#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NormalRefReads_WU	i_NormalVAF_WU	i_NormalVarReads_WU	i_ORegAnno_bin	i_RNARefReads_WU	i_RNAVAF_WU	i_RNAVarReads_WU	i_Start_position_hg18	i_TumorRefReads_WU	i_TumorVAF_WU	i_TumorVarReads_WU	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
USP11	8237	genome.wustl.edu	37	X	47104803	47104803	+	Missense_Mutation	SNP	T	T	A			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	T	T	T	A	T	T	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chrX:47104803T>A	ENST00000218348.3	+	17	2321	c.2321T>A	c.(2320-2322)aTg>aAg	p.M774K	USP11_ENST00000377107.2_Missense_Mutation_p.M731K	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	774	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						GGGTACGTGATGAAGAAGGCT	0.597																																						dbGAP											0			X											67.0	52.0	57.0					X																	47104803		2203	4300	6503	46989747	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2321T>A	X.37:g.47104803T>A	ENSP00000218348:p.Met774Lys	58	3.33	2		99	0.00	0	46989747	82	44.37	67	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	HMMPfam_UCH,HMMSmart_DUSP,HMMPfam_DUF1055,PatternScan_UCH_2_1,PatternScan_UCH_2_2,superfamily_SSF54001	p.M774K	ENST00000218348.3	37	c.2321	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	T	1.026	-0.683451	0.03353	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.18174	2.24;2.23	5.08	5.08	0.68730	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.698156	0.12928	N	0.427597	T	0.06554	0.0168	N	0.01438	-0.865	0.23972	N	0.996306	B;B	0.16396	0.0;0.017	B;B	0.21708	0.0;0.036	T	0.31223	-0.9951	10	0.09084	T	0.74	-5.0223	11.4876	0.50363	0.0:0.0:0.0:1.0	.	500;774	B3KP28;P51784	.;UBP11_HUMAN	K	731;774	ENSP00000366311:M731K;ENSP00000218348:M774K	ENSP00000218348:M774K	M	+	2	0	USP11	46989747	1.000000	0.71417	0.969000	0.41365	0.720000	0.41350	2.270000	0.43355	1.694000	0.51137	0.356000	0.21956	ATG	-	HMMPfam_UCH,superfamily_SSF54001		0.597	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	protein_coding		T	NM_004651		46989747	+1	no_errors	NM_004651.3	genbank	human	reviewed	54_36p	missense	SNP	0.993	A
GPR112	139378	genome.wustl.edu	37	X	135431546	135431546	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chrX:135431546C>T	ENST00000394143.1	+	6	5972	c.5681C>T	c.(5680-5682)cCa>cTa	p.P1894L	GPR112_ENST00000370652.1_Missense_Mutation_p.P1894L|GPR112_ENST00000412101.1_Missense_Mutation_p.P1689L|GPR112_ENST00000287534.4_Missense_Mutation_p.P1831L|GPR112_ENST00000394141.1_Missense_Mutation_p.P1689L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1894					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCTCAGTTTCCAATTTCCACC	0.433																																						dbGAP											0			X											129.0	124.0	126.0					X																	135431546		2203	4300	6503	135259212	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5681C>T	X.37:g.135431546C>T	ENSP00000377699:p.Pro1894Leu	111	0.88	1		NA	NA	NA	135259212	195	36.98	115	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2,superfamily_ConA_like_lec_gl,PatternScan_G_PROTEIN_RECEP_F2_2	p.P1894L	ENST00000394143.1	37	c.5681	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	c	10.47	1.359206	0.24598	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.52754	0.69;0.69;0.65;0.73;0.65	3.78	1.86	0.25419	.	.	.	.	.	T	0.50394	0.1613	L	0.29908	0.895	0.09310	N	1	D;D;D	0.89917	0.969;1.0;1.0	P;D;D	0.87578	0.637;0.998;0.994	T	0.28332	-1.0047	9	0.54805	T	0.06	.	4.5912	0.12307	0.2207:0.6466:0.0:0.1327	.	1831;1689;1894	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	1894;1894;1689;1831;1689	ENSP00000377699:P1894L;ENSP00000359686:P1894L;ENSP00000416526:P1689L;ENSP00000287534:P1831L;ENSP00000377697:P1689L	ENSP00000287534:P1831L	P	+	2	0	GPR112	135259212	0.021000	0.18746	0.006000	0.13384	0.314000	0.28054	0.652000	0.24888	0.547000	0.28938	0.530000	0.56133	CCA	-	NULL		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	C			135259212	+1	no_errors	NM_153834.3	genbank	human	validated	54_36p	missense	SNP	0.002	T
IGKV2-40	28916	genome.wustl.edu	37	2	89630099	89630099	+	RNA	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr2:89630099C>T	ENST00000390264.2	-	0	87									immunoglobulin kappa variable 2-40																		GAGGCTCTGACTAGACCTGCA	0.522																																						dbGAP											0			2											0.0	1.0	1.0					2																	89630099		0	2	2	89411214			0			X59314		2p11.2	2014-05-06			ENSG00000211619	ENSG00000273962		"""Immunoglobulins / IGK locus"""	5789	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000188265		2.37:g.89630099C>T		62	1.59	1		0	0.00	0	89411214	87	25.42	30		Missense_Mutation	SNP	HMMSmart_IGv,HMMPfam_V-set,superfamily_SSF48726	p.S32N	ENST00000390264.2	37	c.95		2																																																																																			-	HMMSmart_IGv,HMMPfam_V-set,superfamily_SSF48726		0.522	IGKV2-40-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211619	IG_V_gene	OTTHUMT00000323475.1	C	NG_000834		89411214	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390264	ensembl	human	known	54_36p	missense	SNP	0.823	T
LRRC58	116064	genome.wustl.edu	37	3	120050085	120050085	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr3:120050085C>T	ENST00000295628.3	-	4	1173	c.1078G>A	c.(1078-1080)Gtt>Att	p.V360I		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	360										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		CGTGCAGCAACACTAGCTTCA	0.433																																						dbGAP											0			3											79.0	79.0	79.0					3																	120050085		1953	4146	6099	121532775	SO:0001583	missense	0			BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.1078G>A	3.37:g.120050085C>T	ENSP00000295628:p.Val360Ile	89	1.11	1		12	45.45	10	121532775	92	41.14	65		Missense_Mutation	SNP	HMMPfam_LRR_1,HMMSmart_LRR_TYP,superfamily_SSF52058	p.V360I	ENST00000295628.3	37	c.1078	CCDS46892.1	3	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328571	0.60743	.	.	ENSG00000163428	ENST00000295628	T	0.49432	0.78	5.61	4.74	0.60224	.	0.113233	0.64402	N	0.000014	T	0.46983	0.1421	M	0.67953	2.075	0.45634	D	0.998565	B	0.06786	0.001	B	0.06405	0.002	T	0.41980	-0.9478	10	0.41790	T	0.15	-5.86	13.4143	0.60959	0.0:0.9243:0.0:0.0757	.	360	Q96CX6	LRC58_HUMAN	I	360	ENSP00000295628:V360I	ENSP00000295628:V360I	V	-	1	0	LRRC58	121532775	1.000000	0.71417	0.946000	0.38457	0.996000	0.88848	4.733000	0.62036	1.369000	0.46134	0.655000	0.94253	GTT	-	NULL		0.433	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC58	protein_coding	OTTHUMT00000355142.1	C	XM_057296		121532775	-1	no_errors	NM_001099678.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
ILDR1	286676	genome.wustl.edu	37	3	121712623	121712623	+	Missense_Mutation	SNP	C	C	T	rs372613583		TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr3:121712623C>T	ENST00000344209.5	-	7	1099	c.973G>A	c.(973-975)Gtg>Atg	p.V325M	ILDR1_ENST00000462014.1_Missense_Mutation_p.V293M|ILDR1_ENST00000393631.1_Missense_Mutation_p.V236M|ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000273691.3_Missense_Mutation_p.V281M	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	325					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		CTGCGTTCCACGACCTCAGAG	0.602																																						dbGAP											0			3						C	MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	80.0	78.0	79.0		973,706,841	4.8	0.4	3		79	0,8600		0,0,4300	no	missense,missense,missense	ILDR1	NM_001199799.1,NM_001199800.1,NM_175924.3	21,21,21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	325/547,236/458,281/503	121712623	1,13005	2203	4300	6503	123195313	SO:0001583	missense	0			BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.973G>A	3.37:g.121712623C>T	ENSP00000345667:p.Val325Met	104	0.00	0		1	50.00	1	123195313	159	39.25	104	Q6ZP61|Q7Z578	Missense_Mutation	SNP	HMMSmart_IG,HMMPfam_LSR,superfamily_SSF48726	p.V281M	ENST00000344209.5	37	c.841	CCDS56271.1	3	.	.	.	.	.	.	.	.	.	.	C	15.03	2.711706	0.48517	2.27E-4	0.0	ENSG00000145103	ENST00000273691;ENST00000344209;ENST00000393631;ENST00000462014	T;T;D;T	0.82081	-0.9;-0.61;-1.57;-0.51	5.66	4.79	0.61399	.	0.523743	0.23384	N	0.048768	D	0.88459	0.6442	L	0.61036	1.89	0.40378	D	0.979418	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;P;D;D	0.91635	0.999;0.791;0.969;0.969	D	0.86984	0.2106	10	0.31617	T	0.26	-19.428	12.1631	0.54115	0.0:0.9172:0.0:0.0828	.	236;325;281;293	Q86SU0-5;Q86SU0;Q86SU0-2;Q86SU0-6	.;ILDR1_HUMAN;.;.	M	281;325;236;293	ENSP00000273691:V281M;ENSP00000345667:V325M;ENSP00000377251:V236M;ENSP00000419414:V293M	ENSP00000273691:V281M	V	-	1	0	ILDR1	123195313	0.001000	0.12720	0.426000	0.26672	0.841000	0.47740	0.077000	0.14738	1.395000	0.46643	0.655000	0.94253	GTG	-	NULL		0.602	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ILDR1	protein_coding	OTTHUMT00000355666.1	C	NM_175924		123195313	-1	no_errors	NM_175924.2	genbank	human	provisional	54_36p	missense	SNP	0.057	T
KLF15	28999	genome.wustl.edu	37	3	126071369	126071369	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr3:126071369C>T	ENST00000296233.3	-	2	627	c.397G>A	c.(397-399)Gtc>Atc	p.V133I	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	133					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		GGCCGTGGGACGTCATCAGGA	0.622																																						dbGAP											0			3											37.0	39.0	38.0					3																	126071369		2203	4300	6503	127554059	SO:0001583	missense	0			AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.397G>A	3.37:g.126071369C>T	ENSP00000296233:p.Val133Ile	13	0.00	0		1	0.00	0	127554059	14	56.25	18		Missense_Mutation	SNP	HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2,superfamily_SSF57667	p.V133I	ENST00000296233.3	37	c.397	CCDS3036.1	3	.	.	.	.	.	.	.	.	.	.	C	1.139	-0.649978	0.03506	.	.	ENSG00000163884	ENST00000296233	T	0.07327	3.2	4.45	2.64	0.31445	.	0.803185	0.11583	N	0.549505	T	0.08403	0.0209	L	0.51422	1.61	0.09310	N	1	B	0.24368	0.102	B	0.17722	0.019	T	0.32640	-0.9899	10	0.32370	T	0.25	.	6.9792	0.24694	0.0:0.7014:0.0:0.2986	.	133	Q9UIH9	KLF15_HUMAN	I	133	ENSP00000296233:V133I	ENSP00000296233:V133I	V	-	1	0	KLF15	127554059	0.232000	0.23762	0.020000	0.16555	0.081000	0.17604	2.068000	0.41471	0.578000	0.29487	-0.216000	0.12614	GTC	-	NULL		0.622	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF15	protein_coding	OTTHUMT00000370096.1	C	NM_014079		127554059	-1	no_errors	NM_014079.3	genbank	human	validated	54_36p	missense	SNP	0.026	T
STAG3L2	442582	genome.wustl.edu	37	7	74306962	74306962	+	RNA	SNP	G	G	C	rs201591143	byFrequency	TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr7:74306962G>C	ENST00000423186.1	-	0	0							P0CL84	ST3L2_HUMAN	stromal antigen 3-like 2 (pseudogene)							nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|pancreas(1)	5						GCTGAGAGCTGGAGGTGAGCT	0.677																																						dbGAP											0			7											22.0	22.0	22.0					7																	74306962		876	1983	2859	73944898			0					7q11.23	2013-06-26	2013-06-26			ENSG00000277072			33886	pseudogene	pseudogene			"""stromal antigen 3-like 2"""				Standard	NR_040584		Approved	MGC131759, STAG3L2P	uc011kfj.2	P0CL84	OTTHUMG00000156216		7.37:g.74306962G>C		101	2.88	3		3	0.00	0	73944898	51	25.00	17	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	Missense_Mutation	SNP	NULL	p.W22S	ENST00000423186.1	37	c.65		7																																																																																			-	NULL		0.677	STAG3L2-002	KNOWN	basic	retained_intron	PMS2L5	pseudogene	OTTHUMT00000343523.2	G	NM_001025202		73944898	+1	no_start_codon	ENST00000337023	ensembl	human	known	54_36p	missense	SNP	0.000	C
STEAP1	26872	genome.wustl.edu	37	7	89790158	89790158	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr7:89790158G>A	ENST00000297205.2	+	3	324	c.124G>A	c.(124-126)Gtg>Atg	p.V42M	STEAP2-AS1_ENST00000478318.2_RNA	NM_012449.2	NP_036581.1	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the prostate 1	42					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|transmembrane transport (GO:0055085)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	channel activity (GO:0015267)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	14	all_hematologic(106;0.112)					AAAAAGACCTGTGCTTTTGCA	0.418																																						dbGAP											0			7											113.0	110.0	111.0					7																	89790158		2203	4300	6503	89628094	SO:0001583	missense	0			AF186249	CCDS5614.1	7q21	2011-08-31	2005-02-21	2005-02-24	ENSG00000164647	ENSG00000164647		"""Serine peptidases / Serine peptidases"""	11378	protein-coding gene	gene with protein product		604415	"""six transmembrane epithelial antigen of the prostate"""	STEAP			Standard	NM_012449		Approved	PRSS24	uc003ujx.3	Q9UHE8	OTTHUMG00000023006	ENST00000297205.2:c.124G>A	7.37:g.89790158G>A	ENSP00000297205:p.Val42Met	106	0.92	1		NA	NA	NA	89628094	128	35.15	71	A4D1E0|O95034	Missense_Mutation	SNP	HMMPfam_Ferric_reduct	p.V42M	ENST00000297205.2	37	c.124	CCDS5614.1	7	.	.	.	.	.	.	.	.	.	.	G	10.16	1.273389	0.23221	.	.	ENSG00000164647	ENST00000297205	T	0.07021	3.23	5.02	4.14	0.48551	.	0.959572	0.08600	N	0.921670	T	0.10594	0.0259	L	0.40543	1.245	0.23816	N	0.996768	B;B	0.10296	0.003;0.003	B;B	0.11329	0.006;0.006	T	0.27088	-1.0084	10	0.52906	T	0.07	-0.0159	13.3882	0.60807	0.0:0.0:0.8426:0.1574	.	42;42	B4E221;Q9UHE8	.;STEA1_HUMAN	M	42	ENSP00000297205:V42M	ENSP00000297205:V42M	V	+	1	0	STEAP1	89628094	0.912000	0.30974	0.973000	0.42090	0.393000	0.30537	1.679000	0.37597	1.330000	0.45394	-0.152000	0.13540	GTG	-	NULL		0.418	STEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP1	protein_coding	OTTHUMT00000059327.3	G	NM_012449		89628094	+1	no_errors	NM_012449.2	genbank	human	reviewed	54_36p	missense	SNP	0.191	A
STRIP2	57464	genome.wustl.edu	37	7	129091522	129091522	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr7:129091522C>T	ENST00000249344.2	+	4	383	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	STRIP2_ENST00000435494.2_Missense_Mutation_p.R115W	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	115					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											ACTCTTGGACCGGCTAGAGGT	0.552																																						dbGAP											0			7											76.0	74.0	75.0					7																	129091522		2203	4300	6503	128878758	SO:0001583	missense	0			AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.343C>T	7.37:g.129091522C>T	ENSP00000249344:p.Arg115Trp	124	0.80	1		1	66.67	2	128878758	81	40.88	56	Q8WUZ4	Missense_Mutation	SNP	HMMPfam_N1221	p.R115W	ENST00000249344.2	37	c.343	CCDS34752.1	7	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947220	0.73672	.	.	ENSG00000128578	ENST00000249344;ENST00000435494	T;T	0.47528	0.84;0.84	4.48	2.44	0.29823	.	0.265950	0.33161	N	0.005202	T	0.49474	0.1559	L	0.50333	1.59	0.36304	D	0.857214	D;D	0.61697	0.99;0.979	P;P	0.54924	0.469;0.764	T	0.57917	-0.7728	10	0.62326	D	0.03	-10.3924	6.7608	0.23540	0.3539:0.4736:0.1725:0.0	.	115;115	Q9ULQ0;Q9ULQ0-2	FA40B_HUMAN;.	W	115	ENSP00000249344:R115W;ENSP00000392393:R115W	ENSP00000249344:R115W	R	+	1	2	FAM40B	128878758	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.249000	0.58766	0.965000	0.38133	0.650000	0.86243	CGG	-	HMMPfam_N1221		0.552	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM40B	protein_coding	OTTHUMT00000349418.1	C	NM_001134336		128878758	+1	no_errors	NM_020704.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
XKR4	114786	genome.wustl.edu	37	8	56436028	56436028	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	A	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr8:56436028C>A	ENST00000327381.6	+	3	1295	c.1195C>A	c.(1195-1197)Ctg>Atg	p.L399M	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	399						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GGTTTTCCAGCTGTACTTTGG	0.512																																						dbGAP											0			8											349.0	276.0	301.0					8																	56436028		2203	4300	6503	56598582	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1195C>A	8.37:g.56436028C>A	ENSP00000328326:p.Leu399Met	177	1.10	2		NA	NA	NA	56598582	160	46.03	139	Q96PZ8	Missense_Mutation	SNP	HMMPfam_XK-related	p.L399M	ENST00000327381.6	37	c.1195	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492677	0.64074	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.68765	-0.35	5.71	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.79399	0.4439	M	0.69523	2.12	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.79526	-0.1767	10	0.54805	T	0.06	-12.4797	12.6233	0.56616	0.0:0.8821:0.0:0.1179	.	399	Q5GH76	XKR4_HUMAN	M	399	ENSP00000328326:L399M	ENSP00000328326:L399M	L	+	1	2	XKR4	56598582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.970000	0.63742	0.775000	0.33450	0.557000	0.71058	CTG	-	HMMPfam_XK-related		0.512	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	protein_coding	OTTHUMT00000378129.2	C	NM_052898		56598582	+1	no_errors	NM_052898.1	genbank	human	provisional	54_36p	missense	SNP	1.000	A
PLPPR1	54886	genome.wustl.edu	37	9	104086335	104086335	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr9:104086335C>T	ENST00000374874.3	+	8	1413	c.974C>T	c.(973-975)aCc>aTc	p.T325I	SNORA31_ENST00000517232.1_RNA|LPPR1_ENST00000395056.2_Missense_Mutation_p.T325I	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		325					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										ACCGAAGTTACCTGAGACGAC	0.413																																						dbGAP											0			9											156.0	123.0	134.0					9																	104086335		2203	4300	6503	103126156	SO:0001583	missense	0																														ENST00000374874.3:c.974C>T	9.37:g.104086335C>T	ENSP00000364008:p.Thr325Ile	175	1.13	2		NA	NA	NA	103126156	142	37.12	85	Q5VX23|Q9NXE2	Missense_Mutation	SNP	HMMPfam_PAP2,HMMSmart_acidPPc,superfamily_AcPase_VanPerase	p.T325I	ENST00000374874.3	37	c.974	CCDS6751.1	9	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835501	0.50951	.	.	ENSG00000148123	ENST00000374874;ENST00000374871;ENST00000395056	T;T	0.32988	1.43;1.43	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.42404	0.1201	N	0.19112	0.55	0.58432	D	0.999997	B;D	0.71674	0.206;0.998	B;D	0.73708	0.076;0.981	T	0.46400	-0.9194	10	0.87932	D	0	0.1166	17.8069	0.88604	0.0:1.0:0.0:0.0	.	309;325	B7Z8P4;Q8TBJ4	.;LPPR1_HUMAN	I	325	ENSP00000364008:T325I;ENSP00000378496:T325I	ENSP00000364005:T325I	T	+	2	0	RP11-35N6.1	103126156	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.013000	0.70776	2.449000	0.82847	0.650000	0.86243	ACC	-	NULL		0.413	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRG-3	protein_coding	OTTHUMT00000053425.1	C			103126156	+1	no_errors	NM_017753.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MACROD1	28992	genome.wustl.edu	37	11	63884184	63884184	+	Intron	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr11:63884184C>T	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Missense_Mutation_p.R149C	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CTCGCTGGCCCGCATCCCGCT	0.617																																						dbGAP											0			11											47.0	43.0	44.0					11																	63884184		2201	4297	6498	63640760	SO:0001627	intron_variant	0			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34526G>A	11.37:g.63884184C>T		21	0.00	0		4	0.00	0	63640760	32	38.46	20	Q9UH96	Missense_Mutation	SNP	HMMPfam_LRRNT,HMMSmart_SM00013,HMMSmart_SM00082,HMMPfam_LRR_1,HMMSmart_SM00369,HMMPfam_fn3,HMMSmart_SM00364,superfamily_L domain-like	p.R149C	ENST00000255681.6	37	c.445	CCDS8056.1	11	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446414	0.63178	.	.	ENSG00000126500	ENST00000246841	T	0.58506	0.33	5.56	4.64	0.57946	.	0.068872	0.64402	D	0.000016	T	0.70753	0.3260	M	0.70108	2.13	0.80722	D	1	D	0.63046	0.992	P	0.60473	0.875	T	0.73062	-0.4101	10	0.56958	D	0.05	-34.6641	13.6819	0.62491	0.0:0.9229:0.0:0.0771	.	121	Q9NZU1	FLRT1_HUMAN	C	149	ENSP00000246841:R149C	ENSP00000246841:R149C	R	+	1	0	FLRT1	63640760	0.738000	0.28186	1.000000	0.80357	0.960000	0.62799	1.551000	0.36233	2.615000	0.88500	0.555000	0.69702	CGC	-	HMMPfam_LRR_1,HMMSmart_SM00369,superfamily_L domain-like		0.617	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT1	protein_coding	OTTHUMT00000396570.1	C	NM_014067		63640760	+1	no_errors	NM_013280.4	genbank	human	reviewed	54_36p	missense	SNP	0.943	T
ELMOD1	55531	genome.wustl.edu	37	11	107501281	107501281	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr11:107501281G>A	ENST00000265840.7	+	3	421	c.156G>A	c.(154-156)atG>atA	p.M52I	ELMOD1_ENST00000531234.1_Missense_Mutation_p.M46I|ELMOD1_ENST00000443271.2_Missense_Mutation_p.M52I	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	52					phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		CTAGAACCATGAAAATCGGTA	0.408																																						dbGAP											0			11											61.0	57.0	59.0					11																	107501281		1862	4102	5964	107006491	SO:0001583	missense	0			AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.156G>A	11.37:g.107501281G>A	ENSP00000265840:p.Met52Ile	159	1.84	3		NA	NA	NA	107006491	166	40.07	113	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	HMMPfam_ELMO_CED12	p.M52I	ENST00000265840.7	37	c.156	CCDS44723.1	11	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731663	0.30684	.	.	ENSG00000110675	ENST00000531234;ENST00000265840;ENST00000443271	.	.	.	5.62	5.62	0.85841	.	0.046863	0.85682	D	0.000000	T	0.42200	0.1192	N	0.22421	0.69	0.40539	D	0.981001	B;B	0.15473	0.006;0.013	B;B	0.06405	0.001;0.002	T	0.29671	-1.0004	9	0.22109	T	0.4	.	12.9371	0.58320	0.0741:0.0:0.9259:0.0	.	52;52	Q8N336;G5E9S5	ELMD1_HUMAN;.	I	46;52;52	.	ENSP00000265840:M52I	M	+	3	0	ELMOD1	107006491	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.275000	0.43399	2.648000	0.89879	0.655000	0.94253	ATG	-	NULL		0.408	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	ELMOD1	protein_coding	OTTHUMT00000389406.1	G	NM_018712		107006491	+1	no_errors	NM_018712.1	genbank	human	validated	54_36p	missense	SNP	1.000	A
IGSF9B	22997	genome.wustl.edu	37	11	133814258	133814258	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr11:133814258C>T	ENST00000321016.8	-	3	496	c.266G>A	c.(265-267)cGg>cAg	p.R89Q	IGSF9B_ENST00000533871.2_Missense_Mutation_p.R89Q			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	89	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		AAGACTGGCCCGGCCTGGGGG	0.572																																						dbGAP											0			11											50.0	53.0	52.0					11																	133814258		1987	4152	6139	133319468	SO:0001583	missense	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.266G>A	11.37:g.133814258C>T	ENSP00000317980:p.Arg89Gln	40	4.76	2		NA	NA	NA	133319468	42	40.00	28	G5EA26	Missense_Mutation	SNP	HMMSmart_IGc2,HMMSmart_IG,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like,HMMPfam_I-set,HMMPfam_V-set,superfamily_SSF48726	p.R89Q	ENST00000321016.8	37	c.266		11	.	.	.	.	.	.	.	.	.	.	C	35	5.453277	0.96223	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160;ENST00000526663	T;T;T;T	0.39787	1.06;1.06;1.06;1.35	5.69	5.69	0.88448	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000035	T	0.67050	0.2852	M	0.74258	2.255	0.58432	D	0.999993	D	0.76494	0.999	D	0.74023	0.982	T	0.69209	-0.5205	10	0.87932	D	0	.	19.8208	0.96592	0.0:1.0:0.0:0.0	.	89	Q9UPX0	TUTLB_HUMAN	Q	89;89;79;136	ENSP00000317980:R89Q;ENSP00000436576:R89Q;ENSP00000434026:R79Q;ENSP00000435989:R136Q	ENSP00000317980:R89Q	R	-	2	0	IGSF9B	133319468	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.705000	0.84606	2.688000	0.91661	0.563000	0.77884	CGG	-	HMMSmart_IG,HMMPfam_V-set,superfamily_SSF48726		0.572	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	protein_coding		C	XM_290502		133319468	-1	no_errors	NM_014987.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
TROAP	10024	genome.wustl.edu	37	12	49722966	49722966	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr12:49722966G>A	ENST00000257909.3	+	10	1119	c.1043G>A	c.(1042-1044)cGt>cAt	p.R348H	TROAP_ENST00000547923.1_Missense_Mutation_p.R56H|TROAP_ENST00000551245.1_Missense_Mutation_p.R348H	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	348					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						GTGTTGCGGCGTCTCACCGTT	0.557																																						dbGAP											0			12											218.0	209.0	212.0					12																	49722966		2203	4300	6503	48009233	SO:0001583	missense	0			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1043G>A	12.37:g.49722966G>A	ENSP00000257909:p.Arg348His	160	5.33	9		12	47.83	11	48009233	145	41.90	106	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	NULL	p.R348H	ENST00000257909.3	37	c.1043	CCDS8784.1	12	.	.	.	.	.	.	.	.	.	.	G	10.88	1.474875	0.26511	.	.	ENSG00000135451	ENST00000551245;ENST00000257909;ENST00000547923	.	.	.	5.33	2.11	0.27256	.	0.233411	0.30781	N	0.008883	T	0.17577	0.0422	N	0.15975	0.35	0.09310	N	1	B;B;B	0.13145	0.007;0.003;0.001	B;B;B	0.11329	0.006;0.006;0.002	T	0.10268	-1.0637	9	0.56958	D	0.05	-5.8502	3.4333	0.07436	0.2165:0.0:0.5813:0.2022	.	348;56;348	F8W130;F8W1U0;Q12815	.;.;TROAP_HUMAN	H	348;348;56	.	ENSP00000257909:R348H	R	+	2	0	TROAP	48009233	0.000000	0.05858	0.020000	0.16555	0.046000	0.14306	0.361000	0.20267	1.253000	0.44018	-0.448000	0.05591	CGT	-	NULL		0.557	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROAP	protein_coding	OTTHUMT00000404300.1	G	NM_005480		48009233	+1	no_errors	NM_005480.1	genbank	human	validated	54_36p	missense	SNP	0.009	A
SACS	26278	genome.wustl.edu	37	13	23928871	23928871	+	Missense_Mutation	SNP	G	G	A	rs370893484	byFrequency	TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr13:23928871G>A	ENST00000382292.3	-	7	2153	c.1880C>T	c.(1879-1881)aCg>aTg	p.T627M	SACS_ENST00000476776.1_5'UTR|SACS_ENST00000402364.1_De_novo_Start_InFrame|SACS_ENST00000382298.3_Missense_Mutation_p.T627M			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	627					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CCACGCGGGCGTCACCTTCCT	0.567													G|||	2	0.000399361	0.0	0.0	5008	,	,		18317	0.001		0.0	False		,,,				2504	0.001					dbGAP											0			13						G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	68.0	62.0	64.0		1880	4.9	1.0	13		64	0,8600		0,0,4300	no	missense	SACS	NM_014363.4	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	627/4580	23928871	1,13005	2203	4300	6503	22826871	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1880C>T	13.37:g.23928871G>A	ENSP00000371729:p.Thr627Met	34	0.00	0		6	40.00	4	22826871	48	49.47	47	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	superfamily_Chaperone J-domain,superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase,HMMPfam_HEPN,HMMSmart_SM00748,superfamily_Nucleotidyltransferase substrate binding subunit/domain	p.T480M	ENST00000382292.3	37	c.1439	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747824	0.49257	2.27E-4	0.0	ENSG00000151835	ENST00000382292;ENST00000382298;ENST00000423156	T;T;T	0.11821	2.74;2.74;2.74	5.74	4.89	0.63831	.	0.049637	0.85682	D	0.000000	T	0.41282	0.1152	M	0.82630	2.6	0.37205	D	0.904574	D;D;D	0.89917	1.0;1.0;0.994	D;D;P	0.79108	0.984;0.992;0.742	T	0.56202	-0.8018	10	0.72032	D	0.01	.	15.2736	0.73726	0.0675:0.0:0.9324:0.0	.	526;414;627	B2REB1;E9PAL4;Q9NZJ4	.;.;SACS_HUMAN	M	627;627;251	ENSP00000371729:T627M;ENSP00000371735:T627M;ENSP00000390925:T251M	ENSP00000371729:T627M	T	-	2	0	SACS	22826871	1.000000	0.71417	0.963000	0.40424	0.390000	0.30446	5.306000	0.65756	1.568000	0.49683	0.561000	0.74099	ACG	-	NULL		0.567	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	protein_coding	OTTHUMT00000044148.3	G	NM_014363		22826871	-1	no_errors	NM_014363.4	genbank	human	validated	54_36p	missense	SNP	1.000	A
ADAM21P1	145241	genome.wustl.edu	37	14	70712652	70712652	+	RNA	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr14:70712652C>T	ENST00000530196.1	-	0	1866					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		GTAAAATGATCTTGGAGAAGA	0.398																																						dbGAP											0			14																																								69782405			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70712652C>T		163	0.61	1		NA	NA	NA	69782405	150	25.62	52		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.398	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P	pseudogene	OTTHUMT00000390451.1	C	NG_002467		69782405	-1	pseudogene	NR_003951.1	genbank	human	validated	54_36p	rna	SNP	0.004	T
FLRT2	23768	genome.wustl.edu	37	14	86088113	86088113	+	Silent	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr14:86088113C>T	ENST00000330753.4	+	2	1022	c.255C>T	c.(253-255)caC>caT	p.H85H	FLRT2_ENST00000554746.1_Silent_p.H85H	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	85					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CAGAACTGCACAATGTACAGT	0.488																																						dbGAP											0			14											134.0	121.0	126.0					14																	86088113		2203	4300	6503	85157866	SO:0001819	synonymous_variant	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.255C>T	14.37:g.86088113C>T		78	2.47	2		NA	NA	NA	85157866	101	44.32	82	A0AV84|B7ZLP3	Silent	SNP	HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRRCT,HMMSmart_LRRCT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like,superfamily_SSF52058	p.H85	ENST00000330753.4	37	c.255	CCDS9877.1	14																																																																																			-	superfamily_SSF52058		0.488	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	protein_coding	OTTHUMT00000413193.1	C			85157866	+1	no_errors	NM_013231.4	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
IDH2	3418	genome.wustl.edu	37	15	90631934	90631934	+	Missense_Mutation	SNP	C	C	T	rs121913502		TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr15:90631934C>T	ENST00000330062.3	-	4	532	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000539790.1_Missense_Mutation_p.R10Q|IDH2_ENST00000540499.2_Missense_Mutation_p.R88Q	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	140	Substrate binding. {ECO:0000250}.		R -> G (in D2HGA2). {ECO:0000269|PubMed:20847235}.|R -> Q (in D2HGA2). {ECO:0000269|PubMed:20847235}.		2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R140Q(292)|p.R140L(8)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTTCCGGATAGTTCC	0.537			M		GBM																																	dbGAP		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	300	Substitution - Missense(300)	haematopoietic_and_lymphoid_tissue(300)	15											103.0	103.0	103.0					15																	90631934		2200	4298	6498	88432938	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.419G>A	15.37:g.90631934C>T	ENSP00000331897:p.Arg140Gln	56	0.00	0		143	43.03	108	88432938	61	41.51	44	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	HMMPfam_Iso_dh,PatternScan_IDH_IMDH,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like	p.R140Q	ENST00000330062.3	37	c.419	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604397	0.66445	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.87179	-2.22;-2.22;-2.22	5.67	4.75	0.60458	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	H	0.96833	3.89	0.48185	D	0.999601	D	0.89917	1.0	D	0.87578	0.998	D	0.96254	0.9185	10	0.87932	D	0	.	12.4459	0.55651	0.0:0.9189:0.0:0.0811	.	140	P48735	IDHP_HUMAN	Q	140;10;88	ENSP00000331897:R140Q;ENSP00000438457:R10Q;ENSP00000446147:R88Q	ENSP00000331897:R140Q	R	-	2	0	IDH2	88432938	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.797000	0.85911	1.397000	0.46682	-0.258000	0.10820	CGG	-	HMMPfam_Iso_dh,superfamily_Isocitrate/Isopropylmalate dehydrogenase-like		0.537	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	protein_coding	OTTHUMT00000313426.1	C			88432938	-1	no_errors	NM_002168.2	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
N4BP1	9683	genome.wustl.edu	37	16	48580097	48580097	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	A	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr16:48580097G>A	ENST00000262384.3	-	6	2530	c.2294C>T	c.(2293-2295)cCt>cTt	p.P765L	N4BP1_ENST00000565423.1_Intron	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	765					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				CTCTAATCGAGGTCCACTTCT	0.423																																						dbGAP											0			16											114.0	109.0	111.0					16																	48580097		1918	4121	6039	47137598	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.2294C>T	16.37:g.48580097G>A	ENSP00000262384:p.Pro765Leu	53	0.00	0		25	41.86	18	47137598	100	30.00	45	A7MD49|Q2YDX1	Missense_Mutation	SNP	NULL	p.P765L	ENST00000262384.3	37	c.2294	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.520880	0.96416	.	.	ENSG00000102921	ENST00000262384	T	0.47177	0.85	5.87	5.87	0.94306	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.75539	0.3863	M	0.88105	2.93	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.77928	-0.2404	10	0.56958	D	0.05	-23.6632	20.2181	0.98305	0.0:0.0:1.0:0.0	.	765	O75113	N4BP1_HUMAN	L	765	ENSP00000262384:P765L	ENSP00000262384:P765L	P	-	2	0	N4BP1	47137598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.376000	0.79658	2.785000	0.95823	0.655000	0.94253	CCT	-	NULL		0.423	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	protein_coding	OTTHUMT00000429920.1	G	NM_014664		47137598	-1	no_errors	NM_153029.3	genbank	human	validated	54_36p	missense	SNP	1.000	A
UNC45B	146862	genome.wustl.edu	37	17	33481714	33481714	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	C	C	C	T	C	C	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr17:33481714C>T	ENST00000268876.5	+	6	690	c.593C>T	c.(592-594)gCt>gTt	p.A198V	UNC45B_ENST00000378449.1_Missense_Mutation_p.A198V|UNC45B_ENST00000394570.2_Missense_Mutation_p.A198V|UNC45B_ENST00000591048.1_Missense_Mutation_p.A198V|UNC45B_ENST00000433649.1_Missense_Mutation_p.A198V	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	198					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CTGGTGCTGGCTGCAGTGCGG	0.602																																						dbGAP											0			17											68.0	59.0	62.0					17																	33481714		2203	4300	6503	30505827	SO:0001583	missense	0			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.593C>T	17.37:g.33481714C>T	ENSP00000268876:p.Ala198Val	41	0.00	0		NA	NA	NA	30505827	48	52.83	56	Q495Q8|Q495Q9	Missense_Mutation	SNP	HMMSmart_SM00185,HMMPfam_TPR_1,superfamily_ARM repeat,HMMSmart_SM00028,superfamily_TPR-like	p.A198V	ENST00000268876.5	37	c.593	CCDS11292.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.177209	0.94846	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.53640	0.61;3.39;0.61;0.67	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.052553	0.85682	D	0.000000	T	0.65943	0.2740	M	0.63843	1.955	0.80722	D	1	D;D;P	0.61697	0.97;0.99;0.773	D;P;P	0.63703	0.917;0.864;0.451	T	0.64782	-0.6326	10	0.51188	T	0.08	-9.2174	18.8468	0.92210	0.0:1.0:0.0:0.0	.	198;198;198	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	V	198	ENSP00000378071:A198V;ENSP00000268876:A198V;ENSP00000412840:A198V;ENSP00000367710:A198V	ENSP00000268876:A198V	A	+	2	0	UNC45B	30505827	1.000000	0.71417	0.977000	0.42913	0.981000	0.71138	7.818000	0.86416	2.701000	0.92244	0.462000	0.41574	GCT	-	HMMSmart_SM00185,superfamily_ARM repeat		0.602	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	protein_coding	OTTHUMT00000256458.2	C	NM_173167		30505827	+1	no_errors	NM_173167.1	genbank	human	validated	54_36p	missense	SNP	1.000	T
PKNOX1	5316	genome.wustl.edu	37	21	44448936	44448936	+	Missense_Mutation	SNP	G	G	C			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	G	G	G	C	G	G	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr21:44448936G>C	ENST00000291547.5	+	10	1262	c.1051G>C	c.(1051-1053)Gca>Cca	p.A351P	PKNOX1_ENST00000432907.2_Missense_Mutation_p.A234P|PKNOX1_ENST00000607150.1_3'UTR	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	351					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						TGATTCTATTGCATCAGGAGT	0.532																																						dbGAP											0			21											71.0	79.0	76.0					21																	44448936		2203	4300	6503	43322005	SO:0001583	missense	0				CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.1051G>C	21.37:g.44448936G>C	ENSP00000291547:p.Ala351Pro	26	0.00	0		36	35.71	20	43322005	36	52.00	39	O00528|Q8IWT7	Missense_Mutation	SNP	HMMPfam_Homeobox,HMMSmart_SM00389,superfamily_Homeodomain-like	p.A351P	ENST00000291547.5	37	c.1051	CCDS13692.1	21	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722385	0.89298	.	.	ENSG00000160199	ENST00000291547;ENST00000432907	D;D	0.87650	-2.01;-2.28	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.92414	0.7592	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	0.993;1.0	P;D	0.87578	0.772;0.998	D	0.92880	0.6322	10	0.66056	D	0.02	-23.1939	18.8388	0.92174	0.0:0.0:1.0:0.0	.	351;351	P55347;P55347-2	PKNX1_HUMAN;.	P	351;234	ENSP00000291547:A351P;ENSP00000402243:A234P	ENSP00000291547:A351P	A	+	1	0	PKNOX1	43322005	1.000000	0.71417	0.136000	0.22124	0.055000	0.15305	8.831000	0.92068	2.518000	0.84900	0.655000	0.94253	GCA	-	NULL		0.532	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX1	protein_coding	OTTHUMT00000195520.3	G			43322005	+1	no_errors	NM_004571.3	genbank	human	validated	54_36p	missense	SNP	1.000	C
NPM1	4869	genome.wustl.edu	37	5	170837543	170837544	+	Frame_Shift_Ins	INS	-	-	TCTG	rs17850940		TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	-	-	-	TCTG	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr5:170837543_170837544insTCTG	ENST00000296930.5	+	11	1160_1161	c.859_860insTCTG	c.(859-861)ctcfs	p.-287fs	NPM1_ENST00000517671.1_Frame_Shift_Ins_p.-287fs|NPM1_ENST00000351986.6_Frame_Shift_Ins_p.-258fs	NM_002520.6	NP_002511.1	P06748	NPM_HUMAN	nucleophosmin (nucleolar phosphoprotein B23, numatrin)						cell aging (GO:0007569)|CENP-A containing nucleosome assembly (GO:0034080)|centrosome cycle (GO:0007098)|DNA repair (GO:0006281)|intracellular protein transport (GO:0006886)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of centrosome duplication (GO:0010826)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of translation (GO:0045727)|protein localization (GO:0008104)|protein oligomerization (GO:0051259)|regulation of centriole replication (GO:0046599)|regulation of eIF2 alpha phosphorylation by dsRNA (GO:0060735)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of endoribonuclease activity (GO:0060699)|response to stress (GO:0006950)|ribosome assembly (GO:0042255)|signal transduction (GO:0007165)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle pole centrosome (GO:0031616)	histone binding (GO:0042393)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|unfolded protein binding (GO:0051082)	p.W288fs*12(7)|p.W288fs*>9(5)|p.L287fs*11(2)|p.L287F(1)	NPM1/ALK(632)	central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4261)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	4269	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TATTCAAGATCTCTGGCAGTGG	0.317			"""T, F """	"""ALK, RARA, MLF1"""	"""NHL, APL, AML"""																																	dbGAP		Dom	yes		5	5q35	4869	"""nucleophosmin (nucleolar phosphoprotein B23, numatrin)"""		L	15	Insertion - Frameshift(14)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(15)	5																																								170770149	SO:0001589	frameshift_variant	0			M26697	CCDS4376.1, CCDS4377.1, CCDS43399.1	5q35.1	2014-09-17			ENSG00000181163	ENSG00000181163			7910	protein-coding gene	gene with protein product	"""nucleolar phosphoprotein B23"", ""numatrin"", ""nucleophosmin/nucleoplasmin family, member 1"""	164040				8471164, 8122112	Standard	NM_002520		Approved	B23, NPM	uc003mbi.3	P06748	OTTHUMG00000130465	ENST00000296930.5:c.860_863dupTCTG	5.37:g.170837544_170837547dupTCTG	ENSP00000296930:p.Leu287fs	NA	NA	NA		NA	NA	NA	170770148	NA	NA	NA	A8K3N7|B5BU00|D3DQL6|P08693|Q12826|Q13440|Q13441|Q14115|Q5EU94|Q5EU95|Q5EU96|Q5EU97|Q5EU98|Q5EU99|Q6V962|Q8WTW5|Q96AT6|Q96DC4|Q96EA5|Q9BYG9|Q9UDJ7	Frame_Shift_Ins	INS	HMMPfam_Nucleoplasmin,superfamily_Nucleoplasmin-like core domain	p.W288fs	ENST00000296930.5	37	c.859_860	CCDS4376.1	5																																																																																			-	NULL		0.317	NPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM1	protein_coding	OTTHUMT00000252858.2	-	NM_002520		170770149	+1	no_errors	NM_002520.1	genbank	human	validated	54_36p	frame_shift_ins	INS	1.000:1.000	TCTG
FLT3	2322	genome.wustl.edu	37	13	28608244	28608245	+	In_Frame_Ins	INS	-	-	TCCCATTTGAGATCATAT			TCGA-AB-2877-03A-01W-0732-08	TCGA-AB-2877-11A-01W-0732-08	-	-	-	TCCCATTTGAGATCATAT	-	-	Verified	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq	1		Illumina HiSeq	166d3943-4006-4434-9af3-4ba8e86b6ac6	a109df8d-1667-48a5-a2bc-91d25851124a	g.chr13:28608244_28608245insTCCCATTTGAGATCATAT	ENST00000241453.7	-	14	1892_1893	c.1811_1812insATATGATCTCAAATGGGA	c.(1810-1812)gag>gaATATGATCTCAAATGGGAg	p.604_604E>EYDLKWE	FLT3_ENST00000380982.4_In_Frame_Ins_p.604_604E>EYDLKWE|FLT3_ENST00000537084.1_In_Frame_Ins_p.604_604E>EYDLKWE	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	604					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.W603_E604insDREYEYDLKW(2)|p.E604_F605ins22(1)|p.E604_F605ins14(1)|p.E604_F605ins15(1)|p.E604_F605insREYEYDLKWE(1)|p.E604>DVDFREYEYDLKW(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCTTGGAAACTCCCATTTGAG	0.381			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	7	Insertion - In frame(6)|Complex - insertion inframe(1)	haematopoietic_and_lymphoid_tissue(7)	13																																								27506245	SO:0001652	inframe_insertion	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.1794_1811dupATATGATCTCAAATGGGA	13.37:g.28608244_28608245insTCCCATTTGAGATCATAT	ENSP00000241453:p.TyrAspLeuLysTrpGlu604dup	NA	NA	NA		NA	NA	NA	27506244	NA	NA	NA	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	In_Frame_Ins	INS	HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR,superfamily_Kinase_like,HMMPfam_ig,PatternScan_PROTEIN_KINASE_ATP,superfamily_SSF48726	p.605in_frame_insYDLKWE	ENST00000241453.7	37	c.1812_1811	CCDS31953.1	13																																																																																			-	superfamily_Kinase_like		0.381	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	protein_coding	OTTHUMT00000044319.2	-			27506245	-1	no_errors	NM_004119.2	genbank	human	reviewed	54_36p	in_frame_ins	INS	1.000:1.000	TCCCATTTGAGATCATAT
