#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABLIM2	84448	ucsc.edu;bcgsc.ca	37	4	7968764	7968764	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr4:7968764C>T	ENST00000341937.5	-	20	1853	c.1789G>A	c.(1789-1791)Gcc>Acc	p.A597T	ABLIM2_ENST00000447017.2_Missense_Mutation_p.A631T|ABLIM2_ENST00000361737.5_Missense_Mutation_p.A517T|ABLIM2_ENST00000505872.1_Missense_Mutation_p.A545T|ABLIM2_ENST00000514025.1_Missense_Mutation_p.A332T|ABLIM2_ENST00000545242.1_Missense_Mutation_p.A557T|ABLIM2_ENST00000318888.4_Missense_Mutation_p.A332T|ABLIM2_ENST00000296372.8_Missense_Mutation_p.A559T|ABLIM2_ENST00000407564.3_Missense_Mutation_p.A507T|ABLIM2_ENST00000546334.1_Missense_Mutation_p.A517T|ABLIM2_ENST00000361581.5_Missense_Mutation_p.A558T	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	597	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						TTCCAGAGGGCCAGGCGGTCA	0.577																																					p.A631T		.											.	ABLIM2	47	0			c.G1891A						.						192.0	212.0	206.0					4																	7968764		2126	4271	6397	SO:0001583	missense	84448	exon21			AGAGGGCCAGGCG	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.1789G>A	4.37:g.7968764C>T	ENSP00000342813:p.Ala597Thr	41.0	0.0		30.0	4.0	NM_001130083	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Missense_Mutation	SNP	ENST00000341937.5	37	CCDS47013.1	.	.	.	.	.	.	.	.	.	.	c	23.1	4.379838	0.82682	.	.	ENSG00000163995	ENST00000361737;ENST00000400045;ENST00000296372;ENST00000545242;ENST00000546334;ENST00000318888;ENST00000514025;ENST00000447017;ENST00000341937;ENST00000361581;ENST00000407564;ENST00000505872	T;T;T;T;T;T;T;T;T;T;T	0.51574	1.53;1.77;1.69;1.5;0.7;0.7;1.58;1.69;1.71;1.46;1.45	4.51	4.51	0.55191	Villin headpiece (5);	0.000000	0.85682	D	0.000000	T	0.67951	0.2948	M	0.74881	2.28	0.58432	D	0.999998	D;D;D;D;D;D;D;D	0.89917	0.979;1.0;0.996;0.994;0.998;0.97;0.984;1.0	P;D;D;D;D;D;D;D	0.97110	0.877;0.999;0.987;0.971;0.988;0.917;0.939;1.0	T	0.72590	-0.4247	10	0.66056	D	0.02	.	14.725	0.69339	0.0:1.0:0.0:0.0	.	507;558;517;597;545;332;559;631	Q08E71;Q6H8Q1-2;Q6H8Q1-3;Q6H8Q1;Q19VH0;Q6H8Q1-4;Q6H8Q1-5;E9PF39	.;.;.;ABLM2_HUMAN;.;.;.;.	T	517;630;559;557;517;332;332;631;597;558;507;545	ENSP00000354887:A517T;ENSP00000296372:A559T;ENSP00000441255:A557T;ENSP00000444365:A517T;ENSP00000317020:A332T;ENSP00000423661:A332T;ENSP00000393511:A631T;ENSP00000342813:A597T;ENSP00000355003:A558T;ENSP00000384658:A507T;ENSP00000421283:A545T	ENSP00000296372:A559T	A	-	1	0	ABLIM2	8019664	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.095000	0.50235	2.051000	0.60960	0.457000	0.33378	GCC	.		0.577	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083	
ACSBG1	23205	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	78472115	78472136	+	Splice_Site	DEL	TCAGGTCGCTGGTGGGAGAGGG	TCAGGTCGCTGGTGGGAGAGGG	-	rs199505466|rs144974698	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	TCAGGTCGCTGGTGGGAGAGGG	TCAGGTCGCTGGTGGGAGAGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:78472115_78472136delTCAGGTCGCTGGTGGGAGAGGG	ENST00000258873.4	-	10	1459_1466	c.1254_1261delCCCTCTCCCACCAGCGACCTGA	c.(1252-1263)agccctctccca>agca	p.PLP419fs	ACSBG1_ENST00000541759.1_Splice_Site_p.PLP177fs|ACSBG1_ENST00000560817.1_Splice_Site_p.PLP177fs	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	419					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GTGAAGGGCTTCAGGTCGCTGGTGGGAGAGGGAGAATGGTTC	0.514																																					p.418_421del		.											.	ACSBG1	91	0			c.1254_1261del						.																																			SO:0001630	splice_region_variant	23205	exon10			AGGGCTTCAGGTC	AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1254-1CCCTCTCCCACCAGCGACCTGA>-	15.37:g.78472115_78472136delTCAGGTCGCTGGTGGGAGAGGG		125.0	0.0		162.0	14.0	NM_015162	B2RB61|O75126|Q76N27|Q9HC26	Frame_Shift_Del	DEL	ENST00000258873.4	37	CCDS10298.1																																																																																			.		0.514	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	Frame_Shift_Del
AFF2	2334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	147744245	147744245	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrX:147744245T>A	ENST00000370460.2	+	3	1476	c.997T>A	c.(997-999)Tca>Aca	p.S333T	AFF2_ENST00000370457.5_Missense_Mutation_p.S329T|AFF2_ENST00000342251.3_Missense_Mutation_p.S329T|AFF2_ENST00000370458.1_Missense_Mutation_p.S329T	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	333					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGCAGCCAGTTCAAAGACTAA	0.378																																					p.S333T		.											.	AFF2	135	0			c.T997A						.						44.0	41.0	42.0					X																	147744245		2203	4299	6502	SO:0001583	missense	2334	exon3			GCCAGTTCAAAGA	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.997T>A	X.37:g.147744245T>A	ENSP00000359489:p.Ser333Thr	357.0	1.0		309.0	288.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	T	2.028	-0.423185	0.04734	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.66638	0.03;-0.22;-0.22;1.01	5.92	-2.34	0.06704	.	0.486350	0.21455	N	0.074274	T	0.43545	0.1252	N	0.25890	0.77	0.80722	D	1	B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001;0.001	B;B;B;B;B;B	0.12156	0.003;0.003;0.003;0.003;0.004;0.007	T	0.08106	-1.0738	10	0.16896	T	0.51	.	7.0505	0.25071	0.4558:0.0:0.2588:0.2855	.	333;329;329;329;333;329	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	T	333;329;329;329	ENSP00000359489:S333T;ENSP00000359486:S329T;ENSP00000345459:S329T;ENSP00000359487:S329T	ENSP00000345459:S329T	S	+	1	0	AFF2	147551937	0.994000	0.37717	0.990000	0.47175	0.995000	0.86356	0.113000	0.15499	-0.385000	0.07833	0.486000	0.48141	TCA	.		0.378	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
APBA2	321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	29346830	29346830	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:29346830C>T	ENST00000558402.1	+	5	1342	c.743C>T	c.(742-744)gCc>gTc	p.A248V	APBA2_ENST00000561069.1_Missense_Mutation_p.A248V|APBA2_ENST00000558259.1_Missense_Mutation_p.A248V|APBA2_ENST00000411764.1_Missense_Mutation_p.A248V|APBA2_ENST00000558330.1_Missense_Mutation_p.A248V			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	248	STXBP1-binding.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.A248D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GCCAGTGAGGCCAGCCCCGAG	0.652																																					p.A248V		.											.	APBA2	90	1	Substitution - Missense(1)	lung(1)	c.C743T						.						50.0	43.0	45.0					15																	29346830		2203	4300	6503	SO:0001583	missense	321	exon3			GTGAGGCCAGCCC	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.743C>T	15.37:g.29346830C>T	ENSP00000453293:p.Ala248Val	126.0	0.0		134.0	60.0	NM_005503	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	37	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.455267	0.43634	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.46451	0.87	4.96	3.93	0.45458	.	0.364621	0.28135	N	0.016475	T	0.32675	0.0837	L	0.51422	1.61	0.28731	N	0.902478	B;B;B	0.29481	0.245;0.129;0.062	B;B;B	0.30646	0.118;0.058;0.058	T	0.12243	-1.0555	10	0.23891	T	0.37	.	6.6082	0.22737	0.0:0.7989:0.0:0.2011	.	248;248;248	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	V	248	ENSP00000409312:A248V	ENSP00000219865:A248V	A	+	2	0	APBA2	27134122	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.864000	0.48404	2.280000	0.76307	0.650000	0.86243	GCC	.		0.652	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
ATP13A1	57130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19756558	19756558	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:19756558C>T	ENST00000357324.6	-	25	3428	c.3402G>A	c.(3400-3402)ctG>ctA	p.L1134L	GMIP_ENST00000445806.2_5'Flank|ATP13A1_ENST00000291503.5_Silent_p.L1016L|GMIP_ENST00000587238.1_5'Flank|GMIP_ENST00000203556.4_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1134						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GACTCCACACCAGGGGCTTGT	0.627																																					p.L1134L	Esophageal Squamous(142;920 1789 9047 14684 24777)	.											.	ATP13A1	138	0			c.G3402A						.						29.0	32.0	31.0					19																	19756558		2203	4297	6500	SO:0001819	synonymous_variant	57130	exon25			CCACACCAGGGGC	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3402G>A	19.37:g.19756558C>T		81.0	0.0		85.0	53.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Silent	SNP	ENST00000357324.6	37	CCDS32970.2																																																																																			.		0.627	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
ATP13A1	57130	ucsc.edu;bcgsc.ca	37	19	19763412	19763412	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:19763412A>G	ENST00000357324.6	-	16	2244	c.2218T>C	c.(2218-2220)Tcc>Ccc	p.S740P	ATP13A1_ENST00000291503.5_Missense_Mutation_p.S622P|ATP13A1_ENST00000496082.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	740						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ACCCGGTGGGACGCATTCTGG	0.607																																					p.S740P	Esophageal Squamous(142;920 1789 9047 14684 24777)	.											.	ATP13A1	138	0			c.T2218C						.						66.0	50.0	55.0					19																	19763412		2201	4300	6501	SO:0001583	missense	57130	exon16			GGTGGGACGCATT	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2218T>C	19.37:g.19763412A>G	ENSP00000349877:p.Ser740Pro	66.0	1.0		39.0	5.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	37	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361225	0.82353	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.68331	-0.32;-0.32	4.29	4.29	0.51040	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	0.999;1.0	D;P	0.83275	0.996;0.899	D	0.89201	0.3557	10	0.66056	D	0.02	-44.3921	11.4291	0.50029	1.0:0.0:0.0:0.0	.	740;622	Q9HD20;Q9HD20-2	AT131_HUMAN;.	P	622;740	ENSP00000291503:S622P;ENSP00000349877:S740P	ENSP00000291503:S622P	S	-	1	0	ATP13A1	19624412	1.000000	0.71417	0.934000	0.37439	0.948000	0.59901	8.569000	0.90744	1.818000	0.53035	0.533000	0.62120	TCC	.		0.607	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
ATP2C2	9914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	84486812	84486812	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:84486812A>T	ENST00000262429.4	+	19	1989	c.1900A>T	c.(1900-1902)Aag>Tag	p.K634*	ATP2C2_ENST00000416219.2_Nonsense_Mutation_p.K634*|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	634					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CAGCGTGGAGAAGGGCGAGCT	0.617																																					p.K634X		.											.	ATP2C2	91	0			c.A1900T						.						60.0	68.0	66.0					16																	84486812		2061	4190	6251	SO:0001587	stop_gained	9914	exon19			GTGGAGAAGGGCG	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1900A>T	16.37:g.84486812A>T	ENSP00000262429:p.Lys634*	111.0	0.0		115.0	49.0	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Nonsense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	A	39	7.849860	0.98525	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	.	.	.	5.22	3.07	0.35406	.	0.586522	0.17025	N	0.189949	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	6.5657	0.22511	0.2928:0.5234:0.1837:0.0	.	.	.	.	X	634;634;483	.	ENSP00000262429:K634X	K	+	1	0	ATP2C2	83044313	0.991000	0.36638	0.393000	0.26258	0.035000	0.12851	0.592000	0.23984	0.452000	0.26830	0.459000	0.35465	AAG	.		0.617	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
ATP5B	506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57032145	57032145	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr12:57032145C>T	ENST00000262030.3	-	10	1602	c.1552G>A	c.(1552-1554)Gca>Aca	p.A518T	BAZ2A_ENST00000379441.3_5'Flank|ATP5B_ENST00000550162.1_5'Flank|BAZ2A_ENST00000551812.1_5'Flank|BAZ2A_ENST00000179765.5_5'Flank|ATP5B_ENST00000552919.1_Missense_Mutation_p.A507T	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	518					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCAGCTTTTGCCACAGCTTCT	0.453																																					p.A518T		.											.	ATP5B	91	0			c.G1552A						.						180.0	170.0	174.0					12																	57032145		2203	4300	6503	SO:0001583	missense	506	exon10			CTTTTGCCACAGC	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.1552G>A	12.37:g.57032145C>T	ENSP00000262030:p.Ala518Thr	147.0	0.0		146.0	55.0	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	CCDS8924.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943984	0.53079	.	.	ENSG00000110955	ENST00000262030;ENST00000552919	T;T	0.77877	-1.13;-1.13	5.37	3.19	0.36642	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.306615	0.35739	N	0.003014	T	0.70176	0.3194	L	0.54323	1.7	0.28680	N	0.905134	B	0.02656	0.0	B	0.04013	0.001	T	0.63892	-0.6534	10	0.42905	T	0.14	-4.2747	9.6137	0.39679	0.0:0.7446:0.0:0.2554	.	518	P06576	ATPB_HUMAN	T	518;507	ENSP00000262030:A518T;ENSP00000450297:A507T	ENSP00000262030:A518T	A	-	1	0	ATP5B	55318412	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.730000	0.47335	1.261000	0.44149	0.561000	0.74099	GCA	.		0.453	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
ATP8A2	51761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26153014	26153014	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:26153014A>G	ENST00000381655.2	+	21	1986	c.1844A>G	c.(1843-1845)cAt>cGt	p.H615R	ATP8A2_ENST00000255283.8_Missense_Mutation_p.H575R|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	575					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ACATTATGCCATCTGGAATAC	0.388																																					p.H615R		.											.	ATP8A2	138	0			c.A1844G						.						136.0	130.0	132.0					13																	26153014		1883	4114	5997	SO:0001583	missense	51761	exon21			TATGCCATCTGGA	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1844A>G	13.37:g.26153014A>G	ENSP00000371070:p.His615Arg	111.0	0.0		89.0	38.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.336979	0.81801	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.67865	-0.29;-0.29	5.61	5.61	0.85477	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.048152	0.85682	D	0.000000	D	0.84174	0.5414	M	0.88241	2.94	0.80722	D	1	D;D;D	0.58620	0.983;0.979;0.983	D;D;D	0.68483	0.958;0.947;0.958	D	0.87335	0.2327	10	0.87932	D	0	.	16.1054	0.81216	1.0:0.0:0.0:0.0	.	575;395;575	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	R	615;575;395	ENSP00000371070:H615R;ENSP00000255283:H575R	ENSP00000255283:H575R	H	+	2	0	ATP8A2	25051014	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.847000	0.92166	2.266000	0.75297	0.533000	0.62120	CAT	.		0.388	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
BAI2	576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32196897	32196897	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:32196897A>T	ENST00000373658.3	-	29	4225	c.3884T>A	c.(3883-3885)tTc>tAc	p.F1295Y	BAI2_ENST00000398547.1_Missense_Mutation_p.F1228Y|BAI2_ENST00000527361.1_Missense_Mutation_p.F1262Y|BAI2_ENST00000398538.1_Missense_Mutation_p.F1283Y|BAI2_ENST00000398556.3_Missense_Mutation_p.F1210Y|BAI2_ENST00000440175.2_Missense_Mutation_p.F904Y|BAI2_ENST00000373655.2_Missense_Mutation_p.F1295Y|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000257070.4_Missense_Mutation_p.F1262Y|BAI2_ENST00000398542.1_Missense_Mutation_p.F1195Y	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1295					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CAGTGGTGAGAAGCTGAGGCT	0.647																																					p.F1295Y		.											.	BAI2	526	0			c.T3884A						.						31.0	26.0	28.0					1																	32196897		2203	4300	6503	SO:0001583	missense	576	exon29			GGTGAGAAGCTGA	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3884T>A	1.37:g.32196897A>T	ENSP00000362762:p.Phe1295Tyr	163.0	0.0		175.0	85.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	A	16.50	3.141251	0.57044	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.57107	1.13;1.3;0.42;0.42;1.56;0.46;0.46;1.2;0.49	5.16	5.16	0.70880	.	0.000000	0.45126	D	0.000394	T	0.53158	0.1779	L	0.40543	1.245	0.43152	D	0.994923	B;P;P;P;B;P;P	0.49447	0.082;0.924;0.709;0.876;0.161;0.876;0.468	B;P;B;P;B;P;B	0.51266	0.219;0.664;0.217;0.463;0.279;0.463;0.348	T	0.47736	-0.9094	10	0.21540	T	0.41	.	14.9679	0.71208	1.0:0.0:0.0:0.0	.	1262;1283;904;1210;1295;1295;1283	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	Y	1210;1228;1295;1295;1195;1262;1262;904;1283	ENSP00000381564:F1210Y;ENSP00000381555:F1228Y;ENSP00000362762:F1295Y;ENSP00000362759:F1295Y;ENSP00000381550:F1195Y;ENSP00000257070:F1262Y;ENSP00000435397:F1262Y;ENSP00000391071:F904Y;ENSP00000381548:F1283Y	ENSP00000257070:F1262Y	F	-	2	0	BAI2	31969484	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.306000	0.59117	2.074000	0.62210	0.459000	0.35465	TTC	.		0.647	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	32914712	32914712	+	Missense_Mutation	SNP	C	C	G	rs34309943|rs276174867	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:32914712C>G	ENST00000380152.3	+	11	6453	c.6220C>G	c.(6220-6222)Cac>Gac	p.H2074D	BRCA2_ENST00000544455.1_Missense_Mutation_p.H2074D			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2074			H -> N (in dbSNP:rs34309943).		brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAGTTCCTTACACAAAGTTAA	0.343			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.H2074D	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	3153	0			c.C6220G	GRCh37	CM012589	BRCA2	M	rs34309943	.						62.0	64.0	64.0					13																	32914712		2203	4297	6500	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	TCCTTACACAAAG	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.6220C>G	13.37:g.32914712C>G	ENSP00000369497:p.His2074Asp	127.0	0.0		94.0	38.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	9.633	1.136989	0.21123	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.73897	-0.79;-0.79	5.77	-4.11	0.03928	.	0.987072	0.08269	N	0.971792	T	0.51058	0.1652	N	0.19112	0.55	0.09310	N	1	B	0.27416	0.178	B	0.28385	0.089	T	0.37314	-0.9711	10	0.21540	T	0.41	.	3.5294	0.07771	0.5141:0.2527:0.1001:0.1331	.	2074	P51587	BRCA2_HUMAN	D	2074	ENSP00000369497:H2074D;ENSP00000439902:H2074D	ENSP00000369497:H2074D	H	+	1	0	BRCA2	31812712	0.833000	0.29383	0.091000	0.20842	0.550000	0.35303	0.382000	0.20635	-0.334000	0.08463	0.591000	0.81541	CAC	C|0.998;A|0.002		0.343	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
BRSK1	84446	ucsc.edu;bcgsc.ca	37	19	55805701	55805701	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:55805701A>G	ENST00000309383.1	+	7	891	c.614A>G	c.(613-615)gAa>gGa	p.E205G	BRSK1_ENST00000590333.1_Missense_Mutation_p.E221G|BRSK1_ENST00000585418.1_Missense_Mutation_p.E205G	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	205	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TTCCAGGGGGAAAAATATGAT	0.582																																					p.E205G		.											.	BRSK1	759	0			c.A614G						.						81.0	83.0	82.0					19																	55805701		2203	4300	6503	SO:0001583	missense	84446	exon7			AGGGGGAAAAATA	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.614A>G	19.37:g.55805701A>G	ENSP00000310649:p.Glu205Gly	77.0	0.0		39.0	4.0	NM_032430	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	ENST00000309383.1	37	CCDS12921.1	.	.	.	.	.	.	.	.	.	.	.	16.48	3.133972	0.56828	.	.	ENSG00000160469	ENST00000309383	T	0.64803	-0.12	4.55	4.55	0.56014	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65760	0.2722	N	0.20401	0.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.986	T	0.71002	-0.4718	10	0.87932	D	0	.	13.1709	0.59597	1.0:0.0:0.0:0.0	.	205;221	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	G	205	ENSP00000310649:E205G	ENSP00000310649:E205G	E	+	2	0	BRSK1	60497513	1.000000	0.71417	0.884000	0.34674	0.167000	0.22549	8.588000	0.90813	1.827000	0.53221	0.459000	0.35465	GAA	.		0.582	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
CACNA1H	8912	ucsc.edu;bcgsc.ca	37	16	1270989	1270989	+	Missense_Mutation	SNP	G	G	A	rs150601404	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:1270989G>A	ENST00000348261.5	+	35	7305	c.7057G>A	c.(7057-7059)Gtg>Atg	p.V2353M	CACNA1H_ENST00000358590.4_Missense_Mutation_p.V2347M|CACNA1H_ENST00000565831.1_Missense_Mutation_p.V2347M	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	2353					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	AGATGACCCCGTGTAGCTCGG	0.697													g|||	5	0.000998403	0.0038	0.0	5008	,	,		14513	0.0		0.0	False		,,,				2504	0.0				p.V2353M		.											.	CACNA1H	67	0			c.G7057A						.		MET/VAL,MET/VAL	4,3638		0,4,1817	9.0	10.0	9.0		7057,7039	1.9	0.2	16	dbSNP_134	9	0,8062		0,0,4031	no	missense,missense	CACNA1H	NM_021098.2,NM_001005407.1	21,21	0,4,5848	AA,AG,GG		0.0,0.1098,0.0342	benign,benign	2353/2354,2347/2348	1270989	4,11700	1821	4031	5852	SO:0001583	missense	8912	exon35			GACCCCGTGTAGC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.7057G>A	16.37:g.1270989G>A	ENSP00000334198:p.Val2353Met	53.0	0.0		46.0	4.0	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	5	0.0022893772893772895	5	0.01016260162601626	0	0.0	0	0.0	0	0.0	g	12.05	1.820979	0.32237	0.001098	0.0	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97114	-4.25;-4.2	3.85	1.86	0.25419	.	.	.	.	.	D	0.89649	0.6776	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.27013	0.166;0.064;0.064;0.062;0.037	B;B;B;B;B	0.16722	0.007;0.007;0.007;0.016;0.007	D	0.84442	0.0583	9	0.87932	D	0	.	7.0024	0.24817	0.2085:0.0:0.7915:0.0	.	1099;1077;1083;2347;2353	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	M	2353;2347	ENSP00000334198:V2353M;ENSP00000351401:V2347M	ENSP00000334198:V2353M	V	+	1	0	CACNA1H	1210990	0.991000	0.36638	0.226000	0.23910	0.064000	0.16182	3.368000	0.52357	0.309000	0.22966	0.580000	0.79431	GTG	G|0.998;A|0.002		0.697	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CCDC88C	440193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91770248	91770248	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:91770248C>T	ENST00000389857.6	-	20	3518	c.3432G>A	c.(3430-3432)acG>acA	p.T1144T		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1144					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				TCTCCTTGGCCGTGTGGTGGT	0.657																																					p.T1144T		.											.	CCDC88C	25	0			c.G3432A						.						75.0	82.0	80.0					14																	91770248		2150	4255	6405	SO:0001819	synonymous_variant	440193	exon20			CTTGGCCGTGTGG		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3432G>A	14.37:g.91770248C>T		100.0	0.0		130.0	51.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																			.		0.657	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
COL16A1	1307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32162651	32162651	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:32162651C>G	ENST00000373672.3	-	8	1293	c.777G>C	c.(775-777)caG>caC	p.Q259H	COL16A1_ENST00000271069.6_Missense_Mutation_p.Q259H|COL16A1_ENST00000373668.3_Missense_Mutation_p.Q259H	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	259	Nonhelical region 10 (NC10).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GCTCATTGCTCTGGGTGTCCC	0.602																																					p.Q259H	Colon(143;498 1786 21362 25193 36625)	.											.	COL16A1	98	0			c.G777C						.						113.0	125.0	121.0					1																	32162651		1986	4145	6131	SO:0001583	missense	1307	exon8			ATTGCTCTGGGTG	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.777G>C	1.37:g.32162651C>G	ENSP00000362776:p.Gln259His	273.0	0.0		305.0	136.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.569750	0.45798	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	T;T;T	0.71934	-0.61;-0.61;-0.61	4.87	2.97	0.34412	.	0.195831	0.35495	N	0.003162	T	0.74230	0.3689	L	0.40543	1.245	0.33708	D	0.615411	D;D;D	0.69078	0.993;0.995;0.997	P;P;D	0.67548	0.903;0.897;0.952	T	0.80663	-0.1282	10	0.87932	D	0	.	9.755	0.40498	0.0:0.8279:0.0:0.1721	.	259;259;259	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	H	259	ENSP00000362776:Q259H;ENSP00000271069:Q259H;ENSP00000362772:Q259H	ENSP00000271069:Q259H	Q	-	3	2	COL16A1	31935238	0.986000	0.35501	1.000000	0.80357	0.884000	0.51177	0.422000	0.21296	1.182000	0.42928	0.655000	0.94253	CAG	.		0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
COTL1	23406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84623756	84623756	+	Silent	SNP	G	G	A	rs376530038		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:84623756G>A	ENST00000262428.4	-	3	435	c.273C>T	c.(271-273)cgC>cgT	p.R91R	COTL1_ENST00000564057.1_Silent_p.R22R	NM_021149.2	NP_066972.1	Q14019	COTL1_HUMAN	coactosin-like F-actin binding protein 1	91	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				defense response to fungus (GO:0050832)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	6						CGGTTTTGGCGCGCTGCAGCC	0.592																																					p.R91R		.											.	COTL1	226	0			c.C273T						.						101.0	76.0	85.0					16																	84623756		2199	4300	6499	SO:0001819	synonymous_variant	23406	exon3			TTTGGCGCGCTGC	L54057	CCDS10947.1	16q24.1	2014-03-05	2014-03-05	2002-08-01	ENSG00000103187	ENSG00000103187			18304	protein-coding gene	gene with protein product		606748	"""coactosin-like 1 (Dictyostelium)"""			10051563, 9326934, 16924104	Standard	NM_021149		Approved	CLP	uc002fid.3	Q14019	OTTHUMG00000137634	ENST00000262428.4:c.273C>T	16.37:g.84623756G>A		120.0	0.0		139.0	67.0	NM_021149	B2RDU3|D3DUL9|Q86XM5	Silent	SNP	ENST00000262428.4	37	CCDS10947.1																																																																																			.		0.592	COTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269075.1	NM_021149	
CTNNA2	1496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	80085161	80085161	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:80085161C>T	ENST00000402739.4	+	3	326	c.321C>T	c.(319-321)tcC>tcT	p.S107S	CTNNA2_ENST00000541047.1_Silent_p.S107S|CTNNA2_ENST00000540488.1_Silent_p.S107S|CTNNA2_ENST00000496558.1_Silent_p.S107S|CTNNA2_ENST00000361291.4_Silent_p.S141S|CTNNA2_ENST00000466387.1_Silent_p.S107S	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	107					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GGATCGCCTCCTCCGAGTTTG	0.582																																					p.S107S		.											.	CTNNA2	368	0			c.C321T						.						97.0	94.0	95.0					2																	80085161		2054	4194	6248	SO:0001819	synonymous_variant	1496	exon4			CGCCTCCTCCGAG		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.321C>T	2.37:g.80085161C>T		136.0	0.0		128.0	52.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	ENST00000402739.4	37																																																																																				.		0.582	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
CXCR6	10663	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45988614	45988614	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:45988614T>C	ENST00000458629.1	+	1	2104	c.641T>C	c.(640-642)aTa>aCa	p.I214T	CXCR6_ENST00000438735.1_Missense_Mutation_p.I214T|FYCO1_ENST00000296137.2_Intron|CXCR6_ENST00000304552.4_Missense_Mutation_p.I214T|FYCO1_ENST00000438446.1_Intron|FYCO1_ENST00000535325.1_Intron|CXCR6_ENST00000457814.1_Missense_Mutation_p.I214T			O00574	CXCR6_HUMAN	chemokine (C-X-C motif) receptor 6	214					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|viral genome replication (GO:0019079)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(3)|lung(1)|prostate(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		TATTCAGTCATAATCAAAACA	0.493																																					p.I214T	Esophageal Squamous(63;1005 1117 15521 45762 47089)	.											.	CXCR6	658	0			c.T641C						.						134.0	131.0	132.0					3																	45988614		2203	4300	6503	SO:0001583	missense	10663	exon2			CAGTCATAATCAA	AF007545	CCDS2735.1	3p21	2012-08-08			ENSG00000172215	ENSG00000172215		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	16647	protein-coding gene	gene with protein product		605163				9166430, 9230441	Standard	XM_005264809		Approved	TYMSTR, STRL33, BONZO, CD186	uc003cpc.1	O00574	OTTHUMG00000133448	ENST00000458629.1:c.641T>C	3.37:g.45988614T>C	ENSP00000395704:p.Ile214Thr	219.0	1.0		216.0	88.0	NM_006564	O00575|Q9HCA5	Missense_Mutation	SNP	ENST00000458629.1	37	CCDS2735.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106888	0.77096	.	.	ENSG00000172215	ENST00000438735;ENST00000304552;ENST00000458629;ENST00000457814	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.045291	0.85682	D	0.000000	T	0.70211	0.3198	M	0.67517	2.055	0.58432	D	0.99999	D	0.89917	1.0	D	0.80764	0.994	T	0.71823	-0.4476	10	0.52906	T	0.07	.	15.0051	0.71504	0.0:0.0:0.0:1.0	.	214	O00574	CXCR6_HUMAN	T	214	ENSP00000396218:I214T;ENSP00000304414:I214T;ENSP00000395704:I214T;ENSP00000396886:I214T	ENSP00000304414:I214T	I	+	2	0	CXCR6	45963618	1.000000	0.71417	0.831000	0.32960	0.830000	0.47004	5.102000	0.64572	2.248000	0.74166	0.533000	0.62120	ATA	.		0.493	CXCR6-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344395.1		
DCLK1	9201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	36385025	36385025	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:36385025G>T	ENST00000360631.3	-	12	1846	c.1635C>A	c.(1633-1635)taC>taA	p.Y545*	DCLK1_ENST00000379893.1_Nonsense_Mutation_p.Y238*|DCLK1_ENST00000255448.4_Nonsense_Mutation_p.Y545*			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	545	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CACAGACTGTGTACAGGGGGC	0.463																																					p.Y545X		.											.	DCLK1	826	0			c.C1635A						.						171.0	165.0	167.0					13																	36385025		2203	4300	6503	SO:0001587	stop_gained	9201	exon12			GACTGTGTACAGG	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1635C>A	13.37:g.36385025G>T	ENSP00000353846:p.Tyr545*	202.0	0.0		252.0	110.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Nonsense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	G	39	7.667052	0.98422	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	.	.	.	5.18	1.52	0.23074	.	0.059652	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1631	0.42864	0.3398:0.0:0.6602:0.0	.	.	.	.	X	237;545;545;238;527	.	ENSP00000255448:Y545X	Y	-	3	2	DCLK1	35283025	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.537000	0.36083	0.036000	0.15547	-0.136000	0.14681	TAC	.		0.463	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	116510776	116510776	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:116510776G>T	ENST00000410059.1	+	11	1457	c.977G>T	c.(976-978)tGg>tTg	p.W326L	DPP10_ENST00000393147.2_Missense_Mutation_p.W330L|DPP10_ENST00000310323.8_Missense_Mutation_p.W319L|DPP10_ENST00000409163.1_Missense_Mutation_p.W276L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	326						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATGGTTAAATGGGTAAGCAAT	0.378																																					p.W330L		.											.	DPP10	142	0			c.G989T						.						104.0	92.0	96.0					2																	116510776		2203	4300	6503	SO:0001583	missense	57628	exon11			TTAAATGGGTAAG	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.977G>T	2.37:g.116510776G>T	ENSP00000386565:p.Trp326Leu	299.0	0.0		196.0	73.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730807	0.89390	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.1	5.1	0.69264	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81763	0.4891	H	0.96142	3.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.87568	0.2476	10	0.87932	D	0	-28.5782	17.6852	0.88255	0.0:0.0:1.0:0.0	.	319;330;322;326	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	326;276;330;319;276	ENSP00000386565:W326L;ENSP00000387038:W276L;ENSP00000376855:W330L;ENSP00000309066:W319L	ENSP00000309066:W319L	W	+	2	0	DPP10	116227246	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.236000	0.95360	2.660000	0.90430	0.650000	0.86243	TGG	.		0.378	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
ECH1	1891	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39322054	39322054	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:39322054T>C	ENST00000221418.4	-	2	387	c.155A>G	c.(154-156)gAc>gGc	p.D52G	ECH1_ENST00000597805.1_Intron|AC104534.3_ENST00000594769.1_Missense_Mutation_p.T222A	NM_001398.2	NP_001389.2	Q13011	ECH1_HUMAN	enoyl CoA hydratase 1, peroxisomal	52					fatty acid beta-oxidation (GO:0006635)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	isomerase activity (GO:0016853)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			ATAGCTGTGGTCTGGGGCTTC	0.567																																					p.D52G		.											.	ECH1	91	0			c.A155G						.						86.0	84.0	85.0					19																	39322054		2203	4300	6503	SO:0001583	missense	1891	exon2			CTGTGGTCTGGGG	U16660	CCDS33014.1	19q13.1	2010-04-30	2010-04-30			ENSG00000104823			3149	protein-coding gene	gene with protein product		600696	"""enoyl Coenzyme A hydratase 1, peroxisomal"""			7558027	Standard	XM_005258610		Approved	HPXEL		Q13011		ENST00000221418.4:c.155A>G	19.37:g.39322054T>C	ENSP00000221418:p.Asp52Gly	62.0	1.0		60.0	27.0	NM_001398	A8K745|Q8WVX0|Q96EZ9	Missense_Mutation	SNP	ENST00000221418.4	37	CCDS33014.1	.	.	.	.	.	.	.	.	.	.	T	2.883	-0.231336	0.05983	.	.	ENSG00000104823	ENST00000221418	T	0.64438	-0.1	5.73	-3.17	0.05202	.	1.768000	0.02315	N	0.072501	T	0.42337	0.1198	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.32771	-0.9894	10	0.17832	T	0.49	.	13.0985	0.59206	0.0:0.5373:0.0:0.4627	.	52;52	B4DVS4;Q13011	.;ECH1_HUMAN	G	52	ENSP00000221418:D52G	ENSP00000221418:D52G	D	-	2	0	ECH1	44013894	0.000000	0.05858	0.286000	0.24833	0.530000	0.34684	-1.691000	0.01920	-1.135000	0.02895	0.533000	0.62120	GAC	.		0.567	ECH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462650.1		
EIF2S3	1968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24084190	24084190	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrX:24084190T>C	ENST00000253039.4	+	8	1101	c.848T>C	c.(847-849)aTc>aCc	p.I283T		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	283					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						GGTGGTAGTATCCTAAAAGGA	0.323																																					p.I283T		.											.	EIF2S3	130	0			c.T848C						.						166.0	153.0	158.0					X																	24084190		2203	4299	6502	SO:0001583	missense	1968	exon8			GTAGTATCCTAAA	L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.848T>C	X.37:g.24084190T>C	ENSP00000253039:p.Ile283Thr	480.0	0.0		387.0	346.0	NM_001415	B5BTZ4	Missense_Mutation	SNP	ENST00000253039.4	37	CCDS14210.1	.	.	.	.	.	.	.	.	.	.	t	20.9	4.073711	0.76415	.	.	ENSG00000130741	ENST00000253039	T	0.71817	-0.6	5.49	5.49	0.81192	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.89770	0.6811	H	0.98089	4.145	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.93420	0.6776	10	0.87932	D	0	.	14.804	0.69938	0.0:0.0:0.0:1.0	.	283	P41091	IF2G_HUMAN	T	283	ENSP00000253039:I283T	ENSP00000253039:I283T	I	+	2	0	EIF2S3	23994111	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.553000	0.82203	1.946000	0.56461	0.438000	0.28831	ATC	.		0.323	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056079.1	NM_001415	
EVPL	2125	broad.mit.edu;bcgsc.ca	37	17	74003349	74003349	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:74003349C>T	ENST00000301607.3	-	22	6190	c.5937G>A	c.(5935-5937)gaG>gaA	p.E1979E	EVPL_ENST00000586740.1_Silent_p.E2001E|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1979	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TCAAATCCTTCTCGTAGCTGG	0.637																																					p.E1979E		.											.	EVPL	93	0			c.G5937A						.						92.0	92.0	92.0					17																	74003349		2203	4300	6503	SO:0001819	synonymous_variant	2125	exon22			ATCCTTCTCGTAG	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5937G>A	17.37:g.74003349C>T		142.0	0.0		210.0	11.0	NM_001988	A0AUV5	Silent	SNP	ENST00000301607.3	37	CCDS11737.1																																																																																			.		0.637	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
EXOSC10	5394	ucsc.edu;bcgsc.ca	37	1	11158092	11158092	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:11158092T>C	ENST00000376936.4	-	2	282	c.233A>G	c.(232-234)gAc>gGc	p.D78G	EXOSC10_ENST00000304457.7_Missense_Mutation_p.D78G|RP4-635E18.6_ENST00000435388.1_RNA|EXOSC10_ENST00000544779.1_Missense_Mutation_p.D78G|RP4-635E18.6_ENST00000447600.1_RNA	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	78					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		AAGCAACCTGTCTCCCTGTGT	0.393																																					p.D78G	Colon(179;105 1987 14326 27364 29542)	.											.	EXOSC10	116	0			c.A233G						.						77.0	72.0	73.0					1																	11158092		2203	4300	6503	SO:0001583	missense	5394	exon2			AACCTGTCTCCCT	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.233A>G	1.37:g.11158092T>C	ENSP00000366135:p.Asp78Gly	49.0	0.0		48.0	4.0	NM_002685	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	ENST00000376936.4	37	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.139699	0.56936	.	.	ENSG00000171824	ENST00000376936;ENST00000304457;ENST00000544779	.	.	.	5.73	5.73	0.89815	Exosome-associated factor Rrp6, N-terminal (1);	0.129187	0.64402	D	0.000001	T	0.58595	0.2133	L	0.46157	1.445	0.58432	D	0.999997	B;B	0.19583	0.03;0.037	B;B	0.28305	0.02;0.088	T	0.54302	-0.8314	9	0.33141	T	0.24	-22.4711	15.2021	0.73147	0.0:0.0:0.0:1.0	.	78;78	Q01780-2;Q01780	.;EXOSX_HUMAN	G	78	.	ENSP00000307307:D78G	D	-	2	0	EXOSC10	11080679	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.507000	0.81676	2.186000	0.69663	0.459000	0.35465	GAC	.		0.393	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
G6PC	2538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41063222	41063222	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:41063222A>G	ENST00000253801.2	+	5	932	c.853A>G	c.(853-855)Aag>Gag	p.K285E	G6PC_ENST00000585489.1_3'UTR|G6PC_ENST00000592383.1_3'UTR	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	285					carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGAGAGCTGCAAGGGGAAACT	0.577																																					p.K285E		.											.	G6PC	292	0			c.A853G						.						94.0	88.0	90.0					17																	41063222		2203	4300	6503	SO:0001583	missense	2538	exon5			AGCTGCAAGGGGA	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.853A>G	17.37:g.41063222A>G	ENSP00000253801:p.Lys285Glu	155.0	0.0		177.0	74.0	NM_000151	A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	ENST00000253801.2	37	CCDS11446.1	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735432	0.30774	.	.	ENSG00000131482	ENST00000253801	T	0.76968	-1.06	4.94	2.7	0.31948	.	0.500148	0.21229	N	0.078016	T	0.64940	0.2644	L	0.40543	1.245	0.80722	D	1	B	0.28713	0.22	B	0.22386	0.039	T	0.57171	-0.7857	10	0.42905	T	0.14	.	7.4228	0.27081	0.6356:0.2889:0.0755:0.0	.	285	P35575	G6PC_HUMAN	E	285	ENSP00000253801:K285E	ENSP00000253801:K285E	K	+	1	0	G6PC	38316748	0.978000	0.34361	0.669000	0.29828	0.561000	0.35649	1.281000	0.33214	0.364000	0.24374	0.445000	0.29226	AAG	.		0.577	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151	
GDF5	8200	broad.mit.edu;mdanderson.org	37	20	34022500	34022500	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr20:34022500T>A	ENST00000374372.1	-	4	1216	c.713A>T	c.(712-714)gAg>gTg	p.E238V	GDF5_ENST00000374369.3_Missense_Mutation_p.E238V|GDF5OS_ENST00000374375.1_Missense_Mutation_p.S182T			P43026	GDF5_HUMAN	growth differentiation factor 5	238					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			GATCCGCAGCTCGGCCCCCAG	0.657																																					p.E238V		.											.	GDF5	226	0			c.A713T						.						71.0	77.0	75.0					20																	34022500		2203	4300	6503	SO:0001583	missense	8200	exon2			CGCAGCTCGGCCC	X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.713A>T	20.37:g.34022500T>A	ENSP00000363492:p.Glu238Val	9.0	0.0		19.0	7.0	NM_000557	E1P5Q2|Q96SB1	Missense_Mutation	SNP	ENST00000374372.1	37	CCDS13254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.2|22.2	4.263761|4.263761	0.80358|0.80358	.|.	.|.	ENSG00000125965|ENSG00000204183	ENST00000374369;ENST00000374372|ENST00000374375	T;T|.	0.73469|.	-0.75;-0.75|.	4.66|4.66	4.66|4.66	0.58398|0.58398	Transforming growth factor-beta, N-terminal (1);|.	0.069946|.	0.56097|.	D|.	0.000039|.	T|T	0.77631|0.77631	0.4159|0.4159	M|M	0.83384|0.83384	2.64|2.64	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	T|T	0.81970|0.81970	-0.0689|-0.0689	10|6	0.87932|0.87932	D|D	0|0	.|.	14.2441|14.2441	0.65975|0.65975	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	238;238|.	F1T0J1;P43026|.	.;GDF5_HUMAN|.	V|T	238|182	ENSP00000363489:E238V;ENSP00000363492:E238V|.	ENSP00000363489:E238V|ENSP00000363495:S182T	E|S	-|+	2|1	0|0	GDF5|GDF5OS	33485914|33485914	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.868000|7.868000	0.87116|0.87116	1.945000|1.945000	0.56424|0.56424	0.459000|0.459000	0.35465|0.35465	GAG|TCG	.		0.657	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078875.2		
GH1	2688	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	61994712	61994712	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:61994712C>T	ENST00000323322.5	-	5	653	c.611G>A	c.(610-612)cGc>cAc	p.R204H	GH1_ENST00000342364.4_Missense_Mutation_p.R109H|CSHL1_ENST00000392824.4_Intron|GH1_ENST00000351388.4_Missense_Mutation_p.R164H|GH1_ENST00000458650.2_Missense_Mutation_p.R189H	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	204					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						CTGCACGATGCGCAGGAATGT	0.582																																					p.R204H		.											.	GH1	522	0			c.G611A						.						159.0	123.0	135.0					17																	61994712		2203	4297	6500	SO:0001583	missense	2688	exon5			ACGATGCGCAGGA	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.611G>A	17.37:g.61994712C>T	ENSP00000312673:p.Arg204His	413.0	1.0		611.0	163.0	NM_000515	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Missense_Mutation	SNP	ENST00000323322.5	37	CCDS11653.1	.	.	.	.	.	.	.	.	.	.	c	12.36	1.913401	0.33815	.	.	ENSG00000204414	ENST00000323322;ENST00000458650;ENST00000351388;ENST00000342364	D;T;D;D	0.91464	-2.85;0.79;-2.85;-2.85	2.62	2.62	0.31277	Somatotropin hormone, conserved site (1);Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	4.792870	0.00622	N	0.000451	D	0.88966	0.6581	M	0.79123	2.44	0.31505	N	0.664319	P;B;B;B	0.41102	0.738;0.241;0.164;0.164	B;B;B;B	0.32928	0.155;0.12;0.061;0.061	T	0.81415	-0.0943	10	0.56958	D	0.05	.	4.6175	0.12433	0.0:0.7127:0.0:0.2873	.	109;164;204;189	B1A4G9;A6NEF6;P01241;B1A4G7	.;.;SOMA_HUMAN;.	H	204;189;164;109	ENSP00000312673:R204H;ENSP00000408486:R189H;ENSP00000343791:R164H;ENSP00000339278:R109H	ENSP00000312673:R204H	R	-	2	0	GH1	59348444	1.000000	0.71417	0.994000	0.49952	0.824000	0.46624	3.326000	0.52037	1.470000	0.48102	0.298000	0.19748	CGC	.		0.582	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515	
GPHN	10243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	67646366	67646366	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:67646366A>T	ENST00000315266.5	+	21	3173	c.2052A>T	c.(2050-2052)gaA>gaT	p.E684D	GPHN_ENST00000305960.9_Missense_Mutation_p.E653D|GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000543237.1_Missense_Mutation_p.E730D|GPHN_ENST00000478722.1_Missense_Mutation_p.E717D	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	684	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ATCACCAAGAACCACTACCTT	0.363			T	MLL	AL																																p.E717D		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	228	0			c.A2151T						.						130.0	107.0	115.0					14																	67646366		2203	4300	6503	SO:0001583	missense	10243	exon22			CCAAGAACCACTA	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.2052A>T	14.37:g.67646366A>T	ENSP00000312771:p.Glu684Asp	329.0	0.0		300.0	139.0	NM_020806	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	A	8.510	0.866181	0.17250	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.	.	.	5.79	2.24	0.28232	MoeA, C-terminal, domain IV (3);	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	N	0.12502	0.225	0.58432	D	0.999999	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.10450	0.003;0.005;0.004;0.004	T	0.04333	-1.0959	9	0.16420	T	0.52	-10.9275	8.3167	0.32104	0.7147:0.0:0.2853:0.0	.	653;730;684;717	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	D	684;717;730;653	.	ENSP00000303019:E653D	E	+	3	2	GPHN	66716119	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.607000	0.46300	0.468000	0.27243	-0.256000	0.11100	GAA	.		0.363	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
GPSM1	26086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139234260	139234260	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:139234260G>A	ENST00000440944.1	+	8	1291	c.1071G>A	c.(1069-1071)caG>caA	p.Q357Q	GPSM1_ENST00000392945.3_Silent_p.Q357Q	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	357	Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		AGCACCTGCAGATCTCCCAGG	0.711																																					p.Q357Q		.											.	GPSM1	90	0			c.G1071A						.						28.0	29.0	29.0					9																	139234260		1829	3503	5332	SO:0001819	synonymous_variant	26086	exon8			CCTGCAGATCTCC	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1071G>A	9.37:g.139234260G>A		86.0	0.0		105.0	30.0	NM_015597	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Silent	SNP	ENST00000440944.1	37	CCDS48055.1																																																																																			.		0.711	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
HSPA12A	259217	ucsc.edu;bcgsc.ca	37	10	118451933	118451933	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr10:118451933T>C	ENST00000369209.3	-	6	696	c.592A>G	c.(592-594)Aga>Gga	p.R198G		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	198						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		ATGACCCATCTGACATCAGAG	0.577																																					p.R198G		.											.	HSPA12A	206	0			c.A592G						.						135.0	146.0	143.0					10																	118451933		2194	4300	6494	SO:0001583	missense	259217	exon6			CCCATCTGACATC	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.592A>G	10.37:g.118451933T>C	ENSP00000358211:p.Arg198Gly	68.0	0.0		48.0	4.0	NM_025015		Missense_Mutation	SNP	ENST00000369209.3	37	CCDS41569.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.450131	0.63290	.	.	ENSG00000165868	ENST00000369209	T	0.03801	3.8	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.19765	0.0475	M	0.79926	2.475	0.58432	D	0.999997	D	0.55385	0.971	D	0.63033	0.91	T	0.00171	-1.1960	10	0.72032	D	0.01	.	11.5885	0.50933	0.0:0.0:0.2729:0.7271	.	198	O43301	HS12A_HUMAN	G	198	ENSP00000358211:R198G	ENSP00000358211:R198G	R	-	1	2	HSPA12A	118441923	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.763000	0.55257	2.224000	0.72417	0.533000	0.62120	AGA	.		0.577	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
INSR	3643	broad.mit.edu;bcgsc.ca	37	19	7143085	7143085	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:7143085T>C	ENST00000302850.5	-	12	2426	c.2284A>G	c.(2284-2286)Agg>Ggg	p.R762G	INSR_ENST00000341500.5_Missense_Mutation_p.R750G	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	762	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> S (in IRAN type A). {ECO:0000269|PubMed:3283938}.		activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CCAAGGGACCTGCGTTTCCGA	0.527																																					p.R762G		.											.	INSR	1381	0			c.A2284G						.						81.0	69.0	73.0					19																	7143085		2203	4300	6503	SO:0001583	missense	3643	exon12			GGGACCTGCGTTT	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2284A>G	19.37:g.7143085T>C	ENSP00000303830:p.Arg762Gly	44.0	0.0		55.0	6.0	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	T	14.92	2.678798	0.47886	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.79247	-1.25;-1.25	5.23	4.18	0.49190	Fibronectin, type III (3);	0.137253	0.32430	U	0.006106	D	0.87168	0.6110	M	0.86343	2.81	0.58432	D	0.999996	D;B	0.57257	0.979;0.417	D;B	0.64776	0.929;0.266	D	0.87180	0.2227	10	0.87932	D	0	.	9.3936	0.38388	0.0:0.0:0.3498:0.6502	.	750;762	P06213-2;P06213	.;INSR_HUMAN	G	762;750	ENSP00000303830:R762G;ENSP00000342838:R750G	ENSP00000303830:R762G	R	-	1	2	INSR	7094085	0.993000	0.37304	1.000000	0.80357	0.218000	0.24690	1.284000	0.33249	0.775000	0.33450	0.459000	0.35465	AGG	.		0.527	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
ICAM1	3383	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	10385686	10385686	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:10385686A>G	ENST00000264832.3	+	2	638	c.313A>G	c.(313-315)Acc>Gcc	p.T105A	CTD-2369P2.5_ENST00000592893.1_RNA|ICAM1_ENST00000423829.2_Intron	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	105					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	AACAGCTAAAACCTTCCTCAC	0.562																																					p.T105A		.											.	ICAM1	91	0			c.A313G						.						105.0	105.0	105.0					19																	10385686		2202	4299	6501	SO:0001583	missense	3383	exon2			GCTAAAACCTTCC		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.313A>G	19.37:g.10385686A>G	ENSP00000264832:p.Thr105Ala	77.0	0.0		55.0	31.0	NM_000201	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	ENST00000264832.3	37	CCDS12231.1	.	.	.	.	.	.	.	.	.	.	A	2.259	-0.369764	0.05069	.	.	ENSG00000090339	ENST00000264832	T	0.26518	1.73	4.46	-7.41	0.01392	Intercellular adhesion molecule, N-terminal (1);Immunoglobulin-like fold (1);	1.154360	0.06315	N	0.703431	T	0.11965	0.0291	N	0.10760	0.04	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.39583	-0.9607	10	0.15499	T	0.54	-0.4045	14.6977	0.69134	0.1734:0.0:0.8266:0.0	.	105	P05362	ICAM1_HUMAN	A	105	ENSP00000264832:T105A	ENSP00000264832:T105A	T	+	1	0	ICAM1	10246686	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.788000	0.04614	-1.333000	0.02247	-0.408000	0.06270	ACC	.		0.562	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
ISPD	729920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	16298092	16298092	+	Missense_Mutation	SNP	A	A	T	rs199890239	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:16298092A>T	ENST00000407010.2	-	8	1041	c.1042T>A	c.(1042-1044)Ttt>Att	p.F348I	ISPD_ENST00000399310.3_Missense_Mutation_p.F298I|ISPD-AS1_ENST00000438573.1_RNA|ISPD-AS1_ENST00000457112.1_RNA	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	348					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						GTTTCTTGAAAATCAGAGGTT	0.313										Multiple Myeloma(15;0.18)			A|||	3	0.000599042	0.0	0.0	5008	,	,		17320	0.0		0.003	False		,,,				2504	0.0				p.F348I		.											.	ISPD	23	0			c.T1042A						.						67.0	62.0	63.0					7																	16298092		1803	4071	5874	SO:0001583	missense	729920	exon8			CTTGAAAATCAGA	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.1042T>A	7.37:g.16298092A>T	ENSP00000385478:p.Phe348Ile	94.0	0.0		101.0	37.0	NM_001101426	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	A	12.37	1.917083	0.33815	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.85861	-2.03;-2.04	5.77	3.35	0.38373	.	.	.	.	.	T	0.71039	0.3293	N	0.14661	0.345	0.25158	N	0.990379	B	0.17038	0.02	B	0.11329	0.006	T	0.59440	-0.7454	9	0.46703	T	0.11	-5.4986	5.2799	0.15670	0.7548:0.0:0.0844:0.1607	.	348	A4D126	ISPD_HUMAN	I	348;298	ENSP00000385478:F348I;ENSP00000382249:F298I	ENSP00000382249:F298I	F	-	1	0	ISPD	16264617	1.000000	0.71417	0.920000	0.36463	0.727000	0.41649	0.962000	0.29280	0.499000	0.27970	-0.274000	0.10170	TTT	A|0.999;T|0.001		0.313	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64952867	64952867	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr10:64952867G>A	ENST00000399262.2	-	16	6125	c.5907C>T	c.(5905-5907)tgC>tgT	p.C1969C	JMJD1C_ENST00000542921.1_Silent_p.C1787C|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Intron	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1969					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					ACTCAGGCATGCACAGAGAAA	0.368																																					p.C1969C		.											.	JMJD1C	275	0			c.C5907T						.						89.0	80.0	83.0					10																	64952867		1870	4124	5994	SO:0001819	synonymous_variant	221037	exon16			AGGCATGCACAGA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.5907C>T	10.37:g.64952867G>A		165.0	0.0		144.0	63.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	9.178	1.022904	0.19433	.	.	ENSG00000171988	ENST00000327520	.	.	.	5.67	4.63	0.57726	.	.	.	.	.	T	0.59404	0.2191	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56553	-0.7960	4	.	.	.	-1.7841	8.8589	0.35245	0.1963:0.0:0.8037:0.0	.	.	.	.	V	516	.	.	A	-	2	0	JMJD1C	64622873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.388000	0.34442	1.141000	0.42275	0.650000	0.86243	GCA	.		0.368	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
KHSRP	8570	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6420136	6420136	+	Silent	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:6420136T>C	ENST00000398148.3	-	6	587	c.495A>G	c.(493-495)gaA>gaG	p.E165E		NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	165	Gly-rich.|KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						TGTTAATTTGTTCACCTCCTC	0.547																																					p.E165E	Colon(55;593 1006 2067 9135 22980)	.											.	KHSRP	226	0			c.A495G						.						52.0	53.0	53.0					19																	6420136		1906	4124	6030	SO:0001819	synonymous_variant	8570	exon6			AATTTGTTCACCT	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.495A>G	19.37:g.6420136T>C		185.0	1.0		136.0	53.0	NM_003685	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Silent	SNP	ENST00000398148.3	37	CCDS45936.1																																																																																			.		0.547	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
KIF1C	10749	ucsc.edu;bcgsc.ca	37	17	4926003	4926003	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:4926003A>G	ENST00000320785.5	+	22	2984	c.2627A>G	c.(2626-2628)cAg>cGg	p.Q876R	AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	876					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						CCCCTGGCCCAGGTAGGACTG	0.602																																					p.Q876R	Melanoma(96;1023 1447 10250 19259 33730)	.											.	KIF1C	92	0			c.A2627G						.						16.0	16.0	16.0					17																	4926003		2201	4299	6500	SO:0001630	splice_region_variant	10749	exon22			TGGCCCAGGTAGG	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2628+1A>G	17.37:g.4926003A>G		19.0	0.0		20.0	4.0	NM_006612	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770610	0.49680	.	.	ENSG00000129250	ENST00000320785	T	0.74106	-0.81	4.4	4.4	0.53042	.	.	.	.	.	T	0.75087	0.3802	L	0.38175	1.15	0.80722	D	1	P	0.39094	0.659	P	0.55391	0.775	T	0.69083	-0.5239	9	0.16420	T	0.52	.	11.6302	0.51168	1.0:0.0:0.0:0.0	.	876	O43896	KIF1C_HUMAN	R	876	ENSP00000320821:Q876R	ENSP00000320821:Q876R	Q	+	2	0	KIF1C	4866727	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.838000	0.55828	1.853000	0.53794	0.533000	0.62120	CAG	.		0.602	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1		Missense_Mutation
KNDC1	85442	broad.mit.edu;bcgsc.ca	37	10	135033549	135033549	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr10:135033549C>T	ENST00000304613.3	+	29	4972	c.4951C>T	c.(4951-4953)Cac>Tac	p.H1651Y	KNDC1_ENST00000368572.2_Missense_Mutation_p.H1653Y			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1651	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCTGGCCATGCACATCCAGCA	0.692																																					p.H1651Y		.											.	KNDC1	229	0			c.C4951T						.						17.0	18.0	18.0					10																	135033549		2135	4222	6357	SO:0001583	missense	85442	exon29			GCCATGCACATCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4951C>T	10.37:g.135033549C>T	ENSP00000304437:p.His1651Tyr	182.0	0.0		87.0	6.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	c	20.6	4.019608	0.75275	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.29397	1.57;1.57	4.08	4.08	0.47627	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.050091	0.85682	U	0.000000	T	0.49184	0.1542	M	0.61703	1.905	0.42281	D	0.992094	D	0.63880	0.993	P	0.62813	0.907	T	0.54463	-0.8290	10	0.66056	D	0.02	-43.1507	14.1294	0.65242	0.0:1.0:0.0:0.0	.	1651	Q76NI1	VKIND_HUMAN	Y	1651;1653	ENSP00000304437:H1651Y;ENSP00000357561:H1653Y	ENSP00000304437:H1651Y	H	+	1	0	KNDC1	134883539	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.595000	0.67563	1.989000	0.58080	0.472000	0.43445	CAC	.		0.692	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KRT8	3856	ucsc.edu;bcgsc.ca	37	12	53294400	53294400	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr12:53294400A>G	ENST00000552551.1	-	5	1094	c.662T>C	c.(661-663)aTc>aCc	p.I221T	KRT8_ENST00000552150.1_Missense_Mutation_p.I249T|KRT8_ENST00000293308.6_Missense_Mutation_p.I221T|KRT8_ENST00000546897.1_Missense_Mutation_p.I221T			P05787	K2C8_HUMAN	keratin 8	221	Coil 1B.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	GAGGAAGTTGATCTCGTCGGT	0.577																																					p.I249T		.											.	KRT8	92	0			c.T746C						.						110.0	108.0	109.0					12																	53294400		2203	4300	6503	SO:0001583	missense	3856	exon5			AAGTTGATCTCGT	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.662T>C	12.37:g.53294400A>G	ENSP00000447566:p.Ile221Thr	51.0	0.0		41.0	5.0	NM_001256282	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.602238	0.66445	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000547176;ENST00000548998;ENST00000546900	D;D;D;D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67;-2.67;-2.67;-2.67	4.52	4.52	0.55395	Filament (1);	0.000000	0.85682	D	0.000000	D	0.96688	0.8919	H	0.96996	3.92	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.996	D;D;D	0.78314	0.991;0.978;0.987	D	0.97404	0.9998	10	0.56958	D	0.05	.	13.3727	0.60721	1.0:0.0:0.0:0.0	.	249;221;221	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	T	221;221;221;221;249;221;51;261;104	ENSP00000447566:I221T;ENSP00000293308:I221T;ENSP00000447402:I221T;ENSP00000449404:I249T;ENSP00000447881:I221T;ENSP00000449010:I51T;ENSP00000447040:I261T;ENSP00000450340:I104T	ENSP00000293308:I221T	I	-	2	0	KRT8	51580667	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	6.282000	0.72639	1.985000	0.57927	0.260000	0.18958	ATC	.		0.577	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406385.1	NM_002273	
LAMB4	22798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107688358	107688358	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:107688358T>C	ENST00000388781.3	-	28	4404	c.4321A>G	c.(4321-4323)Aat>Gat	p.N1441D	LAMB4_ENST00000205386.4_Missense_Mutation_p.N1441D|LAMB4_ENST00000388780.3_Missense_Mutation_p.N1441D	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1441	Domain I.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						TTTACCTGATTTTTCAACCCA	0.383																																					p.N1441D		.											.	LAMB4	140	0			c.A4321G						.						62.0	66.0	65.0					7																	107688358		2203	4300	6503	SO:0001583	missense	22798	exon28			CCTGATTTTTCAA	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4321A>G	7.37:g.107688358T>C	ENSP00000373433:p.Asn1441Asp	374.0	0.0		354.0	168.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	T	11.60	1.687673	0.29962	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.31510	1.49;1.49;1.9;1.51	4.69	4.69	0.59074	.	0.114976	0.38436	N	0.001692	T	0.26593	0.0650	L	0.27053	0.805	0.80722	D	1	B;P	0.46784	0.03;0.884	B;P	0.46419	0.012;0.516	T	0.02294	-1.1181	10	0.18710	T	0.47	.	13.9803	0.64301	0.0:0.0:0.0:1.0	.	1441;1441	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	D	1441;1441;467;1441	ENSP00000205386:N1441D;ENSP00000373433:N1441D;ENSP00000416562:N467D;ENSP00000373432:N1441D	ENSP00000205386:N1441D	N	-	1	0	LAMB4	107475594	1.000000	0.71417	0.769000	0.31535	0.189000	0.23516	2.397000	0.44477	1.972000	0.57404	0.482000	0.46254	AAT	.		0.383	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
LCE1E	353135	broad.mit.edu;bcgsc.ca	37	1	152759943	152759944	+	Frame_Shift_Ins	INS	-	-	GTGGA			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	-	-	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:152759943_152759944insGTGGA	ENST00000368770.3	+	2	221_222	c.168_169insGTGGA	c.(169-171)gggfs	p.G57fs	LCE1E_ENST00000368771.1_Frame_Shift_Ins_p.G57fs	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	57	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCCAGCTCTGGGGGCAGCTG	0.658																																					p.S56fs		.											.	LCE1E	90	0			c.168_169insGTGGA						.																																			SO:0001589	frameshift_variant	353135	exon2			CAGCTCTGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	Exception_encountered	1.37:g.152759943_152759944insGTGGA	ENSP00000357759:p.Gly57fs	173.0	0.0		293.0	0.0	NM_178353	D3DV30	Frame_Shift_Ins	INS	ENST00000368770.3	37	CCDS1024.1																																																																																			.		0.658	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
LHX8	431707	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	75602325	75602325	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:75602325C>T	ENST00000294638.5	+	3	720	c.56C>T	c.(55-57)aCa>aTa	p.T19I	LHX8_ENST00000356261.3_Missense_Mutation_p.T9I	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	19					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GGGCGGACTACAGCCCTGGCG	0.667																																					p.T19I		.											.	LHX8	93	0			c.C56T						.						21.0	22.0	22.0					1																	75602325		1790	3354	5144	SO:0001583	missense	431707	exon3			GGACTACAGCCCT	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.56C>T	1.37:g.75602325C>T	ENSP00000294638:p.Thr19Ile	74.0	0.0		73.0	34.0	NM_001001933	E9PGE3	Missense_Mutation	SNP	ENST00000294638.5	37	CCDS30756.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076522	0.55753	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.86297	-2.1;-2.09	3.58	3.58	0.41010	.	0.925878	0.08939	N	0.871821	T	0.64713	0.2623	N	0.08118	0	0.27613	N	0.948593	B	0.15473	0.013	B	0.04013	0.001	T	0.62348	-0.6873	10	0.72032	D	0.01	.	14.7861	0.69806	0.0:1.0:0.0:0.0	.	19	Q68G74	LHX8_HUMAN	I	19;9	ENSP00000294638:T19I;ENSP00000348597:T9I	ENSP00000294638:T19I	T	+	2	0	LHX8	75374913	0.992000	0.36948	0.998000	0.56505	0.955000	0.61496	2.339000	0.43965	1.533000	0.49186	0.313000	0.20887	ACA	.		0.667	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
LOC81691	81691	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	20826252	20826252	+	Missense_Mutation	SNP	G	G	T	rs201728796		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:20826252G>T	ENST00000261377.6	+	4	464	c.255G>T	c.(253-255)tgG>tgT	p.W85C	AC004381.6_ENST00000567297.1_3'UTR|ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000348433.6_Missense_Mutation_p.W85C|AC004381.6_ENST00000564274.1_Missense_Mutation_p.W85C	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TTGGCAGCTGGTGCCAGCTTT	0.433																																					p.W85C		.											.	LOC81691	92	0			c.G255T						.						101.0	89.0	93.0					16																	20826252		2201	4300	6501	SO:0001583	missense	0	exon4			CAGCTGGTGCCAG																												ENST00000261377.6:c.255G>T	16.37:g.20826252G>T	ENSP00000261377:p.Trp85Cys	211.0	0.0		184.0	76.0	NM_030941		Missense_Mutation	SNP	ENST00000261377.6	37	CCDS10591.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.581324	0.65992	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.72051	-0.62;-0.4	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.82384	0.5025	M	0.65498	2.005	0.80722	D	1	D;P	0.89917	1.0;0.459	D;B	0.91635	0.999;0.403	D	0.83665	0.0163	10	0.66056	D	0.02	-10.6428	14.8209	0.70070	0.0:0.0:1.0:0.0	.	85;85	Q96IC2-2;Q96IC2	.;REXON_HUMAN	C	85	ENSP00000261378:W85C;ENSP00000261377:W85C	ENSP00000261377:W85C	W	+	3	0	AC004381.6	20733753	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	5.476000	0.66793	2.557000	0.86248	0.561000	0.74099	TGG	G|0.999;A|0.000		0.433	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254418.2		
MAB21L1	4081	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	36049710	36049710	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr13:36049710A>G	ENST00000379919.4	-	1	1122	c.566T>C	c.(565-567)cTt>cCt	p.L189P	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	189					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GATGTGGGGAAGTGGCCAGTG	0.607																																					p.L189P		.											.	MAB21L1	92	0			c.T566C						.						45.0	52.0	50.0					13																	36049710		2203	4300	6503	SO:0001583	missense	4081	exon1			TGGGGAAGTGGCC	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.566T>C	13.37:g.36049710A>G	ENSP00000369251:p.Leu189Pro	96.0	0.0		55.0	23.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	37	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.570144	0.45798	.	.	ENSG00000180660	ENST00000379919	T	0.07908	3.15	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.14614	0.0353	L	0.40543	1.245	0.80722	D	1	B	0.29955	0.263	B	0.43990	0.438	T	0.17258	-1.0375	10	0.27785	T	0.31	-8.1728	15.8843	0.79232	1.0:0.0:0.0:0.0	.	189	Q13394	MB211_HUMAN	P	189	ENSP00000369251:L189P	ENSP00000369251:L189P	L	-	2	0	MAB21L1	34947710	1.000000	0.71417	0.955000	0.39395	0.987000	0.75469	9.339000	0.96797	2.164000	0.68074	0.533000	0.62120	CTT	.		0.607	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
MAN1B1	11253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140001761	140001761	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:140001761C>T	ENST00000371589.4	+	11	1699	c.1626C>T	c.(1624-1626)ccC>ccT	p.P542P	MAN1B1_ENST00000540391.1_3'UTR|MAN1B1_ENST00000474902.1_Silent_p.P245P	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	542					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACGGCCTGCCCGCCAGCCACA	0.632																																					p.P542P		.											.	MAN1B1	91	0			c.C1626T						.						47.0	52.0	50.0					9																	140001761		2202	4300	6502	SO:0001819	synonymous_variant	11253	exon11			CCTGCCCGCCAGC	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1626C>T	9.37:g.140001761C>T		162.0	0.0		263.0	89.0	NM_016219	Q5VSG3|Q9BRS9|Q9Y5K7	Silent	SNP	ENST00000371589.4	37	CCDS7029.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.802124	0.00075	.	.	ENSG00000177239	ENST00000535144;ENST00000475449	.	.	.	4.47	-8.94	0.00768	.	.	.	.	.	T	0.14960	0.0361	.	.	.	0.26598	N	0.973067	.	.	.	.	.	.	T	0.08371	-1.0725	4	.	.	.	.	1.0599	0.01598	0.2887:0.0969:0.2715:0.343	.	.	.	.	C	516;16	.	.	R	+	1	0	MAN1B1	139121582	0.000000	0.05858	0.001000	0.08648	0.253000	0.25986	-5.232000	0.00139	-3.577000	0.00138	-1.319000	0.01295	CGC	.		0.632	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055294.2	NM_016219	
MAP3K15	389840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	19410152	19410152	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrX:19410152G>A	ENST00000338883.4	-	18	2398	c.2399C>T	c.(2398-2400)gCg>gTg	p.A800V	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Missense_Mutation_p.A235V|MAP3K15_ENST00000469203.2_Missense_Mutation_p.A632V	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	800	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GTTCACACCCGCAAGACGTTT	0.502																																					p.A800V		.											.	MAP3K15	335	0			c.C2399T						.						77.0	73.0	75.0					X																	19410152		2203	4300	6503	SO:0001583	missense	389840	exon18			ACACCCGCAAGAC	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2399C>T	X.37:g.19410152G>A	ENSP00000345629:p.Ala800Val	36.0	0.0		49.0	44.0	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	37		.	.	.	.	.	.	.	.	.	.	G	14.46	2.543327	0.45280	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.65732	-0.17;-0.17;-0.17	5.09	4.2	0.49525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	N	0.16166	0.38	0.80722	D	1	P;P	0.51537	0.946;0.853	B;B	0.31101	0.124;0.066	T	0.46830	-0.9163	10	0.72032	D	0.01	.	14.2245	0.65850	0.0:0.0:0.8495:0.1505	.	275;800	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	V	800;235;632	ENSP00000345629:A800V;ENSP00000352093:A235V;ENSP00000428356:A632V	ENSP00000345629:A800V	A	-	2	0	MAP3K15	19320073	1.000000	0.71417	0.862000	0.33874	0.325000	0.28411	6.300000	0.72776	1.006000	0.39211	0.513000	0.50165	GCG	.		0.502	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
METTL9	51108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	21636425	21636425	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:21636425A>G	ENST00000358154.3	+	4	998	c.740A>G	c.(739-741)tAt>tGt	p.Y247C	METTL9_ENST00000396014.4_Missense_Mutation_p.Y247C|CTB-31N19.3_ENST00000564271.1_RNA	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	247										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		TTTCATCCCTATGTGGAAAAC	0.443																																					p.Y247C		.											.	METTL9	91	0			c.A740G						.						102.0	91.0	95.0					16																	21636425		2199	4300	6499	SO:0001583	missense	51108	exon4			ATCCCTATGTGGA	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.740A>G	16.37:g.21636425A>G	ENSP00000350874:p.Tyr247Cys	169.0	0.0		139.0	46.0	NM_016025	Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	ENST00000358154.3	37	CCDS10598.2	.	.	.	.	.	.	.	.	.	.	A	16.29	3.081694	0.55753	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.75184	0.3815	L	0.54323	1.7	0.80722	D	1	D;B	0.89917	1.0;0.241	D;B	0.85130	0.997;0.111	T	0.75508	-0.3293	9	0.51188	T	0.08	-14.1756	14.7743	0.69713	1.0:0.0:0.0:0.0	.	247;247	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	C	247;247;211	.	ENSP00000350874:Y247C	Y	+	2	0	METTL9	21543926	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.148000	0.71788	2.371000	0.80710	0.533000	0.62120	TAT	.		0.443	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254465.1	NM_016025	
MAZ	4150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29820038	29820038	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:29820038C>T	ENST00000322945.6	+	4	1420	c.1255C>T	c.(1255-1257)Cat>Tat	p.H419Y	MAZ_ENST00000566906.2_Intron|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000568282.1_Missense_Mutation_p.H20Y|MAZ_ENST00000545521.1_Missense_Mutation_p.H396Y|AC009133.20_ENST00000569039.1_RNA|AC009133.14_ENST00000569981.1_RNA|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000569978.1_Missense_Mutation_p.H20Y|MAZ_ENST00000562337.1_Missense_Mutation_p.H114Y|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000219782.6_Missense_Mutation_p.H419Y|MAZ_ENST00000568544.1_Missense_Mutation_p.H20Y	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	419					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						GGGTCCTCACCATGTCTGTGA	0.607																																					p.H419Y	Colon(72;875 1167 15364 30899 37091)	.											.	MAZ	136	0			c.C1255T						.						43.0	45.0	44.0					16																	29820038		2112	4225	6337	SO:0001583	missense	4150	exon4			CCTCACCATGTCT	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1255C>T	16.37:g.29820038C>T	ENSP00000313362:p.His419Tyr	104.0	0.0		85.0	36.0	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Missense_Mutation	SNP	ENST00000322945.6	37	CCDS42143.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748142	0.49257	.	.	ENSG00000103495	ENST00000545521;ENST00000322945;ENST00000219782;ENST00000544343	T;T;T	0.11604	2.76;2.76;5.07	5.3	4.35	0.52113	.	0.058153	0.64402	D	0.000002	T	0.03783	0.0107	N	0.04508	-0.205	0.33481	D	0.587416	P;B;B;B	0.35507	0.506;0.067;0.23;0.383	B;B;B;B	0.29716	0.083;0.054;0.053;0.106	T	0.21415	-1.0246	10	0.02654	T	1	-2.0738	11.944	0.52918	0.0:0.9143:0.0:0.0857	.	396;194;419;419	C6G496;F5H7A6;P56270;G5E927	.;.;MAZ_HUMAN;.	Y	396;419;419;194	ENSP00000443956:H396Y;ENSP00000313362:H419Y;ENSP00000219782:H419Y	ENSP00000219782:H419Y	H	+	1	0	MAZ	29727539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.434000	0.44802	1.364000	0.46038	0.655000	0.94253	CAT	.		0.607	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151873592	151873592	+	Silent	SNP	A	A	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:151873592A>C	ENST00000262189.6	-	38	9164	c.8946T>G	c.(8944-8946)gtT>gtG	p.V2982V	KMT2C_ENST00000355193.2_Silent_p.V2982V	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2982					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTGAGAAAAAACATGGTTTA	0.473																																					p.V2982V		.											.	MLL3	1398	0			c.T8946G						.						55.0	53.0	54.0					7																	151873592		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon38			AGAAAAAACATGG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8946T>G	7.37:g.151873592A>C		191.0	0.0		187.0	76.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	5.855	0.341872	0.11069	.	.	ENSG00000055609	ENST00000360104	.	.	.	5.47	0.266	0.15617	.	.	.	.	.	T	0.44973	0.1319	.	.	.	0.52099	D	0.999947	.	.	.	.	.	.	T	0.22452	-1.0216	4	.	.	.	.	3.6374	0.08154	0.4698:0.0:0.2762:0.254	.	.	.	.	V	488	.	.	F	-	1	0	MLL3	151504525	0.682000	0.27624	0.829000	0.32907	0.966000	0.64601	0.648000	0.24828	-0.182000	0.10602	-0.256000	0.11100	TTT	.		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MYBPC1	4604	broad.mit.edu;bcgsc.ca	37	12	102067254	102067254	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr12:102067254A>T	ENST00000550270.1	+	24	2642	c.2642A>T	c.(2641-2643)gAt>gTt	p.D881V	MYBPC1_ENST00000545503.2_Missense_Mutation_p.D863V|MYBPC1_ENST00000536007.1_Missense_Mutation_p.D844V|MYBPC1_ENST00000551300.1_Missense_Mutation_p.D764V|MYBPC1_ENST00000541119.1_Missense_Mutation_p.D851V|MYBPC1_ENST00000452455.2_Missense_Mutation_p.D881V|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000549145.1_Missense_Mutation_p.D894V|MYBPC1_ENST00000360610.2_Missense_Mutation_p.D881V|MYBPC1_ENST00000553190.1_Missense_Mutation_p.D863V|MYBPC1_ENST00000547405.1_Missense_Mutation_p.D837V|MYBPC1_ENST00000361685.2_Missense_Mutation_p.D888V|MYBPC1_ENST00000441232.1_Missense_Mutation_p.D881V|MYBPC1_ENST00000547509.1_Missense_Mutation_p.D849V|MYBPC1_ENST00000392934.3_Missense_Mutation_p.D850V|MYBPC1_ENST00000361466.2_Missense_Mutation_p.D888V			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	881	Ig-like C2-type 6.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GCAGAAATTGATAAGAATCAA	0.358																																					p.D888V		.											.	MYBPC1	94	0			c.A2663T						.						131.0	138.0	136.0					12																	102067254		2203	4300	6503	SO:0001583	missense	4604	exon25			AAATTGATAAGAA		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.2642A>T	12.37:g.102067254A>T	ENSP00000449702:p.Asp881Val	156.0	1.0		138.0	6.0	NM_206819	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.805582	0.90623	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25;-0.25	5.75	5.75	0.90469	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000091	D	0.83248	0.5213	M	0.83953	2.67	0.80722	D	1	B;D;B;P;D;D;D;D;B;D	0.89917	0.166;1.0;0.263;0.712;0.998;0.997;0.995;0.996;0.369;0.996	P;D;P;P;D;D;D;D;P;D	0.97110	0.505;1.0;0.617;0.865;0.999;0.993;0.999;1.0;0.563;0.994	D	0.85918	0.1444	10	0.87932	D	0	.	16.0506	0.80760	1.0:0.0:0.0:0.0	.	844;851;881;863;850;837;863;881;888;888	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.	V	837;881;881;881;850;849;888;894;863;863;844;851;888;764;881	ENSP00000448175:D837V;ENSP00000400908:D881V;ENSP00000388989:D881V;ENSP00000353822:D881V;ENSP00000376665:D850V;ENSP00000447362:D849V;ENSP00000354845:D888V;ENSP00000447660:D894V;ENSP00000447900:D863V;ENSP00000440034:D863V;ENSP00000446128:D844V;ENSP00000442847:D851V;ENSP00000354849:D888V;ENSP00000447116:D764V;ENSP00000449702:D881V	ENSP00000353822:D881V	D	+	2	0	MYBPC1	100591385	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.772000	0.91757	2.189000	0.69895	0.454000	0.30748	GAT	.		0.358	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
NAPSA	9476	broad.mit.edu;bcgsc.ca	37	19	50864210	50864210	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:50864210A>G	ENST00000253719.2	-	5	864	c.656T>C	c.(655-657)tTt>tCt	p.F219S	NR1H2_ENST00000542413.1_Intron|NR1H2_ENST00000600978.1_Intron	NM_004851.1	NP_004842.1	O96009	NAPSA_HUMAN	napsin A aspartic peptidase	219					membrane protein proteolysis (GO:0033619)|proteolysis (GO:0006508)|surfactant homeostasis (GO:0043129)	alveolar lamellar body (GO:0097208)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)|peptidase activity (GO:0008233)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)		GTTGAGGTAAAAGGAGAAGAC	0.507																																					p.F219S		.											.	NAPSA	90	0			c.T656C						.						61.0	57.0	58.0					19																	50864210		2203	4300	6503	SO:0001583	missense	9476	exon5			AGGTAAAAGGAGA	AF090386	CCDS12794.1	19q13.33	2011-08-25				ENSG00000131400			13395	protein-coding gene	gene with protein product	"""kidney-derived aspartic protease-like protein"""	605631					Standard	NM_004851		Approved	NAP1, NAPA, Kdap, KAP	uc002prx.3	O96009		ENST00000253719.2:c.656T>C	19.37:g.50864210A>G	ENSP00000253719:p.Phe219Ser	115.0	0.0		82.0	7.0	NM_004851	Q8WWD9	Missense_Mutation	SNP	ENST00000253719.2	37	CCDS12794.1	.	.	.	.	.	.	.	.	.	.	A	19.33	3.806446	0.70682	.	.	ENSG00000131400	ENST00000253719	T	0.59224	0.28	3.88	3.88	0.44766	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.047661	0.85682	D	0.000000	T	0.80859	0.4704	H	0.96080	3.765	0.58432	D	0.999998	D	0.71674	0.998	D	0.67900	0.954	D	0.85531	0.1209	10	0.87932	D	0	.	10.9147	0.47129	1.0:0.0:0.0:0.0	.	219	O96009	NAPSA_HUMAN	S	219	ENSP00000253719:F219S	ENSP00000253719:F219S	F	-	2	0	NAPSA	55556022	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	8.639000	0.91023	1.523000	0.49018	0.402000	0.26972	TTT	.		0.507	NAPSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464714.1	NM_004851	
NID2	22795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	52520942	52520942	+	Missense_Mutation	SNP	C	C	T	rs200644684		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:52520942C>T	ENST00000216286.5	-	4	864	c.865G>A	c.(865-867)Gct>Act	p.A289T	NID2_ENST00000541773.1_Missense_Mutation_p.A236T	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	289					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.A289T(2)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GAGTGGGCAGCGGAAAGGTCT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		18469	0.001		0.0	False		,,,				2504	0.0				p.A289T		.											.	NID2	158	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G865A						.						50.0	49.0	49.0					14																	52520942		2203	4300	6503	SO:0001583	missense	22795	exon4			GGGCAGCGGAAAG	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.865G>A	14.37:g.52520942C>T	ENSP00000216286:p.Ala289Thr	75.0	0.0		82.0	33.0	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	6.518	0.463830	0.12402	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	D;D	0.82803	-1.65;-1.53	4.8	-5.42	0.02640	.	1.086760	0.06888	N	0.803690	T	0.58807	0.2148	N	0.08118	0	0.09310	N	1	B;B;B	0.12630	0.003;0.006;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.47262	-0.9131	10	0.14252	T	0.57	.	4.8997	0.13767	0.0963:0.4039:0.0983:0.4015	.	236;291;289	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	T	289;236;291	ENSP00000216286:A289T;ENSP00000443730:A236T	ENSP00000216286:A289T	A	-	1	0	NID2	51590692	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.731000	0.04909	-1.178000	0.02741	-1.631000	0.00782	GCT	C|0.999;T|0.000		0.517	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
NIPBL	25836	broad.mit.edu;bcgsc.ca	37	5	36976272	36976272	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr5:36976272G>A	ENST00000282516.8	+	9	1762	c.1263G>A	c.(1261-1263)tcG>tcA	p.S421S	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Silent_p.S421S	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	421	Gln-rich.				brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AATGTTTGTCGCAGCAAGAAC	0.423																																					p.S421S		.											.	NIPBL	293	0			c.G1263A						.						76.0	79.0	78.0					5																	36976272		2203	4300	6503	SO:0001819	synonymous_variant	25836	exon9			TTTGTCGCAGCAA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1263G>A	5.37:g.36976272G>A		187.0	0.0		172.0	7.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Silent	SNP	ENST00000282516.8	37	CCDS3920.1																																																																																			.		0.423	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
NIPAL4	348938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156899886	156899886	+	Missense_Mutation	SNP	A	A	G	rs536139990		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr5:156899886A>G	ENST00000311946.7	+	6	1435	c.1319A>G	c.(1318-1320)aAg>aGg	p.K440R	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000435489.2_Missense_Mutation_p.K421R	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	440						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						CTGGAAGACAAGAACGTCCTT	0.483																																					p.K440R		.											.	NIPAL4	68	0			c.A1319G						.						45.0	44.0	45.0					5																	156899886		1897	4129	6026	SO:0001583	missense	348938	exon6			AAGACAAGAACGT	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.1319A>G	5.37:g.156899886A>G	ENSP00000311687:p.Lys440Arg	80.0	0.0		82.0	34.0	NM_001099287	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	37	CCDS47328.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518720	0.64634	.	.	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.91521	-2.73;-2.86	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.91630	0.7355	N	0.24115	0.695	0.58432	D	0.999991	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.91331	0.5090	10	0.35671	T	0.21	-30.6807	16.3829	0.83481	1.0:0.0:0.0:0.0	.	421;440	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	R	421;440	ENSP00000406456:K421R;ENSP00000311687:K440R	ENSP00000311687:K440R	K	+	2	0	NIPAL4	156832464	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	5.975000	0.70475	2.271000	0.75665	0.459000	0.35465	AAG	.		0.483	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
NRCAM	4897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107866734	107866734	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:107866734G>A	ENST00000425651.2	-	6	638	c.639C>T	c.(637-639)cgC>cgT	p.R213R	NRCAM_ENST00000413765.2_Silent_p.R213R|NRCAM_ENST00000379028.3_Silent_p.R213R|NRCAM_ENST00000379022.4_Silent_p.R213R|NRCAM_ENST00000351718.4_Silent_p.R207R|NRCAM_ENST00000379024.4_Silent_p.R213R	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	213	Ig-like 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TATAGTCTTCGCGGGTGTCCT	0.428																																					p.R213R		.											.	NRCAM	156	0			c.C639T						.						127.0	134.0	132.0					7																	107866734		2203	4300	6503	SO:0001819	synonymous_variant	4897	exon6			GTCTTCGCGGGTG		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.639C>T	7.37:g.107866734G>A		62.0	0.0		47.0	21.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	ENST00000425651.2	37	CCDS47686.1																																																																																			.		0.428	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
OR1J2	26740	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125273978	125273978	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:125273978G>A	ENST00000335302.5	+	1	898	c.898G>A	c.(898-900)Gcc>Acc	p.A300T		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						CATGAAAGAGGCCCTTGGGAA	0.393																																					p.A300T		.											.	OR1J2	72	0			c.G898A						.						71.0	73.0	72.0					9																	125273978		2203	4300	6503	SO:0001583	missense	26740	exon1			AAAGAGGCCCTTG		CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.898G>A	9.37:g.125273978G>A	ENSP00000335575:p.Ala300Thr	169.0	2.0		152.0	59.0	NM_054107	A3KFL9|Q6IF14|Q96R90|Q9NZP1	Missense_Mutation	SNP	ENST00000335302.5	37	CCDS35121.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.666692	0.67814	.	.	ENSG00000197233	ENST00000335302	T	0.42131	0.98	5.14	4.21	0.49690	.	0.000000	0.39687	U	0.001297	T	0.49474	0.1559	M	0.86268	2.805	0.09310	N	1	P	0.48911	0.917	P	0.44447	0.45	T	0.54153	-0.8336	10	0.66056	D	0.02	.	9.732	0.40366	0.1037:0.0:0.8963:0.0	.	300	Q8NGS2	OR1J2_HUMAN	T	300	ENSP00000335575:A300T	ENSP00000335575:A300T	A	+	1	0	OR1J2	124313799	0.067000	0.21026	0.009000	0.14445	0.889000	0.51656	2.529000	0.45632	1.363000	0.46019	0.632000	0.83419	GCC	.		0.393	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053932.1		
OR4M1	441670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20249191	20249191	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:20249191G>A	ENST00000315957.4	+	1	791	c.710G>A	c.(709-711)aGg>aAg	p.R237K		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AATACCAACAGGGCCATGTCC	0.463																																					p.R237K		.											.	OR4M1	68	0			c.G710A						.						298.0	258.0	272.0					14																	20249191		2203	4300	6503	SO:0001583	missense	441670	exon1			CCAACAGGGCCAT		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.710G>A	14.37:g.20249191G>A	ENSP00000319654:p.Arg237Lys	701.0	0.0		693.0	279.0	NM_001005500	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	4.405	0.074809	0.08485	.	.	ENSG00000176299	ENST00000315957	T	0.00007	9.64	4.42	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000127	T	0.00012	0.0000	N	0.00063	-2.32	0.31973	N	0.606841	B	0.17268	0.021	B	0.15484	0.013	T	0.06232	-1.0838	10	0.02654	T	1	-9.6388	6.0147	0.19596	0.2032:0.0:0.7968:0.0	.	237	Q8NGD0	OR4M1_HUMAN	K	237	ENSP00000319654:R237K	ENSP00000319654:R237K	R	+	2	0	OR4M1	19319031	1.000000	0.71417	0.982000	0.44146	0.951000	0.60555	3.858000	0.55979	2.468000	0.83385	0.506000	0.49869	AGG	.		0.463	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	4925278	4925278	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chrY:4925278C>T	ENST00000333703.4	+	4	894	c.381C>T	c.(379-381)tgC>tgT	p.C127C	PCDH11Y_ENST00000215473.6_Silent_p.C138C|PCDH11Y_ENST00000362095.5_Silent_p.C138C	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	138	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ATGAGCATTGCTTTTATGAAG	0.408																																					p.C138C		.											.	.	.	0			c.C414T						.																																			SO:0001819	synonymous_variant	83259	exon1			GCATTGCTTTTAT	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.381C>T	Y.37:g.4925278C>T		736.0	1.0		684.0	496.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Silent	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.		0.408	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
PDGFA	5154	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	550578	550578	+	Silent	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:550578C>T	ENST00000354513.5	-	4	713	c.321G>A	c.(319-321)cgG>cgA	p.R107R	PDGFA_ENST00000426681.2_5'Flank|PDGFA_ENST00000402802.3_Silent_p.R107R	NM_002607.5	NP_002598.4	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha polypeptide	107					actin cytoskeleton organization (GO:0030036)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell activation (GO:0001775)|cell projection assembly (GO:0030031)|cell-cell signaling (GO:0007267)|embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|negative chemotaxis (GO:0050919)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling (GO:0060683)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of smooth muscle cell migration (GO:0014910)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|microvillus (GO:0005902)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|growth factor activity (GO:0008083)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)		CGACCTGACTCCGAGGAATCT	0.647																																					p.R107R		.											.	PDGFA	454	0			c.G321A						.						72.0	57.0	62.0					7																	550578		2202	4300	6502	SO:0001819	synonymous_variant	5154	exon4			CTGACTCCGAGGA		CCDS34578.1, CCDS47524.1	7p22	2008-07-18			ENSG00000197461	ENSG00000197461			8799	protein-coding gene	gene with protein product	"""PDGF A-chain"", ""platelet-derived growth factor alpha chain"""	173430				1505216, 2536956	Standard	NM_002607		Approved	PDGF1, PDGF-A	uc003sir.3	P04085	OTTHUMG00000151412	ENST00000354513.5:c.321G>A	7.37:g.550578C>T		93.0	0.0		137.0	63.0	NM_002607	B5BU73	Silent	SNP	ENST00000354513.5	37	CCDS34578.1	.	.	.	.	.	.	.	.	.	.	c	3.113	-0.182242	0.06340	.	.	ENSG00000197461	ENST00000400761	.	.	.	4.69	1.76	0.24704	.	.	.	.	.	T	0.45538	0.1347	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27739	-1.0065	4	.	.	.	-15.6095	3.0708	0.06230	0.143:0.5642:0.1386:0.1542	.	.	.	.	K	114	.	.	E	-	1	0	PDGFA	517104	0.985000	0.35326	1.000000	0.80357	0.113000	0.19764	0.340000	0.19892	0.420000	0.25954	-0.251000	0.11542	GAG	.		0.647	PDGFA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322534.1		
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82464992	82464992	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:82464992T>C	ENST00000333891.9	-	16	14577	c.14240A>G	c.(14239-14241)cAg>cGg	p.Q4747R	PCLO_ENST00000426442.2_Intron|PCLO_ENST00000423517.2_Missense_Mutation_p.Q4747R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCTTGCATTCTGGACAACCAT	0.388																																					p.Q4747R		.											.	PCLO	29	0			c.A14240G						.						59.0	58.0	58.0					7																	82464992		1889	4129	6018	SO:0001583	missense	27445	exon16			GCATTCTGGACAA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14240A>G	7.37:g.82464992T>C	ENSP00000334319:p.Gln4747Arg	162.0	0.0		180.0	84.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	15.84	2.952682	0.53293	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.40756	1.02;1.02	5.88	5.88	0.94601	.	.	.	.	.	T	0.53302	0.1788	N	0.25890	0.77	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.85130	0.997;0.997	T	0.57619	-0.7780	9	0.87932	D	0	.	15.958	0.79902	0.0:0.0:0.0:1.0	.	4747;4747	Q9Y6V0-5;Q9Y6V0-6	.;.	R	4747	ENSP00000334319:Q4747R;ENSP00000388393:Q4747R	ENSP00000334319:Q4747R	Q	-	2	0	PCLO	82302928	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.816000	0.86201	2.243000	0.73865	0.528000	0.53228	CAG	.		0.388	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PELI2	57161	ucsc.edu;bcgsc.ca	37	14	56746414	56746414	+	Silent	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:56746414A>G	ENST00000267460.4	+	3	514	c.228A>G	c.(226-228)caA>caG	p.Q76Q		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	76	FHA; atypical.				innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						GCAAAGGTCAACACAGTATAT	0.338																																					p.Q76Q		.											.	PELI2	91	0			c.A228G						.						129.0	126.0	127.0					14																	56746414		2203	4300	6503	SO:0001819	synonymous_variant	57161	exon3			AGGTCAACACAGT	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.228A>G	14.37:g.56746414A>G		53.0	0.0		47.0	4.0	NM_021255	B2RDY5	Silent	SNP	ENST00000267460.4	37	CCDS9726.1																																																																																			.		0.338	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1		
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	608299	608299	+	Missense_Mutation	SNP	C	C	T	rs200183606		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr11:608299C>T	ENST00000264555.5	+	14	2971	c.2843C>T	c.(2842-2844)tCt>tTt	p.S948F	PHRF1_ENST00000533464.1_Missense_Mutation_p.S944F|PHRF1_ENST00000413872.2_Missense_Mutation_p.S946F|PHRF1_ENST00000416188.2_Missense_Mutation_p.S947F	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	948					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GATGGGGCGTCTTGCAGCACC	0.687																																					p.S947F		.											.	PHRF1	22	0			c.C2840T						.	C	PHE/SER	0,4022		0,0,2011	17.0	23.0	21.0		2840	2.5	0.0	11		21	2,8286		0,2,4142	yes	missense	PHRF1	NM_020901.2	155	0,2,6153	TT,TC,CC		0.0241,0.0,0.0162	benign	947/1649	608299	2,12308	2011	4144	6155	SO:0001583	missense	57661	exon14			GGGCGTCTTGCAG	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.2843C>T	11.37:g.608299C>T	ENSP00000264555:p.Ser948Phe	21.0	0.0		34.0	14.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	C	10.04	1.240978	0.22711	0.0	2.41E-4	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	4.35	2.48	0.30137	.	0.915450	0.08977	N	0.866320	T	0.65647	0.2711	N	0.19112	0.55	0.09310	N	1	P;P;P;P	0.39157	0.531;0.662;0.662;0.531	B;B;B;B	0.33196	0.076;0.159;0.159;0.076	T	0.54470	-0.8289	10	0.56958	D	0.05	-4.1525	8.2573	0.31765	0.0:0.5833:0.3026:0.1141	.	944;946;947;948	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	F	948;946;947;944	ENSP00000264555:S948F;ENSP00000388589:S946F;ENSP00000410626:S947F;ENSP00000431870:S944F	ENSP00000264555:S948F	S	+	2	0	PHRF1	598299	0.002000	0.14202	0.000000	0.03702	0.015000	0.08874	1.261000	0.32980	0.473000	0.27368	0.555000	0.69702	TCT	C|0.996;T|0.004		0.687	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PIGF	5281	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	46839477	46839477	+	Silent	SNP	T	T	A	rs1824050	byFrequency	TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:46839477T>A	ENST00000281382.6	-	4	497	c.327A>T	c.(325-327)gcA>gcT	p.A109A	PIGF_ENST00000306465.4_Silent_p.A109A|PIGF_ENST00000495933.1_5'UTR	NM_002643.3	NP_002634.1	Q07326	PIGF_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class F	109					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)			breast(1)|endometrium(1)|lung(1)|stomach(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ATGTTTCCAATGCCAACCTAG	0.274																																					p.A109A		.											.	PIGF	226	0			c.A327T						.						23.0	21.0	22.0					2																	46839477		2180	4280	6460	SO:0001819	synonymous_variant	5281	exon4			TTCCAATGCCAAC		CCDS1827.1, CCDS1828.1	2p21-p16	2013-02-26	2006-06-28		ENSG00000151665	ENSG00000151665		"""Phosphatidylinositol glycan anchor biosynthesis"""	8962	protein-coding gene	gene with protein product		600153	"""phosphatidylinositol glycan, class F"""			8575782, 8463218	Standard	NM_173074		Approved		uc002rvd.3	Q07326	OTTHUMG00000128816	ENST00000281382.6:c.327A>T	2.37:g.46839477T>A		502.0	2.0		323.0	152.0	NM_002643	Q8WW20	Silent	SNP	ENST00000281382.6	37	CCDS1827.1																																																																																			T|0.797;C|0.203		0.274	PIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250749.2	NM_173074	
PLCXD2	257068	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	111432938	111432938	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:111432938G>T	ENST00000477665.1	+	3	1153	c.829G>T	c.(829-831)Ggc>Tgc	p.G277C	PLCXD2_ENST00000472215.1_3'UTR|PLCXD2_ENST00000393934.3_Missense_Mutation_p.G277C	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	277					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						CATTGCCCGGGGCTTGGTTGG	0.502																																					p.G277C		.											.	PLCXD2	227	0			c.G829T						.						34.0	35.0	35.0					3																	111432938		2203	4300	6503	SO:0001583	missense	257068	exon3			GCCCGGGGCTTGG	AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.829G>T	3.37:g.111432938G>T	ENSP00000420686:p.Gly277Cys	48.0	1.0		68.0	33.0	NM_001185106	Q96N12	Missense_Mutation	SNP	ENST00000477665.1	37	CCDS54619.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.832420	0.91036	.	.	ENSG00000240891	ENST00000393934;ENST00000477665	.	.	.	5.5	5.5	0.81552	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	.	.	.	.	T	0.78020	0.4218	M	0.65975	2.015	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79022	-0.1973	8	0.59425	D	0.04	-18.3537	16.9188	0.86158	0.0:0.0:1.0:0.0	.	277;277	Q0VAA5;Q0VAA5-2	PLCX2_HUMAN;.	C	277	.	ENSP00000377511:G277C	G	+	1	0	PLCXD2	112915628	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	5.896000	0.69822	2.584000	0.87258	0.563000	0.77884	GGC	.		0.502	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
PLD3	23646	ucsc.edu;bcgsc.ca	37	19	40880392	40880392	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:40880392C>T	ENST00000409587.1	+	10	1281	c.884C>T	c.(883-885)gCg>gTg	p.A295V	PLD3_ENST00000409419.1_Missense_Mutation_p.A295V|PLD3_ENST00000356508.5_Missense_Mutation_p.A295V|PLD3_ENST00000409735.4_Missense_Mutation_p.A295V|PLD3_ENST00000409281.1_Missense_Mutation_p.A295V			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	295					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			CCTCAGAGTGCGCCCCCACCC	0.592																																					p.A295V		.											.	PLD3	228	0			c.C884T						.						95.0	86.0	89.0					19																	40880392		2203	4300	6503	SO:0001583	missense	23646	exon10			AGAGTGCGCCCCC	BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.884C>T	19.37:g.40880392C>T	ENSP00000387050:p.Ala295Val	76.0	0.0		38.0	4.0	NM_012268	Q92853|Q9BW87	Missense_Mutation	SNP	ENST00000409587.1	37	CCDS33027.1	.	.	.	.	.	.	.	.	.	.	C	36	5.797194	0.96952	.	.	ENSG00000105223	ENST00000409419;ENST00000409587;ENST00000356508;ENST00000536031;ENST00000409735;ENST00000409281	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	6.08	6.08	0.98989	Phospholipase D/viral envelope (1);	0.109205	0.64402	D	0.000005	T	0.64594	0.2612	L	0.54323	1.7	0.58432	D	0.99999	P	0.50819	0.939	P	0.54590	0.756	T	0.64922	-0.6293	10	0.87932	D	0	-20.1851	18.1573	0.89696	0.0:1.0:0.0:0.0	.	295	Q8IV08	PLD3_HUMAN	V	295;295;295;276;295;295	ENSP00000386293:A295V;ENSP00000387050:A295V;ENSP00000348901:A295V;ENSP00000386938:A295V;ENSP00000387022:A295V	ENSP00000348901:A295V	A	+	2	0	PLD3	45572232	1.000000	0.71417	0.994000	0.49952	0.959000	0.62525	7.174000	0.77620	2.894000	0.99253	0.655000	0.94253	GCG	.		0.592	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268	
POGZ	23126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151414583	151414583	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:151414583T>C	ENST00000271715.2	-	2	412	c.98A>G	c.(97-99)tAt>tGt	p.Y33C	POGZ_ENST00000531094.1_Missense_Mutation_p.Y33C|POGZ_ENST00000392723.1_Missense_Mutation_p.Y33C|POGZ_ENST00000368863.2_Missense_Mutation_p.Y33C|POGZ_ENST00000409503.1_Missense_Mutation_p.Y33C|POGZ_ENST00000361398.3_Missense_Mutation_p.Y33C|POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000491586.1_Missense_Mutation_p.Y33C	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	33					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACTGAATTATAATCTTCAAC	0.388																																					p.Y33C		.											.	POGZ	93	0			c.A98G						.						95.0	92.0	93.0					1																	151414583		2203	4300	6503	SO:0001583	missense	23126	exon2			GAATTATAATCTT	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.98A>G	1.37:g.151414583T>C	ENSP00000271715:p.Tyr33Cys	207.0	0.0		265.0	87.0	NM_145796	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	ENST00000271715.2	37	CCDS997.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.954328	0.73902	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000437847;ENST00000533461;ENST00000533351;ENST00000450842	T;T;T;T;T;T;T	0.01185	5.64;5.86;5.64;5.75;5.84;5.72;5.21	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000020	T	0.01523	0.0049	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D;D	0.83275	0.945;0.962;0.996;0.964;0.983;0.975;0.924	T	0.74621	-0.3604	10	0.62326	D	0.03	-14.65	15.3964	0.74798	0.0:0.0:0.0:1.0	.	33;33;33;33;33;33;33	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-4;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;.;POGZ_HUMAN	C	33	ENSP00000376484:Y33C;ENSP00000271715:Y33C;ENSP00000354467:Y33C;ENSP00000357856:Y33C;ENSP00000386836:Y33C;ENSP00000431259:Y33C;ENSP00000418408:Y33C	ENSP00000271715:Y33C	Y	-	2	0	POGZ	149681207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.129000	0.64739	2.313000	0.78055	0.455000	0.32223	TAT	.		0.388	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034915.2	NM_207171	
POLE2	5427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50140883	50140883	+	Silent	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr14:50140883A>G	ENST00000216367.5	-	5	474	c.375T>C	c.(373-375)gaT>gaC	p.D125D	POLE2_ENST00000539565.2_Silent_p.D99D|POLE2_ENST00000554396.1_Silent_p.D125D|POLE2_ENST00000556584.1_5'UTR	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	125					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TCTCTGCTTTATCTCTTGGTG	0.413																																					p.D125D		.											.	POLE2	229	0			c.T375C						.						248.0	252.0	251.0					14																	50140883		2203	4300	6503	SO:0001819	synonymous_variant	5427	exon5			TGCTTTATCTCTT	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.375T>C	14.37:g.50140883A>G		182.0	0.0		167.0	78.0	NM_001197331	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Silent	SNP	ENST00000216367.5	37	CCDS32073.1																																																																																			.		0.413	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	
PROC	5624	ucsc.edu;bcgsc.ca	37	2	128184733	128184733	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:128184733A>G	ENST00000234071.3	+	8	818	c.731A>G	c.(730-732)cAc>cGc	p.H244R	PROC_ENST00000453608.2_Missense_Mutation_p.H299R|PROC_ENST00000422777.3_Missense_Mutation_p.H244R|PROC_ENST00000409048.1_Missense_Mutation_p.H278R	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	244	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		H -> Y (in patients with PROC deficiency). {ECO:0000269|PubMed:8499565}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GTGCTCATCCACCCCTCCTGG	0.622																																					p.H244R		.											.	PROC	90	0			c.A731G						.						84.0	83.0	83.0					2																	128184733		2203	4300	6503	SO:0001583	missense	5624	exon8			TCATCCACCCCTC	X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.731A>G	2.37:g.128184733A>G	ENSP00000234071:p.His244Arg	42.0	0.0		53.0	6.0	NM_000312	B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Missense_Mutation	SNP	ENST00000234071.3	37	CCDS2145.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062048	0.76187	.	.	ENSG00000115718	ENST00000234071;ENST00000537436;ENST00000453608;ENST00000409048;ENST00000422777	D;D;D;D	0.92965	-3.14;-3.14;-3.14;-3.14	5.48	5.48	0.80851	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.42548	D	0.000690	D	0.92267	0.7547	N	0.20881	0.62	0.47476	D	0.999432	D;D;P;D	0.76494	0.997;0.999;0.586;0.998	P;D;B;P	0.65010	0.895;0.931;0.22;0.895	D	0.93115	0.6520	10	0.52906	T	0.07	.	15.5655	0.76287	1.0:0.0:0.0:0.0	.	299;300;278;244	B4DPQ7;B4DPQ3;E7END6;P04070	.;.;.;PROC_HUMAN	R	244;203;299;278;244	ENSP00000234071:H244R;ENSP00000404030:H299R;ENSP00000386679:H278R;ENSP00000409543:H244R	ENSP00000234071:H244R	H	+	2	0	PROC	127901203	0.999000	0.42202	0.987000	0.45799	0.970000	0.65996	5.897000	0.69831	2.074000	0.62210	0.533000	0.62120	CAC	.		0.622	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254385.2	NM_000312	
PTCH1	5727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	98268744	98268744	+	Silent	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:98268744C>A	ENST00000331920.6	-	2	638	c.339G>T	c.(337-339)gcG>gcT	p.A113A	PTCH1_ENST00000429896.2_5'UTR|PTCH1_ENST00000468211.2_Silent_p.A47A|PTCH1_ENST00000375274.2_Silent_p.A112A|RP11-435O5.5_ENST00000604104.1_RNA|PTCH1_ENST00000430669.2_Silent_p.A47A|PTCH1_ENST00000437951.1_Silent_p.A47A|PTCH1_ENST00000418258.1_5'UTR|PTCH1_ENST00000421141.1_5'UTR	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	113					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TTAATCCCACCGCGAAGGCCC	0.577																																					p.A113A		.											.	PTCH1	3532	0			c.G339T						.						61.0	60.0	60.0					9																	98268744		2203	4300	6503	SO:0001819	synonymous_variant	5727	exon2			TCCCACCGCGAAG	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.339G>T	9.37:g.98268744C>A		181.0	0.0		200.0	90.0	NM_000264	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																			.		0.577	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
RABL6	55684	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	139732077	139732077	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:139732077G>A	ENST00000311502.7	+	9	1325	c.1089G>A	c.(1087-1089)ggG>ggA	p.G363G	RABL6_ENST00000371663.4_Silent_p.G364G|RABL6_ENST00000432842.2_Silent_p.G325G|RABL6_ENST00000371675.3_Silent_p.G248G|RABL6_ENST00000357466.2_Intron			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	363	Pro-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GGCTGTTTGGGACGTCACCTG	0.697																																					p.G364G		.											.	.	.	0			c.G1092A						.						9.0	10.0	9.0					9																	139732077		1893	4086	5979	SO:0001819	synonymous_variant	55684	exon9			GTTTGGGACGTCA	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1089G>A	9.37:g.139732077G>A		32.0	0.0		82.0	24.0	NM_001173988	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Silent	SNP	ENST00000311502.7	37	CCDS48058.1																																																																																			.		0.697	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055141.4	NM_024718	
RHO	6010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129252455	129252455	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:129252455G>A	ENST00000296271.3	+	5	1035	c.941G>A	c.(940-942)cGg>cAg	p.R314Q		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	314					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	TTCCAGTTCCGGAACTGCATG	0.622																																					p.R314Q	Esophageal Squamous(118;214 1623 30842 43234 46940)	.											.	RHO	90	0			c.G941A						.						153.0	134.0	140.0					3																	129252455		2203	4300	6503	SO:0001583	missense	6010	exon5			AGTTCCGGAACTG	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.941G>A	3.37:g.129252455G>A	ENSP00000296271:p.Arg314Gln	33.0	0.0		68.0	33.0	NM_000539	Q16414|Q2M249	Missense_Mutation	SNP	ENST00000296271.3	37	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	G	35	5.479852	0.96307	.	.	ENSG00000163914	ENST00000296271	T	0.57273	0.41	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.75909	-0.3151	10	0.87932	D	0	.	18.7559	0.91832	0.0:0.0:1.0:0.0	.	314	P08100	OPSD_HUMAN	Q	314	ENSP00000296271:R314Q	ENSP00000296271:R314Q	R	+	2	0	RHO	130735145	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.383000	0.97214	2.428000	0.82296	0.655000	0.94253	CGG	.		0.622	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
RRBP1	6238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	17596122	17596122	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr20:17596122G>A	ENST00000377813.1	-	23	4307	c.4004C>T	c.(4003-4005)gCc>gTc	p.A1335V	RRBP1_ENST00000470422.1_5'UTR|RRBP1_ENST00000246043.4_Missense_Mutation_p.A1335V|RRBP1_ENST00000377807.2_Missense_Mutation_p.A902V|RRBP1_ENST00000455029.2_Missense_Mutation_p.A676V|RRBP1_ENST00000360807.4_Missense_Mutation_p.A902V			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1335					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TAGGGGGCCGGCTGTGCGGAG	0.617																																					p.A902V		.											.	RRBP1	92	0			c.C2705T						.						52.0	54.0	53.0					20																	17596122		2203	4300	6503	SO:0001583	missense	6238	exon23			GGGCCGGCTGTGC	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.4004C>T	20.37:g.17596122G>A	ENSP00000367044:p.Ala1335Val	97.0	0.0		99.0	43.0	NM_004587	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		.	.	.	.	.	.	.	.	.	.	G	13.11	2.138467	0.37728	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.13	-0.565	0.11771	.	2.631350	0.01755	N	0.030204	T	0.23611	0.0571	L	0.36672	1.1	0.09310	N	1	B;B	0.24132	0.098;0.015	B;B	0.26770	0.073;0.01	T	0.08700	-1.0709	10	0.29301	T	0.29	6.4995	2.7014	0.05149	0.1518:0.2642:0.4465:0.1375	.	902;1335	Q9P2E9-3;Q9P2E9	.;RRBP1_HUMAN	V	902;1335;902;1335;676	ENSP00000354045:A902V;ENSP00000367044:A1335V;ENSP00000367038:A902V;ENSP00000246043:A1335V;ENSP00000401206:A676V	ENSP00000246043:A1335V	A	-	2	0	RRBP1	17544122	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.966000	0.29331	-0.348000	0.08286	0.556000	0.70494	GCC	.		0.617	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
RRP1B	23076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45092191	45092191	+	Silent	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr21:45092191A>G	ENST00000340648.4	+	3	333	c.216A>G	c.(214-216)gaA>gaG	p.E72E		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	72					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		CTCTGCAGGAAGAGCTCGCCA	0.557																																					p.E72E		.											.	RRP1B	91	0			c.A216G						.						170.0	142.0	151.0					21																	45092191		2203	4300	6503	SO:0001819	synonymous_variant	23076	exon3			GCAGGAAGAGCTC	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.216A>G	21.37:g.45092191A>G		139.0	0.0		118.0	54.0	NM_015056	Q8TBZ4	Silent	SNP	ENST00000340648.4	37	CCDS33577.1																																																																																			.		0.557	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
SEMA7A	8482	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74709733	74709733	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:74709733G>A	ENST00000261918.4	-	6	1152	c.604C>T	c.(604-606)Cgg>Tgg	p.R202W	SEMA7A_ENST00000543145.2_Missense_Mutation_p.R188W|SEMA7A_ENST00000542748.1_Missense_Mutation_p.R37W	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	202	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						CGGCGGAACCGAGGGATCTTC	0.607																																					p.R202W		.											.	SEMA7A	153	0			c.C604T						.						116.0	110.0	112.0					15																	74709733		2197	4296	6493	SO:0001583	missense	8482	exon6			GGAACCGAGGGAT	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.604C>T	15.37:g.74709733G>A	ENSP00000261918:p.Arg202Trp	127.0	1.0		208.0	45.0	NM_003612	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	ENST00000261918.4	37	CCDS10262.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759681	0.69763	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.22539	1.95;1.95;1.95	5.07	2.93	0.34026	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.212847	0.39834	N	0.001255	T	0.40979	0.1139	L	0.56769	1.78	0.34069	D	0.658186	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	T	0.58126	-0.7691	10	0.66056	D	0.02	-28.7941	13.4828	0.61345	0.0:0.0:0.7045:0.2955	.	188;202	F5H1S0;O75326	.;SEM7A_HUMAN	W	202;188;37	ENSP00000261918:R202W;ENSP00000438966:R188W;ENSP00000441493:R37W	ENSP00000261918:R202W	R	-	1	2	SEMA7A	72496786	0.372000	0.25064	0.953000	0.39169	0.987000	0.75469	1.075000	0.30716	1.114000	0.41781	0.561000	0.74099	CGG	.		0.607	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
SERPINB6	5269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	2959566	2959566	+	Start_Codon_SNP	SNP	T	T	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr6:2959566T>C	ENST00000380520.1	-	1	1995	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	SERPINB6_ENST00000380539.1_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000335686.5_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000380546.3_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000380529.1_Start_Codon_SNP_p.M1V|SERPINB6_ENST00000380524.1_Start_Codon_SNP_p.M1V			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	1					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	AGAACATCCATGATGGCAGAC	0.473																																					p.M20V		.											.	SERPINB6	226	0			c.A58G						.						122.0	113.0	116.0					6																	2959566		2203	4300	6503	SO:0001582	initiator_codon_variant	5269	exon2			CATCCATGATGGC	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.1A>G	6.37:g.2959566T>C	ENSP00000369891:p.Met1Val	130.0	0.0		155.0	65.0	NM_001271823	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Missense_Mutation	SNP	ENST00000380520.1	37	CCDS4479.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463937	0.43736	.	.	ENSG00000124570	ENST00000380524;ENST00000380520;ENST00000335686;ENST00000380529;ENST00000380539;ENST00000380546;ENST00000440670	D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	4.74	4.74	0.60224	Serpin domain (1);	0.181994	0.56097	D	0.000025	D	0.89220	0.6653	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90937	0.4794	9	0.87932	D	0	.	13.7526	0.62917	0.0:0.0:0.0:1.0	.	1	P35237	SPB6_HUMAN	V	1	ENSP00000369896:M1V;ENSP00000369891:M1V;ENSP00000338358:M1V;ENSP00000369901:M1V;ENSP00000369912:M1V;ENSP00000369919:M1V	ENSP00000338358:M1V	M	-	1	0	SERPINB6	2904565	1.000000	0.71417	0.992000	0.48379	0.223000	0.24884	6.287000	0.72671	2.055000	0.61198	0.482000	0.46254	ATG	.		0.473	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1		Missense_Mutation
SLIT3	6586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	168119629	168119629	+	Silent	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr5:168119629G>A	ENST00000519560.1	-	29	3578	c.3159C>T	c.(3157-3159)ccC>ccT	p.P1053P	SLIT3_ENST00000404867.3_Silent_p.P1053P|SLIT3_ENST00000332966.8_Silent_p.P1060P	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1053	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTTGTCCAGGGGGATGCACT	0.542																																					p.P1060P	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3	95	0			c.C3180T						.						112.0	85.0	94.0					5																	168119629		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon29			GTCCAGGGGGATG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3159C>T	5.37:g.168119629G>A		73.0	0.0		90.0	9.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																			.		0.542	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SND1	27044	broad.mit.edu;bcgsc.ca	37	7	127528038	127528038	+	Missense_Mutation	SNP	A	A	G	rs542618933		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr7:127528038A>G	ENST00000354725.3	+	13	1621	c.1427A>G	c.(1426-1428)tAc>tGc	p.Y476C		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	476	TNase-like 3. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						TCATCACACTACGATGAACTG	0.458																																					p.Y476C		.											.	SND1	92	0			c.A1427G						.						107.0	80.0	89.0					7																	127528038		2203	4300	6503	SO:0001583	missense	27044	exon13			CACACTACGATGA		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.1427A>G	7.37:g.127528038A>G	ENSP00000346762:p.Tyr476Cys	87.0	0.0		90.0	5.0	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425574	0.83667	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.31247	1.5;1.5	5.1	5.1	0.69264	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.122951	0.56097	D	0.000025	T	0.64746	0.2626	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74717	-0.3571	10	0.87932	D	0	-9.9442	13.1438	0.59450	1.0:0.0:0.0:0.0	.	476	Q7KZF4	SND1_HUMAN	C	476;466;25	ENSP00000346762:Y476C;ENSP00000419327:Y25C	ENSP00000346762:Y476C	Y	+	2	0	SND1	127315274	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	8.065000	0.89485	2.053000	0.61076	0.533000	0.62120	TAC	.		0.458	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
SNTG2	54221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1079315	1079315	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:1079315G>T	ENST00000308624.5	+	2	313	c.184G>T	c.(184-186)Gtg>Ttg	p.V62L	SNTG2_ENST00000407292.1_Missense_Mutation_p.V62L	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	62					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TGTTGTCTGTGTGGGCGGAAG	0.488																																					p.V62L		.											.	SNTG2	136	0			c.G184T						.						114.0	113.0	113.0					2																	1079315		1996	4168	6164	SO:0001583	missense	54221	exon2			GTCTGTGTGGGCG	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.184G>T	2.37:g.1079315G>T	ENSP00000311837:p.Val62Leu	110.0	0.0		90.0	36.0	NM_018968	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	3.107	-0.183483	0.06340	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.54071	1.15;0.59	4.23	1.06	0.20224	PDZ/DHR/GLGF (1);	0.574520	0.17993	N	0.155145	T	0.37210	0.0995	L	0.45137	1.4	0.19300	N	0.999975	B;B	0.22276	0.046;0.067	B;B	0.24541	0.054;0.035	T	0.28902	-1.0029	10	0.09843	T	0.71	.	7.5428	0.27748	0.3238:0.0:0.6762:0.0	.	62;62	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	L	62	ENSP00000311837:V62L;ENSP00000385020:V62L	ENSP00000311837:V62L	V	+	1	0	SNTG2	1069315	0.838000	0.29461	0.027000	0.17364	0.061000	0.15899	0.319000	0.19522	-0.124000	0.11724	0.591000	0.81541	GTG	.		0.488	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
ST8SIA2	8128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	93007604	93007604	+	Missense_Mutation	SNP	G	G	T	rs149476731		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr15:93007604G>T	ENST00000268164.3	+	6	1354	c.1117G>T	c.(1117-1119)Ggg>Tgg	p.G373W	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.G352W	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	373					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			CCAGTGCGATGGGGCCACGTA	0.597																																					p.G373W		.											.	ST8SIA2	90	0			c.G1117T						.	G	TRP/GLY	1,4395		0,1,2197	71.0	68.0	69.0		1117	5.6	1.0	15	dbSNP_134	69	0,8596		0,0,4298	no	missense	ST8SIA2	NM_006011.3	184	0,1,6495	TT,TG,GG		0.0,0.0227,0.0077	possibly-damaging	373/376	93007604	1,12991	2198	4298	6496	SO:0001583	missense	8128	exon6			TGCGATGGGGCCA	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.1117G>T	15.37:g.93007604G>T	ENSP00000268164:p.Gly373Trp	45.0	0.0		86.0	26.0	NM_006011	Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	ENST00000268164.3	37	CCDS10372.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078754	0.76528	2.27E-4	0.0	ENSG00000140557	ENST00000268164;ENST00000539113;ENST00000555434	T;T;T	0.23552	2.2;2.44;1.9	5.6	5.6	0.85130	.	0.241297	0.40144	N	0.001174	T	0.33904	0.0879	L	0.29908	0.895	0.50632	D	0.999883	D;D	0.60575	0.988;0.988	P;P	0.53006	0.715;0.715	T	0.05733	-1.0867	10	0.72032	D	0.01	-17.3051	19.6223	0.95663	0.0:0.0:1.0:0.0	.	352;373	C6G488;Q92186	.;SIA8B_HUMAN	W	373;352;330	ENSP00000268164:G373W;ENSP00000437382:G352W;ENSP00000450851:G330W	ENSP00000268164:G373W	G	+	1	0	ST8SIA2	90808608	1.000000	0.71417	0.980000	0.43619	0.925000	0.55904	6.156000	0.71840	2.635000	0.89317	0.650000	0.86243	GGG	G|1.000;T|0.000		0.597	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
TH	7054	broad.mit.edu;bcgsc.ca	37	11	2185482	2185482	+	Missense_Mutation	SNP	G	G	A	rs201219944		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr11:2185482G>A	ENST00000381178.1	-	14	1586	c.1568C>T	c.(1567-1569)gCg>gTg	p.A523V	TH_ENST00000333684.5_Missense_Mutation_p.A402V|TH_ENST00000352909.3_Missense_Mutation_p.A492V|TH_ENST00000381175.1_Missense_Mutation_p.A519V|INS_ENST00000381330.4_5'Flank	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	523					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	GGCACTCAGCGCATGGGCAAG	0.687																																					p.A523V		.											.	TH	90	0			c.C1568T						.	G	VAL/ALA,VAL/ALA,VAL/ALA	0,4394		0,0,2197	42.0	37.0	39.0		1475,1568,1556	4.3	0.1	11		39	2,8588	2.2+/-6.3	0,2,4293	yes	missense,missense,missense	TH	NM_000360.3,NM_199292.2,NM_199293.2	64,64,64	0,2,6490	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	492/498,523/529,519/525	2185482	2,12982	2197	4295	6492	SO:0001583	missense	7054	exon14			CTCAGCGCATGGG	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.1568C>T	11.37:g.2185482G>A	ENSP00000370571:p.Ala523Val	64.0	0.0		61.0	4.0	NM_199292	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	ENST00000381178.1	37	CCDS7731.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649054	0.67358	0.0	2.33E-4	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66	4.29	4.29	0.51040	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99732	0.9895	M	0.86502	2.82	0.45087	D	0.998107	D;D;D;D;D;D	0.89917	0.999;0.998;0.999;1.0;1.0;0.999	P;P;P;D;D;P	0.65323	0.879;0.869;0.869;0.933;0.934;0.891	D	0.97078	0.9782	10	0.72032	D	0.01	-17.3657	16.091	0.81090	0.0:0.0:1.0:0.0	.	496;402;398;492;523;519	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;.;TY3H_HUMAN;.	V	523;519;492;402	ENSP00000370571:A523V;ENSP00000370567:A519V;ENSP00000325951:A492V;ENSP00000328814:A402V	ENSP00000328814:A402V	A	-	2	0	TH	2142058	1.000000	0.71417	0.111000	0.21465	0.041000	0.13682	4.950000	0.63603	2.085000	0.62840	0.591000	0.81541	GCG	G|0.996;A|0.005		0.687	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026597.1	NM_000360	
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77416900	77416900	+	Silent	SNP	C	C	T	rs372508531		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr9:77416900C>T	ENST00000360774.1	-	16	2160	c.1923G>A	c.(1921-1923)gcG>gcA	p.A641A	TRPM6_ENST00000376864.4_Silent_p.A641A|TRPM6_ENST00000376872.3_Intron|RN7SKP47_ENST00000365347.1_RNA|TRPM6_ENST00000361255.3_Silent_p.A636A|TRPM6_ENST00000449912.2_Silent_p.A636A|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000451710.3_Silent_p.A641A	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	641					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AGAGGATACACGCAATCACGG	0.493																																					p.A641A		.											.	TRPM6	335	0			c.G1923A						.	C	,,	0,4406		0,0,2203	146.0	122.0	130.0		1908,1908,1923	-6.3	0.1	9		130	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	TRPM6	NM_001177310.1,NM_001177311.1,NM_017662.4	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	636/2018,636/2018,641/2023	77416900	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140803	exon16			GATACACGCAATC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1923G>A	9.37:g.77416900C>T		168.0	0.0		192.0	84.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	CCDS6647.1																																																																																			.		0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
UGT2B15	7366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	69535667	69535667	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr4:69535667A>G	ENST00000338206.5	-	1	679	c.670T>C	c.(670-672)Tgg>Cgg	p.W224R		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	224					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATTTGAAACCAAAAGTCAAAA	0.328																																					p.W224R		.											.	UGT2B15	46	0			c.T670C						.						100.0	111.0	107.0					4																	69535667		2203	4296	6499	SO:0001583	missense	7366	exon1			GAAACCAAAAGTC	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.670T>C	4.37:g.69535667A>G	ENSP00000341045:p.Trp224Arg	429.0	2.0		184.0	147.0	NM_001076	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	ENST00000338206.5	37	CCDS3524.1	.	.	.	.	.	.	.	.	.	.	a	6.602	0.479446	0.12581	.	.	ENSG00000196620	ENST00000338206	T	0.60424	0.19	2.79	2.79	0.32731	.	0.376195	0.20935	U	0.083027	T	0.50956	0.1646	M	0.64567	1.98	0.23192	N	0.998149	B	0.15473	0.013	B	0.23852	0.049	T	0.50363	-0.8837	10	0.59425	D	0.04	.	5.9768	0.19385	0.7309:0.2691:0.0:0.0	.	224	P54855	UDB15_HUMAN	R	224	ENSP00000341045:W224R	ENSP00000341045:W224R	W	-	1	0	UGT2B15	69218262	0.010000	0.17322	1.000000	0.80357	0.578000	0.36192	1.985000	0.40668	1.259000	0.44117	0.363000	0.22086	TGG	.		0.328	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365172.1	NM_001076	
ULK2	9706	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19705133	19705133	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr17:19705133C>A	ENST00000395544.4	-	16	1897	c.1398G>T	c.(1396-1398)agG>agT	p.R466S	ULK2_ENST00000361658.2_Missense_Mutation_p.R466S|ULK2_ENST00000580130.1_5'UTR	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	466					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CAGTGGAGAGCCTTCGTCCAA	0.502																																					p.R466S		.											.	ULK2	334	0			c.G1398T						.						178.0	176.0	177.0					17																	19705133		2203	4300	6503	SO:0001583	missense	9706	exon16			GGAGAGCCTTCGT	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1398G>T	17.37:g.19705133C>A	ENSP00000378914:p.Arg466Ser	132.0	1.0		176.0	64.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881236	0.51801	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.50548	0.74;0.74	5.8	-1.26	0.09376	.	0.000000	0.85682	D	0.000000	T	0.56485	0.1988	M	0.64997	1.995	0.41702	D	0.989406	D	0.63880	0.993	D	0.72338	0.977	T	0.53578	-0.8419	10	0.45353	T	0.12	-20.4346	7.269	0.26246	0.0:0.4374:0.1288:0.4338	.	466	Q8IYT8	ULK2_HUMAN	S	466	ENSP00000354877:R466S;ENSP00000378914:R466S	ENSP00000354877:R466S	R	-	3	2	ULK2	19645725	0.707000	0.27866	0.997000	0.53966	0.996000	0.88848	-0.265000	0.08644	-0.110000	0.12022	-0.290000	0.09829	AGG	.		0.502	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
UPK1B	7348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	118909118	118909118	+	Nonsense_Mutation	SNP	T	T	A	rs113148509		TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:118909118T>A	ENST00000264234.3	+	4	446	c.297T>A	c.(295-297)taT>taA	p.Y99*	UPK1B_ENST00000460625.1_Nonsense_Mutation_p.Y99*|UPK1B_ENST00000497685.1_Nonsense_Mutation_p.Y19*	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	99					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		TTATAGTATATGCCTTTGAAG	0.313																																					p.Y99X		.											.	UPK1B	90	0			c.T297A						.						148.0	149.0	149.0					3																	118909118		2203	4300	6503	SO:0001587	stop_gained	7348	exon4			AGTATATGCCTTT	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.297T>A	3.37:g.118909118T>A	ENSP00000264234:p.Tyr99*	523.0	0.0		443.0	178.0	NM_006952	O60753|Q9UIM2|Q9UNX6	Nonsense_Mutation	SNP	ENST00000264234.3	37	CCDS2985.1	.	.	.	.	.	.	.	.	.	.	T	35	5.447698	0.96205	.	.	ENSG00000114638	ENST00000497685;ENST00000264234;ENST00000479520;ENST00000494855;ENST00000460625	.	.	.	4.57	-0.897	0.10553	.	0.079382	0.52532	D	0.000062	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-10.4254	8.7815	0.34794	0.0:0.3214:0.0:0.6786	.	.	.	.	X	19;99;99;99;99	.	ENSP00000264234:Y99X	Y	+	3	2	UPK1B	120391808	0.864000	0.29904	0.942000	0.38095	0.995000	0.86356	-0.303000	0.08210	-0.309000	0.08779	0.460000	0.39030	TAT	T|0.500;C|0.500		0.313	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354883.2		
USH2A	7399	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216496858	216496858	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr1:216496858C>T	ENST00000307340.3	-	8	1894	c.1508G>A	c.(1507-1509)aGa>aAa	p.R503K	USH2A_ENST00000366942.3_Missense_Mutation_p.R503K|USH2A_ENST00000366943.2_Missense_Mutation_p.R503K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	503	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATATCTGTGTCTGAGGTTAAC	0.368										HNSCC(13;0.011)																											p.R503K		.											.	USH2A	115	0			c.G1508A						.						149.0	146.0	147.0					1																	216496858		2203	4300	6503	SO:0001583	missense	7399	exon8			CTGTGTCTGAGGT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1508G>A	1.37:g.216496858C>T	ENSP00000305941:p.Arg503Lys	217.0	1.0		359.0	104.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049535	0.36181	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.20738	2.44;2.43;2.05	5.5	4.59	0.56863	Laminin, N-terminal (3);	0.000000	0.49305	D	0.000150	T	0.22166	0.0534	M	0.68728	2.09	0.41999	D	0.990888	B;P	0.42785	0.164;0.79	B;B	0.34242	0.098;0.178	T	0.05649	-1.0872	10	0.41790	T	0.15	.	14.2176	0.65805	0.0:0.9281:0.0:0.0719	.	503;503	O75445-2;O75445	.;USH2A_HUMAN	K	503	ENSP00000305941:R503K;ENSP00000355910:R503K;ENSP00000355909:R503K	ENSP00000305941:R503K	R	-	2	0	USH2A	214563481	0.058000	0.20735	0.759000	0.31340	0.645000	0.38454	2.330000	0.43885	1.301000	0.44836	0.655000	0.94253	AGA	.		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VRK2	7444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	58373591	58373591	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr2:58373591G>C	ENST00000435505.2	+	15	1909	c.1164G>C	c.(1162-1164)atG>atC	p.M388I	VRK2_ENST00000417641.2_Missense_Mutation_p.M388I|VRK2_ENST00000440705.2_Missense_Mutation_p.M365I|VRK2_ENST00000340157.4_Missense_Mutation_p.M388I|VRK2_ENST00000412104.2_Missense_Mutation_p.M388I			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	388					cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TTGGATTGATGAACAATGAAG	0.378																																					p.M388I		.											.	VRK2	334	0			c.G1164C						.						213.0	230.0	224.0					2																	58373591		2203	4300	6503	SO:0001583	missense	7444	exon12			ATTGATGAACAAT	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.1164G>C	2.37:g.58373591G>C	ENSP00000408002:p.Met388Ile	402.0	0.0		343.0	145.0	NM_001130480	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	ENST00000435505.2	37	CCDS1859.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269199	0.40095	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705	T;T;T;T;T	0.04809	3.55;3.81;3.81;3.55;3.56	5.61	-7.56	0.01322	.	1.800900	0.02598	N	0.100790	T	0.02688	0.0081	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.41770	-0.9490	10	0.37606	T	0.19	7.6974	4.3483	0.11143	0.0696:0.301:0.1975:0.4319	.	388;388;388	Q86Y07-2;Q86Y07-5;Q86Y07	.;.;VRK2_HUMAN	I	388;388;388;388;388;365	ENSP00000408002:M388I;ENSP00000402375:M388I;ENSP00000404156:M388I;ENSP00000342381:M388I;ENSP00000398323:M365I	ENSP00000342381:M388I	M	+	3	0	VRK2	58227095	0.000000	0.05858	0.000000	0.03702	0.850000	0.48378	-0.280000	0.08468	-1.183000	0.02723	0.650000	0.86243	ATG	.		0.378	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296	
WDR87	83889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38383656	38383656	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr19:38383656G>A	ENST00000303868.5	-	4	2794	c.2570C>T	c.(2569-2571)aCc>aTc	p.T857I	WDR87_ENST00000447313.2_Missense_Mutation_p.T896I	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	857										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GACACTGTAGGTTACATCCTT	0.393																																					p.T857I		.											.	.	.	0			c.C2570T						.						121.0	96.0	104.0					19																	38383656		692	1591	2283	SO:0001583	missense	83889	exon4			CTGTAGGTTACAT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2570C>T	19.37:g.38383656G>A	ENSP00000368025:p.Thr857Ile	315.0	1.0		373.0	182.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	G	6.512	0.462670	0.12402	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.10668	2.85;2.85	5.4	4.35	0.52113	.	0.372260	0.22932	N	0.053885	T	0.25791	0.0628	L	0.57536	1.79	0.09310	N	1	D;D	0.69078	0.997;0.997	D;D	0.66196	0.942;0.942	T	0.03077	-1.1075	10	0.56958	D	0.05	-12.8528	11.4495	0.50145	0.0:0.0:0.8198:0.1802	.	857;896	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	I	896;857	ENSP00000405012:T896I;ENSP00000368025:T857I	ENSP00000368025:T857I	T	-	2	0	WDR87	43075496	0.788000	0.28762	0.084000	0.20598	0.051000	0.14879	3.353000	0.52247	1.242000	0.43836	0.643000	0.83706	ACC	.		0.393	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
YTHDF3	253943	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	64099147	64099147	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr8:64099147G>T	ENST00000539294.1	+	4	891	c.575G>T	c.(574-576)gGa>gTa	p.G192V	YTHDF3_ENST00000517371.1_Intron|YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000542911.2_Missense_Mutation_p.G3V	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	193							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			GGCATGACTGGACTGAAAATT	0.468																																					.		.											.	.	.	0			.						.						73.0	79.0	77.0					8																	64099147		2175	4277	6452	SO:0001583	missense	253943	.			TGACTGGACTGAA	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.575G>T	8.37:g.64099147G>T	ENSP00000473496:p.Gly192Val	174.0	0.0		166.0	67.0	.	B3KXL4|Q63Z37|Q659A3	Missense_Mutation	SNP	ENST00000539294.1	37																																																																																				.		0.468	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152758	
ZHX2	22882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	123965265	123965265	+	Silent	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr8:123965265C>A	ENST00000314393.4	+	3	2350	c.1515C>A	c.(1513-1515)tcC>tcA	p.S505S		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	505					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CCAGCGAATCCCTTGCCAAAG	0.562																																					p.S505S	Esophageal Squamous(94;1056 1388 11767 13799 49639)	.											.	ZHX2	227	0			c.C1515A						.						83.0	67.0	72.0					8																	123965265		2203	4300	6503	SO:0001819	synonymous_variant	22882	exon3			CGAATCCCTTGCC	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1515C>A	8.37:g.123965265C>A		31.0	0.0		40.0	17.0	NM_014943		Silent	SNP	ENST00000314393.4	37	CCDS6336.1																																																																																			.		0.562	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
ZNF445	353274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44489484	44489484	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr3:44489484C>A	ENST00000396077.2	-	8	2026	c.1679G>T	c.(1678-1680)cGa>cTa	p.R560L	ZNF445_ENST00000425708.2_Missense_Mutation_p.R560L	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	560					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		ATGGGTTTCTCGGTGCAGACG	0.463																																					p.R560L		.											.	ZNF445	91	0			c.G1679T						.						111.0	113.0	112.0					3																	44489484		2203	4300	6503	SO:0001583	missense	353274	exon8			GTTTCTCGGTGCA	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1679G>T	3.37:g.44489484C>A	ENSP00000379387:p.Arg560Leu	114.0	0.0		92.0	12.0	NM_181489	Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662061	0.29515	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.59083	0.29;0.29	3.61	0.854	0.19007	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.499968	0.17093	N	0.187319	T	0.33527	0.0866	N	0.16567	0.415	0.22511	N	0.999038	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17992	-1.0351	10	0.59425	D	0.04	.	2.4045	0.04409	0.2079:0.2355:0.0:0.5566	.	548;560	B7ZKX2;P59923	.;ZN445_HUMAN	L	560	ENSP00000413073:R560L;ENSP00000379387:R560L	ENSP00000379387:R560L	R	-	2	0	ZNF445	44464488	0.004000	0.15560	0.986000	0.45419	0.910000	0.53928	0.614000	0.24314	0.220000	0.20860	-0.423000	0.05987	CGA	.		0.463	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489	
ZNF785	146540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30594358	30594358	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Y-01A-11D-A12Z-10	TCGA-BC-A10Y-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	54f8357c-9dd7-4e08-bd47-a1ebedb30b62	5589b608-e6ae-4953-8a37-484d4116179b	g.chr16:30594358delC	ENST00000395216.2	-	3	900	c.741delG	c.(739-741)aggfs	p.R248fs	AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA|ZNF785_ENST00000470110.1_Frame_Shift_Del_p.R233fs|RP11-146F11.5_ENST00000563540.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						TGTGAGCCCGCCTGTGGATAG	0.657																																					p.R247fs		.											.	ZNF785	91	0			c.741delG						.						36.0	35.0	35.0					16																	30594358		2197	4300	6497	SO:0001589	frameshift_variant	146540	exon3			AGCCCGCCTGTGG	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.741delG	16.37:g.30594358delC	ENSP00000378642:p.Arg248fs	68.0	0.0		70.0	31.0	NM_152458	O75701|Q8IW91|Q8WV14|Q96MN0	Frame_Shift_Del	DEL	ENST00000395216.2	37	CCDS10685.1																																																																																			.		0.657	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255529.2	NM_152458	
