edu	37	1	68659721	68659721	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr1:68659721G>C	ENST00000262348.4	-	2	549	c.296C>G	c.(295-297)cCc>cGc	p.P99R	GNG12-AS1_ENST00000420587.1_RNA|GNG12-AS1_ENST00000413628.1_RNA|WLS_ENST00000370971.1_Missense_Mutation_p.P99R|WLS_ENST00000370976.3_Intron|WLS_ENST00000540432.1_Missense_Mutation_p.P99R|WLS_ENST00000354777.2_Missense_Mutation_p.P97R	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator	99					anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)	p.P99R(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						CTCCATGTGGGGGAGGGGAAT	0.453																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	1											191.0	153.0	166.0					1																	68659721		2203	4300	6503	68432309	SO:0001583	missense	0			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.296C>G	1.37:g.68659721G>C	ENSP00000262348:p.Pro99Arg	274	1.79	5		NA	NA	NA	68432309	198	30.66	88	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	Missense_Mutation	SNP	HMMPfam_DUF1171	p.P97R	ENST00000262348.4	37	c.290	CCDS642.1	1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009035	0.54361	.	.	ENSG00000116729	ENST00000540432;ENST00000354777;ENST00000262348;ENST00000530486;ENST00000471243;ENST00000370971	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.27	5.27	0.74061	.	0.104228	0.64402	D	0.000002	T	0.26159	0.0638	M	0.81802	2.56	0.80722	D	1	B;B;B;B	0.32467	0.326;0.372;0.005;0.326	B;B;B;B	0.31614	0.129;0.133;0.007;0.129	T	0.10965	-1.0607	10	0.49607	T	0.09	-11.0637	14.8038	0.69935	0.0:0.144:0.856:0.0	.	99;99;99;97	F5H4K0;Q7Z430;Q5T9L3;Q5T9L3-2	.;.;WLS_HUMAN;.	R	99;97;99;54;54;99	ENSP00000446112:P99R;ENSP00000346829:P97R;ENSP00000262348:P99R;ENSP00000433111:P54R;ENSP00000436196:P54R;ENSP00000360010:P99R	ENSP00000262348:P99R	P	-	2	0	WLS	68432309	1.000000	0.71417	0.922000	0.36590	0.946000	0.59487	5.434000	0.66526	2.615000	0.88500	0.655000	0.94253	CCC	-	NULL		0.453	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR177	protein_coding	OTTHUMT00000025368.1	G	NM_024911		68432309	-1	no_errors	NM_001002292.1	genbank	human	validated	54_36p	missense	SNP	0.975	C
TTN	7273	genome.wustl.edu	37	2	179647547	179647547	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr2:179647547T>C	ENST00000591111.1	-	18	3310	c.3086A>G	c.(3085-3087)tAt>tGt	p.Y1029C	TTN_ENST00000460472.2_Missense_Mutation_p.Y983C|TTN_ENST00000342992.6_Missense_Mutation_p.Y1029C|TTN_ENST00000342175.6_Missense_Mutation_p.Y983C|TTN_ENST00000589042.1_Missense_Mutation_p.Y1029C|TTN_ENST00000359218.5_Missense_Mutation_p.Y983C|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.Y1029C			Q8WZ42	TITIN_HUMAN	titin	32579	Ig-like 3.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Y983C(2)|p.Y1029C(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACAGCCAGATAGCAGGATGT	0.502																																						dbGAP											4	Substitution - Missense(4)	haematopoietic_and_lymphoid_tissue(4)	2											78.0	64.0	69.0					2																	179647547		2203	4300	6503	179355792	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3086A>G	2.37:g.179647547T>C	ENSP00000465570:p.Tyr1029Cys	225	0.88	2		NA	NA	NA	179355792	183	27.95	71	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	PatternScan_THIOL_PROTEASE_HIS,PatternScan_IG_MHC,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,superfamily_SSF48726	p.Y1029C	ENST00000591111.1	37	c.3086		2	.	.	.	.	.	.	.	.	.	.	T	14.82	2.649870	0.47362	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	6.17	6.17	0.99709	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74891	0.3776	L	0.32530	0.975	0.39125	D	0.961744	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.72338	0.964;0.964;0.964;0.964;0.977	T	0.78687	-0.2107	9	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	983;983;983;1029;1029	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	C	1029;983;983;983;983;1029	ENSP00000343764:Y1029C;ENSP00000434586:Y983C;ENSP00000340554:Y983C;ENSP00000352154:Y983C;ENSP00000354117:Y1029C	ENSP00000340554:Y983C	Y	-	2	0	TTN	179355792	1.000000	0.71417	0.960000	0.40013	0.953000	0.61014	6.148000	0.71788	2.371000	0.80710	0.533000	0.62120	TAT	-	HMMPfam_I-set,superfamily_SSF48726		0.502	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179355792	-1	no_errors	NM_133379.3	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FRZB	2487	genome.wustl.edu	37	2	183731076	183731076	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr2:183731076T>C	ENST00000295113.4	-	1	814	c.205A>G	c.(205-207)Atc>Gtc	p.I69V		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	69	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.I69V(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			AACTGCTCGATGGCCAGGATG	0.607																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	2											109.0	89.0	95.0					2																	183731076		2203	4300	6503	183439321	SO:0001583	missense	0			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.205A>G	2.37:g.183731076T>C	ENSP00000295113:p.Ile69Val	744	0.93	7		NA	NA	NA	183439321	205	30.87	92	O00181|Q99686	Missense_Mutation	SNP	superfamily_Frizzled cysteine-rich domain,superfamily_TIMP-like,HMMPfam_NTR,HMMSmart_SM00643,HMMPfam_Fz,HMMSmart_SM00063	p.I69V	ENST00000295113.4	37	c.205	CCDS2286.1	2	.	.	.	.	.	.	.	.	.	.	T	10.86	1.469446	0.26423	.	.	ENSG00000162998	ENST00000295113	T	0.79141	-1.24	4.91	3.76	0.43208	Frizzled domain (5);	0.119302	0.56097	D	0.000031	T	0.64821	0.2633	N	0.25031	0.7	0.50632	D	0.999886	B	0.21688	0.059	B	0.30716	0.119	T	0.55509	-0.8130	10	0.22706	T	0.39	.	10.2962	0.43625	0.0:0.0773:0.0:0.9227	.	69	Q92765	SFRP3_HUMAN	V	69	ENSP00000295113:I69V	ENSP00000295113:I69V	I	-	1	0	FRZB	183439321	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.034000	0.57289	0.899000	0.36444	0.459000	0.35465	ATC	-	superfamily_Frizzled cysteine-rich domain,HMMPfam_Fz,HMMSmart_SM00063		0.607	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRZB	protein_coding	OTTHUMT00000255808.1	T	NM_001463		183439321	-1	no_errors	NM_001463.2	genbank	human	validated	54_36p	missense	SNP	1.000	C
ALS2CR11	151254	genome.wustl.edu	37	2	202400926	202400926	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr2:202400926C>T	ENST00000286195.3	-	13	1368	c.1324G>A	c.(1324-1326)Gtg>Atg	p.V442M	ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.V442M|ALS2CR11_ENST00000439140.1_Missense_Mutation_p.V442M	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	442								p.V442M(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						AATGAGTGCACTTCTGTGGGT	0.403																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	2											169.0	156.0	160.0					2																	202400926		2203	4300	6503	202109171	SO:0001583	missense	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1324G>A	2.37:g.202400926C>T	ENSP00000286195:p.Val442Met	277	1.42	4		NA	NA	NA	202109171	266	35.65	149	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	NULL	p.V442M	ENST00000286195.3	37	c.1324	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989238	0.35131	.	.	ENSG00000155754	ENST00000286195;ENST00000439140;ENST00000450242	T;T;T	0.44482	0.92;0.92;0.92	4.57	-9.14	0.00701	.	5.002730	0.00754	N	0.001094	T	0.25158	0.0611	N	0.22421	0.69	0.09310	N	1	P;P	0.49090	0.919;0.919	P;P	0.45558	0.485;0.485	T	0.48703	-0.9012	10	0.36615	T	0.2	.	1.1364	0.01755	0.3619:0.3382:0.1103:0.1897	.	442;442	E9PGG4;Q53TS8	.;AL2SA_HUMAN	M	442	ENSP00000286195:V442M;ENSP00000409937:V442M;ENSP00000399016:V442M	ENSP00000286195:V442M	V	-	1	0	ALS2CR11	202109171	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.583000	0.02115	-2.292000	0.00665	-0.467000	0.05162	GTG	-	NULL		0.403	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	protein_coding	OTTHUMT00000256296.2	C	NM_152525		202109171	-1	no_errors	NM_152525.4	genbank	human	validated	54_36p	missense	SNP	0.000	T
RBM46	166863	genome.wustl.edu	37	4	155749093	155749093	+	Silent	SNP	C	C	T			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr4:155749093C>T	ENST00000281722.3	+	5	1711	c.1476C>T	c.(1474-1476)agC>agT	p.S492S	RBM46_ENST00000510397.1_3'UTR	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	492							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.S492S(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				GGACTCCCAGCGTGCTTCCTT	0.423																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	4											199.0	199.0	199.0					4																	155749093		2203	4300	6503	155968543	SO:0001819	synonymous_variant	0			BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.1476C>T	4.37:g.155749093C>T		341	0.29	1		NA	NA	NA	155968543	167	34.50	89	B3KWU8|B4DZ27	Silent	SNP	HMMPfam_RRM_1,HMMSmart_RRM,superfamily_SSF54928	p.S492	ENST00000281722.3	37	c.1476	CCDS3790.1	4																																																																																			-	NULL		0.423	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM46	protein_coding	OTTHUMT00000365259.1	C	NM_144979		155968543	+1	no_errors	NM_144979.3	genbank	human	validated	54_36p	silent	SNP	1.000	T
PCDHB1	29930	genome.wustl.edu	37	5	140432819	140432819	+	Silent	SNP	C	C	A			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr5:140432819C>A	ENST00000306549.3	+	1	1841	c.1764C>A	c.(1762-1764)acC>acA	p.T588T		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	588	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T588T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCTAGTGACCAAAGTGGTGG	0.483																																						dbGAP											1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	5											85.0	76.0	79.0					5																	140432819		2203	4300	6503	140413003	SO:0001819	synonymous_variant	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1764C>A	5.37:g.140432819C>A		240	0.82	2		NA	NA	NA	140413003	136	32.67	66	Q2M257	Silent	SNP	HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_2,superfamily_Cadherin	p.T588	ENST00000306549.3	37	c.1764	CCDS4243.1	5																																																																																			-	HMMPfam_Cadherin,superfamily_Cadherin		0.483	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	protein_coding	OTTHUMT00000251822.2	C	NM_013340		140413003	+1	no_errors	NM_013340.2	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
RCAN2	10231	genome.wustl.edu	37	6	46190881	46190881	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr6:46190881G>C	ENST00000330430.6	-	4	779	c.591C>G	c.(589-591)aaC>aaG	p.N197K	RCAN2_ENST00000306764.7_Missense_Mutation_p.N243K|RCAN2_ENST00000371374.1_Missense_Mutation_p.N243K|RCAN2_ENST00000405162.1_Missense_Mutation_p.N243K	NM_005822.3	NP_005813.2	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	197					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)	p.N197K(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						AGGCAGCTCAGTTGGACACGG	0.483																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											181.0	208.0	200.0					6																	46190881		1989	4166	6155	46298840	SO:0001583	missense	0			D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000330430.6:c.591C>G	6.37:g.46190881G>C	ENSP00000329454:p.Asn197Lys	258	0.77	2		NA	NA	NA	46298840	218	22.26	63	A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Missense_Mutation	SNP	HMMPfam_Calcipressin	p.N197K	ENST00000330430.6	37	c.591	CCDS43469.1	6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961371	0.74016	.	.	ENSG00000172348	ENST00000330430;ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.47	5.47	0.80525	.	0.139923	0.48286	D	0.000190	T	0.70133	0.3189	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.979	T	0.73219	-0.4052	9	0.87932	D	0	-11.7121	16.4648	0.84076	0.0:0.0:1.0:0.0	.	243;197	Q14206-2;Q14206	.;RCAN2_HUMAN	K	197;243;243;243	.	ENSP00000305223:N243K	N	-	3	2	RCAN2	46298840	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.073000	0.71245	2.558000	0.86282	0.655000	0.94253	AAC	-	NULL		0.483	RCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCAN2	protein_coding	OTTHUMT00000040782.1	G			46298840	-1	no_errors	NM_005822.2	genbank	human	validated	54_36p	missense	SNP	1.000	C
CLVS2	134829	genome.wustl.edu	37	6	123384853	123384853	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr6:123384853C>T	ENST00000275162.5	+	6	2266	c.931C>T	c.(931-933)Cgc>Tgc	p.R311C	CLVS2_ENST00000368438.1_Missense_Mutation_p.R165C	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	311					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.R311C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						AGTACTAAAACGCATGGATAA	0.388																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	6											152.0	138.0	142.0					6																	123384853		2203	4300	6503	123426552	SO:0001583	missense	0			AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.931C>T	6.37:g.123384853C>T	ENSP00000275162:p.Arg311Cys	327	0.91	3		NA	NA	NA	123426552	471	23.18	143	B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Missense_Mutation	SNP	HMMPfam_CRAL_TRIO,HMMSmart_SM00516,superfamily_CRAL/TRIO domain,PatternScan_SUGAR_TRANSPORT_1,HMMPfam_CRAL_TRIO_N,superfamily_CRAL/TRIO N-terminal domain	p.R311C	ENST00000275162.5	37	c.931	CCDS34525.1	6	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606479	0.66445	.	.	ENSG00000146352	ENST00000275162;ENST00000368438	T;T	0.80480	-1.38;-0.67	5.52	5.52	0.82312	.	0.211201	0.51477	D	0.000095	T	0.61714	0.2369	N	0.14661	0.345	0.80722	D	1	D	0.55172	0.97	B	0.40534	0.332	T	0.71862	-0.4464	10	0.72032	D	0.01	-13.719	19.7987	0.96497	0.0:1.0:0.0:0.0	.	311	Q5SYC1	CLVS2_HUMAN	C	311;165	ENSP00000275162:R311C;ENSP00000357423:R165C	ENSP00000275162:R311C	R	+	1	0	CLVS2	123426552	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.070000	0.64376	2.767000	0.95098	0.655000	0.94253	CGC	-	NULL		0.388	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLBP1L2	protein_coding	OTTHUMT00000042042.2	C	NM_001010852		123426552	+1	no_errors	NM_001010852.2	genbank	human	provisional	54_36p	missense	SNP	1.000	T
FKTN	2218	genome.wustl.edu	37	9	108363630	108363630	+	Splice_Site	SNP	G	G	T			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr9:108363630G>T	ENST00000223528.2	+	4	493		c.e4+1		FKTN_ENST00000448551.2_Splice_Site|FKTN_ENST00000540160.1_Splice_Site|FKTN_ENST00000357998.5_Splice_Site|FKTN_ENST00000602661.1_Splice_Site	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin						muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)	p.?(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						GAAGAATGAGGTAAGTGACTT	0.328																																						dbGAP											1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	9																																								107403451	SO:0001630	splice_region_variant	0				CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.369+1G>T	9.37:g.108363630G>T		162	0.61	1		NA	NA	NA	107403451	314	24.52	102	B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	Splice_Site	SNP	-	e3+1	ENST00000223528.2	37	c.369+1	CCDS6766.1	9	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164545	0.78339	.	.	ENSG00000106692	ENST00000223528;ENST00000448551;ENST00000540160;ENST00000357998;ENST00000374705	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9897	0.92786	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FKTN	107403451	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.951000	0.87819	2.732000	0.93576	0.563000	0.77884	.	-	-		0.328	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKTN	protein_coding	OTTHUMT00000053505.1	G	NM_006731	Intron	107403451	+1	no_errors	NM_001079802.1	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
GDF10	2662	genome.wustl.edu	37	10	48429357	48429357	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr10:48429357G>A	ENST00000224605.2	-	2	794	c.529C>T	c.(529-531)Ctc>Ttc	p.L177F		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	177					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.L177F(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						TTCTGCGAGAGGCTGCGGAAG	0.721																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	10											15.0	21.0	19.0					10																	48429357		2195	4288	6483	48049363	SO:0001583	missense	0			L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.529C>T	10.37:g.48429357G>A	ENSP00000224605:p.Leu177Phe	85	1.16	1		NA	NA	NA	48049363	30	44.44	24	Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	HMMPfam_TGF_beta,HMMSmart_SM00204,PatternScan_TGF_BETA_1,superfamily_Cystine-knot cytokines	p.L177F	ENST00000224605.2	37	c.529	CCDS7220.1	10	.	.	.	.	.	.	.	.	.	.	G	6.056	0.378589	0.11466	.	.	ENSG00000107623	ENST00000224605	T	0.76186	-1.0	5.44	1.24	0.21308	.	0.519989	0.19990	N	0.101583	T	0.63260	0.2496	L	0.55481	1.735	0.09310	N	1	B	0.22211	0.066	B	0.20184	0.028	T	0.49679	-0.8914	9	.	.	.	.	6.1518	0.20316	0.0833:0.522:0.2703:0.1243	.	177	P55107	BMP3B_HUMAN	F	177	ENSP00000224605:L177F	.	L	-	1	0	GDF10	48049363	0.051000	0.20477	0.446000	0.26920	0.238000	0.25445	0.280000	0.18790	0.263000	0.21812	-0.266000	0.10368	CTC	-	NULL		0.721	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF10	protein_coding	OTTHUMT00000047884.1	G	NM_004962		48049363	-1	no_errors	NM_004962.2	genbank	human	reviewed	54_36p	missense	SNP	0.005	A
IDH2	3418	genome.wustl.edu	37	15	90631934	90631934	+	Missense_Mutation	SNP	C	C	T	rs121913502		TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr15:90631934C>T	ENST00000330062.3	-	4	532	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000540499.2_Missense_Mutation_p.R88Q|IDH2_ENST00000539790.1_Missense_Mutation_p.R10Q	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	140	Substrate binding. {ECO:0000250}.		R -> G (in D2HGA2). {ECO:0000269|PubMed:20847235}.|R -> Q (in D2HGA2). {ECO:0000269|PubMed:20847235}.		2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R140Q(292)|p.R140L(8)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTTCCGGATAGTTCC	0.537			M		GBM																																	dbGAP		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	300	Substitution - Missense(300)	haematopoietic_and_lymphoid_tissue(300)	15											103.0	103.0	103.0					15																	90631934		2200	4298	6498	88432938	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.419G>A	15.37:g.90631934C>T	ENSP00000331897:p.Arg140Gln	50	1.92	1		NA	NA	NA	88432938	49	30.99	22	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R140Q	ENST00000330062.3	37	c.419	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604397	0.66445	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.87179	-2.22;-2.22;-2.22	5.67	4.75	0.60458	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	H	0.96833	3.89	0.48185	D	0.999601	D	0.89917	1.0	D	0.87578	0.998	D	0.96254	0.9185	10	0.87932	D	0	.	12.4459	0.55651	0.0:0.9189:0.0:0.0811	.	140	P48735	IDHP_HUMAN	Q	140;10;88	ENSP00000331897:R140Q;ENSP00000438457:R10Q;ENSP00000446147:R88Q	ENSP00000331897:R140Q	R	-	2	0	IDH2	88432938	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.797000	0.85911	1.397000	0.46682	-0.258000	0.10820	CGG	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.537	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	protein_coding	OTTHUMT00000313426.1	C			88432938	-1	no_errors	NM_002168.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF236	7776	genome.wustl.edu	37	18	74580744	74580744	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr18:74580744C>G	ENST00000253159.8	+	4	659	c.461C>G	c.(460-462)gCc>gGc	p.A154G	ZNF236_ENST00000320610.9_Missense_Mutation_p.A156G|ZNF236_ENST00000583095.1_3'UTR	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	154					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A154G(2)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CGGCAGCATGCCTGCAAGGCC	0.532																																						dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	18											97.0	103.0	101.0					18																	74580744		2010	4191	6201	72709732	SO:0001583	missense	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.461C>G	18.37:g.74580744C>G	ENSP00000253159:p.Ala154Gly	308	0.65	2		NA	NA	NA	72709732	154	31.14	71	B2RTX9|Q9UL37	Missense_Mutation	SNP	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.A154G	ENST00000253159.8	37	c.461	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	C	3.904	-0.021488	0.07634	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.51817	0.69;0.69	5.17	3.39	0.38822	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.701009	0.13310	N	0.397559	T	0.35998	0.0951	N	0.21324	0.655	0.19775	N	0.999958	B;B	0.29212	0.237;0.042	B;B	0.37731	0.257;0.089	T	0.33548	-0.9864	10	0.28530	T	0.3	.	7.4377	0.27164	0.0:0.6046:0.2414:0.154	.	154;154	Q9NWI2;Q9UL36	.;ZN236_HUMAN	G	154	ENSP00000253159:A154G;ENSP00000444524:A154G	ENSP00000253159:A154G	A	+	2	0	ZNF236	72709732	0.523000	0.26274	0.091000	0.20842	0.176000	0.22953	1.019000	0.30014	0.578000	0.29487	-0.222000	0.12452	GCC	-	HMMPfam_zf-C2H2,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.532	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	protein_coding	OTTHUMT00000445776.1	C			72709732	+1	no_errors	NM_007345.3	genbank	human	validated	54_36p	missense	SNP	0.953	G
ZNF324B	388569	genome.wustl.edu	37	19	58967602	58967602	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr19:58967602G>A	ENST00000336614.4	+	4	1398	c.1291G>A	c.(1291-1293)Ggc>Agc	p.G431S	ZNF324B_ENST00000391696.1_Missense_Mutation_p.G421S|ZNF324B_ENST00000545523.1_Missense_Mutation_p.G431S	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G431S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CGCCCAGTGCGGCCGCTCCTT	0.672																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	19											41.0	46.0	44.0					19																	58967602		2202	4300	6502	63659414	SO:0001583	missense	0			AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.1291G>A	19.37:g.58967602G>A	ENSP00000337473:p.Gly431Ser	207	2.82	6		NA	NA	NA	63659414	54	28.00	21	B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	SNP	HMMPfam_KRAB,HMMSmart_SM00349,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers	p.G431S	ENST00000336614.4	37	c.1291	CCDS33138.1	19	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340043	0.41398	.	.	ENSG00000249471	ENST00000336614;ENST00000545523;ENST00000391696	T;T;T	0.20463	2.07;2.07;2.07	3.07	3.07	0.35406	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42682	D	0.000680	T	0.41766	0.1173	M	0.68593	2.085	0.35828	D	0.825114	D;D	0.89917	1.0;0.997	D;P	0.97110	1.0;0.874	T	0.55237	-0.8172	10	0.59425	D	0.04	.	11.9317	0.52849	0.0:0.0:1.0:0.0	.	431;421	Q6AW86;C9JTQ8	Z324B_HUMAN;.	S	431;431;421	ENSP00000337473:G431S;ENSP00000438930:G431S;ENSP00000375578:G421S	ENSP00000337473:G431S	G	+	1	0	ZNF324B	63659414	0.997000	0.39634	0.141000	0.22245	0.030000	0.12068	3.198000	0.51035	1.703000	0.51240	0.591000	0.81541	GGC	-	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers		0.672	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	protein_coding	OTTHUMT00000467038.1	G	NM_207395		63659414	+1	no_errors	NM_207395.2	genbank	human	validated	54_36p	missense	SNP	0.719	A
ASXL1	171023	genome.wustl.edu	37	20	31024758	31024758	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr20:31024758C>T	ENST00000375687.4	+	13	4667	c.4243C>T	c.(4243-4245)Cga>Tga	p.R1415*	ASXL1_ENST00000306058.5_Nonsense_Mutation_p.R1410*	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1415					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R1415*(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GAAATTACCCCGAGAGCCAGG	0.542			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	1	Substitution - Nonsense(1)	haematopoietic_and_lymphoid_tissue(1)	20											105.0	109.0	108.0					20																	31024758		2203	4300	6503	30488419	SO:0001587	stop_gained	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.4243C>T	20.37:g.31024758C>T	ENSP00000364839:p.Arg1415*	86	0.00	0		NA	NA	NA	30488419	35	35.19	19	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Nonsense_Mutation	SNP	NULL	p.R1415*	ENST00000375687.4	37	c.4243	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	C	43	9.990302	0.99312	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	.	.	.	4.42	2.28	0.28536	.	0.558909	0.16371	N	0.217335	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5323	6.252	0.20852	0.5194:0.3873:0.0:0.0933	.	.	.	.	X	1415;1415;1415;1336;1410	.	ENSP00000305119:R1410X	R	+	1	2	ASXL1	30488419	1.000000	0.71417	0.996000	0.52242	0.773000	0.43773	0.841000	0.27613	0.638000	0.30545	-0.136000	0.14681	CGA	-	NULL		0.542	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	protein_coding	OTTHUMT00000078624.2	C	NM_015338		30488419	+1	no_errors	NM_015338.4	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
RUNX1	861	genome.wustl.edu	37	21	36231877	36231877	+	Splice_Site	SNP	T	T	G			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	T	T	T	G	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr21:36231877T>G	ENST00000344691.4	-	3	2005		c.e3-2		RUNX1_ENST00000399240.1_Splice_Site|RUNX1_ENST00000300305.3_Splice_Site|RUNX1_ENST00000486278.2_Splice_Site|RUNX1_ENST00000437180.1_Splice_Site|RUNX1_ENST00000358356.5_Splice_Site|RUNX1_ENST00000325074.5_Splice_Site	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1						behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.?(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						AGCTTTTCCCTGTGGGGACAC	0.483			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	21											242.0	215.0	224.0					21																	36231877		2203	4300	6503	35153747	SO:0001630	splice_region_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.428-2A>C	21.37:g.36231877T>G		128	0.00	0		NA	NA	NA	35153747	90	44.44	72	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Splice_Site	SNP	-	e5-2	ENST00000344691.4	37	c.509-2	CCDS42922.1	21	.	.	.	.	.	.	.	.	.	.	T	14.07	2.425604	0.43020	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000399245;ENST00000358356;ENST00000399237;ENST00000486278	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8771	0.57996	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RUNX1	35153747	1.000000	0.71417	0.999000	0.59377	0.582000	0.36321	7.698000	0.84413	1.923000	0.55706	0.528000	0.53228	.	-	-		0.483	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	protein_coding	OTTHUMT00000194230.1	T		Intron	35153747	-1	no_errors	NM_001754.2	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	G
UQCR10	29796	genome.wustl.edu	37	22	30163401	30163401	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2907-03A-01D-0739-09	TCGA-AB-2907-11A-01D-0739-09	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0f0881a0-c9bc-4636-a99f-36551df20deb	a29c2d2b-1e78-443f-aac3-def013f368ca	g.chr22:30163401C>A	ENST00000330029.6	+	1	44	c.14C>A	c.(13-15)aCg>aAg	p.T5K	ZMAT5_ENST00000344318.3_5'Flank|ZMAT5_ENST00000397781.3_5'Flank|UQCR10_ENST00000401406.3_Missense_Mutation_p.T5K	NM_001003684.1|NM_013387.3	NP_001003684.1|NP_037519.2	Q9UDW1	QCR9_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit X	5					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)	ubiquinol-cytochrome-c reductase activity (GO:0008121)	p.T5K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)	5						GCGGCCGCGACGTTGACTTCG	0.602																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	22											48.0	56.0	53.0					22																	30163401		2054	4190	6244	28493401	SO:0001583	missense	0			AB028598	CCDS46680.1, CCDS46681.1	22q12.2	2011-07-04			ENSG00000184076	ENSG00000184076		"""Mitochondrial respiratory chain complex / Complex III"""	30863	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit X, 7.2kDa"", ""complex III subunit 9"""	610843				11042152	Standard	NM_013387		Approved	HSPC051, UCRC, QCR9, UCCR7.2	uc003agq.1	Q9UDW1	OTTHUMG00000151283	ENST00000330029.6:c.14C>A	22.37:g.30163401C>A	ENSP00000332887:p.Thr5Lys	141	0.70	1		NA	NA	NA	28493401	75	34.78	40	B5MCM5|Q9T2V6	Missense_Mutation	SNP	HMMPfam_UCR_UQCRX_QCR9,superfamily_Ubiquinol_cytC_Reductase_QCR9	p.T5K	ENST00000330029.6	37	c.14	CCDS46680.1	22	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595483	0.46318	.	.	ENSG00000184076	ENST00000332801;ENST00000330029;ENST00000401406;ENST00000406782	T;T	0.42900	0.96;0.96	5.73	4.65	0.58169	.	0.532223	0.15837	N	0.242222	T	0.28830	0.0715	.	.	.	0.09310	N	1	P;P	0.38020	0.561;0.615	B;B	0.32724	0.103;0.151	T	0.14420	-1.0473	9	0.39692	T	0.17	-0.692	11.2595	0.49074	0.182:0.818:0.0:0.0	.	5;5	Q9UDW1;Q9UDW1-2	QCR9_HUMAN;.	K	5	ENSP00000332887:T5K;ENSP00000384962:T5K	ENSP00000332887:T5K	T	+	2	0	UQCR10	28493401	0.012000	0.17670	0.011000	0.14972	0.005000	0.04900	1.418000	0.34782	2.720000	0.93068	0.558000	0.71614	ACG	-	superfamily_Ubiquinol_cytC_Reductase_QCR9		0.602	UQCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCRC	protein_coding	OTTHUMT00000322081.1	C	NM_013387		28493401	+1	no_errors	NM_013387.1	genbank	human	validated	54_36p	missense	SNP	0.003	A
