#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
GPR112	139378	genome.wustl.edu	37	X	135427148	135427148	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chrX:135427148T>A	ENST00000394143.1	+	6	1574	c.1283T>A	c.(1282-1284)cTc>cAc	p.L428H	GPR112_ENST00000412101.1_Missense_Mutation_p.L223H|GPR112_ENST00000287534.4_Missense_Mutation_p.L365H|GPR112_ENST00000394141.1_Missense_Mutation_p.L223H|GPR112_ENST00000370652.1_Missense_Mutation_p.L428H	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	428					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTGGGGCACTCCCTATCTCC	0.428																																						dbGAP											0			X											86.0	81.0	83.0					X																	135427148		2203	4300	6503	135254814	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1283T>A	X.37:g.135427148T>A	ENSP00000377699:p.Leu428His	57	3.33	2		NA	NA	NA	135254814	37	79.12	144	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2,superfamily_ConA_like_lec_gl,PatternScan_G_PROTEIN_RECEP_F2_2	p.L428H	ENST00000394143.1	37	c.1283	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	t	8.007	0.756608	0.15846	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.48836	0.84;0.84;0.8;0.9;0.8	3.78	1.42	0.22433	.	.	.	.	.	T	0.50103	0.1596	L	0.29908	0.895	0.09310	N	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.76071	0.987;0.957;0.84	T	0.30446	-0.9978	9	0.87932	D	0	.	4.366	0.11225	0.0:0.3037:0.0:0.6963	.	365;223;428	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	H	428;428;223;365;223	ENSP00000377699:L428H;ENSP00000359686:L428H;ENSP00000416526:L223H;ENSP00000287534:L365H;ENSP00000377697:L223H	ENSP00000287534:L365H	L	+	2	0	GPR112	135254814	0.000000	0.05858	0.026000	0.17262	0.020000	0.10135	0.039000	0.13884	0.448000	0.26722	0.336000	0.21669	CTC	-	NULL		0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	T			135254814	+1	no_errors	NM_153834.3	genbank	human	validated	54_36p	missense	SNP	0.011	A
PRAMEF2	65122	genome.wustl.edu	37	1	12919997	12919997	+	Missense_Mutation	SNP	C	C	T	rs143792800		TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr1:12919997C>T	ENST00000240189.2	+	3	824	c.737C>T	c.(736-738)aCg>aTg	p.T246M		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	246					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CATCATTACACGTCAGATAAT	0.438																																						dbGAP											0			1						C	MET/THR	0,4406		0,0,2203	111.0	112.0	112.0		737	0.8	0.0	1	dbSNP_134	112	2,8596	2.2+/-6.3	0,2,4297	no	missense	PRAMEF2	NM_023014.1	81	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	benign	246/475	12919997	2,13002	2203	4299	6502	12842584	SO:0001583	missense	0				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.737C>T	1.37:g.12919997C>T	ENSP00000240189:p.Thr246Met	88	0.00	0		NA	NA	NA	12842584	61	38.38	38		Missense_Mutation	SNP	superfamily_SSF52047	p.T246M	ENST00000240189.2	37	c.737	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	C	1.155	-0.645421	0.03531	0.0	2.33E-4	ENSG00000120952	ENST00000240189	T	0.01414	4.92	0.842	0.842	0.18927	.	1.336560	0.05111	N	0.488877	T	0.01287	0.0042	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.46317	-0.9200	10	0.34782	T	0.22	.	5.0452	0.14480	0.0:1.0:0.0:0.0	.	246	O60811	PRAM2_HUMAN	M	246	ENSP00000240189:T246M	ENSP00000240189:T246M	T	+	2	0	PRAMEF2	12842584	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	-0.502000	0.06390	0.759000	0.33084	0.194000	0.17425	ACG	-	superfamily_SSF52047		0.438	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	protein_coding	OTTHUMT00000005517.1	C	NM_023014		12842584	+1	no_errors	NM_023014.1	genbank	human	provisional	54_36p	missense	SNP	0.009	T
PRAMEF16	654348	genome.wustl.edu	37	1	13497875	13497875	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr1:13497875C>T	ENST00000376121.3	+	3	1202	c.1172C>T	c.(1171-1173)aCg>aTg	p.T391M		NM_001045480.1	NP_001038945.1	Q5VWM1	PRA16_HUMAN	PRAME family member 16	391					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)							Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAGACCTCCACGAATGCTCTG	0.572																																						dbGAP											0			1											4.0	3.0	3.0					1																	13497875		1670	2887	4557	13370462	SO:0001583	missense	0					1p36.21	2013-01-17			ENSG00000204488			"""-"""	25767	protein-coding gene	gene with protein product							Standard	NM_001045480		Approved	OTTHUMG00000002933	uc001aux.3	Q5VWM1	OTTHUMG00000002933	ENST00000376121.3:c.1172C>T	1.37:g.13497875C>T	ENSP00000365289:p.Thr391Met	6	0.00	0		NA	NA	NA	13370462	4	20.00	1		Missense_Mutation	SNP	superfamily_SSF52047	p.T391M	ENST00000376121.3	37	c.1172	CCDS41259.1	1	.	.	.	.	.	.	.	.	.	.	c	0	-2.837488	0.00069	.	.	ENSG00000204488	ENST00000376121	T	0.09163	3.01	1.39	-2.14	0.07123	.	0.482971	0.20276	N	0.095553	T	0.01156	0.0038	N	0.00044	-2.455	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.41980	-0.9478	10	0.02654	T	1	.	5.1887	0.15197	0.0:0.2098:0.0:0.7902	.	391	Q5VWM1	PRA16_HUMAN	M	391	ENSP00000365289:T391M	ENSP00000365289:T391M	T	+	2	0	PRAMEF16	13370462	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.366000	0.07563	-0.449000	0.07117	-1.128000	0.01989	ACG	-	superfamily_SSF52047		0.572	PRAMEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF16	protein_coding	OTTHUMT00000008178.1	C	NM_001045480		13370462	+1	no_errors	NM_001045480.1	genbank	human	provisional	54_36p	missense	SNP	0.012	T
SPEN	23013	genome.wustl.edu	37	1	16260238	16260238	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr1:16260238G>A	ENST00000375759.3	+	11	7707	c.7503G>A	c.(7501-7503)tgG>tgA	p.W2501*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2501	Pro-rich.|RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGACAGAGTGGATCACAAGGC	0.587																																						dbGAP											0			1											93.0	91.0	92.0					1																	16260238		2203	4300	6503	16132825	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7503G>A	1.37:g.16260238G>A	ENSP00000364912:p.Trp2501*	46	0.00	0		33	47.62	30	16132825	34	46.88	30	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_RRM,HMMPfam_SPOC,superfamily_SPOC-like,superfamily_SSF54928	p.W2501*	ENST00000375759.3	37	c.7503	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	48	14.850088	0.99812	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-9.1587	19.1699	0.93574	0.0:0.0:1.0:0.0	.	.	.	.	X	2501	.	ENSP00000364912:W2501X	W	+	3	0	SPEN	16132825	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.972000	0.63756	2.535000	0.85469	0.561000	0.74099	TGG	-	NULL		0.587	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	protein_coding	OTTHUMT00000025993.1	G	NM_015001		16132825	+1	no_errors	NM_015001.2	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
THRAP3	9967	genome.wustl.edu	37	1	36762236	36762236	+	Missense_Mutation	SNP	G	G	A	rs375288205		TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr1:36762236G>A	ENST00000354618.5	+	9	2392	c.2168G>A	c.(2167-2169)cGt>cAt	p.R723H	THRAP3_ENST00000469141.2_Missense_Mutation_p.R723H	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	723	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GATATTGAACGTCGTAAAAAA	0.413			T	USP6	aneurysmal bone cysts																																Pancreas(129;785 1795 20938 23278 32581)	dbGAP		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	0			1						G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	111.0	111.0		2168	5.8	1.0	1		111	0,8600		0,0,4300	no	missense	THRAP3	NM_005119.3	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	723/956	36762236	1,13005	2203	4300	6503	36534823	SO:0001583	missense	0			AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.2168G>A	1.37:g.36762236G>A	ENSP00000346634:p.Arg723His	148	0.00	0		98	39.51	64	36534823	50	41.86	36	D3DPS5|Q5VTK6	Missense_Mutation	SNP	NULL	p.R723H	ENST00000354618.5	37	c.2168	CCDS405.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642511	0.87859	2.27E-4	0.0	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.30714	1.52;1.52	5.75	5.75	0.90469	.	0.067813	0.64402	D	0.000007	T	0.34279	0.0892	L	0.54323	1.7	0.80722	D	1	P	0.43826	0.818	B	0.39419	0.299	T	0.09552	-1.0669	10	0.51188	T	0.08	-3.3789	19.2998	0.94140	0.0:0.0:1.0:0.0	.	723	Q9Y2W1	TR150_HUMAN	H	723	ENSP00000346634:R723H;ENSP00000433825:R723H	ENSP00000346634:R723H	R	+	2	0	THRAP3	36534823	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.471000	0.97696	2.866000	0.98385	0.650000	0.86243	CGT	-	NULL		0.413	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRAP3	protein_coding	OTTHUMT00000021688.2	G	NM_005119		36534823	+1	no_errors	NM_005119.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
GBP1	2633	genome.wustl.edu	37	1	89520512	89520512	+	Missense_Mutation	SNP	C	C	A	rs370603771		TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr1:89520512C>A	ENST00000370473.4	-	10	1737	c.1518G>T	c.(1516-1518)ttG>ttT	p.L506F	GBP1_ENST00000484970.1_5'UTR	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	506					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		GCATTTCCTGCAACATTTTTG	0.443																																						dbGAP											0			1											371.0	381.0	377.0					1																	89520512		2203	4300	6503	89293100	SO:0001583	missense	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1518G>T	1.37:g.89520512C>A	ENSP00000359504:p.Leu506Phe	84	0.00	0		30	16.67	6	89293100	69	40.52	47	D3DT26|Q5T8M1	Missense_Mutation	SNP	HMMPfam_GBP_C,HMMPfam_GBP,superfamily_Interferon-induced guanylate-binding protein 1 (GBP1) C-terminal domain,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L506F	ENST00000370473.4	37	c.1518	CCDS718.1	1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052140	0.36181	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.59364	0.27	4.67	2.73	0.32206	Guanylate-binding protein, C-terminal (3);	0.608156	0.15389	N	0.264908	T	0.64483	0.2602	M	0.90922	3.16	0.26306	N	0.977907	D	0.53745	0.962	P	0.57057	0.812	T	0.58618	-0.7605	10	0.87932	D	0	.	8.6173	0.33840	0.0:0.8053:0.0:0.1947	.	506	P32455	GBP1_HUMAN	F	506;469	ENSP00000359504:L506F	ENSP00000359504:L506F	L	-	3	2	GBP1	89293100	0.000000	0.05858	0.358000	0.25811	0.148000	0.21650	-1.060000	0.03475	0.927000	0.37143	0.491000	0.48974	TTG	-	HMMPfam_GBP_C,superfamily_Interferon-induced guanylate-binding protein 1 (GBP1) C-terminal domain		0.443	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	protein_coding	OTTHUMT00000029289.3	C	NM_002053		89293100	-1	no_errors	NM_002053.2	genbank	human	validated	54_36p	missense	SNP	0.478	A
NLRC4	58484	genome.wustl.edu	37	2	32477645	32477645	+	Silent	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr2:32477645G>A	ENST00000404025.2	-	4	593	c.105C>T	c.(103-105)cgC>cgT	p.R35R	NLRC4_ENST00000402280.1_Silent_p.R35R|NLRC4_ENST00000360906.5_Silent_p.R35R|NLRC4_ENST00000342905.6_Silent_p.R35R			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	35	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTACTTCTTCGCGATTCAGAA	0.403																																						dbGAP											0			2											163.0	148.0	153.0					2																	32477645		2203	4300	6503	32331149	SO:0001819	synonymous_variant	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.105C>T	2.37:g.32477645G>A		49	0.00	0		2	0.00	0	32331149	75	44.03	59	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Silent	SNP	HMMPfam_CARD,HMMPfam_NACHT,superfamily_DEATH domain,superfamily_RNI-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R35	ENST00000404025.2	37	c.105	CCDS33174.1	2																																																																																			-	HMMPfam_CARD,superfamily_DEATH domain		0.403	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	protein_coding	OTTHUMT00000325222.2	G	NM_021209		32331149	-1	no_errors	NM_021209.3	genbank	human	validated	54_36p	silent	SNP	0.000	A
SNRNP200	23020	genome.wustl.edu	37	2	96968974	96968974	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr2:96968974A>G	ENST00000323853.5	-	3	381	c.304T>C	c.(304-306)Tac>Cac	p.Y102H	SNRNP200_ENST00000349783.5_Missense_Mutation_p.Y102H	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	102					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TTGGGCTTGTAGATGATGCCC	0.488																																						dbGAP											0			2											323.0	321.0	322.0					2																	96968974		2203	4300	6503	96332701	SO:0001583	missense	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.304T>C	2.37:g.96968974A>G	ENSP00000317123:p.Tyr102His	50	0.00	0		80	43.75	63	96332701	50	37.50	30	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	HMMPfam_Helicase_C,HMMSmart_SM00490,HMMPfam_Sec63,HMMPfam_DEAD,HMMSmart_SM00487,HMMSmart_SM00611,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Y102H	ENST00000323853.5	37	c.304	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	A	27.7	4.850812	0.91277	.	.	ENSG00000144028	ENST00000323853;ENST00000349783	T;T	0.43294	0.95;0.95	5.87	5.87	0.94306	.	0.061125	0.64402	D	0.000002	T	0.73489	0.3593	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81165	-0.1057	10	0.87932	D	0	-10.5085	15.2631	0.73640	1.0:0.0:0.0:0.0	.	102	O75643	U520_HUMAN	H	102	ENSP00000317123:Y102H;ENSP00000326937:Y102H	ENSP00000317123:Y102H	Y	-	1	0	SNRNP200	96332701	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	8.873000	0.92357	2.248000	0.74166	0.533000	0.62120	TAC	-	NULL		0.488	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	protein_coding	OTTHUMT00000252846.2	A	NM_014014		96332701	-1	no_errors	NM_014014.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
CASP10	843	genome.wustl.edu	37	2	202060580	202060580	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr2:202060580C>A	ENST00000272879.5	+	5	777	c.593C>A	c.(592-594)aCa>aAa	p.T198K	CASP10_ENST00000448480.1_Missense_Mutation_p.T198K|CASP10_ENST00000286186.6_Missense_Mutation_p.T198K|CASP10_ENST00000360132.3_Missense_Mutation_p.T198K|CASP10_ENST00000374650.3_Missense_Mutation_p.T198K|CASP10_ENST00000346817.5_Missense_Mutation_p.T198K|CASP10_ENST00000492363.1_3'UTR|CASP10_ENST00000313728.7_Missense_Mutation_p.T198K	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase	198					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						CAGATAGTGACACCTCCTGTA	0.438																																						dbGAP											0			2											186.0	179.0	181.0					2																	202060580		2203	4300	6503	201768825	SO:0001583	missense	0			U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.593C>A	2.37:g.202060580C>A	ENSP00000272879:p.Thr198Lys	103	0.00	0		35	22.22	10	201768825	109	35.50	60	Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Missense_Mutation	SNP	HMMPfam_DED,HMMSmart_DED,superfamily_DEATH_like,HMMPfam_Peptidase_C14,HMMSmart_CASc,PatternScan_CASPASE_HIS,PatternScan_CASPASE_CYS,superfamily_SSF52129	p.T198K	ENST00000272879.5	37	c.593	CCDS2338.1	2	.	.	.	.	.	.	.	.	.	.	C	7.122	0.578118	0.13686	.	.	ENSG00000003400	ENST00000286186;ENST00000360132;ENST00000272879;ENST00000374650;ENST00000346817;ENST00000313728;ENST00000448480	T;T;T;T;T;T;T	0.44881	4.52;0.91;4.45;0.95;4.44;4.16;4.36	2.12	0.281	0.15687	.	3.442450	0.00887	N	0.002180	T	0.19287	0.0463	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.30068	0.157;0.228;0.139;0.05;0.05;0.267	B;B;B;B;B;B	0.27796	0.051;0.083;0.017;0.037;0.037;0.039	T	0.19418	-1.0306	10	0.05436	T	0.98	.	4.3457	0.11131	0.0:0.6442:0.0:0.3558	.	198;198;198;198;198;198	Q92851-6;Q92851-5;Q92851;Q92851-2;Q92851-4;Q68HC0	.;.;CASPA_HUMAN;.;.;.	K	198	ENSP00000286186:T198K;ENSP00000353250:T198K;ENSP00000272879:T198K;ENSP00000363781:T198K;ENSP00000237865:T198K;ENSP00000314599:T198K;ENSP00000396835:T198K	ENSP00000272879:T198K	T	+	2	0	CASP10	201768825	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.680000	0.05197	0.070000	0.16634	-0.254000	0.11334	ACA	-	NULL		0.438	CASP10-002	KNOWN	basic|CCDS	protein_coding	CASP10	protein_coding	OTTHUMT00000256273.1	C	NM_032977		201768825	+1	no_errors	NM_032977.4	genbank	human	reviewed	54_36p	missense	SNP	0.002	A
LRRFIP1	9208	genome.wustl.edu	37	2	238617188	238617188	+	Splice_Site	SNP	C	C	T	rs143725016		TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr2:238617188C>T	ENST00000392000.4	+	2	185	c.68C>T	c.(67-69)gCg>gTg	p.A23V	LRRFIP1_ENST00000244815.5_Splice_Site_p.A23V|LRRFIP1_ENST00000289175.6_Splice_Site_p.A23V|LRRFIP1_ENST00000308482.9_Splice_Site_p.A33V	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	23					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CCGTTTCAGGCGGAAGCCCGG	0.602																																						dbGAP											0			2						C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	1,4405		0,1,2202	18.0	20.0	19.0		98,68,68,68,68	5.6	1.0	2	dbSNP_134	19	0,8594		0,0,4297	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	LRRFIP1	NM_001137550.1,NM_001137551.1,NM_001137552.1,NM_001137553.1,NM_004735.3	64,64,64,64,64	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	33/641,23/395,23/809,23/753,23/785	238617188	1,12999	2203	4297	6500	238281927	SO:0001630	splice_region_variant	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.67-1C>T	2.37:g.238617188C>T		25	0.00	0		4	66.67	8	238281927	18	37.93	11	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	HMMPfam_DUF2051	p.A23V	ENST00000392000.4	37	c.68	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.083565	0.94050	2.27E-4	0.0	ENSG00000124831	ENST00000308482;ENST00000289175;ENST00000391999;ENST00000244815;ENST00000420665;ENST00000392000	T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.78457	0.4286	M	0.84948	2.725	0.53688	D	0.999972	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999	D;D;D;D;D	0.91635	0.995;0.999;0.999;0.999;0.995	T	0.81189	-0.1046	10	0.66056	D	0.02	-19.4161	15.2014	0.73139	0.0:1.0:0.0:0.0	.	23;23;23;23;33	B4DPC0;Q32MZ4-3;Q32MZ4;Q32MZ4-2;E9PGZ2	.;.;LRRF1_HUMAN;.;.	V	33;23;23;23;23;23	ENSP00000310109:A33V;ENSP00000289175:A23V;ENSP00000244815:A23V;ENSP00000409431:A23V;ENSP00000375857:A23V	ENSP00000244815:A23V	A	+	2	0	LRRFIP1	238281927	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	5.867000	0.69597	2.657000	0.90304	0.655000	0.94253	GCG	-	HMMPfam_DUF2051		0.602	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	protein_coding	OTTHUMT00000317198.1	C	NM_004735	Missense_Mutation	238281927	+1	no_errors	NM_004735.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
DCTD	1635	genome.wustl.edu	37	4	183836708	183836708	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr4:183836708G>A	ENST00000438320.2	-	2	304	c.14C>T	c.(13-15)tCc>tTc	p.S5F	DCTD_ENST00000510370.1_Missense_Mutation_p.S5F|DCTD_ENST00000357067.3_Missense_Mutation_p.S16F|DCTD_ENST00000513383.1_5'UTR	NM_001921.2	NP_001912.2	P32321	DCTD_HUMAN	dCMP deaminase	5					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	dCMP deaminase activity (GO:0004132)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|urinary_tract(1)	18		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)	Cytarabine(DB00987)	TTTCTTGCAGGAAACTTCACT	0.413																																						dbGAP											0			4											116.0	126.0	123.0					4																	183836708		2203	4300	6503	184073702	SO:0001583	missense	0			L12136	CCDS3831.1, CCDS34108.1	4q35.1	2008-08-01			ENSG00000129187	ENSG00000129187	3.5.4.12		2710	protein-coding gene	gene with protein product		607638					Standard	XM_005262778		Approved		uc003ivg.3	P32321	OTTHUMG00000160685	ENST00000438320.2:c.14C>T	4.37:g.183836708G>A	ENSP00000398194:p.Ser5Phe	32	0.00	0		24	29.41	10	184073702	35	27.08	13	B2R836|D3DP49|D3DP50|Q5M7Z8|Q9BVD8	Missense_Mutation	SNP	HMMPfam_dCMP_cyt_deam_1,PatternScan_CYT_DCMP_DEAMINASES,superfamily_Cytidine_deaminase-like	p.S16F	ENST00000438320.2	37	c.47	CCDS3831.1	4	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634481	0.47049	.	.	ENSG00000129187	ENST00000357067;ENST00000438320;ENST00000510370;ENST00000503182;ENST00000510307;ENST00000512766;ENST00000514754;ENST00000503820;ENST00000503988;ENST00000508994	.	.	.	4.7	2.98	0.34508	.	0.593475	0.18857	N	0.129231	T	0.36248	0.0960	N	0.22421	0.69	0.38115	D	0.937687	P;B	0.40144	0.704;0.21	B;B	0.36244	0.22;0.1	T	0.35748	-0.9776	9	0.59425	D	0.04	-11.6272	10.8017	0.46493	0.1524:0.0:0.8476:0.0	.	16;5	P32321-2;P32321	.;DCTD_HUMAN	F	16;5;5;5;5;5;5;5;5;5	.	ENSP00000349576:S16F	S	-	2	0	DCTD	184073702	0.961000	0.32948	0.939000	0.37840	0.955000	0.61496	1.513000	0.35823	0.708000	0.31955	0.655000	0.94253	TCC	-	NULL		0.413	DCTD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTD	protein_coding	OTTHUMT00000361743.2	G			184073702	-1	no_errors	NM_001012732.1	genbank	human	reviewed	54_36p	missense	SNP	0.752	A
TRIO	7204	genome.wustl.edu	37	5	14287024	14287024	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr5:14287024G>A	ENST00000344204.4	+	4	416	c.392G>A	c.(391-393)cGt>cAt	p.R131H	TRIO_ENST00000537187.1_Missense_Mutation_p.R131H|TRIO_ENST00000509967.2_Missense_Mutation_p.R82H	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	131	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTGGACATGCGTGGGTCCAAG	0.557																																						dbGAP											0			5											110.0	98.0	102.0					5																	14287024		2203	4300	6503	14340024	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.392G>A	5.37:g.14287024G>A	ENSP00000339299:p.Arg131His	76	1.30	1		1	0.00	0	14340024	76	31.58	36	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_DBL homology domain (DH-domain),HMMSmart_SM00219,HMMSmart_SM00516,superfamily_CRAL/TRIO domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH3-domain,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_Spectrin,HMMSmart_SM00220,HMMSmart_SM00408,HMMSmart_SM00409,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),HMMPfam_I-set,HMMPfam_Pkinase,HMMSmart_SM00150,superfamily_Spectrin repeat,superfamily_Immunoglobulin,superfamily_PH domain-like	p.R131H	ENST00000344204.4	37	c.392	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712692	0.89112	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967	T;T;T	0.63096	-0.02;-0.02;-0.02	5.55	5.55	0.83447	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.84388	0.5461	M	0.91972	3.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.87501	0.2433	10	0.87932	D	0	.	19.505	0.95111	0.0:0.0:1.0:0.0	.	82;131	F5H228;O75962	.;TRIO_HUMAN	H	131;131;82	ENSP00000339299:R131H;ENSP00000446348:R131H;ENSP00000445592:R82H	ENSP00000339299:R131H	R	+	2	0	TRIO	14340024	1.000000	0.71417	0.966000	0.40874	0.932000	0.56968	9.869000	0.99810	2.616000	0.88540	0.585000	0.79938	CGT	-	HMMSmart_SM00516,superfamily_CRAL/TRIO domain		0.557	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	G	NM_007118		14340024	+1	no_errors	NM_007118.2	genbank	human	validated	54_36p	missense	SNP	1.000	A
KDM3B	51780	genome.wustl.edu	37	5	137729043	137729043	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr5:137729043G>A	ENST00000314358.5	+	9	3013	c.2813G>A	c.(2812-2814)cGt>cAt	p.R938H	KDM3B_ENST00000394866.1_Missense_Mutation_p.R594H|KDM3B_ENST00000542866.1_5'UTR	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	938					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.R938L(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GTAGCCTGCCGTTTCTTTCAC	0.458																																						dbGAP											1	Substitution - Missense(1)	prostate(1)	5											58.0	55.0	56.0					5																	137729043		2203	4300	6503	137756942	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2813G>A	5.37:g.137729043G>A	ENSP00000326563:p.Arg938His	85	0.00	0		4	94.03	63	137756942	16	65.22	30	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	HMMSmart_SM00558,HMMPfam_JmjC,superfamily_Clavaminate synthase-like	p.R938H	ENST00000314358.5	37	c.2813	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.431585	0.96150	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;D	0.85702	-1.46;-2.02	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.93077	0.7796	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.92216	0.5780	10	0.51188	T	0.08	-15.8016	20.4062	0.99009	0.0:0.0:1.0:0.0	.	594;938	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	H	938;728;594	ENSP00000326563:R938H;ENSP00000378335:R594H	ENSP00000326563:R938H	R	+	2	0	KDM3B	137756942	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.831000	0.97527	0.655000	0.94253	CGT	-	NULL		0.458	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD1B	protein_coding	OTTHUMT00000373597.1	G	NM_016604		137756942	+1	no_errors	NM_016604.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
PRPF4B	8899	genome.wustl.edu	37	6	4049339	4049339	+	Splice_Site	SNP	T	T	C			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr6:4049339T>C	ENST00000337659.6	+	8	2125	c.2025T>C	c.(2023-2025)taT>taC	p.Y675Y	PRPF4B_ENST00000538861.1_Splice_Site_p.Y661Y	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	675					mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				AAGGCTATTATCGTAAGTTCA	0.388																																						dbGAP											0			6											69.0	69.0	69.0					6																	4049339		2203	4300	6503	3994338	SO:0001630	splice_region_variant	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2026+1T>C	6.37:g.4049339T>C		79	0.00	0		11	68.57	24	3994338	78	29.09	32	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Silent	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase	p.Y675	ENST00000337659.6	37	c.2025	CCDS4488.1	6																																																																																			-	superfamily_Protein kinase-like (PK-like)		0.388	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	protein_coding	OTTHUMT00000314018.2	T		Silent	3994338	+1	no_errors	NM_003913.4	genbank	human	reviewed	54_36p	silent	SNP	0.991	C
ZPBP	11055	genome.wustl.edu	37	7	50022985	50022985	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr7:50022985C>G	ENST00000046087.2	-	7	983	c.914G>C	c.(913-915)gGa>gCa	p.G305A	ZPBP_ENST00000419417.1_Missense_Mutation_p.G304A|ZPBP_ENST00000491129.1_5'UTR	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	305					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					CATTCCATATCCTGGAAAGCA	0.343																																						dbGAP											0			7											93.0	88.0	90.0					7																	50022985		2203	4300	6503	49993531	SO:0001583	missense	0			D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.914G>C	7.37:g.50022985C>G	ENSP00000046087:p.Gly305Ala	22	4.35	1		NA	NA	NA	49993531	28	41.67	20	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	HMMPfam_Sp38	p.G305A	ENST00000046087.2	37	c.914	CCDS5509.1	7	.	.	.	.	.	.	.	.	.	.	C	19.41	3.823146	0.71143	.	.	ENSG00000042813	ENST00000046087;ENST00000419417	T;T	0.69175	-0.38;-0.38	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000009	D	0.82962	0.5151	M	0.80183	2.485	0.43902	D	0.996532	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83113	-0.0122	9	.	.	.	-17.2922	17.8445	0.88725	0.0:1.0:0.0:0.0	.	304;305	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	A	305;304	ENSP00000046087:G305A;ENSP00000402071:G304A	.	G	-	2	0	ZPBP	49993531	0.994000	0.37717	0.982000	0.44146	0.956000	0.61745	3.346000	0.52190	2.733000	0.93635	0.637000	0.83480	GGA	-	HMMPfam_Sp38		0.343	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP	protein_coding	OTTHUMT00000251374.1	C	NM_007009		49993531	-1	no_errors	NM_007009.1	genbank	human	provisional	54_36p	missense	SNP	0.990	G
NPM2	10361	genome.wustl.edu	37	8	21894040	21894040	+	Intron	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr8:21894040G>A	ENST00000397940.1	+	8	1615				NPM2_ENST00000521157.1_Intron|NPM2_ENST00000518119.1_Intron|NPM2_ENST00000289820.6_Intron|NPM2_ENST00000381530.5_Intron			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2						chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		TGAAAAAGGTGAGTAGGACCA	0.612											OREG0018603	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0			8											57.0	53.0	55.0					8																	21894040		2202	4300	6502	21949986	SO:0001627	intron_variant	0			AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.600+3G>A	8.37:g.21894040G>A		57	0.00	0	752	2	33.33	1	21949986	20	23.08	6	B3KSU0|D3DSQ8|Q6NVH6	Intron	SNP	-	e7+3	ENST00000397940.1	37	c.600+3	CCDS6018.1	8																																																																																			-	-		0.612	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM2	protein_coding	OTTHUMT00000253810.2	G	NM_182795		21949986	+1	no_errors	NM_182795.1	genbank	human	validated	54_36p	splice_region	SNP	0.958	A
Unknown	0	genome.wustl.edu	37	9	65635778	65635778	+	IGR	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr9:65635778G>A								SPATA31A7 (126168 upstream) : RP11-118H15.1 (244754 downstream)																							GGGTGTGCAGGACACTGCAGC	0.562																																						dbGAP											0			9																																								65375598	SO:0001628	intergenic_variant	0																															9.37:g.65635778G>A		22	0.00	0		NA	NA	NA	65375598	15	48.28	14		Missense_Mutation	SNP	HMMSmart_SM00282,superfamily_Fibrinogen C-terminal domain-like,HMMPfam_EGF,HMMSmart_SM00181,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,PatternScan_GLYCO_HORMONE_BETA_1	p.G649E		37	c.1946		9																																																																																			-	superfamily_Concanavalin A-like lectins/glucanases,PatternScan_GLYCO_HORMONE_BETA_1	0	0.562					LOC643827			G			65375598	+1	no_errors	XM_001714537.1	genbank	human	model	54_36p	missense	SNP	1.000	A
KAT6B	23522	genome.wustl.edu	37	10	76735895	76735895	+	Missense_Mutation	SNP	C	C	G			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	G	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr10:76735895C>G	ENST00000287239.4	+	8	2289	c.1800C>G	c.(1798-1800)caC>caG	p.H600Q	KAT6B_ENST00000372711.1_Intron|KAT6B_ENST00000372714.1_Intron|KAT6B_ENST00000372725.1_Intron|KAT6B_ENST00000372724.1_Intron	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	600	Negatively regulates HAT activity.|Poly-Ser.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTATTTCTCACTCCTCCTCCT	0.423																																						dbGAP											0			10											69.0	71.0	70.0					10																	76735895		2203	4300	6503	76405901	SO:0001583	missense	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.1800C>G	10.37:g.76735895C>G	ENSP00000287239:p.His600Gln	46	0.00	0		12	52.00	13	76405901	58	36.96	34	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	"HMMSmart_SM00249,HMMPfam_MOZ_SAS,HMMSmart_SM00526,superfamily_FYVE/PHD zinc finger,superfamily_Acyl-CoA N-acyltransferases (Nat),PatternScan_ZF_PHD_1,HMMPfam_PHD,superfamily_""Winged helix"" DNA-binding domain"	p.H600Q	ENST00000287239.4	37	c.1800	CCDS7345.1	10	.	.	.	.	.	.	.	.	.	.	C	3.419	-0.118520	0.06838	.	.	ENSG00000156650	ENST00000287239	T	0.76060	-0.99	5.16	2.19	0.27852	.	0.132944	0.33938	N	0.004410	T	0.46014	0.1371	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18713	-1.0328	9	.	.	.	-3.7629	4.0278	0.09695	0.0:0.5562:0.2259:0.2179	.	600	Q8WYB5	KAT6B_HUMAN	Q	600	ENSP00000287239:H600Q	.	H	+	3	2	KAT6B	76405901	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.436000	0.21526	1.140000	0.42260	0.655000	0.94253	CAC	-	NULL		0.423	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST4	protein_coding	OTTHUMT00000048771.1	C	NM_012330		76405901	+1	no_errors	NM_012330.2	genbank	human	validated	54_36p	missense	SNP	1.000	G
NAV2	89797	genome.wustl.edu	37	11	20075635	20075635	+	Silent	SNP	C	C	T			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr11:20075635C>T	ENST00000396087.3	+	19	4659	c.4560C>T	c.(4558-4560)ccC>ccT	p.P1520P	NAV2_ENST00000396085.1_Silent_p.P1497P|NAV2_ENST00000349880.4_Silent_p.P1497P|NAV2_ENST00000540292.1_Silent_p.P1451P|NAV2_ENST00000527559.2_Silent_p.P1449P|NAV2_ENST00000360655.4_Silent_p.P1433P|NAV2_ENST00000311043.8_Silent_p.P561P|NAV2_ENST00000533917.1_Silent_p.P561P	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1520	Ser-rich.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						GGTATACTCCCACCTCCCAGC	0.448																																						dbGAP											0			11											75.0	61.0	66.0					11																	20075635		2203	4300	6503	20032211	SO:0001819	synonymous_variant	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.4560C>T	11.37:g.20075635C>T		116	0.85	1		1	66.67	2	20032211	52	34.18	27	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	HMMPfam_CH,HMMSmart_SM00033,HMMSmart_SM00382,superfamily_Calponin-homology domain CH-domain,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.P1520	ENST00000396087.3	37	c.4560	CCDS58126.1	11																																																																																			-	NULL		0.448	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	protein_coding	OTTHUMT00000324112.1	C	NM_145117		20032211	+1	no_errors	NM_182964.1	genbank	human	validated	54_36p	silent	SNP	1.000	T
MED21	9412	genome.wustl.edu	37	12	27179378	27179378	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	T	T	T	C	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr12:27179378T>C	ENST00000282892.3	+	2	98	c.68T>C	c.(67-69)aTt>aCt	p.I23T	MED21_ENST00000536503.1_Intron|MED21_ENST00000546323.1_Missense_Mutation_p.I23T	NM_001271811.1|NM_004264.3	NP_001258740.1|NP_004255.2	Q13503	MED21_HUMAN	mediator complex subunit 21	23					blastocyst development (GO:0001824)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)	DNA-directed RNA polymerase activity (GO:0003899)|transcription coactivator activity (GO:0003713)					Colorectal(261;0.0847)					TGTAATGCCATTGGAGTATTG	0.393																																						dbGAP											0			12											162.0	142.0	149.0					12																	27179378		2203	4300	6503	27070645	SO:0001583	missense	0			U46837	CCDS8711.1	12p12	2007-07-30	2007-07-30	2007-07-30		ENSG00000152944			11473	protein-coding gene	gene with protein product		603800	"""SRB7 (suppressor of RNA polymerase B, yeast) homolog"", ""SRB7 suppressor of RNA polymerase B homolog (yeast)"""	SURB7		8598913	Standard	NM_004264		Approved	SRB7	uc001rhp.2	Q13503		ENST00000282892.3:c.68T>C	12.37:g.27179378T>C	ENSP00000282892:p.Ile23Thr	59	0.00	0		9	47.06	8	27070645	112	32.12	53	B2R4I3|Q6IB05|Q92811	Missense_Mutation	SNP	NULL	p.I23T	ENST00000282892.3	37	c.68	CCDS8711.1	12	.	.	.	.	.	.	.	.	.	.	T	16.51	3.142918	0.57044	.	.	ENSG00000152944	ENST00000546323;ENST00000282892	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.58163	0.2103	L	0.48362	1.52	0.80722	D	1	B	0.26445	0.149	B	0.29663	0.105	T	0.60156	-0.7318	9	0.59425	D	0.04	-4.7286	15.0592	0.71939	0.0:0.0:0.0:1.0	.	23	Q13503	MED21_HUMAN	T	23	.	ENSP00000282892:I23T	I	+	2	0	MED21	27070645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.191000	0.77763	2.186000	0.69663	0.477000	0.44152	ATT	-	NULL		0.393	MED21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED21	protein_coding	OTTHUMT00000403262.1	T	NM_004264		27070645	+1	no_errors	NM_004264.3	genbank	human	provisional	54_36p	missense	SNP	1.000	C
MYF6	4618	genome.wustl.edu	37	12	81102640	81102640	+	Silent	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr12:81102640G>A	ENST00000228641.3	+	3	852	c.630G>A	c.(628-630)tcG>tcA	p.S210S		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	210					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						GTATTGATTCGTCAGCCTCGA	0.542																																						dbGAP											0			12											176.0	153.0	161.0					12																	81102640		2203	4300	6503	79626771	SO:0001819	synonymous_variant	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.630G>A	12.37:g.81102640G>A		95	0.00	0		NA	NA	NA	79626771	52	44.09	41	B2R898|Q53X80|Q6FHI9	Silent	SNP	HMMPfam_HLH,HMMSmart_SM00353,HMMPfam_Basic,HMMSmart_SM00520,superfamily_HLH helix-loop-helix DNA-binding domain	p.S210	ENST00000228641.3	37	c.630	CCDS9019.1	12																																																																																			-	NULL		0.542	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	protein_coding	OTTHUMT00000407756.1	G	NM_002469		79626771	+1	no_errors	NM_002469.1	genbank	human	provisional	54_36p	silent	SNP	0.004	A
RAB15	376267	genome.wustl.edu	37	14	65417130	65417130	+	Silent	SNP	G	G	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr14:65417130G>A	ENST00000533601.2	-	5	664	c.327C>T	c.(325-327)taC>taT	p.Y109Y	RAB15_ENST00000267512.5_Missense_Mutation_p.T153M|RAB15_ENST00000436278.2_3'UTR|FNTB_ENST00000447296.2_Intron|CHURC1-FNTB_ENST00000549987.1_Intron|FNTB_ENST00000542227.1_Intron|RAB15_ENST00000426039.3_Silent_p.Y63Y			P59190	RAB15_HUMAN	RAB15, member RAS oncogene family	109					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	8				all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)		CTTCTGGTGCGTACTAGGGAC	0.562																																						dbGAP											0			14											190.0	168.0	175.0					14																	65417130		2203	4300	6503	64486883	SO:0001819	synonymous_variant	0			BC014511	CCDS9768.1	14q23.2	2012-02-28	2012-02-28		ENSG00000139998	ENSG00000139998		"""RAB, member RAS oncogene"""	20150	protein-coding gene	gene with protein product						11697911	Standard	NM_198686		Approved		uc001xhz.2	P59190	OTTHUMG00000142810	ENST00000533601.2:c.327C>T	14.37:g.65417130G>A		69	0.00	0		21	30.00	9	64486883	29	40.82	20	G5EMR7|Q86TX7|Q8IW89	Missense_Mutation	SNP	PatternScan_SIGMA54_INTERACT_1,HMMSmart_RAB,HMMPfam_Ras,superfamily_SSF52540	p.T153M	ENST00000533601.2	37	c.458		14	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041099	0.35989	.	.	ENSG00000139998	ENST00000267512	T	0.67171	-0.25	5.84	-9.89	0.00464	.	1.023860	0.07856	N	0.965462	T	0.44265	0.1285	N	0.03608	-0.345	0.80722	D	1	B	0.13145	0.007	B	0.11329	0.006	T	0.36720	-0.9736	10	0.87932	D	0	.	21.9789	0.99964	0.2525:0.0:0.7475:0.0	.	153	P59190-2	.	M	153	ENSP00000267512:T153M	ENSP00000267512:T153M	T	-	2	0	RAB15	64486883	0.121000	0.22262	0.509000	0.27700	0.556000	0.35491	-0.381000	0.07417	-1.934000	0.01051	-1.202000	0.01658	ACG	-	NULL		0.562	RAB15-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	RAB15	protein_coding	OTTHUMT00000390443.2	G	NM_198686		64486883	-1	no_errors	NM_198686.2	genbank	human	validated	54_36p	missense	SNP	0.997	A
DUOX1	53905	genome.wustl.edu	37	15	45440166	45440166	+	Silent	SNP	T	T	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr15:45440166T>A	ENST00000321429.4	+	21	3020	c.2613T>A	c.(2611-2613)atT>atA	p.I871I	DUOX1_ENST00000561166.1_Silent_p.I517I|DUOX1_ENST00000389037.3_Silent_p.I871I	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	871	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		ATGGCCTCATTTCCAAGGATG	0.552																																						dbGAP											0			15											149.0	140.0	143.0					15																	45440166		2198	4298	6496	43227458	SO:0001819	synonymous_variant	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2613T>A	15.37:g.45440166T>A		62	0.00	0		0	100.00	2	43227458	52	42.22	38	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	HMMPfam_An_peroxidase,HMMSmart_SM00054,superfamily_Heme-dependent peroxidases,HMMPfam_FAD_binding_8,HMMPfam_NAD_binding_6,HMMPfam_Ferric_reduct,superfamily_Riboflavin synthase domain-like,PatternScan_EF_HAND_1,HMMPfam_efhand,superfamily_EF-hand,superfamily_Ferredoxin reductase-like C-terminal NADP-linked domain	p.I871	ENST00000321429.4	37	c.2613	CCDS32221.1	15																																																																																			-	HMMSmart_SM00054,PatternScan_EF_HAND_1,HMMPfam_efhand,superfamily_EF-hand		0.552	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	protein_coding	OTTHUMT00000416251.1	T	NM_017434		43227458	+1	no_errors	NM_017434.3	genbank	human	reviewed	54_36p	silent	SNP	0.894	A
MEX3B	84206	genome.wustl.edu	37	15	82336007	82336007	+	Missense_Mutation	SNP	A	A	G			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	A	A	A	G	A	A	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr15:82336007A>G	ENST00000329713.4	-	2	1639	c.1204T>C	c.(1204-1206)Tcg>Ccg	p.S402P	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	402					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						gaagcagacgaagatgcagaa	0.662																																						dbGAP											0			15											65.0	70.0	68.0					15																	82336007		2197	4288	6485	80123062	SO:0001583	missense	0			AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.1204T>C	15.37:g.82336007A>G	ENSP00000329918:p.Ser402Pro	17	0.00	0		12	47.83	11	80123062	17	32.00	8	Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	HMMSmart_SM00184,HMMSmart_SM00322,HMMPfam_KH_1,HMMPfam_zf-C3HC4,superfamily_Eukaryotic type KH-domain (KH-domain type I),superfamily_RING/U-box	p.S402P	ENST00000329713.4	37	c.1204	CCDS10319.1	15	.	.	.	.	.	.	.	.	.	.	A	2.654	-0.281351	0.05642	.	.	ENSG00000183496	ENST00000329713	T	0.25085	1.82	4.57	4.57	0.56435	.	0.662303	0.12522	N	0.461582	T	0.25306	0.0615	L	0.29908	0.895	0.80722	D	1	D	0.53885	0.963	P	0.49421	0.61	T	0.01099	-1.1452	10	0.34782	T	0.22	-7.1605	9.228	0.37418	0.8385:0.0:0.0:0.1615	.	402	Q6ZN04	MEX3B_HUMAN	P	402	ENSP00000329918:S402P	ENSP00000329918:S402P	S	-	1	0	MEX3B	80123062	0.006000	0.16342	0.237000	0.24090	0.025000	0.11179	-0.008000	0.12788	1.920000	0.55613	0.379000	0.24179	TCG	-	NULL		0.662	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3B	protein_coding	OTTHUMT00000304000.1	A	XM_290645		80123062	-1	no_errors	NM_032246.3	genbank	human	provisional	54_36p	missense	SNP	0.078	G
MUC16	94025	genome.wustl.edu	37	19	9088095	9088095	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	G	G	G	T	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr19:9088095G>T	ENST00000397910.4	-	1	3923	c.3720C>A	c.(3718-3720)agC>agA	p.S1240R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1240	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGGGTAGGTGCTGAGGGTTG	0.512																																						dbGAP											0			19											362.0	354.0	357.0					19																	9088095		2114	4243	6357	8949095	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.3720C>A	19.37:g.9088095G>T	ENSP00000381008:p.Ser1240Arg	135	0.74	1		NA	NA	NA	8949095	188	39.94	125	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	HMMPfam_SEA,HMMSmart_SM00200,PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain	p.S1240R	ENST00000397910.4	37	c.3720	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	2.949	-0.217175	0.06101	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	1.38	0.129	0.14739	.	.	.	.	.	T	0.01661	0.0053	N	0.08118	0	.	.	.	P	0.46020	0.871	B	0.40506	0.331	T	0.46857	-0.9161	8	0.87932	D	0	.	5.0979	0.14742	0.0:0.3805:0.6195:0.0	.	1240	B5ME49	.	R	1240	ENSP00000381008:S1240R	ENSP00000381008:S1240R	S	-	3	2	MUC16	8949095	0.000000	0.05858	0.000000	0.03702	0.101000	0.19017	-1.027000	0.03592	0.087000	0.17167	0.305000	0.20034	AGC	-	NULL		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690		8949095	-1	no_errors	NM_024690.2	genbank	human	validated	54_36p	missense	SNP	0.000	T
RBFOX2	23543	genome.wustl.edu	37	22	36334905	36334905	+	Missense_Mutation	SNP	C	C	T	rs562357805		TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr22:36334905C>T	ENST00000438146.2	-	2	226	c.227G>A	c.(226-228)cGg>cAg	p.R76Q	RBFOX2_ENST00000359369.4_5'UTR	NM_001082578.1|NM_001082579.1	NP_001076047|NP_001076048.1	O43251	RFOX2_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 2	16					dendrite morphogenesis (GO:0048813)|intracellular estrogen receptor signaling pathway (GO:0030520)|mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of cell proliferation (GO:0042127)|regulation of definitive erythrocyte differentiation (GO:0010724)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(4)|large_intestine(7)|lung(7)	18						CTGGCTGTCCCGCGCTGGGAA	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		17203	0.0		0.0	False		,,,				2504	0.001					dbGAP											0			22											87.0	88.0	88.0					22																	36334905		1932	4159	6091	34664851	SO:0001583	missense	0			AL009266	CCDS13921.1, CCDS43013.1, CCDS46699.1, CCDS46700.1, CCDS46701.1	22q12-q13	2013-02-12	2010-09-10	2010-09-10	ENSG00000100320	ENSG00000100320		"""RNA binding motif (RRM) containing"""	9906	protein-coding gene	gene with protein product	"""hexaribonucleotide binding protein 2"""	612149	"""RNA binding motif protein 9"""	RBM9			Standard	NM_014309		Approved	HNRBP2, FOX-2, HRNBP2	uc003aon.4	O43251	OTTHUMG00000150585	ENST00000438146.2:c.227G>A	22.37:g.36334905C>T	ENSP00000413035:p.Arg76Gln	79	0.00	0		3	40.00	2	34664851	86	15.69	16	A4F5G8|A8K5Z5|B0QYY8|B0QYY9|Q0PRL5|Q0VH35|Q5TF71|Q6IC09|Q8TD00|Q8WYB1|Q96DZ6|Q96NL7|Q9UGW4|Q9UH33	Missense_Mutation	SNP	HMMPfam_RRM_1,HMMSmart_RRM,superfamily_SSF54928	p.R76Q	ENST00000438146.2	37	c.227	CCDS43013.1	22	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073778	0.55646	.	.	ENSG00000100320	ENST00000338644;ENST00000438146;ENST00000408983	T;T	0.47869	0.83;1.8	5.22	5.22	0.72569	.	1.074000	0.07270	N	0.868992	T	0.50888	0.1642	N	0.08118	0	0.29756	N	0.835942	D;D	0.69078	0.997;0.997	D;D	0.66847	0.947;0.947	T	0.54430	-0.8295	10	0.44086	T	0.13	.	14.1472	0.65357	0.0:1.0:0.0:0.0	.	76;76	O43251-6;O43251-8	.;.	Q	16;76;28	ENSP00000413035:R76Q;ENSP00000386177:R28Q	ENSP00000342831:R16Q	R	-	2	0	RBFOX2	34664851	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.801000	0.55545	2.717000	0.92951	0.563000	0.77884	CGG	-	NULL		0.413	RBFOX2-005	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	RBM9	protein_coding	OTTHUMT00000319299.3	C			34664851	-1	no_errors	NM_001082578.2	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
MICALL1	85377	genome.wustl.edu	37	22	38323713	38323713	+	Silent	SNP	C	C	A			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr22:38323713C>A	ENST00000215957.6	+	9	1887	c.1761C>A	c.(1759-1761)ggC>ggA	p.G587G	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	587	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					GGACCAGGGGCAGCTCAGGTC	0.642																																						dbGAP											0			22											80.0	86.0	84.0					22																	38323713		2203	4300	6503	36653659	SO:0001819	synonymous_variant	0			BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.1761C>A	22.37:g.38323713C>A		33	0.00	0		13	18.75	3	36653659	13	27.78	5	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Silent	SNP	HMMPfam_CH,HMMSmart_CH,HMMPfam_LIM,HMMSmart_LIM,PatternScan_LIM_DOMAIN_1,superfamily_Calponin-homology,superfamily_SSF57716	p.G587	ENST00000215957.6	37	c.1761	CCDS13961.1	22	.	.	.	.	.	.	.	.	.	.	C	0.927	-0.713954	0.03206	.	.	ENSG00000100139	ENST00000454685	.	.	.	5.35	3.17	0.36434	.	.	.	.	.	T	0.55433	0.1920	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	T	0.51180	-0.8738	4	.	.	.	.	6.6392	0.22899	0.1448:0.7081:0.0:0.1472	.	.	.	.	K	165	.	.	Q	+	1	0	MICALL1	36653659	0.913000	0.31002	0.304000	0.25085	0.098000	0.18820	0.985000	0.29578	1.263000	0.44181	0.555000	0.69702	CAG	-	NULL		0.642	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	protein_coding	OTTHUMT00000319545.4	C	NM_033386		36653659	+1	no_errors	NM_033386.2	genbank	human	validated	54_36p	silent	SNP	0.758	A
DOCK8	81704	genome.wustl.edu	37	9	434936	434937	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AB-2849-03B-01W-0728-08	TCGA-AB-2849-11B-01W-0729-08	-	-	-	T	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	0d3e1576-f0cd-4066-b6af-e3f96cac6d25	b983feb5-f7d5-4890-a57a-0ad7f94bacc2	g.chr9:434936_434937insT	ENST00000453981.1	+	39	5152_5153	c.5040_5041insT	c.(5041-5043)gacfs	p.D1681fs	DOCK8_ENST00000469391.1_Frame_Shift_Ins_p.D1581fs|DOCK8_ENST00000432829.2_Frame_Shift_Ins_p.D1613fs|DOCK8_ENST00000382329.1_Frame_Shift_Ins_p.D1148fs			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1681	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GCATGCTGGAGGACCACAGCTA	0.574																																						dbGAP											0			9																																								424937	SO:0001589	frameshift_variant	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	Exception_encountered	9.37:g.434936_434937insT	ENSP00000408464:p.Asp1681fs	48	0.00	0		21	0.00	0	424936	42	23.64	13	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Frame_Shift_Ins	INS	HMMPfam_Ded_cyto	p.D1612fs	ENST00000453981.1	37	c.4836_4837	CCDS6440.2	9																																																																																			-	NULL		0.574	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	-	XM_036307		424937	+1	no_errors	NM_203447.1	genbank	human	validated	54_36p	frame_shift_ins	INS	1.000:1.000	T
