#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACTC1	70	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35084616	35084616	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr15:35084616G>A	ENST00000290378.4	-	4	1264	c.609C>T	c.(607-609)gtC>gtT	p.V203V	RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'UTR|RP11-814P5.1_ENST00000558707.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	203					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CACCAGTGGTGACAAAGGAGT	0.537																																					p.V203V		.											.	ACTC1	92	0			c.C609T						.						104.0	93.0	96.0					15																	35084616		2201	4298	6499	SO:0001819	synonymous_variant	70	exon4			AGTGGTGACAAAG	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.609C>T	15.37:g.35084616G>A		66.0	0.0		164.0	54.0	NM_005159	P04270	Silent	SNP	ENST00000290378.4	37	CCDS10041.1																																																																																			.		0.537	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
ACVR1	90	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	158637001	158637001	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr2:158637001T>C	ENST00000263640.3	-	4	608	c.179A>G	c.(178-180)aAc>aGc	p.N60S	ACVR1_ENST00000410057.2_Missense_Mutation_p.N60S|ACVR1_ENST00000434821.1_Missense_Mutation_p.N60S|ACVR1_ENST00000409283.2_Missense_Mutation_p.N60S|ACVR1_ENST00000487456.1_5'UTR	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	60					activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	GAAGCCATCGTTGATGCTCAG	0.547																																					p.N60S		.											.	ACVR1	980	0			c.A179G						.						117.0	115.0	116.0					2																	158637001		2203	4300	6503	SO:0001583	missense	90	exon4			CCATCGTTGATGC		CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.179A>G	2.37:g.158637001T>C	ENSP00000263640:p.Asn60Ser	43.0	0.0		163.0	61.0	NM_001105		Missense_Mutation	SNP	ENST00000263640.3	37	CCDS2206.1	.	.	.	.	.	.	.	.	.	.	T	12.73	2.024122	0.35701	.	.	ENSG00000115170	ENST00000263640;ENST00000409283;ENST00000434821;ENST00000410057;ENST00000412025;ENST00000440523;ENST00000539637;ENST00000424669	D;D;D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88;-2.88	5.26	5.26	0.73747	TGF-beta receptor/activin receptor, type I/II (1);	0.044226	0.85682	D	0.000000	T	0.82029	0.4948	N	0.05230	-0.09	0.45366	D	0.998355	B	0.06786	0.001	B	0.14023	0.01	T	0.77230	-0.2664	10	0.13108	T	0.6	.	14.8539	0.70319	0.0:0.0:0.0:1.0	.	60	Q04771	ACVR1_HUMAN	S	60	ENSP00000263640:N60S;ENSP00000387273:N60S;ENSP00000405004:N60S;ENSP00000387127:N60S;ENSP00000403006:N60S;ENSP00000401189:N60S;ENSP00000440091:N60S;ENSP00000400767:N60S	ENSP00000263640:N60S	N	-	2	0	ACVR1	158345247	1.000000	0.71417	0.935000	0.37517	0.984000	0.73092	4.833000	0.62766	1.990000	0.58119	0.533000	0.62120	AAC	.		0.547	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254927.1	NM_001105	
ACVRL1	94	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52307800	52307800	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:52307800C>T	ENST00000388922.4	+	5	851	c.568C>T	c.(568-570)Ctc>Ttc	p.L190F	ACVRL1_ENST00000419526.2_Intron|ACVRL1_ENST00000550683.1_Missense_Mutation_p.L204F	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	190	GS. {ECO:0000255|PROSITE- ProRule:PRU00585}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	TGGCTCAGGGCTCCCCTTCCT	0.647																																					p.L190F		.											.	ACVRL1	521	0			c.C568T						.						67.0	53.0	58.0					12																	52307800		2203	4300	6503	SO:0001583	missense	94	exon5			TCAGGGCTCCCCT	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.568C>T	12.37:g.52307800C>T	ENSP00000373574:p.Leu190Phe	44.0	0.0		171.0	71.0	NM_000020	A6NGA8	Missense_Mutation	SNP	ENST00000388922.4	37	CCDS31804.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661461	0.88154	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683	D;D	0.96459	-4.02;-4.02	5.18	5.18	0.71444	Protein kinase-like domain (1);TGF beta receptor, GS motif (3);	0.000000	0.40222	N	0.001159	D	0.97551	0.9198	L	0.60957	1.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98221	1.0478	10	0.87932	D	0	.	17.6209	0.88080	0.0:1.0:0.0:0.0	.	190	P37023	ACVL1_HUMAN	F	190;190;204	ENSP00000373574:L190F;ENSP00000447884:L204F	ENSP00000267008:L190F	L	+	1	0	ACVRL1	50594067	0.998000	0.40836	0.990000	0.47175	0.994000	0.84299	3.935000	0.56560	2.662000	0.90505	0.655000	0.94253	CTC	.		0.647	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2		
ADAD1	132612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123301311	123301311	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr4:123301311G>A	ENST00000296513.2	+	3	272	c.87G>A	c.(85-87)gcG>gcA	p.A29A	ADAD1_ENST00000388725.2_Silent_p.A11A|ADAD1_ENST00000388724.2_Silent_p.A29A	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	29					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTCAACCAGCGACAAAGACGA	0.483																																					p.A29A		.											.	ADAD1	90	0			c.G87A						.						100.0	84.0	89.0					4																	123301311		2203	4300	6503	SO:0001819	synonymous_variant	132612	exon3			ACCAGCGACAAAG	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.87G>A	4.37:g.123301311G>A		65.0	0.0		130.0	87.0	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	ENST00000296513.2	37	CCDS34058.1																																																																																			.		0.483	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
ADAT1	23536	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	75637056	75637056	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr16:75637056T>C	ENST00000307921.3	-	10	1448	c.1303A>G	c.(1303-1305)Aaa>Gaa	p.K435E	ADAT1_ENST00000568478.1_5'Flank|RP11-77K12.8_ENST00000564489.1_RNA	NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	435	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						AGTTCCACTTTGCTGATTTGG	0.423																																					p.K435E		.											.	ADAT1	92	0			c.A1303G						.						258.0	244.0	249.0					16																	75637056		2198	4300	6498	SO:0001583	missense	23536	exon10			CCACTTTGCTGAT	AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.1303A>G	16.37:g.75637056T>C	ENSP00000310015:p.Lys435Glu	55.0	0.0		90.0	49.0	NM_012091	Q9NVB7|Q9UNG3	Missense_Mutation	SNP	ENST00000307921.3	37	CCDS10922.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.389856	0.82902	.	.	ENSG00000065457	ENST00000307921;ENST00000542252	D	0.96651	-4.08	5.5	5.5	0.81552	Adenosine deaminase/editase (3);	0.134749	0.64402	D	0.000003	D	0.98548	0.9515	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99585	1.0974	10	0.87932	D	0	-4.5079	13.2857	0.60241	0.0:0.0:0.0:1.0	.	435	Q9BUB4	ADAT1_HUMAN	E	435;406	ENSP00000310015:K435E	ENSP00000310015:K435E	K	-	1	0	ADAT1	74194557	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.303000	0.65738	2.206000	0.71126	0.528000	0.53228	AAA	.		0.423	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1	NM_012091	
ADCK1	57143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78353552	78353552	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:78353552A>G	ENST00000238561.5	+	5	641	c.542A>G	c.(541-543)aAg>aGg	p.K181R	ADCK1_ENST00000341211.5_Missense_Mutation_p.K113R	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	188	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		CAGCACCCAAAGGTGCGGGCT	0.617																																					p.K181R		.											.	ADCK1	334	0			c.A542G						.						75.0	70.0	72.0					14																	78353552		2203	4300	6503	SO:0001583	missense	57143	exon5			ACCCAAAGGTGCG	AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.542A>G	14.37:g.78353552A>G	ENSP00000238561:p.Lys181Arg	23.0	0.0		50.0	22.0	NM_020421	B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	ENST00000238561.5	37	CCDS9869.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.228732	0.58777	.	.	ENSG00000063761	ENST00000238561;ENST00000557501;ENST00000341211	T;T;T	0.55052	0.54;0.54;0.54	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	N	0.11651	0.15	0.80722	D	1	B;B	0.23937	0.028;0.094	B;B	0.30401	0.115;0.039	T	0.26395	-1.0104	10	0.37606	T	0.19	0.0012	16.3797	0.83452	1.0:0.0:0.0:0.0	.	113;181	Q9UIE6;Q86TW2-2	.;.	R	181;181;113	ENSP00000238561:K181R;ENSP00000451549:K181R;ENSP00000339663:K113R	ENSP00000238561:K181R	K	+	2	0	ADCK1	77423305	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.300000	0.96151	2.271000	0.75665	0.533000	0.62120	AAG	.		0.617	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413864.1	NM_020421	
AGO4	192670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36291032	36291032	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:36291032A>G	ENST00000373210.3	+	4	670	c.425A>G	c.(424-426)aAt>aGt	p.N142S		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	142					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										GGGCACTTGAATGAAGTCCCA	0.443																																					p.N142S		.											.	.	.	0			c.A425G						.						168.0	157.0	161.0					1																	36291032		2203	4300	6503	SO:0001583	missense	192670	exon4			ACTTGAATGAAGT	AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.425A>G	1.37:g.36291032A>G	ENSP00000362306:p.Asn142Ser	123.0	0.0		264.0	143.0	NM_017629	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	37	CCDS397.1	.	.	.	.	.	.	.	.	.	.	A	5.505	0.278206	0.10403	.	.	ENSG00000134698	ENST00000373210	T	0.08984	3.03	5.57	1.47	0.22746	Argonaute/Dicer protein, PAZ (1);	0.126247	0.64402	N	0.000001	T	0.03305	0.0096	N	0.05351	-0.065	0.42460	D	0.992783	B	0.02656	0.0	B	0.06405	0.002	T	0.44802	-0.9304	10	0.06625	T	0.88	-8.6246	9.0857	0.36579	0.771:0.0:0.229:0.0	.	142	Q9HCK5	AGO4_HUMAN	S	142	ENSP00000362306:N142S	ENSP00000362306:N142S	N	+	2	0	EIF2C4	36063619	0.994000	0.37717	0.999000	0.59377	0.992000	0.81027	0.670000	0.25157	-0.013000	0.14199	0.533000	0.62120	AAT	.		0.443	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
ALMS1	7840	broad.mit.edu;bcgsc.ca	37	2	73716774	73716774	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr2:73716774C>T	ENST00000264448.6	+	10	7796	c.7685C>T	c.(7684-7686)cCa>cTa	p.P2562L	AC096546.1_ENST00000408160.1_RNA|ALMS1_ENST00000409009.1_Missense_Mutation_p.P2520L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2562					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TTACAGAGTCCACGGGGAATG	0.378																																					p.P2562L		.											.	ALMS1	142	0			c.C7685T						.						130.0	121.0	124.0					2																	73716774		1894	4105	5999	SO:0001583	missense	7840	exon10			AGAGTCCACGGGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.7685C>T	2.37:g.73716774C>T	ENSP00000264448:p.Pro2562Leu	53.0	0.0		145.0	7.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650852	0.67472	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.15372	2.43;2.43	4.45	4.45	0.53987	.	0.143348	0.33005	N	0.005381	T	0.32971	0.0847	L	0.48642	1.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.985;0.985;0.985	T	0.01401	-1.1364	10	0.72032	D	0.01	.	12.9143	0.58197	0.0:1.0:0.0:0.0	.	2562;2520;2562	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	L	2520;2562	ENSP00000386627:P2520L;ENSP00000264448:P2562L	ENSP00000264448:P2562L	P	+	2	0	ALMS1	73570282	0.999000	0.42202	0.998000	0.56505	0.960000	0.62799	3.429000	0.52800	2.748000	0.94277	0.650000	0.86243	CCA	.		0.378	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ALOX15B	247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7951723	7951723	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:7951723C>T	ENST00000380183.4	+	14	2010	c.1871C>T	c.(1870-1872)cCg>cTg	p.P624L	ALOX15B_ENST00000380173.2_Missense_Mutation_p.P595L|ALOX15B_ENST00000573359.1_Missense_Mutation_p.P550L|ALOX15B_ENST00000572022.1_Missense_Mutation_p.P612L	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	624	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						GGCACCTATCCGGATGAGCAC	0.657																																					p.P624L		.											.	ALOX15B	227	0			c.C1871T						.						43.0	48.0	46.0					17																	7951723		2203	4300	6503	SO:0001583	missense	247	exon14			CCTATCCGGATGA	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1871C>T	17.37:g.7951723C>T	ENSP00000369530:p.Pro624Leu	19.0	0.0		35.0	20.0	NM_001141	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	ENST00000380183.4	37	CCDS11128.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.664341	0.67700	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	T;T	0.76316	-1.01;-1.01	3.89	3.89	0.44902	Lipoxygenase, C-terminal (3);	0.394849	0.28499	N	0.015135	D	0.86957	0.6058	M	0.73598	2.24	0.53005	D	0.999962	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.81914	0.934;0.984;0.984;0.995	D	0.88962	0.3394	10	0.87932	D	0	-19.5832	15.1338	0.72545	0.0:1.0:0.0:0.0	.	612;550;595;624	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	L	595;550;624	ENSP00000369520:P595L;ENSP00000369530:P624L	ENSP00000344337:P550L	P	+	2	0	ALOX15B	7892448	0.989000	0.36119	0.953000	0.39169	0.915000	0.54546	3.257000	0.51500	2.163000	0.67991	0.561000	0.74099	CCG	.		0.657	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
AMACR	23600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	34005875	34005875	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:34005875T>C	ENST00000335606.6	-	2	465	c.377A>G	c.(376-378)tAt>tGt	p.Y126C	AMACR_ENST00000502637.1_Missense_Mutation_p.Y126C|AMACR_ENST00000382072.2_Missense_Mutation_p.Y126C|AMACR_ENST00000382085.3_Missense_Mutation_p.Y126C|AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000382068.3_Missense_Mutation_p.Y126C|AMACR_ENST00000441713.2_Missense_Mutation_p.Y126C|AMACR_ENST00000426255.2_Missense_Mutation_p.Y126C|AMACR_ENST00000512079.1_Missense_Mutation_p.Y126C|RP11-1084J3.4_ENST00000382079.3_Silent_p.L273L	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	126					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						CAAAGCCAAATAGTTGATATC	0.388																																					p.Y126C		.											.	AMACR	90	0			c.A377G						.						47.0	50.0	49.0					5																	34005875		2203	4300	6503	SO:0001583	missense	23600	exon2			GCCAAATAGTTGA	AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.377A>G	5.37:g.34005875T>C	ENSP00000334424:p.Tyr126Cys	27.0	0.0		61.0	16.0	NM_014324	A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	ENST00000335606.6	37	CCDS3902.1	.	.	.	.	.	.	.	.	.	.	T	18.09	3.545157	0.65198	.	.	ENSG00000242110	ENST00000335606;ENST00000382072;ENST00000382085;ENST00000502637;ENST00000441713	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.46	-0.439	0.12264	CoA-transferase family III domain (2);	0.166117	0.56097	D	0.000034	T	0.76702	0.4024	H	0.95294	3.65	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.998;0.998;0.996;0.998;0.998;0.998	T	0.80171	-0.1493	10	0.87932	D	0	-7.7514	11.1724	0.48579	0.4662:0.0:0.0:0.5338	.	126;126;126;126;126;126	B3KMU8;Q6VRU4;F8W9N1;D6RB81;Q9UHK6-4;Q9UHK6	.;.;.;.;.;AMACR_HUMAN	C	126	ENSP00000334424:Y126C;ENSP00000371504:Y126C;ENSP00000371517:Y126C;ENSP00000424351:Y126C;ENSP00000403800:Y126C	ENSP00000334424:Y126C	Y	-	2	0	AMACR	34041632	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	1.441000	0.35035	0.071000	0.16664	0.533000	0.62120	TAT	.		0.388	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207467.1	NM_014324	
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	9256402	9256402	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr18:9256402A>T	ENST00000262126.4	+	9	3377	c.3137A>T	c.(3136-3138)aAa>aTa	p.K1046I	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.K1023I|ANKRD12_ENST00000400020.3_Missense_Mutation_p.K1023I	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1046						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CTCAAACTAAAATCTGAAGCA	0.303																																					p.K1046I		.											.	ANKRD12	92	0			c.A3137T						.						63.0	67.0	66.0					18																	9256402		2200	4295	6495	SO:0001583	missense	23253	exon9			AACTAAAATCTGA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3137A>T	18.37:g.9256402A>T	ENSP00000262126:p.Lys1046Ile	122.0	0.0		239.0	64.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672580	0.67928	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.46451	0.87;0.87	5.17	5.17	0.71159	.	0.100908	0.64402	D	0.000002	T	0.61286	0.2335	M	0.63428	1.95	0.44462	D	0.997395	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.65047	-0.6263	10	0.87932	D	0	-1.3383	13.5699	0.61841	1.0:0.0:0.0:0.0	.	1023;1046	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	I	1023;1046	ENSP00000372932:K1023I;ENSP00000262126:K1046I	ENSP00000262126:K1046I	K	+	2	0	ANKRD12	9246402	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.162000	0.77515	1.953000	0.56701	0.528000	0.53228	AAA	.		0.303	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ARAP2	116984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	36216083	36216083	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr4:36216083T>A	ENST00000303965.4	-	3	1414	c.925A>T	c.(925-927)Aat>Tat	p.N309Y		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	309					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GTAGCAACATTTCTTCTTTCA	0.284																																					p.N309Y		.											.	ARAP2	93	0			c.A925T						.						83.0	85.0	84.0					4																	36216083		2202	4300	6502	SO:0001583	missense	116984	exon3			CAACATTTCTTCT	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.925A>T	4.37:g.36216083T>A	ENSP00000302895:p.Asn309Tyr	120.0	0.0		397.0	281.0	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.572079	0.45798	.	.	ENSG00000047365	ENST00000303965	T	0.08720	3.06	5.34	5.34	0.76211	.	0.388395	0.24527	N	0.037743	T	0.10551	0.0258	L	0.53249	1.67	0.25641	N	0.986201	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.10337	-1.0634	10	0.51188	T	0.08	.	11.7098	0.51618	0.0:0.0:0.0:1.0	.	239;309	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	Y	309	ENSP00000302895:N309Y	ENSP00000302895:N309Y	N	-	1	0	ARAP2	35892478	0.932000	0.31603	0.989000	0.46669	0.996000	0.88848	1.326000	0.33735	1.997000	0.58415	0.533000	0.62120	AAT	.		0.284	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
ARAP3	64411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141033643	141033643	+	Silent	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:141033643C>A	ENST00000239440.4	-	33	4574	c.4509G>T	c.(4507-4509)ctG>ctT	p.L1503L	ARAP3_ENST00000513878.1_Silent_p.L1152L|ARAP3_ENST00000508305.1_Silent_p.L1334L|FCHSD1_ENST00000522783.1_5'Flank|FCHSD1_ENST00000519800.1_5'Flank|ARAP3_ENST00000512390.1_5'UTR|FCHSD1_ENST00000435817.2_5'Flank|FCHSD1_ENST00000522126.1_5'Flank	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1503	Pro-rich.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						AAGGACTTCCCAGGCCTGCAG	0.627																																					p.L1503L		.											.	ARAP3	291	0			c.G4509T						.						41.0	49.0	46.0					5																	141033643		2203	4300	6503	SO:0001819	synonymous_variant	64411	exon33			ACTTCCCAGGCCT	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4509G>T	5.37:g.141033643C>A		61.0	0.0		208.0	86.0	NM_022481	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	37	CCDS4266.1																																																																																			.		0.627	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
ARID3C	138715	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	9	34623647	34623647	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr9:34623647G>T	ENST00000378909.2	-	4	732	c.640C>A	c.(640-642)Cag>Aag	p.Q214K		NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	214					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		ATGGCGGCCTGGAGCTCCCCT	0.677																																					p.Q214K		.											.	ARID3C	91	0			c.C640A						.						11.0	12.0	12.0					9																	34623647		2161	4249	6410	SO:0001583	missense	138715	exon4			CGGCCTGGAGCTC		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.640C>A	9.37:g.34623647G>T	ENSP00000368189:p.Gln214Lys	19.0	0.0		32.0	16.0	NM_001017363		Missense_Mutation	SNP	ENST00000378909.2	37	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875305	0.72180	.	.	ENSG00000205143	ENST00000378909	T	0.64438	-0.1	5.01	5.01	0.66863	ARID/BRIGHT DNA-binding domain (2);	0.000000	0.47455	D	0.000225	T	0.64204	0.2577	M	0.78049	2.395	0.58432	D	0.999998	B	0.24576	0.106	B	0.28991	0.097	T	0.62144	-0.6916	10	0.12103	T	0.63	-13.6509	17.3336	0.87274	0.0:0.0:1.0:0.0	.	214	A6NKF2	ARI3C_HUMAN	K	214	ENSP00000368189:Q214K	ENSP00000368189:Q214K	Q	-	1	0	ARID3C	34613647	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.342000	0.97044	2.341000	0.79615	0.549000	0.68633	CAG	.		0.677	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	
ATRNL1	26033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	117228753	117228753	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr10:117228753T>C	ENST00000355044.3	+	24	3694	c.3568T>C	c.(3568-3570)Tcc>Ccc	p.S1190P	ATRNL1_ENST00000423111.2_Missense_Mutation_p.S241P|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1190					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AGATAGTTTTTCCTATGAAAA	0.289																																					p.S1190P		.											.	ATRNL1	96	0			c.T3568C						.						36.0	40.0	39.0					10																	117228753		2191	4264	6455	SO:0001583	missense	26033	exon24			AGTTTTTCCTATG	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3568T>C	10.37:g.117228753T>C	ENSP00000347152:p.Ser1190Pro	71.0	0.0		84.0	39.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.031252	0.75504	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;T	0.63580	-0.05;-0.05	5.73	5.73	0.89815	.	0.049260	0.85682	D	0.000000	T	0.73024	0.3534	L	0.47016	1.485	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	T	0.70403	-0.4881	10	0.31617	T	0.26	-11.7768	16.0287	0.80560	0.0:0.0:0.0:1.0	.	241;1190	B4DH41;Q5VV63	.;ATRN1_HUMAN	P	1190;241	ENSP00000347152:S1190P;ENSP00000409624:S241P	ENSP00000347152:S1190P	S	+	1	0	ATRNL1	117218743	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.990000	0.88215	2.194000	0.70268	0.477000	0.44152	TCC	.		0.289	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
BAHD1	22893	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	40757537	40757537	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr15:40757537T>A	ENST00000416165.1	+	6	2127	c.2056T>A	c.(2056-2058)Ttg>Atg	p.L686M	RP11-64K12.8_ENST00000559730.1_RNA|BAHD1_ENST00000561234.1_Missense_Mutation_p.L685M|BAHD1_ENST00000560846.1_Intron	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	686	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CTTTGAGCCCTTGCAGAATGA	0.537																																					p.L686M		.											.	BAHD1	90	0			c.T2056A						.						166.0	124.0	138.0					15																	40757537		2203	4300	6503	SO:0001583	missense	22893	exon6			GAGCCCTTGCAGA	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.2056T>A	15.37:g.40757537T>A	ENSP00000396976:p.Leu686Met	70.0	0.0		182.0	69.0	NM_014952	Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	ENST00000416165.1	37	CCDS10058.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518522	0.64634	.	.	ENSG00000140320	ENST00000416165	T	0.19669	2.13	5.75	5.75	0.90469	Bromo adjacent homology (BAH) domain (3);	0.177862	0.39407	N	0.001364	T	0.35068	0.0919	L	0.50333	1.59	0.80722	D	1	D;D	0.61697	0.99;0.987	P;P	0.62298	0.9;0.838	T	0.03493	-1.1031	10	0.36615	T	0.2	-6.7082	11.1463	0.48432	0.0:0.0:0.1535:0.8465	.	686;685	Q8TBE0;Q8TBE0-2	BAHD1_HUMAN;.	M	686	ENSP00000396976:L686M	ENSP00000396976:L686M	L	+	1	2	BAHD1	38544829	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	2.232000	0.43018	2.191000	0.70037	0.533000	0.62120	TTG	.		0.537	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952	
BDH1	622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	197238766	197238766	+	Nonstop_Mutation	SNP	T	T	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:197238766T>G	ENST00000392378.2	-	7	1342	c.1032A>C	c.(1030-1032)tgA>tgC	p.*344C	BDH1_ENST00000441275.1_Nonstop_Mutation_p.*257C|BDH1_ENST00000392379.1_Nonstop_Mutation_p.*344C|BDH1_ENST00000358186.2_Nonstop_Mutation_p.*344C	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	0					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		GCGAGACTCTTCAGCGGATGT	0.552																																					p.X344C		.											.	BDH1	91	0			c.A1032C						.						62.0	61.0	62.0					3																	197238766		2203	4300	6503	SO:0001578	stop_lost	622	exon7			GACTCTTCAGCGG	M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.1032A>C	3.37:g.197238766T>G	ENSP00000376183:p.*344Trpext*26	60.0	0.0		153.0	51.0	NM_004051	D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	ENST00000392378.2	37	CCDS3328.1	.	.	.	.	.	.	.	.	.	.	T	8.121	0.780841	0.16120	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000441275	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6685	0.28445	0.0:0.0917:0.0:0.9083	.	.	.	.	C	344;344;344;257	.	.	X	-	3	0	BDH1	198723163	0.996000	0.38824	0.840000	0.33206	0.024000	0.10985	3.278000	0.51662	2.281000	0.76405	0.533000	0.62120	TGA	.		0.552	BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340267.1	NM_004051	
BIN1	274	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	127821169	127821169	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr2:127821169delT	ENST00000316724.5	-	9	1163	c.752delA	c.(751-753)aacfs	p.N251fs	BIN1_ENST00000409400.1_Frame_Shift_Del_p.N220fs|BIN1_ENST00000346226.3_Frame_Shift_Del_p.N220fs|BIN1_ENST00000376113.2_Frame_Shift_Del_p.N220fs|BIN1_ENST00000466111.1_5'UTR|BIN1_ENST00000259238.4_Frame_Shift_Del_p.N220fs|BIN1_ENST00000352848.3_Frame_Shift_Del_p.N220fs|BIN1_ENST00000348750.4_Frame_Shift_Del_p.N220fs|BIN1_ENST00000393040.3_Frame_Shift_Del_p.N220fs|BIN1_ENST00000357970.3_Frame_Shift_Del_p.N251fs|BIN1_ENST00000351659.3_Frame_Shift_Del_p.N251fs|BIN1_ENST00000393041.3_Frame_Shift_Del_p.N220fs	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	251	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		CTTGTGGAAGTTTTCCTCCAG	0.632																																					p.N251fs		.											.	BIN1	655	0			c.752delA						.						94.0	70.0	78.0					2																	127821169		2203	4300	6503	SO:0001589	frameshift_variant	274	exon9			TGGAAGTTTTCCT	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.752delA	2.37:g.127821169delT	ENSP00000316779:p.Asn251fs	54.0	0.0		152.0	52.0	NM_139345	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Frame_Shift_Del	DEL	ENST00000316724.5	37	CCDS2138.1																																																																																			.		0.632	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
C11orf84	144097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63585307	63585307	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:63585307G>C	ENST00000294244.4	+	2	457	c.158G>C	c.(157-159)aGa>aCa	p.R53T		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	53										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						CCACCGCCTAGACCCAGCCCG	0.617																																					p.R53T		.											.	C11orf84	90	0			c.G158C						.						37.0	32.0	34.0					11																	63585307		2200	4296	6496	SO:0001583	missense	144097	exon2			CGCCTAGACCCAG	BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.158G>C	11.37:g.63585307G>C	ENSP00000294244:p.Arg53Thr	38.0	0.0		87.0	24.0	NM_138471	Q68CV7|Q6PHS2|Q96IH0	Missense_Mutation	SNP	ENST00000294244.4	37	CCDS31594.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423625	0.62733	.	.	ENSG00000168005	ENST00000294244	T	0.47177	0.85	5.48	4.58	0.56647	.	0.655189	0.14298	N	0.328492	T	0.40094	0.1103	L	0.51422	1.61	0.09310	N	1	P	0.36535	0.557	B	0.31101	0.124	T	0.37911	-0.9685	10	0.87932	D	0	-16.7214	10.21	0.43134	0.0915:0.0:0.9085:0.0	.	53	Q9BUA3	CK084_HUMAN	T	53	ENSP00000294244:R53T	ENSP00000294244:R53T	R	+	2	0	C11orf84	63341883	0.427000	0.25514	0.294000	0.24946	0.278000	0.26855	3.006000	0.49529	1.330000	0.45394	0.561000	0.74099	AGA	.		0.617	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396084.1	NM_138471	
C14orf39	317761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	60921835	60921835	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:60921835C>G	ENST00000321731.3	-	16	1546	c.1387G>C	c.(1387-1389)Gtt>Ctt	p.V463L		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	463					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TCTGTTTGAACTTCAGGTACT	0.299																																					p.V463L		.											.	C14orf39	94	0			c.G1387C						.						58.0	63.0	61.0					14																	60921835		2201	4291	6492	SO:0001583	missense	317761	exon16			TTTGAACTTCAGG	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1387G>C	14.37:g.60921835C>G	ENSP00000324920:p.Val463Leu	104.0	0.0		252.0	89.0	NM_174978	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.656197	0.29425	.	.	ENSG00000179008	ENST00000321731	T	0.22336	1.96	5.84	-0.985	0.10256	.	1.016140	0.07853	N	0.965033	T	0.10981	0.0268	N	0.22421	0.69	0.09310	N	1	B	0.19817	0.039	B	0.18871	0.023	T	0.36915	-0.9728	9	.	.	.	2.2271	1.9519	0.03368	0.1248:0.452:0.1214:0.3018	.	463	Q8N1H7	S6OS1_HUMAN	L	463	ENSP00000324920:V463L	.	V	-	1	0	C14orf39	59991588	0.008000	0.16893	0.247000	0.24249	0.990000	0.78478	-0.400000	0.07241	-0.152000	0.11156	0.561000	0.74099	GTT	.		0.299	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
C19orf10	56005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4658077	4658077	+	Silent	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:4658077T>A	ENST00000262947.3	-	6	497	c.462A>T	c.(460-462)gcA>gcT	p.A154A	AC005339.2_ENST00000598070.1_RNA	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	154					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		CAGCTTTGAATGCCCCGGGCC	0.572																																					p.A154A		.											.	C19orf10	90	0			c.A462T						.						50.0	45.0	47.0					19																	4658077		2202	4299	6501	SO:0001819	synonymous_variant	56005	exon6			TTTGAATGCCCCG	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.462A>T	19.37:g.4658077T>A		23.0	0.0		38.0	11.0	NM_019107	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Silent	SNP	ENST00000262947.3	37	CCDS12133.1																																																																																			.		0.572	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
C1QTNF2	114898	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	159776748	159776748	+	Silent	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:159776748T>C	ENST00000393975.3	-	3	423	c.420A>G	c.(418-420)ccA>ccG	p.P140P		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	95	Collagen-like.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTTGCCCTTTGGTCCTGGCT	0.667																																					p.P140P		.											.	C1QTNF2	91	0			c.A420G						.						23.0	27.0	26.0					5																	159776748		2197	4295	6492	SO:0001819	synonymous_variant	114898	exon3			GCCCTTTGGTCCT	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.420A>G	5.37:g.159776748T>C		15.0	0.0		37.0	8.0	NM_031908		Silent	SNP	ENST00000393975.3	37	CCDS4351.2																																																																																			.		0.667	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
C1S	716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7177505	7177505	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:7177505G>A	ENST00000406697.1	+	15	2245	c.1617G>A	c.(1615-1617)gtG>gtA	p.V539V	C1S_ENST00000328916.3_Silent_p.V539V|C1S_ENST00000402681.3_Silent_p.V372V|C1S_ENST00000495061.1_3'UTR|C1S_ENST00000360817.5_Silent_p.V539V			P09871	C1S_HUMAN	complement component 1, s subcomponent	539	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	AAGACCCAGTGAAAATGGGAC	0.537																																					p.V539V	GBM(156;750 1943 12971 24779 31015)	.											.	C1S	91	0			c.G1617A						.						60.0	58.0	59.0					12																	7177505		2203	4300	6503	SO:0001819	synonymous_variant	716	exon12			CCCAGTGAAAATG		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.1617G>A	12.37:g.7177505G>A		35.0	0.0		87.0	33.0	NM_201442	D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Silent	SNP	ENST00000406697.1	37	CCDS31735.1																																																																																			.		0.537	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	NM_001734	
C6orf165	154313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88128113	88128113	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr6:88128113G>T	ENST00000507897.1	+	7	902	c.819G>T	c.(817-819)gaG>gaT	p.E273D	C6ORF165_ENST00000369562.4_Missense_Mutation_p.E273D			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	273										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		GACAATATGAGGTCTTCCTTC	0.403																																					p.E273D		.											.	C6orf165	90	0			c.G819T						.						98.0	105.0	103.0					6																	88128113		2203	4300	6503	SO:0001583	missense	154313	exon7			ATATGAGGTCTTC	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.819G>T	6.37:g.88128113G>T	ENSP00000426769:p.Glu273Asp	71.0	0.0		173.0	71.0	NM_001031743	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	ENST00000507897.1	37	CCDS34498.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161388	0.78226	.	.	ENSG00000213204	ENST00000369562	T	0.35973	1.28	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.56934	0.2019	M	0.80183	2.485	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.989	T	0.58346	-0.7652	10	0.46703	T	0.11	.	18.607	0.91270	0.0:0.0:1.0:0.0	.	273;273	Q8IYR0;E1P509	CF165_HUMAN;.	D	273	ENSP00000358575:E273D	ENSP00000358575:E273D	E	+	3	2	C6orf165	88184832	0.991000	0.36638	0.996000	0.52242	0.815000	0.46073	1.652000	0.37313	2.575000	0.86900	0.591000	0.81541	GAG	.		0.403	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000470406.1	NM_178823	
CACNA1B	774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140901281	140901281	+	Silent	SNP	C	C	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr9:140901281C>G	ENST00000371372.1	+	16	2182	c.2037C>G	c.(2035-2037)gtC>gtG	p.V679V	CACNA1B_ENST00000371357.1_Silent_p.V680V|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000277551.2_Silent_p.V679V|CACNA1B_ENST00000371363.1_Silent_p.V679V|CACNA1B_ENST00000371355.4_Silent_p.V680V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	679					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGGCGGCGTCAGCAAAGGCA	0.562																																					p.V679V		.											.	CACNA1B	138	0			c.C2037G						.						156.0	156.0	156.0					9																	140901281		2140	4257	6397	SO:0001819	synonymous_variant	774	exon16			CGGCGTCAGCAAA	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2037C>G	9.37:g.140901281C>G		92.0	0.0		210.0	143.0	NM_001243812	B1AQK5	Silent	SNP	ENST00000371372.1	37	CCDS59522.1																																																																																			.		0.562	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	181548355	181548355	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:181548355A>T	ENST00000367573.2	+	5	764	c.764A>T	c.(763-765)aAt>aTt	p.N255I	CACNA1E_ENST00000360108.3_Missense_Mutation_p.N255I|CACNA1E_ENST00000357570.5_Missense_Mutation_p.N206I|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Missense_Mutation_p.N255I|CACNA1E_ENST00000367570.1_Missense_Mutation_p.N255I|CACNA1E_ENST00000358338.5_Missense_Mutation_p.N206I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	255					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTCATGAACAATTCAGGTAGG	0.453																																					p.N255I		.											.	CACNA1E	95	0			c.A764T						.						303.0	277.0	285.0					1																	181548355		1934	4151	6085	SO:0001583	missense	777	exon5			TGAACAATTCAGG	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.764A>T	1.37:g.181548355A>T	ENSP00000356545:p.Asn255Ile	113.0	0.0		545.0	189.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.570357	0.45798	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97430	-4.38;-4.0;-3.99;-4.01;-3.99;-3.99;-4.0	4.88	4.88	0.63580	.	11.845600	0.00166	N	0.000006	D	0.95370	0.8497	L	0.33245	0.995	0.80722	D	1	B;B	0.14012	0.009;0.009	B;B	0.15484	0.013;0.013	T	0.72626	-0.4236	10	0.33141	T	0.24	.	14.4515	0.67389	1.0:0.0:0.0:0.0	.	255;255	Q15878-2;Q15878-3	.;.	I	255;255;255;206;206;255;255	ENSP00000432038:N255I;ENSP00000356542:N255I;ENSP00000434814:N255I;ENSP00000350183:N206I;ENSP00000351101:N206I;ENSP00000353222:N255I;ENSP00000356545:N255I	ENSP00000350183:N206I	N	+	2	0	CACNA1E	179814978	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.016000	0.49607	1.951000	0.56629	0.459000	0.35465	AAT	.		0.453	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CCNB1IP1	57820	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	20779825	20779826	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:20779825_20779826insA	ENST00000398169.3	-	7	1333_1334	c.717_718insT	c.(715-720)tttgcgfs	p.A240fs	CCNB1IP1_ENST00000358932.4_Frame_Shift_Ins_p.A240fs|CCNB1IP1_ENST00000398160.2_Frame_Shift_Ins_p.A240fs|CCNB1IP1_ENST00000353689.4_Frame_Shift_Ins_p.A240fs|CCNB1IP1_ENST00000437553.2_Frame_Shift_Ins_p.A240fs|CCNB1IP1_ENST00000398163.2_Frame_Shift_Ins_p.A240fs			Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1, E3 ubiquitin protein ligase	240					blastocyst formation (GO:0001825)|chiasma assembly (GO:0051026)|protein ubiquitination (GO:0016567)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		HMGA2/CCNB1IP1(2)	breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	9	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		GGAGAACCCGCAAAAAATGGTC	0.45			T	HMGA2	leiomyoma																																p.A240fs		.		Dom	yes		14	14q11.2	57820	"""cyclin B1 interacting protein 1, E3 ubiquitin protein ligase"""		M	.	CCNB1IP1	659	0			c.718_719insT						.																																			SO:0001589	frameshift_variant	57820	exon7			AACCCGCAAAAAA	AF216381	CCDS9547.1	14q11.2	2014-02-04	2011-01-31	2004-01-14	ENSG00000100814	ENSG00000100814			19437	protein-coding gene	gene with protein product	"""human enhancer of invasion 10"""	608249	"""chromosome 14 open reading frame 18"", ""cyclin B1 interacting protein 1"""	C14orf18		12612082, 21779533	Standard	NM_021178		Approved	HEI10	uc001vwy.4	Q9NPC3	OTTHUMG00000029509	ENST00000398169.3:c.718dupT	14.37:g.20779831_20779831dupA	ENSP00000381235:p.Ala240fs	90.0	0.0		291.0	83.0	NM_021178		Frame_Shift_Ins	INS	ENST00000398169.3	37	CCDS9547.1																																																																																			.		0.450	CCNB1IP1-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073538.3	NM_021178, NM_182849, NM_182851, NM_182852	
CDH7	1005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	63430104	63430104	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr18:63430104G>T	ENST00000397968.2	+	2	452	c.26G>T	c.(25-27)tGc>tTc	p.C9F	CDH7_ENST00000323011.3_Missense_Mutation_p.C9F|CDH7_ENST00000536984.2_Missense_Mutation_p.C9F	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	9					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GTGGAGTTCTGCCATTTTCTG	0.408																																					p.C9F		.											.	CDH7	94	0			c.G26T						.						114.0	112.0	113.0					18																	63430104		2203	4300	6503	SO:0001583	missense	1005	exon2			AGTTCTGCCATTT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.26G>T	18.37:g.63430104G>T	ENSP00000381058:p.Cys9Phe	54.0	0.0		94.0	31.0	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399009	0.25291	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.54279	0.58;0.6;0.58	5.83	4.96	0.65561	.	0.073160	0.64402	D	0.000013	T	0.47985	0.1475	L	0.58101	1.795	0.42167	D	0.991626	P;P	0.50943	0.723;0.94	B;B	0.41571	0.173;0.36	T	0.47873	-0.9083	10	0.12766	T	0.61	.	15.2241	0.73336	0.0672:0.0:0.9328:0.0	.	9;9	F5H5X9;Q9ULB5	.;CADH7_HUMAN	F	9	ENSP00000319166:C9F;ENSP00000443030:C9F;ENSP00000381058:C9F	ENSP00000319166:C9F	C	+	2	0	CDH7	61581084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.450000	0.60041	1.487000	0.48415	-0.127000	0.14921	TGC	.		0.408	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CDHR5	53841	ucsc.edu;bcgsc.ca	37	11	618860	618860	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:618860T>C	ENST00000358353.3	-	14	2021	c.1699A>G	c.(1699-1701)Agt>Ggt	p.S567G	IRF7_ENST00000397570.1_5'Flank|CDHR5_ENST00000397542.2_Missense_Mutation_p.S567G|CDHR5_ENST00000349570.7_Intron|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397574.2_5'Flank|IRF7_ENST00000397562.3_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	567	4 X 31 AA approximate tandem repeats.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						GTGCCCCCACTGGGTGTGGCT	0.672																																					p.S567G		.											.	CDHR5	90	0			c.A1699G						.																																			SO:0001583	missense	53841	exon13			CCCCACTGGGTGT	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.1699A>G	11.37:g.618860T>C	ENSP00000351118:p.Ser567Gly	84.0	0.0		389.0	50.0	NM_021924	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	C	3.103	-0.184385	0.06340	.	.	ENSG00000099834	ENST00000397542;ENST00000358353	T;T	0.50277	0.75;0.75	2.59	-2.0	0.07433	.	.	.	.	.	T	0.18383	0.0441	N	0.02916	-0.46	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30327	-0.9982	9	0.07990	T	0.79	.	9.3241	0.37982	0.0:0.2294:0.0:0.7706	.	561;567	Q9HBB8-4;Q9HBB8	.;CDHR5_HUMAN	G	567	ENSP00000380676:S567G;ENSP00000351118:S567G	ENSP00000351118:S567G	S	-	1	0	CDHR5	608860	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.029000	0.03585	-0.744000	0.04778	-0.222000	0.12452	AGT	.		0.672	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109795619	109795619	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:109795619T>C	ENST00000271332.3	+	1	2979	c.2918T>C	c.(2917-2919)aTc>aCc	p.I973T		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	973	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CAGCTGGACATCTTCTCCGGG	0.597																																					p.I973T	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.T2918C						.						113.0	102.0	105.0					1																	109795619		2203	4300	6503	SO:0001583	missense	1952	exon1			TGGACATCTTCTC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.2918T>C	1.37:g.109795619T>C	ENSP00000271332:p.Ile973Thr	37.0	0.0		95.0	42.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	9.247	1.039869	0.19669	.	.	ENSG00000143126	ENST00000271332	T	0.44482	0.92	4.92	4.92	0.64577	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.22044	0.0531	N	0.03000	-0.44	0.43448	D	0.995637	D	0.56521	0.976	D	0.65140	0.932	T	0.21314	-1.0249	9	0.12766	T	0.61	.	14.7889	0.69824	0.0:0.0:0.0:1.0	.	973	Q9HCU4	CELR2_HUMAN	T	973	ENSP00000271332:I973T	ENSP00000271332:I973T	I	+	2	0	CELSR2	109597142	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.982000	0.70532	2.095000	0.63458	0.529000	0.55759	ATC	.		0.597	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CGN	57530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151499552	151499552	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:151499552G>T	ENST00000271636.7	+	10	1998	c.1865G>T	c.(1864-1866)gGa>gTa	p.G622V	SNORA44_ENST00000517031.1_RNA	NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	616	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCTAGTGCTGGAGATACTCGC	0.542																																					p.G622V		.											.	CGN	93	0			c.G1865T						.						117.0	107.0	111.0					1																	151499552		2203	4300	6503	SO:0001583	missense	57530	exon10			GTGCTGGAGATAC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.1865G>T	1.37:g.151499552G>T	ENSP00000271636:p.Gly622Val	83.0	0.0		228.0	79.0	NM_020770	A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	ENST00000271636.7	37	CCDS999.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.309784	0.23821	.	.	ENSG00000143375	ENST00000271636	T	0.62364	0.03	5.54	3.27	0.37495	.	0.748757	0.13601	N	0.375871	T	0.24431	0.0592	N	0.25647	0.755	0.27275	N	0.958263	B	0.10296	0.003	B	0.09377	0.004	T	0.07986	-1.0744	10	0.31617	T	0.26	-1.8441	5.9002	0.18962	0.1227:0.4023:0.4749:0.0	.	616	Q9P2M7	CING_HUMAN	V	622	ENSP00000271636:G622V	ENSP00000271636:G622V	G	+	2	0	CGN	149766176	0.766000	0.28496	0.614000	0.29051	0.983000	0.72400	0.482000	0.22276	1.457000	0.47850	0.650000	0.86243	GGA	.		0.542	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130286897	130286897	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:130286897A>G	ENST00000358511.6	+	5	1881	c.1850A>G	c.(1849-1851)aAa>aGa	p.K617R	COL6A6_ENST00000453409.2_Missense_Mutation_p.K617R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	617	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GCAGCTTGCAAAGAGATGAAA	0.343																																					p.K617R		.											.	COL6A6	76	0			c.A1850G						.						50.0	48.0	49.0					3																	130286897		1828	4101	5929	SO:0001583	missense	131873	exon5			CTTGCAAAGAGAT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1850A>G	3.37:g.130286897A>G	ENSP00000351310:p.Lys617Arg	50.0	0.0		121.0	45.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	A	8.783	0.928789	0.18131	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78246	-1.16;-1.16	5.32	0.312	0.15837	.	0.095602	0.45867	N	0.000322	T	0.57417	0.2052	N	0.20304	0.555	0.25997	N	0.982165	B	0.18310	0.027	B	0.15052	0.012	T	0.38866	-0.9641	10	0.19147	T	0.46	.	8.7651	0.34698	0.6943:0.0:0.3057:0.0	.	617	A6NMZ7	CO6A6_HUMAN	R	617	ENSP00000351310:K617R;ENSP00000399236:K617R	ENSP00000351310:K617R	K	+	2	0	COL6A6	131769587	1.000000	0.71417	0.985000	0.45067	0.538000	0.34931	3.306000	0.51881	-0.161000	0.10983	-0.250000	0.11733	AAA	.		0.343	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113988234	113988234	+	Missense_Mutation	SNP	C	C	T	rs557572936		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:113988234C>T	ENST00000297405.5	-	7	1418	c.1174G>A	c.(1174-1176)Gag>Aag	p.E392K	CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000352409.3_Missense_Mutation_p.E392K|CSMD3_ENST00000343508.3_Missense_Mutation_p.E352K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	392						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E392K(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CGCTGTTCCTCGGAAAGTCTA	0.502										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			C|||	1	0.000199681	0.0	0.0	5008	,	,		17209	0.001		0.0	False		,,,				2504	0.0				p.E392K		.											CSMD3,NS,carcinoma,0	CSMD3	1132	1	Substitution - Missense(1)	ovary(1)	c.G1174A						.						203.0	178.0	186.0					8																	113988234		2203	4300	6503	SO:0001583	missense	114788	exon7			GTTCCTCGGAAAG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1174G>A	8.37:g.113988234C>T	ENSP00000297405:p.Glu392Lys	101.0	0.0		404.0	85.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919931	0.73098	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000352409	T;T;T	0.18338	2.22;2.22;2.22	6.17	6.17	0.99709	.	0.177149	0.36268	N	0.002692	T	0.26846	0.0657	N	0.22421	0.69	0.36807	D	0.885667	D;D	0.65815	0.992;0.995	D;D	0.70716	0.935;0.97	T	0.01753	-1.1281	10	0.05959	T	0.93	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	392;352	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	K	352;392;392	ENSP00000345799:E352K;ENSP00000297405:E392K;ENSP00000343124:E392K	ENSP00000297405:E392K	E	-	1	0	CSMD3	114057410	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.685000	0.54678	2.941000	0.99782	0.655000	0.94253	GAG	.		0.502	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	C	rs121913416		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:41266100T>C	ENST00000349496.5	+	3	377	c.97T>C	c.(97-99)Tct>Cct	p.S33P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1	CTNNB1	24361	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)	c.T97C						.						93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGACTCTGGAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>C	3.37:g.41266100T>C	ENSP00000344456:p.Ser33Pro	91.0	1.0		223.0	71.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395782	0.83011	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	P	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26P;ENSP00000385604:S33P;ENSP00000412219:S33P;ENSP00000379486:S33P;ENSP00000344456:S33P;ENSP00000411226:S26P;ENSP00000379488:S33P;ENSP00000409302:S33P;ENSP00000401599:S33P	ENSP00000344456:S33P	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DCST2	127579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155003099	155003099	+	Silent	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:155003099C>A	ENST00000368424.3	-	6	886	c.828G>T	c.(826-828)cgG>cgT	p.R276R	DCST2_ENST00000295536.5_Silent_p.R276R	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	276						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCTGACGCACCCGGTTGAGCA	0.617																																					p.R276R		.											.	DCST2	92	0			c.G828T						.						66.0	47.0	54.0					1																	155003099		2203	4300	6503	SO:0001819	synonymous_variant	127579	exon6			ACGCACCCGGTTG	AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.828G>T	1.37:g.155003099C>A		67.0	0.0		253.0	94.0	NM_144622	Q2M2R2|Q8N810|Q96M03	Silent	SNP	ENST00000368424.3	37	CCDS1082.2																																																																																			.		0.617	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13770967	13770967	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:13770967T>C	ENST00000265104.4	-	56	9600	c.9496A>G	c.(9496-9498)Aga>Gga	p.R3166G	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3166	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CGTCGGAATCTCTGAAAATAA	0.468									Kartagener syndrome																												p.R3166G		.											.	DNAH5	182	0			c.A9496G						.						137.0	132.0	134.0					5																	13770967		2203	4300	6503	SO:0001583	missense	1767	exon56	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GGAATCTCTGAAA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9496A>G	5.37:g.13770967T>C	ENSP00000265104:p.Arg3166Gly	66.0	0.0		272.0	77.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	19.49	3.838286	0.71373	.	.	ENSG00000039139	ENST00000265104	T	0.41400	1.0	5.71	4.51	0.55191	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	M	0.92649	3.33	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.76650	-0.2881	10	0.87932	D	0	.	12.0222	0.53350	0.0:0.0:0.2733:0.7267	.	3166	Q8TE73	DYH5_HUMAN	G	3166	ENSP00000265104:R3166G	ENSP00000265104:R3166G	R	-	1	2	DNAH5	13823967	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.820000	0.48057	0.933000	0.37291	0.533000	0.62120	AGA	.		0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169141427	169141427	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:169141427A>T	ENST00000256935.8	+	19	1987	c.1907A>T	c.(1906-1908)aAg>aTg	p.K636M	DOCK2_ENST00000520908.1_Missense_Mutation_p.K128M|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	636					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AATTTAGAAAAGTTGAAGATT	0.438																																					p.K636M		.											.	DOCK2	97	0			c.A1907T						.						165.0	169.0	168.0					5																	169141427		2203	4300	6503	SO:0001583	missense	1794	exon19			TAGAAAAGTTGAA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1907A>T	5.37:g.169141427A>T	ENSP00000256935:p.Lys636Met	100.0	0.0		385.0	103.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.603877	0.87157	.	.	ENSG00000134516	ENST00000256935;ENST00000520908	T;T	0.22134	1.97;1.97	5.64	5.64	0.86602	.	0.043687	0.85682	D	0.000000	T	0.47488	0.1448	M	0.80746	2.51	0.80722	D	1	D;D;D	0.76494	0.999;0.975;0.998	D;P;P	0.64687	0.928;0.701;0.818	T	0.48525	-0.9028	10	0.46703	T	0.11	.	15.8502	0.78924	1.0:0.0:0.0:0.0	.	128;636;636	E7ERW7;E5RFJ0;Q92608	.;.;DOCK2_HUMAN	M	636;128	ENSP00000256935:K636M;ENSP00000429283:K128M	ENSP00000256935:K636M	K	+	2	0	DOCK2	169074005	1.000000	0.71417	0.960000	0.40013	0.964000	0.63967	9.310000	0.96267	2.144000	0.66660	0.528000	0.53228	AAG	.		0.438	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
DSP	1832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	7585392	7585392	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr6:7585392A>G	ENST00000379802.3	+	24	8238	c.7897A>G	c.(7897-7899)Att>Gtt	p.I2633V	DSP_ENST00000418664.2_Missense_Mutation_p.I2034V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2633	4.5 X 38 AA tandem repeats (Domain C).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GAAAATCTCCATTACAGAAGG	0.522																																					p.I2633V		.											.	DSP	518	0			c.A7897G						.						66.0	72.0	70.0					6																	7585392		2203	4300	6503	SO:0001583	missense	1832	exon24			ATCTCCATTACAG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.7897A>G	6.37:g.7585392A>G	ENSP00000369129:p.Ile2633Val	34.0	0.0		88.0	28.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	A	8.934	0.964183	0.18583	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.70282	-0.47;-0.47	5.8	4.64	0.57946	.	0.000000	0.64402	D	0.000006	T	0.39809	0.1092	L	0.28274	0.84	0.25457	N	0.987954	B;D	0.53745	0.24;0.962	B;P	0.45449	0.087;0.481	T	0.35500	-0.9786	10	0.13108	T	0.6	.	12.0016	0.53235	0.9326:0.0:0.0674:0.0	.	2081;2633	Q4LE79;P15924	.;DESP_HUMAN	V	2633;2034	ENSP00000369129:I2633V;ENSP00000396591:I2034V	ENSP00000369129:I2633V	I	+	1	0	DSP	7530391	0.959000	0.32827	0.449000	0.26957	0.979000	0.70002	2.309000	0.43699	1.025000	0.39708	-0.270000	0.10280	ATT	.		0.522	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
DTX3L	151636	broad.mit.edu;bcgsc.ca	37	3	122287562	122287562	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:122287562A>G	ENST00000296161.4	+	3	815	c.626A>G	c.(625-627)aAg>aGg	p.K209R	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	209			K -> N (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		ACAGAGAGGAAGCCACTCAGT	0.433																																					p.K209R		.											DTX3L,NS,carcinoma,-1	DTX3L	587	0			c.A626G						.						74.0	73.0	73.0					3																	122287562		2203	4300	6503	SO:0001583	missense	151636	exon3			AGAGGAAGCCACT		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.626A>G	3.37:g.122287562A>G	ENSP00000296161:p.Lys209Arg	53.0	0.0		128.0	7.0	NM_138287	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	37	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	A	9.455	1.091489	0.20471	.	.	ENSG00000163840	ENST00000296161	T	0.31510	1.49	5.5	-1.45	0.08828	.	0.391624	0.21694	N	0.070535	T	0.17577	0.0422	L	0.43152	1.355	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.12993	-1.0526	10	0.28530	T	0.3	-0.0463	1.4717	0.02418	0.4466:0.2722:0.1501:0.1312	.	209	Q8TDB6	DTX3L_HUMAN	R	209	ENSP00000296161:K209R	ENSP00000296161:K209R	K	+	2	0	DTX3L	123770252	0.001000	0.12720	0.000000	0.03702	0.088000	0.18126	0.289000	0.18957	-0.377000	0.07930	0.533000	0.62120	AAG	.		0.433	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
EIF4G1	1981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184049265	184049265	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:184049265G>A	ENST00000346169.2	+	30	4537	c.4266G>A	c.(4264-4266)gtG>gtA	p.V1422V	EIF4G1_ENST00000434061.2_Silent_p.V1227V|EIF4G1_ENST00000392537.2_Silent_p.V1335V|EIF4G1_ENST00000342981.4_Silent_p.V1423V|EIF4G1_ENST00000441154.1_Silent_p.V1259V|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000350481.5_Silent_p.V1258V|EIF4G1_ENST00000382330.3_Silent_p.V1429V|EIF4G1_ENST00000427845.1_Silent_p.V1336V|EIF4G1_ENST00000435046.2_Silent_p.V1226V|EIF4G1_ENST00000319274.6_Silent_p.V1422V|EIF4G1_ENST00000414031.1_Silent_p.V1382V|EIF4G1_ENST00000411531.1_Silent_p.V1383V|EIF4G1_ENST00000424196.1_Silent_p.V1429V|EIF4G1_ENST00000352767.3_Silent_p.V1429V	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1422					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGCAGAAGGTGGAGTATACCC	0.557																																					p.V1429V		.											.	EIF4G1	344	0			c.G4287A						.						103.0	120.0	114.0					3																	184049265		2203	4300	6503	SO:0001819	synonymous_variant	1981	exon31			GAAGGTGGAGTAT	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.4266G>A	3.37:g.184049265G>A		28.0	0.0		68.0	28.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Silent	SNP	ENST00000346169.2	37	CCDS3259.1																																																																																			.		0.557	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
EPB41L3	23136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	5433469	5433469	+	Splice_Site	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr18:5433469T>A	ENST00000341928.2	-	8	1251	c.911A>T	c.(910-912)aAg>aTg	p.K304M	EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000342933.3_Splice_Site_p.K304M|EPB41L3_ENST00000544123.1_Splice_Site_p.K304M|EPB41L3_ENST00000540638.2_Splice_Site_p.K304M|EPB41L3_ENST00000400111.3_Splice_Site_p.K304M	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	304	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GATGCATACCTTAGCATGATG	0.318																																					p.K304M		.											.	EPB41L3	95	0			c.A911T						.						146.0	139.0	142.0					18																	5433469		2203	4299	6502	SO:0001630	splice_region_variant	23136	exon8			CATACCTTAGCAT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.912+1A>T	18.37:g.5433469T>A		42.0	0.0		85.0	27.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.293987	0.81025	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91	5.9	5.9	0.94986	FERM domain (1);Pleckstrin homology-type (1);	0.042501	0.85682	D	0.000000	D	0.93936	0.8059	M	0.91818	3.245	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.999;0.999;0.992	D;D;P;D;P	0.81914	0.994;0.951;0.9;0.995;0.8	D	0.95079	0.8211	10	0.87932	D	0	.	16.3076	0.82855	0.0:0.0:0.0:1.0	.	304;304;195;304;304	F5GX05;Q9Y2J2-3;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	M	304;195;304;195;304;304	ENSP00000343158:K304M;ENSP00000441174:K304M;ENSP00000341138:K304M;ENSP00000382981:K304M	ENSP00000343158:K304M	K	-	2	0	EPB41L3	5423469	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.139000	0.64801	2.252000	0.74401	0.533000	0.62120	AAG	.		0.318	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	Missense_Mutation
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144945358	144945358	+	Silent	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:144945358G>T	ENST00000525985.1	-	2	2135	c.2064C>A	c.(2062-2064)gtC>gtA	p.V688V				P58107	EPIPL_HUMAN	epiplakin 1	688						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGTAGCCAGTGACAGCGCGCT	0.627																																					p.V688V		.											.	EPPK1	25	0			c.C2064A						.						46.0	51.0	49.0					8																	144945358		2188	4281	6469	SO:0001819	synonymous_variant	83481	exon1			GCCAGTGACAGCG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.2064C>A	8.37:g.144945358G>T		37.0	0.0		209.0	40.0	NM_031308	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				.		0.627	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
ERC1	23085	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1517402	1517402	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:1517402T>A	ENST00000397203.2	+	17	3419	c.3013T>A	c.(3013-3015)Tcc>Acc	p.S1005T	ERC1_ENST00000546231.2_Missense_Mutation_p.S1009T|ERC1_ENST00000360905.4_Missense_Mutation_p.S1005T|ERC1_ENST00000355446.5_Missense_Mutation_p.S1005T|ERC1_ENST00000589028.1_Missense_Mutation_p.S1005T|ERC1_ENST00000543086.3_Missense_Mutation_p.S977T			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	1005					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TCACAAGCCCTCCCCAGACCA	0.388																																					p.S1005T		.											.	ERC1	660	0			c.T3013A						.						82.0	70.0	74.0					12																	1517402		2203	4300	6503	SO:0001583	missense	23085	exon17			AAGCCCTCCCCAG	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.3013T>A	12.37:g.1517402T>A	ENSP00000380386:p.Ser1005Thr	17.0	0.0		63.0	18.0	NM_178040	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.870894	0.91587	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T	0.34859	1.39;1.59;1.56;1.4;1.65;1.59;1.34	5.93	5.93	0.95920	.	0.062950	0.64402	D	0.000003	T	0.48390	0.1497	L	0.29908	0.895	0.58432	D	0.999999	P;D;D;D	0.61697	0.913;0.99;0.99;0.987	P;D;D;P	0.72982	0.716;0.979;0.979;0.857	T	0.38650	-0.9651	10	0.35671	T	0.21	-8.2394	16.3798	0.83452	0.0:0.0:0.0:1.0	.	713;981;977;1005	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	T	937;1005;981;937;709;977;981;709;1005;1005;1005;981;713	ENSP00000340054:S937T;ENSP00000380386:S1005T;ENSP00000438546:S977T;ENSP00000442976:S709T;ENSP00000347621:S1005T;ENSP00000354158:S1005T;ENSP00000410064:S981T	ENSP00000299183:S709T	S	+	1	0	ERC1	1387663	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.342000	0.79310	2.271000	0.75665	0.533000	0.62120	TCC	T|1.000;C|0.000		0.388	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
ERCC8	1161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	60217888	60217888	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:60217888T>C	ENST00000265038.5	-	3	310	c.268A>G	c.(268-270)Att>Gtt	p.I90V	ERCC8_ENST00000426742.2_Missense_Mutation_p.I32V|AC104113.3_ENST00000457499.1_RNA|ERCC8_ENST00000543101.1_5'UTR	NM_000082.3	NP_000073.1	Q13216	ERCC8_HUMAN	excision repair cross-complementation group 8	90					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|positive regulation of DNA repair (GO:0045739)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|transcription-coupled nucleotide-excision repair (GO:0006283)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|protein complex (GO:0043234)	protein complex binding (GO:0032403)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				TACCTGCCAATGGAACACACT	0.328																																					p.I90V		.											.	ERCC8	227	0			c.A268G						.						84.0	80.0	82.0					5																	60217888		2203	4299	6502	SO:0001583	missense	1161	exon3			TGCCAATGGAACA	U28413	CCDS3978.1	5q12.1	2014-09-17	2014-03-07		ENSG00000049167	ENSG00000049167		"""WD repeat domain containing"""	3439	protein-coding gene	gene with protein product		609412	"""Cockayne syndrome 1 (classical)"", ""excision repair cross-complementing rodent repair deficiency, complementation group 8"""	CKN1		8596535	Standard	NM_000082		Approved	CSA	uc003jsm.3	Q13216	OTTHUMG00000097741	ENST00000265038.5:c.268A>G	5.37:g.60217888T>C	ENSP00000265038:p.Ile90Val	36.0	0.0		59.0	24.0	NM_000082	B2RB64|Q6FHX5|Q96GB9	Missense_Mutation	SNP	ENST00000265038.5	37	CCDS3978.1	.	.	.	.	.	.	.	.	.	.	T	2.841	-0.240564	0.05944	.	.	ENSG00000049167	ENST00000426742;ENST00000265038;ENST00000536596;ENST00000439176	T;T;T	0.70516	-0.49;-0.17;-0.09	5.16	-3.51	0.04696	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.288635	0.38217	N	0.001777	T	0.36853	0.0982	N	0.02665	-0.54	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.45673	-0.9245	10	0.02654	T	1	-27.2961	15.792	0.78372	0.0:0.7793:0.0:0.2207	.	90;90	Q13216-2;Q13216	.;ERCC8_HUMAN	V	32;90;89;32	ENSP00000400110:I32V;ENSP00000265038:I90V;ENSP00000408344:I32V	ENSP00000265038:I90V	I	-	1	0	ERCC8	60253645	0.131000	0.22433	0.943000	0.38184	0.960000	0.62799	0.130000	0.15850	-0.568000	0.06038	-0.280000	0.10049	ATT	.		0.328	ERCC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214971.2	NM_000082	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40424311	40424311	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:40424311G>C	ENST00000221347.6	-	4	1899	c.1892C>G	c.(1891-1893)cCt>cGt	p.P631R		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	631	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACAGCGTCAGGAGCCAGAGC	0.612																																					p.P631R		.											.	FCGBP	98	0			c.C1892G						.						147.0	157.0	154.0					19																	40424311		2203	4300	6503	SO:0001583	missense	8857	exon4			GCGTCAGGAGCCA	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1892C>G	19.37:g.40424311G>C	ENSP00000221347:p.Pro631Arg	44.0	0.0		104.0	40.0	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.273349	0.23221	.	.	ENSG00000090920	ENST00000221347	T	0.18338	2.22	5.21	4.15	0.48705	von Willebrand factor, type D domain (1);	0.835797	0.10227	N	0.700215	T	0.30727	0.0774	L	0.52206	1.635	0.09310	N	1	D	0.63046	0.992	P	0.58520	0.84	T	0.18147	-1.0346	10	0.18710	T	0.47	.	13.821	0.63320	0.0:0.0:0.8454:0.1546	.	631	Q9Y6R7	FCGBP_HUMAN	R	631	ENSP00000221347:P631R	ENSP00000221347:P631R	P	-	2	0	FCGBP	45116151	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	0.779000	0.26746	1.159000	0.42565	0.561000	0.74099	CCT	.		0.612	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FLT4	2324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180047636	180047636	+	Silent	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:180047636G>C	ENST00000261937.6	-	16	2457	c.2379C>G	c.(2377-2379)ctC>ctG	p.L793L	FLT4_ENST00000393347.3_Silent_p.L793L|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000502649.1_Silent_p.L793L	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	793					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGATGAGGAGGAGGAGGACCC	0.597																																					p.L793L	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4	1490	0			c.C2379G						.						107.0	110.0	109.0					5																	180047636		2202	4300	6502	SO:0001819	synonymous_variant	2324	exon16			GAGGAGGAGGAGG	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2379C>G	5.37:g.180047636G>C		47.0	0.0		172.0	64.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	ENST00000261937.6	37	CCDS4457.1																																																																																			.		0.597	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
FMO1	2326	broad.mit.edu;mdanderson.org	37	1	171251160	171251160	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:171251160C>T	ENST00000354841.4	+	6	1002	c.871C>T	c.(871-873)Cgc>Tgc	p.R291C	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000367750.3_Missense_Mutation_p.R291C|FMO1_ENST00000402921.2_Missense_Mutation_p.R228C	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	291					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.R291C(2)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GCTCCCAGGACGCATCATCAC	0.418																																					p.R291C		.											.	FMO1	515	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.C871T						.						75.0	69.0	71.0					1																	171251160		2203	4300	6503	SO:0001583	missense	2326	exon7			CCAGGACGCATCA	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.871C>T	1.37:g.171251160C>T	ENSP00000346901:p.Arg291Cys	39.0	0.0		37.0	7.0	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348608	0.24426	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.55413	0.52;0.52;0.52	5.81	-0.52	0.11935	.	0.108962	0.64402	N	0.000005	T	0.29126	0.0724	L	0.56769	1.78	0.19775	N	0.999951	B;B;B	0.33857	0.429;0.178;0.113	B;B;B	0.39738	0.14;0.308;0.099	T	0.35773	-0.9775	10	0.29301	T	0.29	-6.6858	10.3213	0.43767	0.0:0.4836:0.0:0.5164	.	228;291;291	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	C	291;228;291	ENSP00000356724:R291C;ENSP00000385543:R228C;ENSP00000346901:R291C	ENSP00000346901:R291C	R	+	1	0	FMO1	169517784	0.000000	0.05858	0.933000	0.37362	0.769000	0.43574	-0.086000	0.11233	-0.118000	0.11851	0.555000	0.69702	CGC	.		0.418	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
FOXN1	8456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26851109	26851109	+	Splice_Site	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:26851109G>T	ENST00000226247.2	+	1	151	c.122G>T	c.(121-123)aGt>aTt	p.S41I	FOXN1_ENST00000579795.1_Splice_Site_p.S41I	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	41					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GCCCCACAGAGTGTAAGTACC	0.682																																					p.S41I		.											.	FOXN1	226	0			c.G122T						.						10.0	10.0	10.0					17																	26851109		2192	4284	6476	SO:0001630	splice_region_variant	8456	exon1			CACAGAGTGTAAG	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.123+1G>T	17.37:g.26851109G>T		37.0	0.0		78.0	34.0	NM_003593	B2R9Q7|O15352	Missense_Mutation	SNP	ENST00000226247.2	37	CCDS11232.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268947	0.40095	.	.	ENSG00000109101	ENST00000226247	D	0.93133	-3.17	5.03	0.129	0.14739	.	0.431911	0.24229	N	0.040373	D	0.85080	0.5615	N	0.19112	0.55	0.24096	N	0.99589	B	0.29085	0.232	B	0.28709	0.093	T	0.76250	-0.3028	10	0.66056	D	0.02	.	7.9671	0.30104	0.3666:0.0:0.6334:0.0	.	41	O15353	FOXN1_HUMAN	I	41	ENSP00000226247:S41I	ENSP00000226247:S41I	S	+	2	0	FOXN1	23875236	0.037000	0.19845	0.969000	0.41365	0.619000	0.37552	-0.171000	0.09883	-0.133000	0.11537	0.561000	0.74099	AGT	.		0.682	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		Missense_Mutation
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39265478	39265478	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr13:39265478G>C	ENST00000280481.7	+	1	4213	c.3997G>C	c.(3997-3999)Gat>Cat	p.D1333H		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1333					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1333Y(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AACAGATTTAGATTCAGAAGA	0.353																																					p.D1333H		.											.	FREM2	100	1	Substitution - Missense(1)	large_intestine(1)	c.G3997C						.						76.0	80.0	79.0					13																	39265478		2203	4300	6503	SO:0001583	missense	341640	exon1			GATTTAGATTCAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3997G>C	13.37:g.39265478G>C	ENSP00000280481:p.Asp1333His	64.0	0.0		73.0	42.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781469	0.70222	.	.	ENSG00000150893	ENST00000280481	T	0.74106	-0.81	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.92047	0.7480	H	0.97611	4.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93768	0.7072	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	1333	Q5SZK8	FREM2_HUMAN	H	1333	ENSP00000280481:D1333H	ENSP00000280481:D1333H	D	+	1	0	FREM2	38163478	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.864000	0.99589	2.894000	0.99253	0.655000	0.94253	GAT	.		0.353	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FZR1	51343	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	3527733	3527733	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:3527733T>G	ENST00000395095.3	+	6	575	c.575T>G	c.(574-576)cTg>cGg	p.L192R	FZR1_ENST00000313639.8_Intron|FZR1_ENST00000441788.2_Missense_Mutation_p.L192R	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	192					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TACCTCAATCTGGTGGACTGG	0.632																																					p.L192R		.											.	FZR1	227	0			c.T575G						.						135.0	110.0	119.0					19																	3527733		2202	4298	6500	SO:0001583	missense	51343	exon6			TCAATCTGGTGGA	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.575T>G	19.37:g.3527733T>G	ENSP00000378529:p.Leu192Arg	50.0	0.0		160.0	47.0	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.646422	0.87958	.	.	ENSG00000105325	ENST00000441788;ENST00000395095	T;T	0.28895	1.59;1.59	5.14	5.14	0.70334	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.65186	0.2667	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.75434	-0.3319	10	0.87932	D	0	-23.8474	13.811	0.63264	0.0:0.0:0.0:1.0	.	192;192	Q9UM11;Q9UM11-2	FZR_HUMAN;.	R	192	ENSP00000410369:L192R;ENSP00000378529:L192R	ENSP00000378529:L192R	L	+	2	0	FZR1	3478733	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.798000	0.85924	1.943000	0.56356	0.533000	0.62120	CTG	.		0.632	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
GIT2	9815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110385195	110385195	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:110385195T>C	ENST00000355312.3	-	15	1506	c.1507A>G	c.(1507-1509)Aga>Gga	p.R503G	GIT2_ENST00000547815.1_3'UTR|GIT2_ENST00000553118.1_Intron|GIT2_ENST00000356259.4_Intron|GIT2_ENST00000360185.4_Missense_Mutation_p.R453G|GIT2_ENST00000457474.2_Missense_Mutation_p.R455G|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000343646.5_Missense_Mutation_p.R423G|GIT2_ENST00000338373.5_Intron|GIT2_ENST00000551209.1_Missense_Mutation_p.R452G|GIT2_ENST00000361006.5_Missense_Mutation_p.R503G|GIT2_ENST00000354574.4_Missense_Mutation_p.R455G	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	503					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						GACGGACGTCTCTTTAAGGAA	0.522																																					p.R503G		.											.	GIT2	226	0			c.A1507G						.						122.0	109.0	113.0					12																	110385195		2203	4300	6503	SO:0001583	missense	9815	exon15			GACGTCTCTTTAA	AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.1507A>G	12.37:g.110385195T>C	ENSP00000347464:p.Arg503Gly	88.0	0.0		282.0	98.0	NM_001135214	Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Missense_Mutation	SNP	ENST00000355312.3	37	CCDS9138.1	.	.	.	.	.	.	.	.	.	.	T	10.77	1.444315	0.25987	.	.	ENSG00000139436	ENST00000355312;ENST00000360185;ENST00000354574;ENST00000343646;ENST00000457474;ENST00000361006;ENST00000551209;ENST00000542273	T;T;T;T;T;T;T	0.78126	-0.66;-0.74;-1.15;-0.85;-1.12;-0.66;-0.77	5.97	3.04	0.35103	.	0.000000	0.85682	D	0.000000	T	0.70736	0.3258	L	0.48642	1.525	0.80722	D	1	B;B;B;B;B	0.10296	0.003;0.003;0.0;0.002;0.0	B;B;B;B;B	0.10450	0.005;0.005;0.001;0.001;0.003	T	0.62320	-0.6879	10	0.31617	T	0.26	.	14.1029	0.65068	0.0:0.0:0.4562:0.5438	.	455;455;503;441;503	Q14161-10;F8WAK2;Q14161;B4E027;Q14161-5	.;.;GIT2_HUMAN;.;.	G	503;453;455;423;455;503;452;441	ENSP00000347464:R503G;ENSP00000353312:R453G;ENSP00000346585:R455G;ENSP00000340938:R423G;ENSP00000391813:R455G;ENSP00000354282:R503G;ENSP00000448832:R452G	ENSP00000340938:R423G	R	-	1	2	GIT2	108869578	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.150000	0.42254	0.361000	0.24292	-0.460000	0.05396	AGA	.		0.522	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403407.1	NM_057169	
GPR110	266977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46976681	46976681	+	Splice_Site	SNP	C	C	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr6:46976681C>G	ENST00000371253.2	-	11	2705	c.2490G>C	c.(2488-2490)caG>caC	p.Q830H	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Splice_Site_p.Q633H	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	830					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						CTGTTCTCACCTGGAATGCAT	0.443																																					p.Q830H		.											.	GPR110	71	0			c.G2490C						.						50.0	55.0	54.0					6																	46976681		2203	4300	6503	SO:0001630	splice_region_variant	266977	exon11			TCTCACCTGGAAT	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2490+1G>C	6.37:g.46976681C>G		81.0	0.0		171.0	60.0	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	37	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412312	0.83340	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	T;T	0.60424	0.19;0.19	5.9	5.9	0.94986	GPCR, family 2-like (1);	0.000000	0.56097	D	0.000025	T	0.80347	0.4606	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82837	-0.0260	9	.	.	.	-16.5137	20.2789	0.98501	0.0:1.0:0.0:0.0	.	830	Q5T601	GP110_HUMAN	H	830;633	ENSP00000360299:Q830H;ENSP00000283297:Q633H	.	Q	-	3	2	GPR110	47084640	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.852000	0.69488	2.788000	0.95919	0.650000	0.86243	CAG	.		0.443	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	Missense_Mutation
HDHD1	8226	broad.mit.edu;bcgsc.ca	37	X	7035008	7035008	+	Intron	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:7035008C>T	ENST00000381077.5	-	2	138				HDHD1_ENST00000498474.2_Intron|HDHD1_ENST00000412827.2_Intron|HDHD1_ENST00000540122.1_Intron|HDHD1_ENST00000424830.2_Splice_Site_p.T43T	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1						nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						cctgcttacccgtccaccgtg	0.507																																					p.T43T		.											.	HDHD1	130	0			c.G129A						.						117.0	98.0	104.0					X																	7035008		692	1590	2282	SO:0001627	intron_variant	8226	exon2			CTTACCCGTCCAC	M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.62-11129G>A	X.37:g.7035008C>T		31.0	0.0		105.0	5.0	NM_001135565	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Silent	SNP	ENST00000381077.5	37	CCDS48075.1																																																																																			.		0.507	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055683.2	NM_012080	
HECW2	57520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197084796	197084796	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr2:197084796T>C	ENST00000260983.3	-	26	4557	c.4375A>G	c.(4375-4377)Agt>Ggt	p.S1459G	HECW2_ENST00000409111.1_Missense_Mutation_p.S1103G	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1459	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CTCCAATCACTTAGGTCTATT	0.393																																					p.S1459G		.											.	HECW2	668	0			c.A4375G						.						130.0	127.0	128.0					2																	197084796		2203	4300	6503	SO:0001583	missense	57520	exon26			AATCACTTAGGTC	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4375A>G	2.37:g.197084796T>C	ENSP00000260983:p.Ser1459Gly	56.0	0.0		120.0	38.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	T	13.05	2.121861	0.37436	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.42513	0.97;0.97	5.25	5.25	0.73442	HECT (4);	0.203518	0.53938	D	0.000053	T	0.36303	0.0962	L	0.37800	1.135	0.28399	N	0.918746	B	0.12013	0.005	B	0.10450	0.005	T	0.33445	-0.9868	10	0.56958	D	0.05	.	15.3174	0.74092	0.0:0.0:0.0:1.0	.	1459	Q9P2P5	HECW2_HUMAN	G	1103;1459	ENSP00000386775:S1103G;ENSP00000260983:S1459G	ENSP00000260983:S1459G	S	-	1	0	HECW2	196793041	0.897000	0.30589	0.989000	0.46669	0.991000	0.79684	1.394000	0.34509	2.199000	0.70637	0.533000	0.62120	AGT	.		0.393	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
HGSNAT	138050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	43033222	43033222	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:43033222T>A	ENST00000458501.2	+	10	941	c.941T>A	c.(940-942)gTa>gAa	p.V314E	HGSNAT_ENST00000521576.1_5'Flank|HGSNAT_ENST00000297798.7_5'Flank|HGSNAT_ENST00000379644.4_Missense_Mutation_p.V286E			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	314					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TTTAGGTTTGTATTTATTATG	0.333																																					p.V286E		.											.	HGSNAT	68	0			c.T857A						.						115.0	116.0	116.0					8																	43033222		1792	4062	5854	SO:0001583	missense	138050	exon10			GGTTTGTATTTAT		CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.941T>A	8.37:g.43033222T>A	ENSP00000389524:p.Val314Glu	114.0	0.0		197.0	110.0	NM_152419	B4E2V0	Missense_Mutation	SNP	ENST00000458501.2	37		.	.	.	.	.	.	.	.	.	.	T	22.2	4.255759	0.80135	.	.	ENSG00000165102	ENST00000458501;ENST00000379644;ENST00000522082	D;D;D	0.91068	-2.78;-2.78;-1.89	5.68	5.68	0.88126	.	0.144593	0.46442	D	0.000287	D	0.95204	0.8445	M	0.85373	2.75	0.80722	D	1	D	0.63880	0.993	D	0.65573	0.936	D	0.95751	0.8792	10	0.87932	D	0	-10.7461	13.9256	0.63961	0.0:0.0:0.0:1.0	.	314	Q68CP4	HGNAT_HUMAN	E	314;286;33	ENSP00000389524:V314E;ENSP00000368965:V286E;ENSP00000430151:V33E	ENSP00000368965:V286E	V	+	2	0	HGSNAT	43152379	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	6.332000	0.72934	2.179000	0.69175	0.529000	0.55759	GTA	.		0.333	HGSNAT-202	KNOWN	basic	protein_coding	protein_coding		XM_372038	
HIRA	7290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19376069	19376069	+	Silent	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr22:19376069A>G	ENST00000263208.5	-	10	1201	c.945T>C	c.(943-945)tgT>tgC	p.C315C	HIRA_ENST00000546308.1_Silent_p.C271C|HIRA_ENST00000541063.1_Silent_p.C271C|HIRA_ENST00000340170.4_Silent_p.C315C	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	315					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GCCGTTTCAGACATGTGAGCT	0.423																																					p.C315C		.											.	HIRA	91	0			c.T945C						.						65.0	63.0	64.0					22																	19376069		2203	4300	6503	SO:0001819	synonymous_variant	7290	exon10			TTTCAGACATGTG	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.945T>C	22.37:g.19376069A>G		41.0	0.0		100.0	41.0	NM_003325	Q05BU9|Q8IXN2	Silent	SNP	ENST00000263208.5	37	CCDS13759.1																																																																																			.		0.423	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
HMGXB4	10042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	35661228	35661228	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr22:35661228G>A	ENST00000216106.5	+	5	975	c.847G>A	c.(847-849)Gat>Aat	p.D283N	HMGXB4_ENST00000444518.2_Missense_Mutation_p.D174N	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	283					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGCTAACCTTGATCTTTCAGG	0.502																																					p.D283N		.											.	HMGXB4	272	0			c.G847A						.						80.0	77.0	78.0					22																	35661228		2203	4300	6503	SO:0001583	missense	10042	exon5			AACCTTGATCTTT	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.847G>A	22.37:g.35661228G>A	ENSP00000216106:p.Asp283Asn	72.0	0.0		228.0	72.0	NM_001003681	O75672|O75673|Q9UMT5	Missense_Mutation	SNP	ENST00000216106.5	37	CCDS33641.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020395	0.54576	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.47869	0.83;2.18;0.83;2.18	5.71	5.71	0.89125	.	0.230253	0.44688	D	0.000430	T	0.35068	0.0919	N	0.14661	0.345	0.37220	D	0.905208	B	0.30482	0.281	B	0.27796	0.083	T	0.40213	-0.9575	10	0.72032	D	0.01	-10.556	18.4046	0.90529	0.0:0.0:1.0:0.0	.	283	Q9UGU5	HMGX4_HUMAN	N	174;174;174;283	ENSP00000401658:D174N;ENSP00000398302:D174N;ENSP00000415500:D174N;ENSP00000216106:D283N	ENSP00000216106:D283N	D	+	1	0	HMGXB4	33991228	0.998000	0.40836	0.266000	0.24541	0.927000	0.56198	4.208000	0.58486	2.861000	0.98227	0.650000	0.86243	GAT	.		0.502	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
HYAL4	23553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123517143	123517143	+	Silent	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr7:123517143T>A	ENST00000223026.4	+	5	2018	c.1380T>A	c.(1378-1380)ccT>ccA	p.P460P	HYAL4_ENST00000476325.1_Silent_p.P460P	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	460					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						GGGTTTCCCCTTCTCCTGGTT	0.428																																					p.P460P		.											.	HYAL4	91	0			c.T1380A						.						108.0	110.0	109.0					7																	123517143		2203	4300	6503	SO:0001819	synonymous_variant	23553	exon5			TTCCCCTTCTCCT	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.1380T>A	7.37:g.123517143T>A		106.0	0.0		302.0	112.0	NM_012269	D0VXG1|Q9UL99|Q9Y6T9	Silent	SNP	ENST00000223026.4	37	CCDS5789.1																																																																																			.		0.428	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269	
INTS7	25896	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	212184718	212184718	+	Splice_Site	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:212184718T>C	ENST00000366994.3	-	5	659	c.555A>G	c.(553-555)caA>caG	p.Q185Q	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000440600.2_Splice_Site_p.Q136Q|INTS7_ENST00000366992.3_Splice_Site_p.Q185Q|INTS7_ENST00000366993.3_Splice_Site_p.Q185Q	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	185					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		AATACATACCTTGAATCATTT	0.274																																					p.Q185Q		.											.	INTS7	90	0			c.A555G						.						46.0	47.0	47.0					1																	212184718		2201	4296	6497	SO:0001630	splice_region_variant	25896	exon5			CATACCTTGAATC	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.556+1A>G	1.37:g.212184718T>C		153.0	0.0		559.0	39.0	NM_015434	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Silent	SNP	ENST00000366994.3	37	CCDS1501.1																																																																																			.		0.274	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	Silent
KIF4B	285643	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	154396242	154396242	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:154396242C>G	ENST00000435029.4	+	1	2983	c.2823C>G	c.(2821-2823)agC>agG	p.S941R		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	941	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGCAGGAAAGCCAAATGGCAG	0.473																																					p.S941R		.											.	KIF4B	1	0			c.C2823G						.						87.0	83.0	85.0					5																	154396242		2203	4300	6503	SO:0001583	missense	285643	exon1			GGAAAGCCAAATG	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2823C>G	5.37:g.154396242C>G	ENSP00000387875:p.Ser941Arg	103.0	1.0		484.0	86.0	NM_001099293		Missense_Mutation	SNP	ENST00000435029.4	37	CCDS47324.1	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.876482	0.00537	.	.	ENSG00000226650	ENST00000435029	T	0.67523	-0.27	1.76	0.825	0.18824	.	.	.	.	.	T	0.49541	0.1563	L	0.34521	1.04	0.28566	N	0.910855	B	0.02656	0.0	B	0.01281	0.0	T	0.37911	-0.9685	9	0.34782	T	0.22	.	5.2265	0.15397	0.3419:0.6581:0.0:0.0	.	941	Q2VIQ3	KIF4B_HUMAN	R	941	ENSP00000387875:S941R	ENSP00000387875:S941R	S	+	3	2	KIF4B	154376435	0.891000	0.30450	0.993000	0.49108	0.097000	0.18754	0.460000	0.21924	0.274000	0.22072	-0.319000	0.08680	AGC	.		0.473	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	135025348	135025348	+	Missense_Mutation	SNP	G	G	T	rs201175312		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr10:135025348G>T	ENST00000304613.3	+	23	4243	c.4222G>T	c.(4222-4224)Ggc>Tgc	p.G1408C	KNDC1_ENST00000368572.2_Missense_Mutation_p.G1410C			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1408					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CTCAGAGGACGGCATCTCCAG	0.642																																					p.G1408C		.											.	KNDC1	229	0			c.G4222T						.						44.0	40.0	42.0					10																	135025348		2203	4299	6502	SO:0001583	missense	85442	exon23			GAGGACGGCATCT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4222G>T	10.37:g.135025348G>T	ENSP00000304437:p.Gly1408Cys	11.0	0.0		36.0	21.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950229	0.34377	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.13196	2.61;2.61	3.34	1.4	0.22301	Ras guanine nucleotide exchange factor, domain (1);	1.090190	0.07095	U	0.839449	T	0.07683	0.0193	N	0.24115	0.695	0.27204	N	0.9601	P	0.35844	0.524	B	0.25140	0.058	T	0.31194	-0.9952	10	0.45353	T	0.12	-13.6231	4.7291	0.12955	0.4066:0.0:0.5934:0.0	.	1408	Q76NI1	VKIND_HUMAN	C	1408;1410	ENSP00000304437:G1408C;ENSP00000357561:G1410C	ENSP00000304437:G1408C	G	+	1	0	KNDC1	134875338	0.030000	0.19436	0.985000	0.45067	0.442000	0.32017	0.212000	0.17497	0.702000	0.31825	0.282000	0.19409	GGC	G|0.999;A|0.001		0.642	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KRT75	9119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	52826871	52826871	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:52826871C>A	ENST00000252245.5	-	2	884	c.664G>T	c.(664-666)Gaa>Taa	p.E222*		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	222	Coil 1B.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		AGTTCAGCTTCAAGCCTGCCC	0.537																																					p.E222X		.											.	KRT75	90	0			c.G664T						.						119.0	108.0	111.0					12																	52826871		2203	4300	6503	SO:0001587	stop_gained	9119	exon2			CAGCTTCAAGCCT	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.664G>T	12.37:g.52826871C>A	ENSP00000252245:p.Glu222*	53.0	0.0		192.0	83.0	NM_004693	B4DQU4|Q9NSA9	Nonsense_Mutation	SNP	ENST00000252245.5	37	CCDS8827.1	.	.	.	.	.	.	.	.	.	.	C	38	7.121599	0.98077	.	.	ENSG00000170454	ENST00000252245	.	.	.	5.77	5.77	0.91146	.	0.111882	0.38897	N	0.001521	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	16.252	0.82491	0.0:0.8675:0.1325:0.0	.	.	.	.	X	222	.	ENSP00000252245:E222X	E	-	1	0	KRT75	51113138	0.246000	0.23909	0.482000	0.27366	0.854000	0.48673	2.126000	0.42026	2.723000	0.93209	0.655000	0.94253	GAA	.		0.537	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693	
KRTAP13-2	337959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	31744410	31744410	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr21:31744410C>A	ENST00000399889.2	-	1	147	c.122G>T	c.(121-123)tGc>tTc	p.C41F		NM_181621.3	NP_853652.1	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	41						intermediate filament (GO:0005882)				endometrium(1)|kidney(1)|lung(14)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	21						GCTGGGAGAGCAGAGGTCAGT	0.597																																					p.C41F		.											.	KRTAP13-2	90	0			c.G122T						.						86.0	82.0	83.0					21																	31744410		2203	4300	6503	SO:0001583	missense	337959	exon1			GGAGAGCAGAGGT	AP001708	CCDS13589.1	21q22.1	2011-02-10			ENSG00000182816	ENSG00000182816		"""Keratin associated proteins"""	18923	protein-coding gene	gene with protein product						12359730	Standard	NM_181621		Approved	KAP13-2	uc002ynz.4	Q52LG2	OTTHUMG00000057793	ENST00000399889.2:c.122G>T	21.37:g.31744410C>A	ENSP00000382777:p.Cys41Phe	79.0	0.0		225.0	76.0	NM_181621		Missense_Mutation	SNP	ENST00000399889.2	37	CCDS13589.1	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181048	0.38511	.	.	ENSG00000182816	ENST00000399889	T	0.04454	3.62	4.51	2.16	0.27623	.	1.394900	0.05165	N	0.498547	T	0.16428	0.0395	M	0.72118	2.19	0.09310	N	1	P	0.48911	0.917	P	0.56700	0.804	T	0.14117	-1.0484	10	0.72032	D	0.01	.	7.6607	0.28402	0.0:0.816:0.0:0.184	.	41	Q52LG2	KR132_HUMAN	F	41	ENSP00000382777:C41F	ENSP00000382777:C41F	C	-	2	0	KRTAP13-2	30666281	0.000000	0.05858	0.001000	0.08648	0.979000	0.70002	-0.339000	0.07832	0.305000	0.22832	0.655000	0.94253	TGC	.		0.597	KRTAP13-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128245.1		
KRTAP4-3	85290	broad.mit.edu;bcgsc.ca	37	17	39324104	39324104	+	Silent	SNP	A	A	G	rs368619075		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:39324104A>G	ENST00000391356.2	-	1	320	c.321T>C	c.(319-321)tcT>tcC	p.S107S		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	107	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].		Missing (in allele KAP3-v2). {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.S107S(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGCAGCAACTAGAAATGCAGC	0.597																																					p.S107S		.											.	KRTAP4-3	22	1	Substitution - coding silent(1)	large_intestine(1)	c.T321C						.						18.0	23.0	21.0					17																	39324104		2109	4252	6361	SO:0001819	synonymous_variant	85290	exon1			GCAACTAGAAATG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.321T>C	17.37:g.39324104A>G		91.0	0.0		310.0	26.0	NM_033187		Silent	SNP	ENST00000391356.2	37	CCDS42331.1																																																																																			.		0.597	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
KRTAP5-10	387273	hgsc.bcm.edu;bcgsc.ca	37	11	71276918	71276918	+	Silent	SNP	C	C	T	rs375555617		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:71276918C>T	ENST00000398531.1	+	1	310	c.285C>T	c.(283-285)ggC>ggT	p.G95G	KRTAP5-10_ENST00000376536.4_Intron	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	95	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G95G(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						GGGGCTGTGGCTCCTGTGGGG	0.687																																					p.G95G		.											.	KRTAP5-10	91	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C285T						.	C		161,4009		0,161,1924	35.0	55.0	48.0		285	-0.0	0.2	11		48	119,8289		0,119,4085	no	coding-synonymous	KRTAP5-10	NM_001012710.1		0,280,6009	TT,TC,CC		1.4153,3.8609,2.2261		95/203	71276918	280,12298	2085	4204	6289	SO:0001819	synonymous_variant	387273	exon1			CTGTGGCTCCTGT	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.285C>T	11.37:g.71276918C>T		39.0	0.0		158.0	40.0	NM_001012710	B9EHA4	Silent	SNP	ENST00000398531.1	37	CCDS41684.1																																																																																			.		0.687	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
LEO1	123169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52251010	52251010	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr15:52251010G>T	ENST00000299601.5	-	6	1234	c.1174C>A	c.(1174-1176)Cag>Aag	p.Q392K	LEO1_ENST00000315141.5_Intron	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	392					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TCATAATACTGAGGATCAAAA	0.269																																					p.Q392K	Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	.											.	LEO1	68	0			c.C1174A						.						77.0	76.0	76.0					15																	52251010		2194	4288	6482	SO:0001583	missense	123169	exon6			AATACTGAGGATC	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1174C>A	15.37:g.52251010G>T	ENSP00000299601:p.Gln392Lys	101.0	0.0		280.0	101.0	NM_138792	Q96N99	Missense_Mutation	SNP	ENST00000299601.5	37	CCDS10146.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433155	0.62844	.	.	ENSG00000166477	ENST00000299601;ENST00000538386	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.42966	0.1226	N	0.13168	0.305	0.80722	D	1	B	0.27910	0.193	B	0.27715	0.082	T	0.28522	-1.0041	9	0.18710	T	0.47	.	19.1406	0.93445	0.0:0.0:1.0:0.0	.	392	Q8WVC0	LEO1_HUMAN	K	392;370	.	ENSP00000299601:Q392K	Q	-	1	0	LEO1	50038302	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	9.602000	0.98312	2.619000	0.88677	0.557000	0.71058	CAG	.		0.269	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2	NM_138792	
LILRB1	10859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55148212	55148212	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:55148212G>A	ENST00000396331.1	+	16	2193	c.1836G>A	c.(1834-1836)gtG>gtA	p.V612V	LILRB1_ENST00000396327.3_Silent_p.V613V|LILRB1_ENST00000396321.2_Silent_p.V612V|LILRB1_ENST00000324602.7_Silent_p.V614V|LILRB1_ENST00000434867.2_Silent_p.V612V|LILRB1_ENST00000396315.1_Silent_p.V614V|LILRB1_ENST00000418536.2_Silent_p.V596V|LILRB1_ENST00000396332.4_Silent_p.V613V|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396317.1_Silent_p.V596V|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000427581.2_Silent_p.V663V	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	612					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCCAGGATGTGACCTACGCCC	0.657										HNSCC(37;0.09)																											p.V614V		.											.	LILRB1	137	0			c.G1842A						.						73.0	66.0	68.0					19																	55148212		2203	4300	6503	SO:0001819	synonymous_variant	10859	exon15			GGATGTGACCTAC	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1836G>A	19.37:g.55148212G>A		119.0	0.0		385.0	105.0	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.		0.657	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
LPAR4	2846	ucsc.edu;bcgsc.ca	37	X	78011334	78011334	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:78011334A>T	ENST00000435339.3	+	2	1354	c.968A>T	c.(967-969)tAc>tTc	p.Y323F		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	323					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						AAGTCCTTCTACATCAATGCC	0.428																																					p.Y323F		.											.	LPAR4	133	0			c.A968T						.						179.0	153.0	162.0					X																	78011334		2203	4299	6502	SO:0001583	missense	2846	exon2			CCTTCTACATCAA	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.968A>T	X.37:g.78011334A>T	ENSP00000408205:p.Tyr323Phe	50.0	0.0		40.0	4.0	NM_005296	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	A	2.851	-0.238200	0.05944	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.36699	1.24;1.24	4.26	4.26	0.50523	.	0.333726	0.25189	N	0.032464	T	0.16727	0.0402	N	0.08118	0	0.24340	N	0.994966	B	0.29232	0.238	B	0.25614	0.062	T	0.15954	-1.0419	10	0.10902	T	0.67	.	11.4425	0.50105	1.0:0.0:0.0:0.0	.	323	Q99677	LPAR4_HUMAN	F	323	ENSP00000408205:Y323F;ENSP00000362398:Y323F	ENSP00000362398:Y323F	Y	+	2	0	LPAR4	77897990	1.000000	0.71417	0.991000	0.47740	0.016000	0.09150	3.883000	0.56168	1.575000	0.49775	0.345000	0.21793	TAC	.		0.428	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296	
LRRC18	474354	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	50122143	50122143	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr10:50122143T>C	ENST00000374160.3	-	1	134	c.58A>G	c.(58-60)Aat>Gat	p.N20D	WDFY4_ENST00000325239.5_Intron|WDFY4_ENST00000413659.2_Intron|RP11-523O18.7_ENST00000430438.1_RNA|LRRC18_ENST00000298124.3_Missense_Mutation_p.N20D	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	20						cytoplasm (GO:0005737)				NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TTGATGCAATTCCTGGCCACC	0.448																																					p.N20D		.											.	LRRC18	92	0			c.A58G						.						74.0	68.0	70.0					10																	50122143		2203	4300	6503	SO:0001583	missense	474354	exon1			TGCAATTCCTGGC	AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.58A>G	10.37:g.50122143T>C	ENSP00000363275:p.Asn20Asp	37.0	0.0		53.0	21.0	NM_001006939	Q6UY02	Missense_Mutation	SNP	ENST00000374160.3	37	CCDS31197.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.057109	0.76074	.	.	ENSG00000165383	ENST00000374160;ENST00000298124	T;T	0.59083	0.47;0.29	6.06	6.06	0.98353	.	0.101514	0.64402	D	0.000001	T	0.60573	0.2279	M	0.76002	2.32	0.50632	D	0.999882	P	0.47106	0.89	B	0.40901	0.343	T	0.64757	-0.6332	9	.	.	.	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	20	Q8N456	LRC18_HUMAN	D	20	ENSP00000363275:N20D;ENSP00000298124:N20D	.	N	-	1	0	LRRC18	49792149	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.105000	0.57797	2.323000	0.78572	0.528000	0.53228	AAT	.		0.448	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939	
LTBP3	4054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65320914	65320914	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:65320914T>G	ENST00000301873.5	-	4	1220	c.952A>C	c.(952-954)Aag>Cag	p.K318Q	LTBP3_ENST00000322147.4_Missense_Mutation_p.K318Q|LTBP3_ENST00000536982.1_Intron	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	318	TB 1.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						TGGGGACACTTGTGGCACTTG	0.667																																					p.K318Q		.											.	LTBP3	91	0			c.A952C						.						28.0	30.0	29.0					11																	65320914		2194	4291	6485	SO:0001583	missense	4054	exon4			GACACTTGTGGCA	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.952A>C	11.37:g.65320914T>G	ENSP00000301873:p.Lys318Gln	48.0	0.0		160.0	66.0	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756048	0.69648	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000530866;ENST00000530426	D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11	4.8	4.8	0.61643	Matrix fibril-associated (3);TGF-beta binding (1);	0.059831	0.64402	D	0.000005	D	0.91613	0.7350	L	0.28115	0.83	0.80722	D	1	D;P;D;P	0.76494	0.999;0.775;0.999;0.778	D;B;D;B	0.87578	0.998;0.306;0.998;0.262	D	0.88261	0.2923	10	0.13853	T	0.58	.	12.3307	0.55038	0.0:0.0:0.0:1.0	.	229;201;318;318	E9PKW1;B9EG76;Q9NS15;Q9NS15-2	.;.;LTBP3_HUMAN;.	Q	318;318;229;39	ENSP00000326647:K318Q;ENSP00000301873:K318Q;ENSP00000435276:K229Q;ENSP00000432476:K39Q	ENSP00000301873:K318Q	K	-	1	0	LTBP3	65077490	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.182000	0.50910	2.022000	0.59522	0.413000	0.27773	AAG	.		0.667	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
MAP2K4	6416	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	12016635	12016636	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:12016635_12016636delTA	ENST00000353533.5	+	7	834_835	c.771_772delTA	c.(769-774)tctattfs	p.I258fs	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Frame_Shift_Del_p.I269fs	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	258	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TTGTGGACTCTATTGCCAAGAC	0.45			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.257_258del		.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4	3134	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)	c.771_772del						.																																			SO:0001589	frameshift_variant	6416	exon7			GGACTCTATTGCC	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.771_772delTA	17.37:g.12016635_12016636delTA	ENSP00000262445:p.Ile258fs	50.0	0.0		71.0	37.0	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Frame_Shift_Del	DEL	ENST00000353533.5	37	CCDS11162.1																																																																																			.		0.450	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
MAP4K2	5871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64564456	64564456	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:64564456G>T	ENST00000294066.2	-	20	1496	c.1405C>A	c.(1405-1407)Cat>Aat	p.H469N	MAP4K2_ENST00000377350.3_Missense_Mutation_p.H461N	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	469					activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						ACACTTACATGCACCTTGGGA	0.652																																					p.H469N		.											.	MAP4K2	360	0			c.C1405A						.						75.0	71.0	72.0					11																	64564456		2201	4297	6498	SO:0001583	missense	5871	exon20			TTACATGCACCTT	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1405C>A	11.37:g.64564456G>T	ENSP00000294066:p.His469Asn	53.0	0.0		130.0	57.0	NM_004579	Q86VU3	Missense_Mutation	SNP	ENST00000294066.2	37	CCDS8082.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278474	0.59758	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.70516	-0.49;-0.49	4.51	4.51	0.55191	.	0.610916	0.16303	N	0.220371	T	0.62600	0.2441	L	0.46157	1.445	0.40163	D	0.977082	D;D	0.53885	0.963;0.963	B;B	0.41036	0.346;0.346	T	0.62163	-0.6912	10	0.25106	T	0.35	.	13.1403	0.59430	0.0:0.0:1.0:0.0	.	461;469	Q86VU3;Q12851	.;M4K2_HUMAN	N	469;461	ENSP00000294066:H469N;ENSP00000366567:H461N	ENSP00000294066:H469N	H	-	1	0	MAP4K2	64321032	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.092000	0.64511	2.247000	0.74100	0.558000	0.71614	CAT	.		0.652	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	6296583	6296583	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:6296583G>A	ENST00000344683.5	+	6	622	c.546G>A	c.(544-546)gaG>gaA	p.E182E	MCPH1_ENST00000522905.1_Intron|MCPH1_ENST00000519480.1_Silent_p.E182E	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	182					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GATTACAAGAGATGAAGGAGA	0.338																																					p.E182E	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1	229	0			c.G546A						.						86.0	79.0	81.0					8																	6296583		1871	4104	5975	SO:0001819	synonymous_variant	79648	exon6			ACAAGAGATGAAG	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.546G>A	8.37:g.6296583G>A		36.0	0.0		95.0	28.0	NM_001172574	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	37	CCDS43689.1																																																																																			.		0.338	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
METTL21C	196541	broad.mit.edu;bcgsc.ca	37	13	103339359	103339359	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr13:103339359A>G	ENST00000267273.6	-	3	336	c.331T>C	c.(331-333)Ttc>Ctc	p.F111L		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	111					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						GCATCTTGGAAATTCAATTCC	0.388																																					p.F111L		.											.	METTL21C	90	0			c.T331C						.						81.0	76.0	78.0					13																	103339359		2203	4300	6503	SO:0001583	missense	196541	exon3			CTTGGAAATTCAA		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.331T>C	13.37:g.103339359A>G	ENSP00000267273:p.Phe111Leu	46.0	0.0		78.0	7.0	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	37	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	A	2.034	-0.421775	0.04734	.	.	ENSG00000139780	ENST00000267273	T	0.38722	1.12	5.96	1.26	0.21427	.	0.322040	0.34507	N	0.003905	T	0.15219	0.0367	N	0.03084	-0.415	0.30901	N	0.729231	B	0.02656	0.0	B	0.04013	0.001	T	0.35500	-0.9786	10	0.02654	T	1	0.0557	10.3763	0.44083	0.3229:0.0:0.6771:0.0	.	111	Q5VZV1	MT21C_HUMAN	L	111	ENSP00000267273:F111L	ENSP00000267273:F111L	F	-	1	0	METTL21C	102137360	1.000000	0.71417	0.997000	0.53966	0.526000	0.34562	1.319000	0.33655	0.414000	0.25790	-0.924000	0.02725	TTC	.		0.388	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
MRPL10	124995	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	45906024	45906024	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:45906024G>A	ENST00000351111.2	-	2	70	c.65C>T	c.(64-66)aCc>aTc	p.T22I	MRPL10_ENST00000290208.7_Missense_Mutation_p.T32I|MRPL10_ENST00000414011.1_Missense_Mutation_p.T32I|LRRC46_ENST00000269025.4_5'Flank	NM_145255.3	NP_660298.2	Q7Z7H8	RM10_HUMAN	mitochondrial ribosomal protein L10	22					ribosome biogenesis (GO:0042254)|translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|large_intestine(1)|lung(3)|ovary(1)	8						AGTCTGGAGGGTAGGCAGCCG	0.552																																					p.T32I		.											.	MRPL10	91	0			c.C95T						.						44.0	38.0	40.0					17																	45906024		2203	4300	6503	SO:0001583	missense	124995	exon3			TGGAGGGTAGGCA	AB051618	CCDS11516.1, CCDS11517.1	17q21.3	2012-09-13			ENSG00000159111	ENSG00000159111		"""Mitochondrial ribosomal proteins / large subunits"""	14055	protein-coding gene	gene with protein product	"""39S ribosomal protein L10, mitochondrial"""	611825				11551941	Standard	NM_148887		Approved	RPML8, MRP-L8, L10MT, MRP-L10, MRPL8, MGC17973	uc002ily.3	Q7Z7H8	OTTHUMG00000156302	ENST00000351111.2:c.65C>T	17.37:g.45906024G>A	ENSP00000324100:p.Thr22Ile	15.0	0.0		39.0	16.0	NM_148887	A6NGJ4|Q96B80|Q96Q55	Missense_Mutation	SNP	ENST00000351111.2	37	CCDS11516.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710597	0.30322	.	.	ENSG00000159111	ENST00000351111;ENST00000290208;ENST00000414011	T;T;T	0.48201	0.82;2.27;2.27	5.32	3.34	0.38264	.	0.295182	0.35555	N	0.003131	T	0.45617	0.1351	M	0.70595	2.14	0.28737	N	0.902192	B;B	0.31910	0.138;0.346	B;B	0.30943	0.086;0.122	T	0.46345	-0.9198	10	0.52906	T	0.07	-7.2633	10.8403	0.46710	0.1561:0.0:0.8439:0.0	.	22;32	Q7Z7H8;A6NGJ4	RM10_HUMAN;.	I	22;32;32	ENSP00000324100:T22I;ENSP00000290208:T32I;ENSP00000395870:T32I	ENSP00000290208:T32I	T	-	2	0	MRPL10	43261023	1.000000	0.71417	0.926000	0.36857	0.691000	0.40173	3.770000	0.55310	0.645000	0.30675	0.561000	0.74099	ACC	.		0.552	MRPL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343764.1	NM_145255	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9002558	9002558	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:9002558G>T	ENST00000397910.4	-	51	40461	c.40258C>A	c.(40258-40260)Cac>Aac	p.H13420N	MUC16_ENST00000380951.5_Missense_Mutation_p.H61N	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13422	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGATGCCGTGGGTCAGCTGG	0.587																																					p.H13420N		.											.	MUC16	566	0			c.C40258A						.						187.0	170.0	175.0					19																	9002558		2150	4250	6400	SO:0001583	missense	94025	exon51			TGCCGTGGGTCAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.40258C>A	19.37:g.9002558G>T	ENSP00000381008:p.His13420Asn	99.0	0.0		362.0	117.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	6.688	0.495604	0.12762	.	.	ENSG00000181143	ENST00000397910;ENST00000380951	T;T	0.35605	1.3;1.3	2.75	1.69	0.24217	SEA (1);	.	.	.	.	T	0.43964	0.1271	L	0.46157	1.445	.	.	.	B;P	0.46859	0.003;0.885	B;P	0.60236	0.005;0.871	T	0.51568	-0.8689	8	0.37606	T	0.19	-0.5084	7.0787	0.25219	0.0:0.0:0.7305:0.2695	.	21065;13420	Q8WXI7;B5ME49	MUC16_HUMAN;.	N	13420;61	ENSP00000381008:H13420N;ENSP00000370338:H61N	ENSP00000370338:H61N	H	-	1	0	MUC16	8863558	0.001000	0.12720	0.250000	0.24296	0.003000	0.03518	0.235000	0.17948	0.737000	0.32582	-0.656000	0.03901	CAC	.		0.587	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9087113	9087113	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:9087113T>C	ENST00000397910.4	-	1	4905	c.4702A>G	c.(4702-4704)Aca>Gca	p.T1568A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1568	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTGACTGTGTCACGTGAGTA	0.507																																					p.T1568A		.											.	MUC16	566	0			c.A4702G						.						407.0	391.0	396.0					19																	9087113		2089	4216	6305	SO:0001583	missense	94025	exon1			ACTGTGTCACGTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4702A>G	19.37:g.9087113T>C	ENSP00000381008:p.Thr1568Ala	139.0	0.0		406.0	153.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	0.138	-1.105758	0.01828	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	0.235	-0.47	0.12131	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	.	.	.	B	0.06786	0.001	B	0.04013	0.001	T	0.46190	-0.9209	7	0.87932	D	0	.	.	.	.	.	1568	B5ME49	.	A	1568	ENSP00000381008:T1568A	ENSP00000381008:T1568A	T	-	1	0	MUC16	8948113	0.000000	0.05858	0.025000	0.17156	0.028000	0.11728	0.254000	0.18314	-0.867000	0.04063	-0.908000	0.02827	ACA	.		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH6	4624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23866803	23866803	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:23866803T>A	ENST00000356287.3	-	15	1940	c.1911A>T	c.(1909-1911)aaA>aaT	p.K637N	MYH6_ENST00000405093.3_Missense_Mutation_p.K637N			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	637	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCTTGCCTCCTTTGCTTTTAC	0.572																																					p.K637N		.											.	MYH6	94	0			c.A1911T						.						94.0	89.0	91.0					14																	23866803		2203	4300	6503	SO:0001583	missense	4624	exon16			GCCTCCTTTGCTT	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1911A>T	14.37:g.23866803T>A	ENSP00000348634:p.Lys637Asn	37.0	0.0		89.0	23.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	.	17.79	3.475098	0.63737	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.88201	-2.35;-2.35	4.27	4.27	0.50696	Myosin head, motor domain (2);	.	.	.	.	D	0.92270	0.7548	M	0.74881	2.28	0.50813	D	0.999891	P	0.44986	0.847	P	0.59056	0.851	D	0.92455	0.5973	9	0.72032	D	0.01	.	9.2762	0.37700	0.0:0.0893:0.0:0.9107	.	637	P13533	MYH6_HUMAN	N	637	ENSP00000386041:K637N;ENSP00000348634:K637N	ENSP00000348634:K637N	K	-	3	2	MYH6	22936643	0.988000	0.35896	1.000000	0.80357	0.917000	0.54804	0.286000	0.18902	1.933000	0.56026	0.533000	0.62120	AAA	.		0.572	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23883217	23883217	+	Splice_Site	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:23883217G>A	ENST00000355349.3	-	38	5816	c.5654C>T	c.(5653-5655)gCg>gTg	p.A1885V	CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1885					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTCACTCACCGCCTCCTCGGC	0.637																																					p.A1885V		.											.	MYH7	94	0			c.C5654T						.						78.0	75.0	76.0					14																	23883217		2203	4300	6503	SO:0001630	splice_region_variant	4625	exon38			CTCACCGCCTCCT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5655+1C>T	14.37:g.23883217G>A		58.0	0.0		121.0	51.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	G	34	5.299435	0.95574	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.80393	-1.37	5.07	5.07	0.68467	Myosin tail (1);	.	.	.	.	D	0.88437	0.6436	M	0.83312	2.635	0.80722	D	1	D	0.52996	0.957	P	0.55577	0.779	D	0.89529	0.3784	9	0.56958	D	0.05	.	18.2298	0.89931	0.0:0.0:1.0:0.0	.	1885	P12883	MYH7_HUMAN	V	1885;1890	ENSP00000347507:A1885V	ENSP00000347507:A1885V	A	-	2	0	MYH7	22953057	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.444000	0.97578	2.653000	0.90120	0.561000	0.74099	GCG	.		0.637	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	Missense_Mutation
MYO1G	64005	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	45002481	45002481	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr7:45002481G>T	ENST00000258787.7	-	22	3050	c.2914C>A	c.(2914-2916)Ctg>Atg	p.L972M	RP4-647J21.1_ENST00000568457.1_RNA	NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	972	Myosin tail. {ECO:0000255}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						CGAACCTCCAGGGTGCGGCCC	0.726																																					p.L972M		.											.	MYO1G	137	0			c.C2914A						.						6.0	7.0	7.0					7																	45002481		2066	4115	6181	SO:0001583	missense	64005	exon22			CCTCCAGGGTGCG	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.2914C>A	7.37:g.45002481G>T	ENSP00000258787:p.Leu972Met	8.0	0.0		47.0	18.0	NM_033054	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	ENST00000258787.7	37	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600210	0.66332	.	.	ENSG00000136286	ENST00000258787	T	0.55413	0.52	4.38	3.5	0.40072	Myosin tail 2 (1);	0.000000	0.29133	U	0.013044	T	0.70894	0.3276	M	0.84326	2.69	0.38994	D	0.959207	D	0.67145	0.996	D	0.72982	0.979	T	0.75036	-0.3459	10	0.72032	D	0.01	.	9.9067	0.41381	0.099:0.0:0.901:0.0	.	972	B0I1T2	MYO1G_HUMAN	M	972	ENSP00000258787:L972M	ENSP00000258787:L972M	L	-	1	2	MYO1G	44969006	0.995000	0.38212	0.774000	0.31636	0.851000	0.48451	2.742000	0.47434	0.968000	0.38212	-0.263000	0.10527	CTG	.		0.726	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2		
NEU1	4758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31830507	31830507	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr6:31830507C>A	ENST00000375631.4	-	1	176	c.47G>T	c.(46-48)gGg>gTg	p.G16V		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	16					glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	AATCCGCGGCCCCCAGCGTCT	0.662																																					p.G16V		.											.	NEU1	91	0			c.G47T						.						58.0	46.0	50.0					6																	31830507		1511	2709	4220	SO:0001583	missense	4758	exon1			CGCGGCCCCCAGC	AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.47G>T	6.37:g.31830507C>A	ENSP00000364782:p.Gly16Val	33.0	0.0		105.0	32.0	NM_000434		Missense_Mutation	SNP	ENST00000375631.4	37	CCDS4723.1	.	.	.	.	.	.	.	.	.	.	C	11.97	1.796757	0.31777	.	.	ENSG00000204386	ENST00000375631	D	0.89343	-2.5	5.07	-0.41	0.12374	.	1.438730	0.04638	N	0.404912	T	0.64316	0.2587	L	0.36672	1.1	0.09310	N	0.999999	B;B	0.20671	0.005;0.047	B;B	0.17098	0.015;0.017	T	0.52480	-0.8570	10	0.12766	T	0.61	-9.4339	4.4117	0.11436	0.0:0.3306:0.3631:0.3063	.	16;16	E9PIF4;Q99519	.;NEUR1_HUMAN	V	16	ENSP00000364782:G16V	ENSP00000364782:G16V	G	-	2	0	NEU1	31938486	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-1.760000	0.01806	0.020000	0.15106	-0.229000	0.12294	GGG	.		0.662	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076616.2		
NOS1	4842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117696926	117696926	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:117696926T>C	ENST00000338101.4	-	14	2381	c.2377A>G	c.(2377-2379)Atg>Gtg	p.M793V	NOS1_ENST00000317775.6_Missense_Mutation_p.M793V|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TATTCTTCCATGGACATCACC	0.522																																					p.M793V	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1	154	0			c.A2377G						.						105.0	102.0	103.0					12																	117696926		2006	4167	6173	SO:0001583	missense	4842	exon15			CTTCCATGGACAT		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2377A>G	12.37:g.117696926T>C	ENSP00000337459:p.Met793Val	43.0	0.0		156.0	58.0	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.230172	0.79688	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.73047	-0.71;-0.71	4.95	4.95	0.65309	Flavodoxin/nitric oxide synthase (2);	0.000000	0.85682	D	0.000000	D	0.85071	0.5613	M	0.85462	2.755	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.87639	0.2521	10	0.72032	D	0.01	-36.9725	14.4302	0.67243	0.0:0.0:0.0:1.0	.	793	P29475	NOS1_HUMAN	V	688;793;793;793	ENSP00000320758:M793V;ENSP00000337459:M793V	ENSP00000320758:M793V	M	-	1	0	NOS1	116181309	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.939000	0.70179	2.070000	0.61991	0.533000	0.62120	ATG	.		0.522	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
NPC1	4864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21125036	21125036	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr18:21125036T>C	ENST00000269228.5	-	12	2389	c.1835A>G	c.(1834-1836)gAa>gGa	p.E612G	NPC1_ENST00000540608.1_5'UTR|NPC1_ENST00000412552.2_Missense_Mutation_p.E294G	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	612			E -> D (in NPC1). {ECO:0000269|PubMed:11349231}.		adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ACGATTTAGTTCATCTTCAAT	0.358																																					p.E612G		.											.	NPC1	92	0			c.A1835G						.						113.0	102.0	106.0					18																	21125036		2203	4300	6503	SO:0001583	missense	4864	exon12			TTTAGTTCATCTT	AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.1835A>G	18.37:g.21125036T>C	ENSP00000269228:p.Glu612Gly	89.0	0.0		334.0	115.0	NM_000271	B4DET3|Q9P130	Missense_Mutation	SNP	ENST00000269228.5	37	CCDS11878.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.819773	0.90873	.	.	ENSG00000141458	ENST00000269228;ENST00000412552;ENST00000540608	D;D	0.92199	-2.99;-2.99	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.95348	0.8490	M	0.87547	2.89	0.58432	D	0.999999	P;P	0.46395	0.877;0.747	P;P	0.52627	0.704;0.533	D	0.95455	0.8538	10	0.54805	T	0.06	-27.9068	16.422	0.83766	0.0:0.0:0.0:1.0	.	623;612	Q59GR1;O15118	.;NPC1_HUMAN	G	612;294;457	ENSP00000269228:E612G;ENSP00000408606:E294G	ENSP00000269228:E612G	E	-	2	0	NPC1	19379034	1.000000	0.71417	0.930000	0.37139	0.868000	0.49771	7.830000	0.86741	2.270000	0.75569	0.533000	0.62120	GAA	.		0.358	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254823.2	NM_000271	
NUMA1	4926	hgsc.bcm.edu;broad.mit.edu	37	11	71726211	71726220	+	Frame_Shift_Del	DEL	CCTGATGGGC	CCTGATGGGC	-	rs3750912	byFrequency	TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	CCTGATGGGC	CCTGATGGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:71726211_71726220delCCTGATGGGC	ENST00000393695.3	-	15	2660_2669	c.2329_2338delGCCCATCAGG	c.(2329-2340)gcccatcaggctfs	p.AHQA777fs	NUMA1_ENST00000351960.6_Intron|RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000358965.6_Frame_Shift_Del_p.AHQA777fs	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						TCAGTCTCAGCCTGATGGGCCTCCCCAAGC	0.619			T	RARA	APL																																p.777_780del		.		Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	.	NUMA1	633	0			c.2329_2338del						.																																			SO:0001589	frameshift_variant	4926	exon15			TCTCAGCCTGATG	Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.2329_2338delGCCCATCAGG	11.37:g.71726211_71726220delCCTGATGGGC	ENSP00000377298:p.Ala777fs	23.0	0.0		70.0	10.0	NM_006185		Frame_Shift_Del	DEL	ENST00000393695.3	37	CCDS31633.1																																																																																			.		0.619	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395769.1		
PAWR	5074	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	80083895	80083895	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:80083895C>A	ENST00000328827.4	-	2	502	c.130G>T	c.(130-132)Ggg>Tgg	p.G44W	PAWR_ENST00000547571.1_5'Flank|RP11-530C5.1_ENST00000551995.1_lincRNA	NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	44					actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CTGCTGCCCCCTcccgggggg	0.756																																					p.G44W		.											.	PAWR	90	0			c.G130T						.						1.0	1.0	1.0					12																	80083895		921	2291	3212	SO:0001583	missense	5074	exon2			TGCCCCCTCCCGG	U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.130G>T	12.37:g.80083895C>A	ENSP00000328088:p.Gly44Trp	15.0	0.0		22.0	6.0	NM_002583	O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	ENST00000328827.4	37	CCDS31863.1	.	.	.	.	.	.	.	.	.	.	C	8.981	0.975325	0.18736	.	.	ENSG00000177425	ENST00000328827;ENST00000548426;ENST00000552637	T;T;T	0.57907	2.71;0.38;0.37	2.45	0.216	0.15258	.	0.652385	0.14023	N	0.346688	T	0.50565	0.1623	L	0.34521	1.04	0.09310	N	1	D	0.61697	0.99	P	0.59171	0.853	T	0.39440	-0.9614	9	.	.	.	-6.6033	6.6153	0.22773	0.2117:0.5993:0.189:0.0	.	44	Q96IZ0	PAWR_HUMAN	W	44	ENSP00000328088:G44W;ENSP00000447454:G44W;ENSP00000449928:G44W	.	G	-	1	0	PAWR	78608026	0.155000	0.22806	0.013000	0.15412	0.391000	0.30476	1.772000	0.38552	-0.112000	0.11979	0.313000	0.20887	GGG	.		0.756	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407175.1	NM_002583	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52588770	52588770	+	Missense_Mutation	SNP	C	C	A	rs143564112	byFrequency	TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:52588770C>A	ENST00000296302.7	-	27	4580	c.4579G>T	c.(4579-4581)Gtg>Ttg	p.V1527L	PBRM1_ENST00000409114.3_Intron|SMIM4_ENST00000476842.1_Intron|RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000337303.4_Intron|PBRM1_ENST00000394830.3_Missense_Mutation_p.V1420L|PBRM1_ENST00000410007.1_Missense_Mutation_p.V1447L|PBRM1_ENST00000409767.1_Intron|PBRM1_ENST00000409057.1_Missense_Mutation_p.V1472L|PBRM1_ENST00000356770.4_Missense_Mutation_p.V1440L			Q86U86	PB1_HUMAN	polybromo 1	1527	Pro-rich.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGGCCAGGCACACCTGGCGGA	0.557			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.V1420L		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	575	0			c.G4258T						.						45.0	44.0	45.0					3																	52588770		2203	4300	6503	SO:0001583	missense	55193	exon27			CAGGCACACCTGG	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4579G>T	3.37:g.52588770C>A	ENSP00000296302:p.Val1527Leu	69.0	0.0		229.0	83.0	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	13.52	2.262476	0.39995	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000409057;ENST00000410007	T;T;T;T;T	0.33216	1.42;1.42;1.46;1.43;1.42	5.62	3.58	0.41010	.	0.353225	0.30850	N	0.008759	T	0.13884	0.0336	N	0.08118	0	0.80722	D	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001	B;B;B;B;B	0.17722	0.005;0.003;0.005;0.001;0.019	T	0.06516	-1.0822	10	0.49607	T	0.09	-7.5268	4.2397	0.10642	0.0:0.6107:0.0:0.3893	.	1447;1420;1472;1527;1440	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86;Q86U86-3	.;.;.;PB1_HUMAN;.	L	1440;1420;1527;1472;1447	ENSP00000349213:V1440L;ENSP00000378307:V1420L;ENSP00000296302:V1527L;ENSP00000386593:V1472L;ENSP00000386529:V1447L	ENSP00000296302:V1527L	V	-	1	0	PBRM1	52563810	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.917000	0.56424	1.348000	0.45733	0.563000	0.77884	GTG	C|0.999;T|0.001		0.557	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
PDK3	5165	broad.mit.edu;bcgsc.ca	37	X	24549826	24549826	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:24549826A>C	ENST00000379162.4	+	10	1251	c.1016A>C	c.(1015-1017)cAa>cCa	p.Q339P	PDK3_ENST00000441463.2_Missense_Mutation_p.Q339P	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	339	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AGATATTTTCAAGGAGATCTG	0.378																																					p.Q339P		.											.	PDK3	377	0			c.A1016C						.						300.0	249.0	266.0					X																	24549826		2203	4300	6503	SO:0001583	missense	5165	exon10			ATTTTCAAGGAGA	L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.1016A>C	X.37:g.24549826A>C	ENSP00000368460:p.Gln339Pro	98.0	1.0		395.0	22.0	NM_005391	B4DXG6	Missense_Mutation	SNP	ENST00000379162.4	37	CCDS14212.1	.	.	.	.	.	.	.	.	.	.	A	20.0	3.929843	0.73327	.	.	ENSG00000067992	ENST00000379162;ENST00000441463	T;T	0.76839	-1.05;-1.05	5.26	5.26	0.73747	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.90428	0.7003	H	0.94222	3.51	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.66351	0.943;0.943	D	0.92722	0.6192	10	0.62326	D	0.03	.	14.2518	0.66026	1.0:0.0:0.0:0.0	.	339;339	B4DXG6;Q15120	.;PDK3_HUMAN	P	339	ENSP00000368460:Q339P;ENSP00000387536:Q339P	ENSP00000368460:Q339P	Q	+	2	0	PDK3	24459747	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.761000	0.91691	1.941000	0.56285	0.441000	0.28932	CAA	.		0.378	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1	NM_005391	
PHLDB3	653583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	43983597	43983597	+	Missense_Mutation	SNP	C	C	A	rs200179651		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:43983597C>A	ENST00000292140.5	-	14	1994	c.1634G>T	c.(1633-1635)cGc>cTc	p.R545L		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	545	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				GGTCTTGATGCGGCCGCCCAT	0.652																																					p.R545L		.											.	PHLDB3	68	0			c.G1634T						.						15.0	18.0	17.0					19																	43983597		2039	4169	6208	SO:0001583	missense	653583	exon14			TTGATGCGGCCGC		CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1634G>T	19.37:g.43983597C>A	ENSP00000292140:p.Arg545Leu	39.0	0.0		165.0	63.0	NM_198850	Q8N7Z4	Missense_Mutation	SNP	ENST00000292140.5	37	CCDS12621.2	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877146	0.51801	.	.	ENSG00000176531	ENST00000292140	T	0.74002	-0.8	4.59	3.56	0.40772	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000002	T	0.80330	0.4603	L	0.46157	1.445	0.50313	D	0.999866	D;D	0.76494	0.997;0.999	D;D	0.75484	0.949;0.986	T	0.81239	-0.1023	10	0.72032	D	0.01	.	11.179	0.48616	0.0:0.9062:0.0:0.0938	.	215;545	B2RXH3;Q6NSJ2	.;PHLB3_HUMAN	L	545	ENSP00000292140:R545L	ENSP00000292140:R545L	R	-	2	0	PHLDB3	48675437	0.996000	0.38824	0.899000	0.35326	0.222000	0.24845	2.367000	0.44213	1.260000	0.44134	-0.236000	0.12185	CGC	.		0.652	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319643.2		
PIGR	5284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207110487	207110487	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:207110487A>G	ENST00000356495.4	-	4	1181	c.998T>C	c.(997-999)cTg>cCg	p.L333P		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	333	Ig-like V-type 3.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GCCTTCCTGCAGCTGACCATC	0.597																																					p.L333P		.											.	PIGR	92	0			c.T998C						.						70.0	60.0	63.0					1																	207110487		2203	4300	6503	SO:0001583	missense	5284	exon4			TCCTGCAGCTGAC		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.998T>C	1.37:g.207110487A>G	ENSP00000348888:p.Leu333Pro	53.0	0.0		112.0	30.0	NM_002644	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	A	4.224	0.040357	0.08148	.	.	ENSG00000162896	ENST00000356495	T	0.15372	2.43	5.52	0.96	0.19631	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.793165	0.11491	N	0.558714	T	0.04452	0.0122	N	0.00972	-1.085	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.38542	-0.9656	10	0.30078	T	0.28	-33.0436	2.8831	0.05654	0.3868:0.0:0.4222:0.191	.	333	P01833	PIGR_HUMAN	P	333	ENSP00000348888:L333P	ENSP00000348888:L333P	L	-	2	0	PIGR	205177110	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.286000	0.08399	0.179000	0.19938	0.528000	0.53228	CTG	.		0.597	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088975.1	NM_002644	
PLP1	5354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	103041518	103041518	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:103041518A>G	ENST00000303958.2	+	3	462	c.316A>G	c.(316-318)Acc>Gcc	p.T106A	PLP1_ENST00000418604.1_Missense_Mutation_p.T106A|PLP1_ENST00000361621.2_Missense_Mutation_p.T106A	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	106					astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						CGACTACAAGACCACCATCTG	0.587																																					p.T106A		.											.	PLP1	555	0			c.A316G						.						119.0	106.0	110.0					X																	103041518		2203	4300	6503	SO:0001583	missense	5354	exon4			TACAAGACCACCA	M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.316A>G	X.37:g.103041518A>G	ENSP00000305152:p.Thr106Ala	86.0	0.0		169.0	131.0	NM_001128834	P04400|P06905|Q502Y1|Q6FHZ6	Missense_Mutation	SNP	ENST00000303958.2	37	CCDS14513.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.564697	0.45694	.	.	ENSG00000123560	ENST00000434483;ENST00000429977;ENST00000455268;ENST00000422393;ENST00000418604;ENST00000443502;ENST00000303958;ENST00000361621	D;D;D;D;D;D;D;D	0.99259	-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64	5.78	5.78	0.91487	.	0.183995	0.64402	D	0.000018	D	0.97284	0.9112	N	0.19112	0.55	0.41067	D	0.985429	B;B;B;B;P	0.35192	0.022;0.003;0.003;0.003;0.489	B;B;B;B;B	0.39465	0.012;0.006;0.008;0.006;0.3	D	0.97617	1.0133	10	0.42905	T	0.14	-4.5431	12.8049	0.57607	1.0:0.0:0.0:0.0	.	51;106;106;106;106	B4DI30;A8K9L3;B1B1G6;P60201;P60201-2	.;.;.;MYPR_HUMAN;.	A	106	ENSP00000403335:T106A;ENSP00000399913:T106A;ENSP00000409802:T106A;ENSP00000413931:T106A;ENSP00000405750:T106A;ENSP00000391853:T106A;ENSP00000305152:T106A;ENSP00000354860:T106A	ENSP00000305152:T106A	T	+	1	0	PLP1	102928174	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.159000	0.77483	1.931000	0.55961	0.486000	0.48141	ACC	.		0.587	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057743.2		
POM121L4P	266697	broad.mit.edu;ucsc.edu	37	22	21044998	21044998	+	RNA	SNP	C	C	T	rs5751737	byFrequency	TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr22:21044998C>T	ENST00000412250.3	+	0	680									POM121 transmembrane nucleoporin-like 4 pseudogene											breast(2)	2						CGGGTCACTGCTGAAGACCTG	0.612																																					.		.											.	.	.	0			.						.																																					266697	.			TCACTGCTGAAGA			22q11.2	2012-03-13	2012-03-13		ENSG00000217261	ENSG00000217261			19326	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 4 pseudogene (rat)"", ""POM121 membrane glycoprotein-like 4 pseudogene"""				Standard	NR_024592		Approved		uc002zsw.2		OTTHUMG00000150756		22.37:g.21044998C>T		22.0	0.0		92.0	22.0	.		RNA	SNP	ENST00000412250.3	37		283	0.1295787545787546	131	0.266260162601626	52	0.143646408839779	52	0.09090909090909091	48	0.0633245382585752	C	6.283	0.420324	0.11928	.	.	ENSG00000217261	ENST00000412250	.	.	.	0.706	-1.41	0.08941	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.16166	0.016	B	0.12837	0.008	T	0.25537	-1.0129	5	0.42905	T	0.14	.	.	.	.	rs5751737	227	F5H5H7	.	V	227	.	ENSP00000443399:A227V	A	+	2	0	POM121L4P	19374998	0.890000	0.30428	0.011000	0.14972	0.077000	0.17291	0.632000	0.24583	-0.349000	0.08274	0.163000	0.16589	GCT	C|0.878;T|0.122		0.612	POM121L4P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene	OTTHUMT00000468456.1		
POTEG	404785	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	19553573	19553573	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:19553573G>T	ENST00000409832.3	+	1	209	c.157G>T	c.(157-159)Gct>Tct	p.A53S		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	53										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CGACGATTCTGCTATGAAGAC	0.607																																					p.A53S		.											.	POTEG	1	0			c.G157T						.						104.0	143.0	130.0					14																	19553573		2198	4286	6484	SO:0001583	missense	404785	exon1			GATTCTGCTATGA		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.157G>T	14.37:g.19553573G>T	ENSP00000386971:p.Ala53Ser	173.0	0.0		1087.0	131.0	NM_001005356	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	37	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	4.687	0.127650	0.08981	.	.	ENSG00000222036	ENST00000409832	T	0.27720	1.65	.	.	.	.	.	.	.	.	T	0.19446	0.0467	L	0.40543	1.245	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.33954	-0.9848	7	0.11794	T	0.64	.	.	.	.	.	53	Q6S5H5	POTEG_HUMAN	S	53	ENSP00000386971:A53S	ENSP00000386971:A53S	A	+	1	0	POTEG	18623573	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-0.334000	0.07883	0.162000	0.19483	0.165000	0.16767	GCT	.		0.607	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
PRB4	5545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	11461456	11461456	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:11461456C>A	ENST00000535904.1	-	3	494	c.461G>T	c.(460-462)gGt>gTt	p.G154V	PRB4_ENST00000279575.1_Missense_Mutation_p.G154V|PRB4_ENST00000445719.2_Intron			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	175	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele M and allele S).	Missing (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						AGGTGGGGGACCTTGGGACTG	0.607										HNSCC(22;0.051)																											p.G154V		.											.	PRB4	91	0			c.G461T						.						193.0	211.0	205.0					12																	11461456		2203	4300	6503	SO:0001583	missense	5545	exon3			GGGGGACCTTGGG		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.461G>T	12.37:g.11461456C>A	ENSP00000442834:p.Gly154Val	144.0	0.0		500.0	173.0	NM_002723	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	4.941	0.174747	0.09391	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.06068	3.35;3.35	0.903	-1.68	0.08212	.	.	.	.	.	T	0.09686	0.0238	M	0.75615	2.305	0.09310	N	1	D	0.58268	0.982	P	0.47673	0.554	T	0.13683	-1.0500	9	0.38643	T	0.18	.	3.7245	0.08469	0.0:0.46:0.0:0.54	.	154	E9PAL0	.	V	154	ENSP00000279575:G154V;ENSP00000442834:G154V	ENSP00000279575:G154V	G	-	2	0	PRB4	11352723	0.011000	0.17503	0.000000	0.03702	0.001000	0.01503	-0.528000	0.06193	-0.563000	0.06078	-0.362000	0.07510	GGT	.		0.607	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402308.1	NM_002723	
PPP1CC	5501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	111162541	111162541	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:111162541C>T	ENST00000335007.5	-	4	637	c.447G>A	c.(445-447)tgG>tgA	p.W149*	PPP1CC_ENST00000550991.1_Nonsense_Mutation_p.W149*|PPP1CC_ENST00000546933.1_Nonsense_Mutation_p.W158*|PPP1CC_ENST00000340766.5_Nonsense_Mutation_p.W149*|PPP1CC_ENST00000551676.1_Nonsense_Mutation_p.W149*	NM_002710.3	NP_002701.1	P36873	PP1G_HUMAN	protein phosphatase 1, catalytic subunit, gamma isozyme	149					cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|large_intestine(2)|lung(3)	6						TGAAAGTTTTCCATAGTTTAA	0.368																																					p.W149X		.											.	PPP1CC	1082	0			c.G447A						.						154.0	135.0	142.0					12																	111162541		2203	4300	6503	SO:0001587	stop_gained	5501	exon4			AGTTTTCCATAGT		CCDS9150.1, CCDS58279.1	12q24.1-q24.2	2013-01-17	2010-03-05		ENSG00000186298	ENSG00000186298	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9283	protein-coding gene	gene with protein product		176914	"""protein phosphatase 1, catalytic subunit, gamma isoform"""				Standard	NM_002710		Approved	PP1C, PP1gamma	uc021rdx.1	P36873	OTTHUMG00000169531	ENST00000335007.5:c.447G>A	12.37:g.111162541C>T	ENSP00000335084:p.Trp149*	99.0	0.0		362.0	40.0	NM_002710		Nonsense_Mutation	SNP	ENST00000335007.5	37	CCDS9150.1	.	.	.	.	.	.	.	.	.	.	C	38	7.122684	0.98077	.	.	ENSG00000186298	ENST00000335007;ENST00000340766;ENST00000546933;ENST00000550991;ENST00000551676	.	.	.	5.86	5.86	0.93980	.	0.052633	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3039	20.5632	0.99335	0.0:1.0:0.0:0.0	.	.	.	.	X	149;149;158;149;149	.	ENSP00000335084:W149X	W	-	3	0	PPP1CC	109646924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.937000	0.99478	0.650000	0.86243	TGG	.		0.368	PPP1CC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404659.1		
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68939468	68939468	+	Silent	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:68939468G>T	ENST00000288368.4	+	5	730	c.453G>T	c.(451-453)ctG>ctT	p.L151L	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	151	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ACTGCATGCTGCTTGGAGGAC	0.348																																					p.L151L		.											.	PREX2	390	0			c.G453T						.						126.0	120.0	122.0					8																	68939468		2203	4300	6503	SO:0001819	synonymous_variant	80243	exon5			CATGCTGCTTGGA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.453G>T	8.37:g.68939468G>T		71.0	0.0		200.0	45.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																			.		0.348	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
QRFPR	84109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122250816	122250816	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr4:122250816C>T	ENST00000394427.2	-	6	1360	c.949G>A	c.(949-951)Gtg>Atg	p.V317M	QRFPR_ENST00000334383.5_3'UTR|Y_RNA_ENST00000384419.1_RNA	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	317					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						ATAATTTGCACGATAGCAAAA	0.279																																					p.V317M		.											.	QRFPR	90	0			c.G949A						.						35.0	36.0	36.0					4																	122250816		2202	4298	6500	SO:0001583	missense	84109	exon6			TTTGCACGATAGC	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.949G>A	4.37:g.122250816C>T	ENSP00000377948:p.Val317Met	63.0	0.0		108.0	64.0	NM_198179		Missense_Mutation	SNP	ENST00000394427.2	37	CCDS3719.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471314	0.84533	.	.	ENSG00000186867	ENST00000394427	T	0.72505	-0.66	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.83211	0.5205	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.82896	-0.0230	10	0.48119	T	0.1	.	19.3074	0.94169	0.0:1.0:0.0:0.0	.	317	Q96P65	QRFPR_HUMAN	M	317	ENSP00000377948:V317M	ENSP00000377948:V317M	V	-	1	0	QRFPR	122470266	1.000000	0.71417	0.943000	0.38184	0.946000	0.59487	5.898000	0.69838	2.569000	0.86673	0.491000	0.48974	GTG	.		0.279	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
RAB3GAP2	25782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220356254	220356254	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:220356254C>G	ENST00000358951.2	-	20	2134	c.2018G>C	c.(2017-2019)aGg>aCg	p.R673T		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	673					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TTCATCAAGCCTTAGTAACAG	0.363																																					p.R673T		.											.	RAB3GAP2	90	0			c.G2018C						.						67.0	65.0	66.0					1																	220356254		2203	4300	6503	SO:0001583	missense	25782	exon20			TCAAGCCTTAGTA	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2018G>C	1.37:g.220356254C>G	ENSP00000351832:p.Arg673Thr	103.0	0.0		373.0	116.0	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.901431	0.33535	.	.	ENSG00000118873	ENST00000358951	T	0.31247	1.5	5.67	2.81	0.32909	.	0.256963	0.43747	D	0.000536	T	0.22975	0.0555	L	0.40543	1.245	0.32568	N	0.530193	B	0.30361	0.277	B	0.29942	0.109	T	0.23762	-1.0179	10	0.21014	T	0.42	.	10.9519	0.47334	0.0:0.7976:0.0:0.2024	.	673	Q9H2M9	RBGPR_HUMAN	T	673	ENSP00000351832:R673T	ENSP00000351832:R673T	R	-	2	0	RAB3GAP2	218422877	0.372000	0.25064	0.997000	0.53966	0.990000	0.78478	1.597000	0.36729	0.346000	0.23899	-0.225000	0.12378	AGG	.		0.363	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
RAPGEF1	2889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	134497245	134497245	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr9:134497245C>T	ENST00000372189.3	-	11	1915	c.1792G>A	c.(1792-1794)Ggg>Agg	p.G598R	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.G616R|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.G615R	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	598					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GAGTCCACCCCACTGAAGGAG	0.602																																					p.G616R		.											.	RAPGEF1	849	0			c.G1846A						.						50.0	59.0	56.0					9																	134497245		2046	4183	6229	SO:0001583	missense	2889	exon11			CCACCCCACTGAA	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1792G>A	9.37:g.134497245C>T	ENSP00000361263:p.Gly598Arg	58.0	0.0		140.0	80.0	NM_198679	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	37	CCDS48047.1	.	.	.	.	.	.	.	.	.	.	C	7.333	0.619357	0.14129	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000398415;ENST00000437236;ENST00000372191;ENST00000357686;ENST00000431470;ENST00000545785	T;T;T	0.23950	1.88;1.89;1.89	4.84	-1.21	0.09524	.	1.978000	0.02142	N	0.057242	T	0.19167	0.0460	N	0.22421	0.69	0.19300	N	0.999979	P;B;P;B;P;B;B;B	0.45474	0.773;0.145;0.773;0.041;0.859;0.134;0.041;0.068	B;B;B;B;B;B;B;B	0.42422	0.219;0.101;0.3;0.043;0.387;0.043;0.043;0.094	T	0.26292	-1.0107	10	0.15499	T	0.54	.	9.5338	0.39209	0.0:0.3305:0.0:0.6695	.	12;293;56;578;559;615;598;616	E7ERR9;E9PDT1;Q5JUE7;C9JL20;Q13905-2;Q68DL3;Q13905;Q13905-3	.;.;.;.;.;.;RPGF1_HUMAN;.	R	598;615;492;598;616;578;524;12;12;293;615;12;12	ENSP00000361269:G615R;ENSP00000361263:G598R;ENSP00000361264:G616R	ENSP00000266110:G598R	G	-	1	0	RAPGEF1	133487066	0.990000	0.36364	0.002000	0.10522	0.004000	0.04260	1.045000	0.30341	-0.284000	0.09102	-0.258000	0.10820	GGG	.		0.602	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312	
RBMXL3	139804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	114424168	114424168	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:114424168C>A	ENST00000424776.3	+	1	206	c.164C>A	c.(163-165)aCc>aAc	p.T55N	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	55	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GCGTTCGTCACCTTCGAAAGC	0.542																																					p.T55N		.											.	.	.	0			c.C164A						.						74.0	70.0	71.0					X																	114424168		692	1591	2283	SO:0001583	missense	139804	exon1			TCGTCACCTTCGA	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.164C>A	X.37:g.114424168C>A	ENSP00000417451:p.Thr55Asn	27.0	0.0		62.0	55.0	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	37	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072650	0.36566	.	.	ENSG00000175718	ENST00000424776	T	0.17370	2.28	0.69	0.69	0.18039	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	T	0.15696	0.0378	L	0.54965	1.715	0.34374	D	0.692419	B	0.21905	0.062	B	0.29353	0.101	T	0.18555	-1.0333	9	0.87932	D	0	.	3.6018	0.08027	0.4387:0.5612:1.0E-4:0.0	.	55	Q8N7X1	RMXL3_HUMAN	N	55	ENSP00000417451:T55N	ENSP00000417451:T55N	T	+	2	0	RBMXL3	114330424	0.969000	0.33509	0.019000	0.16419	0.007000	0.05969	2.482000	0.45224	0.587000	0.29643	0.422000	0.28245	ACC	.		0.542	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
RFX7	64864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	56387675	56387675	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr15:56387675A>C	ENST00000559447.2	-	9	2231	c.1960T>G	c.(1960-1962)Tca>Gca	p.S654A	RFX7_ENST00000317318.6_Missense_Mutation_p.S751A|RFX7_ENST00000422057.1_Missense_Mutation_p.S654A|RFX7_ENST00000423270.1_Missense_Mutation_p.S751A			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	654					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GGAGATGATGATGGGGTTGTT	0.403																																					p.S751A		.											.	RFX7	90	0			c.T2251G						.						95.0	86.0	89.0					15																	56387675		1888	4107	5995	SO:0001583	missense	64864	exon9			ATGATGATGGGGT			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1960T>G	15.37:g.56387675A>C	ENSP00000453281:p.Ser654Ala	57.0	0.0		81.0	37.0	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	37		.	.	.	.	.	.	.	.	.	.	A	3.862	-0.029663	0.07589	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.55052	0.54;0.54;0.54	5.17	4.04	0.47022	.	0.378699	0.21995	N	0.066098	T	0.24044	0.0582	N	0.04508	-0.205	0.25871	N	0.983707	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.12192	-1.0557	10	0.14656	T	0.56	-6.2777	5.8648	0.18768	0.6162:0.294:0.0897:0.0	.	654;654	Q2KHR2;C9JU50	RFX7_HUMAN;.	A	654;751;751	ENSP00000387504:S654A;ENSP00000313299:S751A;ENSP00000397644:S751A	ENSP00000313299:S751A	S	-	1	0	RFX7	54174967	0.990000	0.36364	0.957000	0.39632	0.466000	0.32739	1.646000	0.37249	2.064000	0.61679	0.482000	0.46254	TCA	.		0.403	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
RRP1B	23076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45094517	45094517	+	Splice_Site	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr21:45094517C>A	ENST00000340648.4	+	5	475	c.358C>A	c.(358-360)Ctg>Atg	p.L120M		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	120					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		CTTTCTTTAGCTGATTCGTCT	0.353																																					p.L120M		.											.	RRP1B	91	0			c.C358A						.						78.0	71.0	73.0					21																	45094517		2203	4300	6503	SO:0001630	splice_region_variant	23076	exon5			CTTTAGCTGATTC	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.358-1C>A	21.37:g.45094517C>A		60.0	0.0		175.0	55.0	NM_015056	Q8TBZ4	Missense_Mutation	SNP	ENST00000340648.4	37	CCDS33577.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083221	0.36758	.	.	ENSG00000160208	ENST00000340648	T	0.64991	-0.13	5.53	3.33	0.38152	.	0.069267	0.56097	D	0.000021	D	0.82426	0.5034	H	0.96604	3.85	0.53005	D	0.999964	D	0.89917	1.0	D	0.97110	1.0	T	0.82973	-0.0191	9	.	.	.	-9.1608	5.382	0.16196	0.0:0.6875:0.0:0.3124	.	120	Q14684	RRP1B_HUMAN	M	120	ENSP00000339145:L120M	.	L	+	1	2	RRP1B	43918945	1.000000	0.71417	0.993000	0.49108	0.114000	0.19823	1.046000	0.30354	1.466000	0.48025	0.650000	0.86243	CTG	.		0.353	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	Missense_Mutation
SEMA3E	9723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	83037733	83037733	+	Silent	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr7:83037733C>T	ENST00000307792.3	-	6	1088	c.621G>A	c.(619-621)ggG>ggA	p.G207G	SEMA3E_ENST00000427262.1_Silent_p.G147G	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	207	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GGGCCAGTCGCCCCATGCTGC	0.468																																					p.G207G		.											.	SEMA3E	93	0			c.G621A						.						67.0	62.0	64.0					7																	83037733		2203	4300	6503	SO:0001819	synonymous_variant	9723	exon6			CAGTCGCCCCATG	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.621G>A	7.37:g.83037733C>T		69.0	0.0		214.0	71.0	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1																																																																																			.		0.468	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
SESN3	143686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94918494	94918494	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:94918494T>C	ENST00000536441.1	-	5	1024	c.688A>G	c.(688-690)Aac>Gac	p.N230D	SESN3_ENST00000416495.2_Missense_Mutation_p.N230D|SESN3_ENST00000278499.2_Missense_Mutation_p.N91D|RP11-712B9.2_ENST00000534891.1_RNA|SESN3_ENST00000393234.1_Missense_Mutation_p.N230D|RP11-712B9.2_ENST00000534864.1_RNA	NM_001271594.1|NM_144665.2	NP_001258523.1|NP_653266.2	P58005	SESN3_HUMAN	sestrin 3	230					glucose homeostasis (GO:0042593)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)|response to insulin (GO:0032868)	nucleus (GO:0005634)				endometrium(5)|large_intestine(6)|lung(3)|skin(1)|stomach(1)	16		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		CAGAAATTGTTGACTGATATT	0.388																																					p.N230D		.											.	SESN3	90	0			c.A688G						.						185.0	185.0	185.0					11																	94918494		2201	4298	6499	SO:0001583	missense	143686	exon5			AATTGTTGACTGA	AK096300	CCDS8303.1, CCDS60938.1	11q21	2005-09-18			ENSG00000149212	ENSG00000149212			23060	protein-coding gene	gene with protein product		607768				12607115	Standard	NM_144665		Approved	SEST3, MGC29667	uc001pfj.4	P58005	OTTHUMG00000167829	ENST00000536441.1:c.688A>G	11.37:g.94918494T>C	ENSP00000441927:p.Asn230Asp	95.0	0.0		134.0	47.0	NM_144665	B7Z7P9|Q96AD1	Missense_Mutation	SNP	ENST00000536441.1	37	CCDS8303.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.856634	0.51376	.	.	ENSG00000149212	ENST00000536441;ENST00000278499;ENST00000393234;ENST00000416495	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.68	5.68	0.88126	.	0.211356	0.47852	D	0.000206	T	0.16938	0.0407	L	0.36672	1.1	0.45415	D	0.998397	B;B;B	0.29301	0.011;0.241;0.011	B;B;B	0.26969	0.025;0.075;0.046	T	0.05099	-1.0906	10	0.10111	T	0.7	0.0614	15.9249	0.79609	0.0:0.0:0.0:1.0	.	91;230;230	B7Z7P9;P58005-3;P58005	.;.;SESN3_HUMAN	D	230;91;230;230	ENSP00000441927:N230D;ENSP00000278499:N91D;ENSP00000376926:N230D;ENSP00000407008:N230D	ENSP00000278499:N91D	N	-	1	0	SESN3	94558142	1.000000	0.71417	0.889000	0.34880	0.986000	0.74619	7.256000	0.78350	2.170000	0.68504	0.459000	0.35465	AAC	.		0.388	SESN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396475.3	NM_144665	
SHROOM2	357	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	9863964	9863964	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:9863964G>T	ENST00000380913.3	+	4	2106	c.2016G>T	c.(2014-2016)caG>caT	p.Q672H		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	672					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GTGGCACCCAGGAAGGACCCC	0.672																																					p.Q672H		.											.	SHROOM2	198	0			c.G2016T						.						9.0	8.0	8.0					X																	9863964		2136	4196	6332	SO:0001583	missense	357	exon4			CACCCAGGAAGGA	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2016G>T	X.37:g.9863964G>T	ENSP00000370299:p.Gln672His	9.0	0.0		33.0	21.0	NM_001649	B9EIQ7	Missense_Mutation	SNP	ENST00000380913.3	37	CCDS14135.1	.	.	.	.	.	.	.	.	.	.	G	2.372	-0.344160	0.05208	.	.	ENSG00000146950	ENST00000380913	T	0.44083	0.93	4.52	-4.05	0.03998	Apx/shroom, ASD1 (1);	7.240040	0.00644	N	0.000523	T	0.36744	0.0978	L	0.38175	1.15	0.49915	D	0.999837	P	0.48694	0.914	P	0.48334	0.574	T	0.34650	-0.9820	10	0.59425	D	0.04	-3.1131	2.1711	0.03849	0.2795:0.1136:0.3817:0.2253	.	672	Q13796	SHRM2_HUMAN	H	672	ENSP00000370299:Q672H	ENSP00000370299:Q672H	Q	+	3	2	SHROOM2	9823964	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-2.504000	0.00964	-1.275000	0.02417	-0.340000	0.08031	CAG	.		0.672	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
SLC2A13	114134	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	40499574	40499574	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:40499574G>C	ENST00000280871.4	-	1	87	c.37C>G	c.(37-39)Ctg>Gtg	p.L13V	SLC2A13_ENST00000380858.1_Missense_Mutation_p.L13V	NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	13					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				AGGCTCCGCAGCGTGTACTCC	0.751										HNSCC(50;0.14)																											p.L13V		.											.	SLC2A13	515	0			c.C37G						.						1.0	1.0	1.0					12																	40499574		964	1903	2867	SO:0001583	missense	114134	exon1			TCCGCAGCGTGTA	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.37C>G	12.37:g.40499574G>C	ENSP00000280871:p.Leu13Val	9.0	0.0		56.0	22.0	NM_052885	Q17S07	Missense_Mutation	SNP	ENST00000280871.4	37	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051601	0.55218	.	.	ENSG00000151229	ENST00000280871;ENST00000380858	D;D	0.83163	-1.68;-1.69	4.0	2.06	0.26882	.	2.181300	0.03396	U	0.202639	T	0.72011	0.3408	N	0.14661	0.345	0.37298	D	0.908574	B;B	0.26744	0.158;0.158	B;B	0.22601	0.04;0.04	T	0.60125	-0.7324	10	0.56958	D	0.05	-1.066	8.0877	0.30782	0.0878:0.0:0.7579:0.1544	.	13;13	Q96QE2;E9PE47	MYCT_HUMAN;.	V	13	ENSP00000280871:L13V;ENSP00000370239:L13V	ENSP00000280871:L13V	L	-	1	2	SLC2A13	38785841	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.534000	0.60622	0.639000	0.30564	0.462000	0.41574	CTG	.		0.751	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
SLC45A4	57210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142231707	142231707	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:142231707G>A	ENST00000024061.3	-	2	553	c.246C>T	c.(244-246)ggC>ggT	p.G82G	SLC45A4_ENST00000433583.2_Silent_p.G75G|SLC45A4_ENST00000517878.1_Silent_p.G133G|SLC45A4_ENST00000519067.1_Silent_p.G82G	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AAAGTGCAACGCCAAAGAGGA	0.622																																					p.G82G		.											.	SLC45A4	70	0			c.C246T						.						71.0	78.0	76.0					8																	142231707		2203	4300	6503	SO:0001819	synonymous_variant	57210	exon2			TGCAACGCCAAAG	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.246C>T	8.37:g.142231707G>A		27.0	0.0		157.0	39.0	NM_001080431	Q6ZRI2|Q9ULU3	Silent	SNP	ENST00000024061.3	37	CCDS34948.1																																																																																			.		0.622	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SLC9A3	6550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	474998	474998	+	Splice_Site	SNP	A	A	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:474998A>T	ENST00000264938.3	-	16	2510	c.2501T>A	c.(2500-2502)aTg>aAg	p.M834K	CTD-2228K2.5_ENST00000510714.1_5'Flank|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|SLC9A3_ENST00000514375.1_Splice_Site_p.M825K|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000342584.3_5'Flank	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	834					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GGAGCGTTACATGTGTGTGGA	0.711																																					p.M834K		.											.	SLC9A3	90	0			c.T2501A						.						7.0	8.0	8.0					5																	474998		2153	4209	6362	SO:0001630	splice_region_variant	6550	exon16			CGTTACATGTGTG		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2501+1T>A	5.37:g.474998A>T		23.0	0.0		68.0	20.0	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	A	14.41	2.527702	0.44969	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.56941	0.84;0.43	4.81	4.81	0.61882	.	0.922181	0.08928	N	0.873468	T	0.50463	0.1617	L	0.60455	1.87	0.42249	D	0.99196	P;P	0.49185	0.704;0.92	B;B	0.38106	0.104;0.265	T	0.51616	-0.8683	9	.	.	.	.	14.0272	0.64592	1.0:0.0:0.0:0.0	.	825;834	E9PF67;P48764	.;SL9A3_HUMAN	K	834;825	ENSP00000264938:M834K;ENSP00000422983:M825K	.	M	-	2	0	SLC9A3	527998	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	7.450000	0.80656	1.810000	0.52873	0.379000	0.24179	ATG	.		0.711	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	Missense_Mutation
SLX4	84464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	3651153	3651153	+	Silent	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr16:3651153C>A	ENST00000294008.3	-	5	1630	c.990G>T	c.(988-990)gtG>gtT	p.V330V		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	330	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GGATCTGAGGCACAGAAGGTC	0.488								Direct reversal of damage																													p.V330V		.											.	SLX4	94	0			c.G990T						.						110.0	103.0	105.0					16																	3651153		2197	4300	6497	SO:0001819	synonymous_variant	84464	exon5			CTGAGGCACAGAA	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.990G>T	16.37:g.3651153C>A		58.0	0.0		166.0	58.0	NM_032444	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	37	CCDS10506.2																																																																																			.		0.488	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112343665	112343665	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr10:112343665G>A	ENST00000361804.4	+	12	1162	c.1036G>A	c.(1036-1038)Gaa>Aaa	p.E346K		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	346					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AGAACTGGCAGAAACAGAACC	0.338																																					p.E346K		.											.	SMC3	92	0			c.G1036A						.						90.0	97.0	94.0					10																	112343665		2203	4300	6503	SO:0001583	missense	9126	exon12			CTGGCAGAAACAG	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1036G>A	10.37:g.112343665G>A	ENSP00000354720:p.Glu346Lys	89.0	0.0		311.0	101.0	NM_005445	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321619	0.60634	.	.	ENSG00000108055	ENST00000361804	T	0.78246	-1.16	5.52	5.52	0.82312	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.61813	0.2377	N	0.05554	-0.025	0.80722	D	1	B	0.23128	0.08	B	0.24269	0.052	T	0.57906	-0.7730	10	0.17369	T	0.5	.	18.4459	0.90683	0.0:0.0:1.0:0.0	.	346	Q9UQE7	SMC3_HUMAN	K	346	ENSP00000354720:E346K	ENSP00000354720:E346K	E	+	1	0	SMC3	112333655	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.916000	0.92745	2.589000	0.87451	0.650000	0.86243	GAA	.		0.338	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
SMG5	23381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156220788	156220788	+	Splice_Site	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:156220788C>A	ENST00000361813.5	-	21	2973		c.e21-1		PAQR6_ENST00000292291.5_5'Flank|PAQR6_ENST00000335852.1_5'Flank|PAQR6_ENST00000368270.1_5'Flank|PAQR6_ENST00000492619.1_5'Flank|PAQR6_ENST00000540423.1_5'Flank|SMG5_ENST00000368267.5_Intron|PAQR6_ENST00000356983.2_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					ATAGAGAGTCCTGGGGATGGG	0.612																																					.		.											.	SMG5	231	0			c.2829-1G>T						.						46.0	51.0	49.0					1																	156220788		2203	4300	6503	SO:0001630	splice_region_variant	23381	exon22			AGAGTCCTGGGGA	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2829-1G>T	1.37:g.156220788C>A		22.0	0.0		58.0	31.0	NM_015327	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Splice_Site	SNP	ENST00000361813.5	37	CCDS1137.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437754	0.62955	.	.	ENSG00000198952	ENST00000361813;ENST00000420555	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.641	0.77001	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMG5	154487412	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.028000	0.76470	2.359000	0.80004	0.655000	0.94253	.	.		0.612	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046308.1	NM_015327	Intron
SMOX	54498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	4163387	4163387	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr20:4163387G>T	ENST00000305958.4	+	5	1486	c.1261G>T	c.(1261-1263)Ggc>Tgc	p.G421C	SMOX_ENST00000346595.2_Intron|SMOX_ENST00000339123.6_Missense_Mutation_p.G368C|SMOX_ENST00000379460.2_Missense_Mutation_p.G421C|SMOX_ENST00000278795.3_Missense_Mutation_p.G368C	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	421					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	TGAGCGCTACGGCCATGTGCT	0.622																																					p.G421C		.											.	SMOX	153	0			c.G1261T						.						90.0	81.0	84.0					20																	4163387		2203	4300	6503	SO:0001583	missense	54498	exon5			CGCTACGGCCATG	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1261G>T	20.37:g.4163387G>T	ENSP00000307252:p.Gly421Cys	62.0	0.0		165.0	67.0	NM_175839	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	37	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883111	0.51908	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000379460;ENST00000457205	D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15	5.5	4.55	0.56014	Amine oxidase (1);	0.092562	0.85682	D	0.000000	D	0.95284	0.8470	L	0.60957	1.885	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.981;0.998	D	0.94976	0.8121	10	0.56958	D	0.05	-21.4086	11.8162	0.52211	0.0847:0.0:0.9153:0.0	.	345;421;421;368;368	B4DE63;Q9NWM0-6;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;SMOX_HUMAN;.;.	C	368;421;368;421;278	ENSP00000344595:G368C;ENSP00000307252:G421C;ENSP00000278795:G368C;ENSP00000368773:G421C;ENSP00000407269:G278C	ENSP00000278795:G368C	G	+	1	0	SMOX	4111387	1.000000	0.71417	0.946000	0.38457	0.433000	0.31745	9.863000	0.99569	1.340000	0.45581	0.650000	0.86243	GGC	.		0.622	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
SPATA31C1	441452	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	9	90535228	90535228	+	RNA	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr9:90535228G>A	ENST00000602681.1	+	0	1132							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGACCCGCCAGGTGAGGTGGG	0.597																																					p.G136S		.											.	.	.	0			c.G406A						.						56.0	69.0	65.0					9																	90535228		692	1590	2282			441452	exon4			CCGCCAGGTGAGG	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90535228G>A		123.0	0.0		348.0	187.0	NM_001145124		Missense_Mutation	SNP	ENST00000602681.1	37																																																																																				.		0.597	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
SPHK1	8877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74383503	74383503	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:74383503C>G	ENST00000545180.1	+	8	1800	c.991C>G	c.(991-993)Ccc>Gcc	p.P331A	SPHK1_ENST00000590959.1_Missense_Mutation_p.P345A|SPHK1_ENST00000592299.1_Missense_Mutation_p.P331A|SPHK1_ENST00000392496.3_Missense_Mutation_p.P331A|SPHK1_ENST00000323374.4_Missense_Mutation_p.P417A			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	331					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CCGCTTGGAGCCCAAGGATGG	0.577																																					p.P417A	GBM(90;966 1307 27369 33775 44498)	.											.	SPHK1	1107	0			c.C1249G						.						78.0	78.0	78.0					17																	74383503		2202	4300	6502	SO:0001583	missense	8877	exon6			TTGGAGCCCAAGG	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.991C>G	17.37:g.74383503C>G	ENSP00000440970:p.Pro331Ala	51.0	0.0		187.0	56.0	NM_182965	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	ENST00000545180.1	37	CCDS45785.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814537	0.50527	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.13538	2.58;2.58;2.58	5.08	4.11	0.48088	.	2.948360	0.02167	N	0.059323	T	0.47507	0.1449	M	0.85462	2.755	0.52501	D	0.999959	D;D;D	0.67145	0.993;0.987;0.996	P;P;D	0.70716	0.899;0.844;0.97	T	0.00468	-1.1721	10	0.72032	D	0.01	-12.5451	13.3258	0.60459	0.0:0.9235:0.0:0.0765	.	417;345;331	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	A	331;417;331;330	ENSP00000440970:P331A;ENSP00000313681:P417A;ENSP00000376285:P331A	ENSP00000313681:P417A	P	+	1	0	SPHK1	71895098	1.000000	0.71417	0.865000	0.33974	0.086000	0.17979	5.617000	0.67716	1.135000	0.42183	0.456000	0.33151	CCC	.		0.577	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
STEAP2	261729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	89854615	89854615	+	Silent	SNP	G	G	A	rs145786195		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr7:89854615G>A	ENST00000287908.3	+	2	612	c.219G>A	c.(217-219)gtG>gtA	p.V73V	STEAP2_ENST00000394622.2_Silent_p.V73V|STEAP2_ENST00000394632.1_Silent_p.V73V|STEAP2_ENST00000402625.2_Silent_p.V73V|STEAP2_ENST00000394621.2_Silent_p.V73V|STEAP2_ENST00000394626.1_Silent_p.V73V|STEAP2_ENST00000394629.2_Silent_p.V73V	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	73					copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					TTCCTCATGTGGTAGATGTCA	0.378																																					p.V73V		.											.	STEAP2	92	0			c.G219A						.						184.0	165.0	171.0					7																	89854615		2203	4300	6503	SO:0001819	synonymous_variant	261729	exon3			TCATGTGGTAGAT	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.219G>A	7.37:g.89854615G>A		93.0	0.0		160.0	51.0	NM_001244946	A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Silent	SNP	ENST00000287908.3	37	CCDS5615.1																																																																																			G|1.000;T|0.000		0.378	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059662.4	NM_152999	
SYT4	6860	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	40850324	40850324	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr18:40850324G>A	ENST00000255224.3	-	4	1628	c.1260C>T	c.(1258-1260)caC>caT	p.H420H	SYT4_ENST00000590752.1_Silent_p.H402H|SYT4_ENST00000586678.1_5'UTR	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	420					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CACAGAGCACGTGCCACTTGG	0.458																																					p.H420H	NSCLC(85;81 1419 2855 22820 35912)	.											.	SYT4	132	0			c.C1260T						.						187.0	193.0	191.0					18																	40850324		2203	4300	6503	SO:0001819	synonymous_variant	6860	exon4			GAGCACGTGCCAC	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.1260C>T	18.37:g.40850324G>A		79.0	0.0		172.0	10.0	NM_020783	B4DEU3|Q9P2K4	Silent	SNP	ENST00000255224.3	37	CCDS11922.1																																																																																			.		0.458	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
TBX10	347853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	67399113	67399113	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:67399113G>A	ENST00000335385.3	-	8	1208	c.1121C>T	c.(1120-1122)aCt>aTt	p.T374I	NUDT8_ENST00000301490.4_5'Flank|NUDT8_ENST00000376693.2_5'Flank	NM_005995.4	NP_005986.2	O75333	TBX10_HUMAN	T-box 10	374					anatomical structure morphogenesis (GO:0009653)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|lung(4)|ovary(1)	7						GCACACCACAGTGGGGGACAG	0.667																																					p.T374I		.											.	TBX10	90	0			c.C1121T						.						14.0	14.0	14.0					11																	67399113		2195	4282	6477	SO:0001583	missense	347853	exon8			ACCACAGTGGGGG	AH006177	CCDS31621.1	11q13.2	2005-10-11	2004-10-05		ENSG00000167800	ENSG00000167800		"""T-boxes"""	11593	protein-coding gene	gene with protein product		604648	"""T-box 7"""	TBX7		9545502	Standard	NM_005995		Approved	TBX13	uc001omp.3	O75333	OTTHUMG00000167291	ENST00000335385.3:c.1121C>T	11.37:g.67399113G>A	ENSP00000335191:p.Thr374Ile	12.0	0.0		44.0	18.0	NM_005995	Q14D64|Q86XS3	Missense_Mutation	SNP	ENST00000335385.3	37	CCDS31621.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.693808	0.30052	.	.	ENSG00000167800	ENST00000335385	D	0.86865	-2.18	3.58	2.63	0.31362	.	1.123250	0.07046	N	0.831045	T	0.79209	0.4407	N	0.24115	0.695	0.09310	N	1	P	0.45348	0.856	B	0.40477	0.33	T	0.70876	-0.4753	10	0.87932	D	0	.	7.4119	0.27021	0.1367:0.0:0.8633:0.0	.	374	O75333	TBX10_HUMAN	I	374	ENSP00000335191:T374I	ENSP00000335191:T374I	T	-	2	0	TBX10	67155689	0.010000	0.17322	0.027000	0.17364	0.005000	0.04900	1.897000	0.39799	1.719000	0.51432	0.561000	0.74099	ACT	.		0.667	TBX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394034.1	NM_005995	
SYTL2	54843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	85436897	85436897	+	Intron	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:85436897A>G	ENST00000528231.1	-	7	1737				SYTL2_ENST00000354566.3_Silent_p.N201N|SYTL2_ENST00000525423.1_Silent_p.N201N|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000359152.5_Silent_p.N725N	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GCCATGTCCTATTTTCAGAAA	0.403																																					p.N201N		.											.	SYTL2	137	0			c.T603C						.						137.0	126.0	130.0					11																	85436897		2203	4299	6502	SO:0001627	intron_variant	54843	exon1			TGTCCTATTTTCA	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+2041T>C	11.37:g.85436897A>G		134.0	0.0		451.0	158.0	NM_206927	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	ENST00000528231.1	37	CCDS53688.1																																																																																			.		0.403	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
TEP1	7011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20872028	20872028	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr14:20872028C>A	ENST00000262715.5	-	6	1088	c.1048G>T	c.(1048-1050)Gat>Tat	p.D350Y	TEP1_ENST00000556935.1_Intron	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	350	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TTATTCTTATCTCCCTCAGCC	0.517																																					p.D350Y		.											.	TEP1	95	0			c.G1048T						.						82.0	81.0	81.0					14																	20872028		2203	4300	6503	SO:0001583	missense	7011	exon6			TCTTATCTCCCTC		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1048G>T	14.37:g.20872028C>A	ENSP00000262715:p.Asp350Tyr	22.0	0.0		56.0	26.0	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	37	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857644	0.51376	.	.	ENSG00000129566	ENST00000262715;ENST00000359243	T	0.19250	2.16	5.69	2.87	0.33458	TROVE (2);	1.146690	0.06270	N	0.695529	T	0.19886	0.0478	L	0.29908	0.895	0.09310	N	1	P	0.52577	0.954	B	0.42282	0.382	T	0.33317	-0.9873	10	0.62326	D	0.03	0.1176	11.4947	0.50402	0.0:0.5666:0.349:0.0844	.	350	Q99973	TEP1_HUMAN	Y	350	ENSP00000262715:D350Y	ENSP00000262715:D350Y	D	-	1	0	TEP1	19941868	0.000000	0.05858	0.001000	0.08648	0.696000	0.40369	0.342000	0.19926	0.329000	0.23460	0.655000	0.94253	GAT	.		0.517	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
TGIF2LX	90316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	89177754	89177754	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chrX:89177754G>A	ENST00000561129.2	+	1	800	c.670G>A	c.(670-672)Gca>Aca	p.A224T	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.A224T			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	224					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						AGTCGATGCAGCAGTACAAAG	0.498																																					p.A224T		.											.	TGIF2LX	92	0			c.G670A						.						44.0	47.0	46.0					X																	89177754		2198	4293	6491	SO:0001583	missense	90316	exon2			GATGCAGCAGTAC	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.670G>A	X.37:g.89177754G>A	ENSP00000453704:p.Ala224Thr	78.0	0.0		275.0	216.0	NM_138960	Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553979	0.27739	.	.	ENSG00000153779	ENST00000283891	T	0.76060	-0.99	3.11	2.24	0.28232	.	0.671285	0.12355	N	0.476210	D	0.84051	0.5387	M	0.83483	2.645	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.70029	-0.4984	9	.	.	.	-20.3271	5.5631	0.17154	0.1575:0.0:0.8425:0.0	.	224	Q8IUE1	TF2LX_HUMAN	T	224	ENSP00000355119:A224T	.	A	+	1	0	TGIF2LX	89064410	0.990000	0.36364	0.011000	0.14972	0.004000	0.04260	4.421000	0.59848	0.723000	0.32274	0.415000	0.27848	GCA	.		0.498	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960	
TIGD7	91151	hgsc.bcm.edu;broad.mit.edu	37	16	3350520	3350536	+	Frame_Shift_Del	DEL	ATTACACTTTTAAGTGA	ATTACACTTTTAAGTGA	-	rs376508195		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	ATTACACTTTTAAGTGA	ATTACACTTTTAAGTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr16:3350520_3350536delATTACACTTTTAAGTGA	ENST00000396862.1	-	2	1907_1923	c.79_95delTCACTTAAAAGTGTAAT	c.(79-96)tcacttaaaagtgtaatgfs	p.SLKSVM27fs	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Frame_Shift_Del_p.SLKSVM27fs	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	27	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						AAATTCATCCATTACACTTTTAAGTGATCGTCCAGCT	0.336																																					p.27_32del		.											.	TIGD7	90	0			c.79_95del						.																																			SO:0001589	frameshift_variant	91151	exon2			TCATCCATTACAC	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.79_95delTCACTTAAAAGTGTAAT	16.37:g.3350520_3350536delATTACACTTTTAAGTGA	ENSP00000380071:p.Ser27fs	64.0	0.0		260.0	75.0	NM_033208	Q9BXZ0	Frame_Shift_Del	DEL	ENST00000396862.1	37	CCDS10500.1																																																																																			.		0.336	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208	
TNPO1	3842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	72144245	72144245	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:72144245G>T	ENST00000337273.5	+	2	475	c.49G>T	c.(49-51)Gag>Tag	p.E17*	TNPO1_ENST00000523768.1_Nonsense_Mutation_p.E17*|TNPO1_ENST00000447967.2_Nonsense_Mutation_p.E9*|TNPO1_ENST00000506351.2_Nonsense_Mutation_p.E9*|TNPO1_ENST00000513944.1_3'UTR|TNPO1_ENST00000454282.1_Nonsense_Mutation_p.E17*	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	17					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		GAAACCTGACGAGCAAGGGCT	0.547																																					p.E17X		.											.	TNPO1	228	0			c.G49T						.						98.0	88.0	91.0					5																	72144245		2203	4300	6503	SO:0001587	stop_gained	3842	exon2			CCTGACGAGCAAG	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.49G>T	5.37:g.72144245G>T	ENSP00000336712:p.Glu17*	43.0	0.0		99.0	21.0	NM_002270	B4DVC6|Q92957|Q92975	Nonsense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	G	33	5.259065	0.95368	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000447967;ENST00000523768;ENST00000506351	.	.	.	3.06	2.17	0.27698	.	0.112278	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-6.9146	10.1847	0.42991	0.1036:0.0:0.8964:0.0	.	.	.	.	X	17;17;9;17;9	.	ENSP00000336712:E17X	E	+	1	0	TNPO1	72180001	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	6.695000	0.74593	0.607000	0.29982	0.305000	0.20034	GAG	.		0.547	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
TRAM1L1	133022	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	118006517	118006517	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr4:118006517G>A	ENST00000310754.4	-	1	219	c.33C>T	c.(31-33)ccC>ccT	p.P11P		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	11					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						TGAGAACGGGGGGGTTCTTGG	0.627																																					p.P11P		.											.	TRAM1L1	90	0			c.C33T						.						50.0	49.0	49.0					4																	118006517		2203	4300	6503	SO:0001819	synonymous_variant	133022	exon1			AACGGGGGGGTTC	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.33C>T	4.37:g.118006517G>A		40.0	0.0		63.0	45.0	NM_152402	Q8N2L7	Silent	SNP	ENST00000310754.4	37	CCDS3707.1																																																																																			.		0.627	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
TRPA1	8989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	72966074	72966074	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:72966074G>C	ENST00000262209.4	-	13	1765	c.1558C>G	c.(1558-1560)Cat>Gat	p.H520D	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	520					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATGGACGCATGATGCAAAGCT	0.478																																					p.H520D		.											.	TRPA1	230	0			c.C1558G						.						66.0	55.0	59.0					8																	72966074		2203	4300	6503	SO:0001583	missense	8989	exon13			ACGCATGATGCAA	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1558C>G	8.37:g.72966074G>C	ENSP00000262209:p.His520Asp	49.0	0.0		151.0	24.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163430	0.57476	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.71461	-0.57;-0.57	5.35	4.47	0.54385	Ankyrin repeat-containing domain (4);	0.096049	0.64402	D	0.000001	T	0.80696	0.4672	M	0.73962	2.25	0.44227	D	0.997069	D	0.89917	1.0	D	0.77004	0.989	T	0.79006	-0.1979	10	0.36615	T	0.2	-17.8704	8.8632	0.35269	0.0745:0.0:0.7752:0.1503	.	520	O75762	TRPA1_HUMAN	D	372;520	ENSP00000428151:H372D;ENSP00000262209:H520D	ENSP00000262209:H520D	H	-	1	0	TRPA1	73128628	1.000000	0.71417	0.993000	0.49108	0.586000	0.36452	5.693000	0.68264	1.231000	0.43661	0.561000	0.74099	CAT	.		0.478	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	77400791	77400791	+	Splice_Site	SNP	A	A	G	rs142068228		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr9:77400791A>G	ENST00000360774.1	-	21	3155	c.2918T>C	c.(2917-2919)aTg>aCg	p.M973T	TRPM6_ENST00000361255.3_Splice_Site_p.M968T|TRPM6_ENST00000449912.2_Splice_Site_p.M968T|TRPM6_ENST00000451710.3_Splice_Site_p.M973T|TRPM6_ENST00000376864.4_Splice_Site_p.M973T|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000376871.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	973					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGTACTCACCATTTTTGCAAT	0.423																																					p.M973T		.											.	TRPM6	335	0			c.T2918C						.	A	THR/MET,THR/MET,THR/MET	0,4406		0,0,2203	139.0	140.0	140.0		2903,2903,2918	5.4	1.0	9	dbSNP_134	140	2,8598	2.2+/-6.3	0,2,4298	yes	missense-near-splice,missense-near-splice,missense-near-splice	TRPM6	NM_001177310.1,NM_001177311.1,NM_017662.4	81,81,81	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	968/2018,968/2018,973/2023	77400791	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	140803	exon21			CTCACCATTTTTG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.2919+1T>C	9.37:g.77400791A>G		48.0	0.0		99.0	58.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	A	19.47	3.834164	0.71373	0.0	2.33E-4	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	5.39	5.39	0.77823	Ion transport (1);	0.068830	0.85682	D	0.000000	D	0.87414	0.6171	M	0.94063	3.49	0.80722	D	1	D;B;P	0.54397	0.966;0.45;0.8	P;P;P	0.55871	0.786;0.555;0.691	D	0.90845	0.4726	10	0.87932	D	0	.	15.5669	0.76300	1.0:0.0:0.0:0.0	.	636;973;968	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	T	973;973;968;968;973;636;636	ENSP00000354006:M973T;ENSP00000407341:M973T;ENSP00000396672:M968T;ENSP00000354962:M968T;ENSP00000366060:M973T	ENSP00000309693:M636T	M	-	2	0	TRPM6	76590611	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.078000	0.94023	2.264000	0.75181	0.448000	0.29417	ATG	A|1.000;G|0.000		0.423	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	Missense_Mutation
TVP23C	201158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	15406424	15406424	+	Missense_Mutation	SNP	C	C	A	rs17850827		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:15406424C>A	ENST00000225576.3	-	6	680	c.585G>T	c.(583-585)agG>agT	p.R195S	TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000519970.1_Missense_Mutation_p.R152S	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	195				R -> S (in Ref. 4; AAH11952). {ECO:0000305}.		integral component of membrane (GO:0016021)											GATGAAACTTCCTCGAGGGAT	0.562																																					p.R195S		.											.	.	.	0			c.G585T						.						32.0	32.0	32.0					17																	15406424		2203	4300	6503	SO:0001583	missense	201158	exon6			AAACTTCCTCGAG	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.585G>T	17.37:g.15406424C>A	ENSP00000225576:p.Arg195Ser	29.0	0.0		64.0	41.0	NM_145301	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.482814	0.26598	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106	ENST00000557349;ENST00000519970;ENST00000225576	T	0.22336	1.96	1.71	1.71	0.24356	.	1.414060	0.04645	N	0.406015	T	0.10252	0.0251	N	0.11789	0.175	0.09310	N	1	B;B	0.33494	0.414;0.006	B;B	0.17979	0.02;0.003	T	0.18999	-1.0319	10	0.22706	T	0.39	.	6.893	0.24241	0.0:1.0:0.0:0.0	rs17850827	152;195	B4E0Q0;Q96ET8	.;F18B2_HUMAN	S	152;152;195	ENSP00000225576:R195S	ENSP00000225576:R195S	R	-	3	2	RP11-726O12.1;FAM18B2	15347149	0.005000	0.15991	0.020000	0.16555	0.035000	0.12851	-0.028000	0.12350	1.283000	0.44513	0.460000	0.39030	AGG	C|1.000;|0.000		0.562	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
UBE3B	89910	ucsc.edu;bcgsc.ca	37	12	109939174	109939174	+	Splice_Site	SNP	A	A	G			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr12:109939174A>G	ENST00000342494.3	+	13	1713		c.e13-1		UBE3B_ENST00000280774.5_Splice_Site|UBE3B_ENST00000434735.2_Splice_Site	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GCTCTCTCCTAGCCTTAACGA	0.542																																					.		.											.	UBE3B	660	0			c.1119-2A>G						.						206.0	191.0	196.0					12																	109939174		2203	4300	6503	SO:0001630	splice_region_variant	89910	exon13			TCTCCTAGCCTTA	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1119-1A>G	12.37:g.109939174A>G		29.0	0.0		44.0	5.0	NM_183415	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Splice_Site	SNP	ENST00000342494.3	37	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370796	0.61624	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5106	0.67784	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE3B	108423557	1.000000	0.71417	0.981000	0.43875	0.701000	0.40568	9.048000	0.93830	2.105000	0.64084	0.533000	0.62120	.	.		0.542	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	Intron
USP36	57602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76802273	76802273	+	Silent	SNP	G	G	A	rs372776119		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:76802273G>A	ENST00000542802.3	-	15	2624	c.2181C>T	c.(2179-2181)ccC>ccT	p.P727P	USP36_ENST00000312010.6_Silent_p.P727P|USP36_ENST00000588467.1_5'Flank|USP36_ENST00000449938.2_Silent_p.P427P			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	727					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			AGGCAACGACGGGGTGAGAGG	0.632																																					p.P727P		.											.	USP36	659	0			c.C2181T						.	G		1,4405	2.1+/-5.4	0,1,2202	89.0	82.0	85.0		2181	2.0	0.5	17		85	0,8600		0,0,4300	no	coding-synonymous	USP36	NM_025090.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		727/1124	76802273	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57602	exon15			AACGACGGGGTGA	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.2181C>T	17.37:g.76802273G>A		34.0	0.0		141.0	69.0	NM_025090	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	CCDS32755.1																																																																																			.		0.632	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090	
USP47	55031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	11927068	11927068	+	Silent	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr11:11927068T>C	ENST00000399455.2	+	9	1122	c.1002T>C	c.(1000-1002)taT>taC	p.Y334Y	USP47_ENST00000339865.5_Silent_p.Y246Y|USP47_ENST00000539466.1_5'UTR|USP47_ENST00000527733.1_Silent_p.Y314Y	NM_001282659.1	NP_001269588.1	Q96K76	UBP47_HUMAN	ubiquitin specific peptidase 47	334	USP.				base-excision repair (GO:0006284)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell growth (GO:0030307)|response to drug (GO:0042493)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-specific protease activity (GO:0004843)|WD40-repeat domain binding (GO:0071987)			breast(4)|endometrium(7)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46				Epithelial(150;0.000339)		TCCGACCTTATGGGTCCAGCC	0.448																																					p.Y246Y		.											.	USP47	660	0			c.T738C						.						168.0	172.0	171.0					11																	11927068		2040	4204	6244	SO:0001819	synonymous_variant	55031	exon7			ACCTTATGGGTCC	AK027362	CCDS41619.1, CCDS60725.1	11p15.2	2008-02-05	2005-08-08		ENSG00000170242	ENSG00000170242		"""Ubiquitin-specific peptidases"""	20076	protein-coding gene	gene with protein product		614460	"""Trf (TATA binding protein-related factor)-proximal homolog (Drosophila)"", ""ubiquitin specific protease 47"""			12838346	Standard	XM_005252997		Approved		uc001mjr.3	Q96K76	OTTHUMG00000165685	ENST00000399455.2:c.1002T>C	11.37:g.11927068T>C		86.0	0.0		230.0	89.0	NM_017944	B3KXF5|E9PM46|Q658U0|Q86Y73|Q8TEP6|Q9BWI0|Q9NWN1	Silent	SNP	ENST00000399455.2	37																																																																																				.		0.448	USP47-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000385853.2	NM_017944	
VIM	7431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	17277863	17277863	+	Silent	SNP	A	A	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr10:17277863A>T	ENST00000224237.5	+	7	1393	c.1248A>T	c.(1246-1248)ccA>ccT	p.P416P	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Silent_p.P416P			P08670	VIME_HUMAN	vimentin	416	Tail.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGCCTCTTCCAAACTTTTCCT	0.363																																					p.P416P		.											.	VIM	291	0			c.A1248T						.						147.0	128.0	135.0					10																	17277863		2203	4300	6503	SO:0001819	synonymous_variant	7431	exon8			TCTTCCAAACTTT	M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1248A>T	10.37:g.17277863A>T		114.0	0.0		391.0	151.0	NM_003380	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Silent	SNP	ENST00000224237.5	37	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	A	11.12	1.545864	0.27652	.	.	ENSG00000026025	ENST00000545533	.	.	.	5.49	-3.86	0.04230	.	.	.	.	.	T	0.59018	0.2163	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62388	-0.6865	5	0.41790	T	0.15	.	11.3631	0.49655	0.3546:0.5813:0.0641:0.0	.	.	.	.	L	403	.	ENSP00000439432:Q403L	Q	+	2	0	VIM	17317869	0.326000	0.24669	0.973000	0.42090	0.998000	0.95712	-0.124000	0.10595	-0.403000	0.07622	0.523000	0.50628	CAA	.		0.363	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
VTN	7448	broad.mit.edu;bcgsc.ca	37	17	26694414	26694414	+	Silent	SNP	G	G	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr17:26694414G>C	ENST00000226218.4	-	8	2031	c.1413C>G	c.(1411-1413)ggC>ggG	p.G471G	VTN_ENST00000438614.1_Intron|CTB-96E2.3_ENST00000591482.1_RNA|CTB-96E2.2_ENST00000555059.2_Intron|VTN_ENST00000536498.1_Intron|TMEM199_ENST00000509083.1_Intron|VTN_ENST00000431468.1_5'Flank|SARM1_ENST00000379061.4_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	471					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GAGCTGGGCAGCCCAGCCAGT	0.612																																					p.G471G		.											.	VTN	227	0			c.C1413G						.						81.0	72.0	75.0					17																	26694414		2203	4300	6503	SO:0001819	synonymous_variant	7448	exon8			TGGGCAGCCCAGC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.1413C>G	17.37:g.26694414G>C		29.0	2.0		95.0	38.0	NM_000638	B2R7G0|P01141|Q9BSH7	Silent	SNP	ENST00000226218.4	37	CCDS11229.1																																																																																			.		0.612	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
WWC1	23286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	167891765	167891765	+	Missense_Mutation	SNP	G	G	A	rs139653620		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr5:167891765G>A	ENST00000265293.4	+	21	3450	c.2948G>A	c.(2947-2949)cGt>cAt	p.R983H	WWC1_ENST00000521089.1_Missense_Mutation_p.R989H|WWC1_ENST00000522140.1_3'UTR	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	983	Interaction with PRKCZ.|Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)	p.R983H(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CGCTCCGAGCGTCTGATCCGT	0.602																																					p.R989H		.											WWC1,NS,carcinoma,0	WWC1	157	1	Substitution - Missense(1)	ovary(1)	c.G2966A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	54.0	53.0	53.0		2966,2966,2948	4.1	1.0	5	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	WWC1	NM_001161661.1,NM_001161662.1,NM_015238.2	29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	989/1120,989/1119,983/1114	167891765	1,13005	2203	4300	6503	SO:0001583	missense	23286	exon21			CCGAGCGTCTGAT	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2948G>A	5.37:g.167891765G>A	ENSP00000265293:p.Arg983His	39.0	0.0		194.0	53.0	NM_001161662	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	ENST00000265293.4	37	CCDS4366.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760611	0.31137	0.0	1.16E-4	ENSG00000113645	ENST00000265293;ENST00000521089;ENST00000524038	T;T;T	0.42131	0.98;0.98;0.98	4.99	4.12	0.48240	.	0.129675	0.56097	D	0.000032	T	0.30947	0.0781	L	0.33485	1.01	0.50632	D	0.999882	B;B	0.21821	0.061;0.01	B;B	0.16722	0.016;0.005	T	0.05971	-1.0853	10	0.18276	T	0.48	.	13.4327	0.61064	0.076:0.0:0.924:0.0	.	989;983	Q8IX03-2;Q8IX03	.;KIBRA_HUMAN	H	983;989;315	ENSP00000265293:R983H;ENSP00000427772:R989H;ENSP00000428084:R315H	ENSP00000265293:R983H	R	+	2	0	WWC1	167824343	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	5.504000	0.66968	1.106000	0.41623	0.442000	0.29010	CGT	G|1.000;A|0.000		0.602	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
YTHDF3	253943	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	64098980	64098980	+	Silent	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:64098980G>A	ENST00000539294.1	+	4	724	c.408G>A	c.(406-408)ggG>ggA	p.G136G	YTHDF3_ENST00000517371.1_Intron|YTHDF3_ENST00000542911.2_5'UTR|YTHDF3_ENST00000521674.1_3'UTR	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	137							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			CTACATGGGGGACAAGTGGAT	0.428																																					.		.											.	.	.	0			.						.						79.0	74.0	76.0					8																	64098980		1892	4129	6021	SO:0001819	synonymous_variant	253943	.			ATGGGGGACAAGT	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.408G>A	8.37:g.64098980G>A		122.0	0.0		770.0	176.0	.	B3KXL4|Q63Z37|Q659A3	Silent	SNP	ENST00000539294.1	37																																																																																				.		0.428	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152758	
ZDHHC19	131540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195935366	195935366	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:195935366C>T	ENST00000296326.3	-	4	553	c.474G>A	c.(472-474)atG>atA	p.M158I	ZDHHC19_ENST00000488508.1_5'UTR	NM_001039617.1	NP_001034706.1	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC-type containing 19	158						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(7)|ovary(3)	14	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		GGACAAGCAGCATGAAGAAGC	0.597																																					p.M158I		.											.	ZDHHC19	93	0			c.G474A						.						126.0	146.0	139.0					3																	195935366		2192	4282	6474	SO:0001583	missense	131540	exon4			AAGCAGCATGAAG	BC022078	CCDS43190.1	3q29	2008-05-02			ENSG00000163958	ENSG00000163958		"""Zinc fingers, DHHC-type"""	20713	protein-coding gene	gene with protein product							Standard	XR_246038		Approved	MGC33345	uc003fwc.3	Q8WVZ1	OTTHUMG00000133642	ENST00000296326.3:c.474G>A	3.37:g.195935366C>T	ENSP00000296326:p.Met158Ile	81.0	0.0		269.0	91.0	NM_001039617	A8MSY6|B3KVI1	Missense_Mutation	SNP	ENST00000296326.3	37	CCDS43190.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485295	0.63962	.	.	ENSG00000163958	ENST00000296326	T	0.20881	2.04	5.61	4.68	0.58851	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.368313	0.26635	N	0.023291	T	0.11324	0.0276	N	0.11845	0.185	0.31438	N	0.672257	P	0.35656	0.514	B	0.31016	0.123	T	0.06427	-1.0827	10	0.48119	T	0.1	-23.8633	11.6545	0.51309	0.0:0.8214:0.1786:0.0	.	158	Q8WVZ1	ZDH19_HUMAN	I	158	ENSP00000296326:M158I	ENSP00000296326:M158I	M	-	3	0	ZDHHC19	197419763	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.782000	0.47758	2.638000	0.89438	0.561000	0.74099	ATG	.		0.597	ZDHHC19-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341533.1	NM_144637	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77767241	77767241	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:77767241G>T	ENST00000521891.2	+	10	8532	c.8084G>T	c.(8083-8085)cGc>cTc	p.R2695L	ZFHX4_ENST00000455469.2_Missense_Mutation_p.R2650L|ZFHX4_ENST00000050961.6_Missense_Mutation_p.R2650L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.R2669L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2650					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGCCACATTCGCTCTCGGCAC	0.527										HNSCC(33;0.089)																											p.R2695L		.											.	ZFHX4	98	0			c.G8084T						.						55.0	55.0	55.0					8																	77767241		1952	4139	6091	SO:0001583	missense	79776	exon10			ACATTCGCTCTCG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8084G>T	8.37:g.77767241G>T	ENSP00000430497:p.Arg2695Leu	36.0	0.0		175.0	36.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947965	0.34377	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.45361	U	0.000364	T	0.50188	0.1601	L	0.47716	1.5	0.80722	D	1	D;P;D	0.57571	0.965;0.956;0.98	D;D;D	0.69307	0.963;0.939;0.961	T	0.46162	-0.9211	10	0.59425	D	0.04	.	18.8803	0.92353	0.0:0.0:1.0:0.0	.	2650;2650;2695	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	L	2695;2679;2650;2650;2669	ENSP00000430497:R2695L;ENSP00000399605:R2650L;ENSP00000050961:R2650L;ENSP00000430848:R2669L	ENSP00000050961:R2650L	R	+	2	0	ZFHX4	77929796	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	9.657000	0.98554	2.695000	0.91970	0.555000	0.69702	CGC	.		0.527	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFP64	55734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50769740	50769740	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr20:50769740G>A	ENST00000216923.4	-	6	1340	c.991C>T	c.(991-993)Cgg>Tgg	p.R331W	ZFP64_ENST00000346617.4_Missense_Mutation_p.R277W|ZFP64_ENST00000371515.4_Missense_Mutation_p.R329W|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000477786.1_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CTGTGCTTCCGGAGGGTGGCT	0.582																																					p.R331W		.											.	ZFP64	155	0			c.C991T						.						114.0	105.0	108.0					20																	50769740		2203	4300	6503	SO:0001583	missense	55734	exon6			GCTTCCGGAGGGT	AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.991C>T	20.37:g.50769740G>A	ENSP00000216923:p.Arg331Trp	78.0	0.0		244.0	101.0	NM_018197	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	ENST00000216923.4	37	CCDS13440.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.886396	0.91814	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083;ENST00000371516	T;T;T	0.16196	2.36;2.36;2.36	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.53938	D	0.000042	T	0.51500	0.1678	M	0.88906	2.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.99;0.993;0.994	T	0.55792	-0.8085	10	0.54805	T	0.06	-27.0779	20.0381	0.97570	0.0:0.0:1.0:0.0	.	277;329;331	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	W	331;277;329;173;484	ENSP00000216923:R331W;ENSP00000344615:R277W;ENSP00000360570:R329W	ENSP00000216923:R331W	R	-	1	2	ZFP64	50203147	1.000000	0.71417	0.928000	0.36995	0.996000	0.88848	7.639000	0.83342	2.740000	0.93945	0.609000	0.83330	CGG	.		0.582	ZFP64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079744.1	NM_018197	
ZFYVE20	64145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	15115343	15115343	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr3:15115343C>A	ENST00000253699.3	-	14	2914	c.2301G>T	c.(2299-2301)gaG>gaT	p.E767D	ZFYVE20_ENST00000476527.2_Missense_Mutation_p.E767D	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	767	Necessary for the interaction with EHD1.|Necessary for the interaction with RAB5A.				blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						CCCGCAGATTCTCTGTCAGCA	0.592																																					p.E767D		.											.	ZFYVE20	92	0			c.G2301T						.						69.0	64.0	66.0					3																	15115343		2203	4300	6503	SO:0001583	missense	64145	exon14			CAGATTCTCTGTC	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.2301G>T	3.37:g.15115343C>A	ENSP00000253699:p.Glu767Asp	50.0	0.0		143.0	56.0	NM_022340	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	ENST00000253699.3	37	CCDS2623.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539092	0.45176	.	.	ENSG00000131381	ENST00000253699;ENST00000476527	T;T	0.47177	0.85;0.85	5.49	2.74	0.32292	.	0.151633	0.56097	D	0.000025	T	0.45577	0.1349	L	0.38838	1.175	0.80722	D	1	P	0.50819	0.939	P	0.51453	0.67	T	0.41822	-0.9487	10	0.72032	D	0.01	-15.3114	9.4222	0.38559	0.0:0.7149:0.0:0.2851	.	767	Q9H1K0	RBNS5_HUMAN	D	767	ENSP00000253699:E767D;ENSP00000422551:E767D	ENSP00000253699:E767D	E	-	3	2	ZFYVE20	15090347	0.999000	0.42202	0.997000	0.53966	0.956000	0.61745	0.732000	0.26072	0.685000	0.31468	-0.216000	0.12614	GAG	.		0.592	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	NM_022340	
ZHX1	11244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	124267557	124267557	+	Silent	SNP	T	T	C			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr8:124267557T>C	ENST00000522655.1	-	3	1170	c.630A>G	c.(628-630)aaA>aaG	p.K210K	ZHX1_ENST00000522595.1_5'Flank|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Silent_p.K210K|ZHX1_ENST00000297857.2_Silent_p.K210K			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	210					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TTTCATTCTCTTTCTCTTCAG	0.338																																					p.K210K		.											.	ZHX1	91	0			c.A630G						.						97.0	101.0	100.0					8																	124267557		2203	4300	6503	SO:0001819	synonymous_variant	11244	exon3			ATTCTCTTTCTCT	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.630A>G	8.37:g.124267557T>C		109.0	0.0		608.0	126.0	NM_007222	Q8IWD8	Silent	SNP	ENST00000522655.1	37	CCDS6342.1																																																																																			.		0.338	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000381759.1		
ZNF414	84330	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	8576572	8576572	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:8576572C>A	ENST00000255616.8	-	5	904	c.803G>T	c.(802-804)cGc>cTc	p.R268L	ZNF414_ENST00000393927.4_Missense_Mutation_p.R268L	NM_032370.2	NP_115746.2	Q96IQ9	ZN414_HUMAN	zinc finger protein 414	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(2)	2						GGGGCGCAGGCGCGGGGGGCT	0.721																																					p.R268L		.											.	ZNF414	90	0			c.G803T						.						4.0	6.0	5.0					19																	8576572		1937	3866	5803	SO:0001583	missense	84330	exon5			CGCAGGCGCGGGG	AK074191	CCDS12205.1, CCDS54211.1	19p13.2	2008-02-05				ENSG00000133250		"""Zinc fingers, C2H2-type"""	20630	protein-coding gene	gene with protein product							Standard	NM_032370		Approved	MGC15716, Zfp414	uc002mke.4	Q96IQ9		ENST00000255616.8:c.803G>T	19.37:g.8576572C>A	ENSP00000255616:p.Arg268Leu	11.0	0.0		34.0	19.0	NM_032370	A8MY94	Missense_Mutation	SNP	ENST00000255616.8	37	CCDS12205.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936398	0.73442	.	.	ENSG00000133250	ENST00000393927;ENST00000255616	T;T	0.15372	2.43;2.43	4.52	4.52	0.55395	.	0.315541	0.29684	N	0.011468	T	0.30634	0.0771	L	0.34521	1.04	0.47037	D	0.999291	D;D	0.67145	0.996;0.996	D;D	0.76575	0.988;0.988	T	0.04664	-1.0935	10	0.87932	D	0	-15.5975	14.3255	0.66518	0.0:1.0:0.0:0.0	.	268;268	Q96IQ9;A8MY94	ZN414_HUMAN;.	L	268	ENSP00000377504:R268L;ENSP00000255616:R268L	ENSP00000255616:R268L	R	-	2	0	ZNF414	8482572	1.000000	0.71417	0.998000	0.56505	0.343000	0.28985	3.404000	0.52623	2.234000	0.73211	0.491000	0.48974	CGC	.		0.721	ZNF414-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460199.2	NM_032370	
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	31038933	31038933	+	Missense_Mutation	SNP	C	C	T	rs140147461		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:31038933C>T	ENST00000355537.3	+	4	2554	c.2407C>T	c.(2407-2409)Cgg>Tgg	p.R803W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	803					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCGACACCATCGGGAGCGGCA	0.527													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17421	0.0		0.0	False		,,,				2504	0.0				p.R803W		.											.	ZNF536	144	0			c.C2407T						.	C	TRP/ARG	0,4406		0,0,2203	68.0	74.0	72.0		2407	4.9	1.0	19	dbSNP_134	72	4,8596	3.7+/-12.6	1,2,4297	yes	missense	ZNF536	NM_014717.1	101	1,2,6500	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging	803/1301	31038933	4,13002	2203	4300	6503	SO:0001583	missense	9745	exon4			CACCATCGGGAGC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2407C>T	19.37:g.31038933C>T	ENSP00000347730:p.Arg803Trp	37.0	0.0		118.0	47.0	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977216	0.53720	0.0	4.65E-4	ENSG00000198597	ENST00000355537	T	0.08008	3.14	5.98	4.89	0.63831	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.052467	0.85682	D	0.000000	T	0.18718	0.0449	L	0.34521	1.04	0.53688	D	0.999975	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.00183	-1.1945	10	0.62326	D	0.03	-29.0327	13.8314	0.63382	0.2675:0.7325:0.0:0.0	.	803;803	A7E228;O15090	.;ZN536_HUMAN	W	803	ENSP00000347730:R803W	ENSP00000347730:R803W	R	+	1	2	ZNF536	35730773	0.989000	0.36119	0.999000	0.59377	0.793000	0.44817	1.837000	0.39201	2.837000	0.97791	0.591000	0.81541	CGG	C|1.000;T|0.000		0.527	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF606	80095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58489830	58489830	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:58489830G>A	ENST00000341164.4	-	7	2838	c.2218C>T	c.(2218-2220)Cat>Tat	p.H740Y	ZNF606_ENST00000536132.1_Missense_Mutation_p.H650Y	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	740					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TTTTCACAATGATTACATTTG	0.358																																					p.H740Y		.											.	ZNF606	92	0			c.C2218T						.						129.0	136.0	134.0					19																	58489830		2203	4300	6503	SO:0001583	missense	80095	exon7			CACAATGATTACA	AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.2218C>T	19.37:g.58489830G>A	ENSP00000343617:p.His740Tyr	100.0	0.0		269.0	11.0	NM_025027	A8KAN2|Q8NE04|Q96JH5	Missense_Mutation	SNP	ENST00000341164.4	37	CCDS12968.1	.	.	.	.	.	.	.	.	.	.	G	6.692	0.496343	0.12762	.	.	ENSG00000166704	ENST00000341164;ENST00000536132	T;T	0.07216	3.21;3.21	4.55	4.55	0.56014	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.148462	0.31577	N	0.007412	T	0.08802	0.0218	N	0.12637	0.245	0.09310	N	1	D	0.53619	0.961	P	0.51701	0.677	T	0.12967	-1.0527	10	0.87932	D	0	.	11.5434	0.50679	0.0:0.2978:0.7022:0.0	.	740	Q8WXB4	ZN606_HUMAN	Y	740;650	ENSP00000343617:H740Y;ENSP00000445624:H650Y	ENSP00000343617:H740Y	H	-	1	0	ZNF606	63181642	0.000000	0.05858	0.976000	0.42696	0.987000	0.75469	-0.365000	0.07573	2.492000	0.84095	0.650000	0.86243	CAT	.		0.358	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405961.1	NM_025027	
ZNF644	84146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	91405648	91405648	+	Silent	SNP	C	C	T	rs78456645	byFrequency	TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:91405648C>T	ENST00000370440.1	-	3	1480	c.1263G>A	c.(1261-1263)gaG>gaA	p.E421E	ZNF644_ENST00000337393.5_Silent_p.E421E|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGTGCTTCTTCTCCCTAAAAT	0.423													C|||	8	0.00159744	0.0061	0.0	5008	,	,		20873	0.0		0.0	False		,,,				2504	0.0				p.E421E		.											.	ZNF644	155	0			c.G1263A						.	C	,,	27,4379	31.7+/-61.6	0,27,2176	115.0	116.0	116.0		,,1263	4.7	1.0	1	dbSNP_132	116	0,8600		0,0,4300	no	intron,intron,coding-synonymous	ZNF644	NM_016620.3,NM_032186.4,NM_201269.2	,,	0,27,6476	TT,TC,CC		0.0,0.6128,0.2076	,,	,,421/1328	91405648	27,12979	2203	4300	6503	SO:0001819	synonymous_variant	84146	exon3			CTTCTTCTCCCTA	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1263G>A	1.37:g.91405648C>T		90.0	0.0		170.0	76.0	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	ENST00000370440.1	37	CCDS731.1																																																																																			C|0.997;T|0.003		0.423	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
ZNF676	163223	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	22363957	22363958	+	Frame_Shift_Del	DEL	TA	TA	-	rs386807906		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:22363957_22363958delTA	ENST00000397121.2	-	3	878_879	c.561_562delTA	c.(559-564)tataagfs	p.YK187fs		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	187				TLTYYKSI -> NLMEHKRV (in Ref. 2; BAC05174). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TGAATACTCTTATAATAAGTAA	0.347																																					p.187_188del		.											.	ZNF676	90	0			c.561_562del						.																																			SO:0001589	frameshift_variant	163223	exon3			TACTCTTATAATA	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.561_562delTA	19.37:g.22363959_22363960delTA	ENSP00000380310:p.Tyr187fs	61.0	0.0		110.0	30.0	NM_001001411	A8MVX5	Frame_Shift_Del	DEL	ENST00000397121.2	37	CCDS42539.1																																																																																			.		0.347	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
ZNF687	57592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151260007	151260007	+	Silent	SNP	C	C	T			TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:151260007C>T	ENST00000368879.2	+	2	1338	c.1240C>T	c.(1240-1242)Ctg>Ttg	p.L414L		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGCCATGCTGATGGCAGC	0.597																																					p.L414L		.											.	ZNF687	92	0			c.C1240T						.						45.0	42.0	43.0					1																	151260007		2203	4300	6503	SO:0001819	synonymous_variant	57592	exon2			GCCATGCTGATGG		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.1240C>T	1.37:g.151260007C>T		19.0	0.0		71.0	26.0	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	ENST00000368879.2	37																																																																																				.		0.597	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
ZNF790	388536	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	37309866	37309869	+	Frame_Shift_Del	DEL	AAGA	AAGA	-	rs199677584		TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	AAGA	AAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:37309866_37309869delAAGA	ENST00000356725.4	-	5	1497_1500	c.1377_1380delTCTT	c.(1375-1380)tttcttfs	p.FL459fs	CTD-2162K18.5_ENST00000588906.1_RNA|CTD-2162K18.5_ENST00000587278.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	459					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CTGAGCCATGAAGAAAGGTCTTTC	0.377																																					p.459_460del		.											.	ZNF790	92	0			c.1377_1380del						.																																			SO:0001589	frameshift_variant	388536	exon5			GCCATGAAGAAAG	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1377_1380delTCTT	19.37:g.37309866_37309869delAAGA	ENSP00000349161:p.Phe459fs	68.0	0.0		174.0	51.0	NM_206894		Frame_Shift_Del	DEL	ENST00000356725.4	37	CCDS12496.1																																																																																			.		0.377	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385341.2	NM_206894	
ZNF676	163223	hgsc.bcm.edu;bcgsc.ca	37	19	22363952	22363953	+	Missense_Mutation	DNP	AC	AC	TA	rs537289839|rs570225845	byFrequency	TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr19:22363952_22363953AC>TA	ENST00000397121.2	-	3	883_884	c.566_567GT>TA	c.(565-567)aGT>aTA	p.S189I		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	189				TLTYYKSI -> NLMEHKRV (in Ref. 2; BAC05174). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CAGTATGAATACTCTTATAATA	0.342																																					p.S189I		.											.	.	.	0			.						.																																			SO:0001583	missense	163223	.			ATGAATACTCTTA	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.566_567delinsTA	19.37:g.22363952_22363953delinsTA	ENSP00000380310:p.Ser189Ile	60.0	0.0		98.0	31.0	.	A8MVX5	Missense_Mutation	DNP	ENST00000397121.2	37	CCDS42539.1																																																																																			.		0.342	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
OR2T4	127074	ucsc.edu;bcgsc.ca	37	1	248525290	248525291	+	Missense_Mutation	DNP	CG	CG	TC	rs386642002|rs28540568|rs374193555|rs141576206|rs57728407|rs202028348	byFrequency	TCGA-DD-A116-01A-11D-A12Z-10	TCGA-DD-A116-10A-01D-A12Z-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	62bed857-df38-4647-9db4-b95bca893cfb	3e8275bd-f6e8-43cc-956f-83a6c36c0b09	g.chr1:248525290_248525291CG>TC	ENST00000366475.1	+	1	408_409	c.408_409CG>TC	c.(406-411)taCGtg>taTCtg	p.V137L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y136*(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTTCTTCTACGTGACACTAGC	0.52																																					p.V137L		.											.	.	.	1	Substitution - Nonsense(1)	lung(1)	.						.																																			SO:0001583	missense	127074	.			CTTCTACGTGACA	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	Exception_encountered	1.37:g.248525290_248525291delinsTC	ENSP00000355431:p.Val137Leu	151.0	0.0		817.0	157.0	.	Q6IEZ8	Missense_Mutation	DNP	ENST00000366475.1	37	CCDS31113.1																																																																																			.		0.520	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
