#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AARS2	57505	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44272531	44272531	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:44272531C>G	ENST00000244571.4	-	12	1605	c.1603G>C	c.(1603-1605)Gtg>Ctg	p.V535L	RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGTTGCAACACCTGGGCCTCA	0.607											OREG0017473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V535L		.											.	AARS2	91	0			c.G1603C						.						42.0	43.0	43.0					6																	44272531		2203	4300	6503	SO:0001583	missense	57505	exon12			GCAACACCTGGGC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1603G>C	6.37:g.44272531C>G	ENSP00000244571:p.Val535Leu	72.0	1.0	922	229.0	33.0	NM_020745		Missense_Mutation	SNP	ENST00000244571.4	37	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078322	0.76528	.	.	ENSG00000124608	ENST00000244571	T	0.74526	-0.85	5.87	4.82	0.62117	Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.274115	0.36409	N	0.002602	T	0.63010	0.2475	L	0.59436	1.845	0.46586	D	0.999113	P	0.47604	0.898	B	0.41440	0.357	T	0.70861	-0.4757	10	0.66056	D	0.02	-23.2869	13.0404	0.58895	0.0:0.8701:0.0:0.1299	.	535	Q5JTZ9	SYAM_HUMAN	L	535	ENSP00000244571:V535L	ENSP00000244571:V535L	V	-	1	0	AARS2	44380509	0.997000	0.39634	0.998000	0.56505	0.944000	0.59088	2.386000	0.44380	2.781000	0.95711	0.511000	0.50034	GTG	.		0.607	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48559835	48559835	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:48559835A>G	ENST00000435803.1	+	53	14020	c.13996A>G	c.(13996-13998)Aca>Gca	p.T4666A	ABCA13_ENST00000544596.1_Missense_Mutation_p.T396A	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4666					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTCGCAGGGCACAGTACTTCT	0.522																																					p.T4666A		.											.	ABCA13	521	0			c.A13996G						.						74.0	69.0	71.0					7																	48559835		1944	4151	6095	SO:0001583	missense	154664	exon53			CAGGGCACAGTAC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13996A>G	7.37:g.48559835A>G	ENSP00000411096:p.Thr4666Ala	98.0	0.0		275.0	92.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.339449	0.41398	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.85629	-2.01;-2.01;-2.01	5.32	4.15	0.48705	.	0.132497	0.34268	N	0.004104	D	0.84179	0.5415	L	0.45470	1.425	0.35129	D	0.76778	B;P;D	0.58970	0.187;0.459;0.984	B;B;P	0.54706	0.074;0.225;0.759	T	0.83121	-0.0118	10	0.16896	T	0.51	.	9.6005	0.39601	0.8441:0.0:0.0:0.1559	.	396;2368;4666	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	A	4666;439;396	ENSP00000411096:T4666A;ENSP00000391042:T439A;ENSP00000442634:T396A	ENSP00000391042:T439A	T	+	1	0	ABCA13	48530381	0.994000	0.37717	0.907000	0.35723	0.137000	0.21094	2.250000	0.43178	0.845000	0.35118	0.533000	0.62120	ACA	.		0.522	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ADH1C	126	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100266044	100266044	+	RNA	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:100266044T>C	ENST00000510055.1	-	0	716				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	TGCAGACCCATAACCAGTCGA	0.478																																					.		.											.	.	.	0			.						.						98.0	97.0	98.0					4																	100266044		2203	4300	6503			126	.			GACCCATAACCAG	M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100266044T>C		99.0	0.0		159.0	113.0	.	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	RNA	SNP	ENST00000510055.1	37																																																																																				.		0.478	ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	polymorphic_pseudogene	OTTHUMT00000365189.2	NM_000669	
AHNAK2	113146	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105418058	105418058	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:105418058C>G	ENST00000333244.5	-	7	3849	c.3730G>C	c.(3730-3732)Ggg>Cgg	p.G1244R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1244						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCAGGTGCCCTTTGAAGCCG	0.637																																					p.G1244R		.											.	AHNAK2	47	0			c.G3730C						.						80.0	64.0	69.0					14																	105418058		1817	3374	5191	SO:0001583	missense	113146	exon7			GGTGCCCTTTGAA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3730G>C	14.37:g.105418058C>G	ENSP00000353114:p.Gly1244Arg	41.0	1.0		63.0	54.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	10.44	1.350498	0.24512	.	.	ENSG00000185567	ENST00000333244	T	0.01584	4.75	4.29	4.29	0.51040	.	.	.	.	.	T	0.11537	0.0281	M	0.92691	3.335	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.24693	-1.0153	9	0.15952	T	0.53	.	10.1539	0.42812	0.0:0.8998:0.0:0.1002	.	1244	Q8IVF2	AHNK2_HUMAN	R	1244	ENSP00000353114:G1244R	ENSP00000353114:G1244R	G	-	1	0	AHNAK2	104489103	.	.	0.014000	0.15608	0.011000	0.07611	.	.	1.957000	0.56846	0.491000	0.48974	GGG	.		0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AKAP8L	26993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15512065	15512065	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr19:15512065C>T	ENST00000397410.5	-	5	842	c.712G>A	c.(712-714)Ggt>Agt	p.G238S	AKAP8L_ENST00000595879.1_5'UTR|AKAP8L_ENST00000595465.2_Missense_Mutation_p.G177S	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	238						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						GCGCCCCCACCTCGCATGCCC	0.647																																					p.G238S		.											.	AKAP8L	1	0			c.G712A						.						87.0	101.0	97.0					19																	15512065		1947	4138	6085	SO:0001583	missense	26993	exon5			CCCCACCTCGCAT	BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.712G>A	19.37:g.15512065C>T	ENSP00000380557:p.Gly238Ser	19.0	0.0		22.0	17.0	NM_014371	B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Missense_Mutation	SNP	ENST00000397410.5	37	CCDS46005.1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678657	0.68042	.	.	ENSG00000011243	ENST00000397410	T	0.58652	0.32	4.74	4.74	0.60224	.	0.061125	0.64402	D	0.000005	T	0.69797	0.3151	L	0.49778	1.585	0.34874	D	0.743843	D;D;D;D	0.89917	0.996;1.0;0.995;0.996	D;D;D;P	0.87578	0.933;0.998;0.922;0.875	T	0.76785	-0.2831	10	0.42905	T	0.14	-11.5322	14.6587	0.68852	0.0:1.0:0.0:0.0	.	177;8;238;238	B4DJ74;Q9UF73;B3KMD4;Q9ULX6	.;.;.;AKP8L_HUMAN	S	238	ENSP00000380557:G238S	ENSP00000380557:G238S	G	-	1	0	AKAP8L	15373065	1.000000	0.71417	0.814000	0.32528	0.670000	0.39368	5.810000	0.69179	2.194000	0.70268	0.491000	0.48974	GGT	.		0.647	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461301.2	NM_014371	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	114278315	114278315	+	Silent	SNP	A	A	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:114278315A>T	ENST00000357077.4	+	38	8594	c.8541A>T	c.(8539-8541)tcA>tcT	p.S2847S	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Silent_p.S2814S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2847					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTTCATCTTCATCCTCTTTGC	0.403																																					p.S2847S		.											.	ANK2	583	0			c.A8541T						.						108.0	107.0	108.0					4																	114278315		2203	4300	6503	SO:0001819	synonymous_variant	287	exon38			ATCTTCATCCTCT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.8541A>T	4.37:g.114278315A>T		67.0	0.0		212.0	76.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1																																																																																			.		0.403	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANKRD20A1	84210	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	67968357	67968357	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:67968357A>T	ENST00000377477.2	+	15	2028	c.1916A>T	c.(1915-1917)gAt>gTt	p.D639V	RP11-195B21.3_ENST00000417488.1_5'Flank	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	639						plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						AGAACACGAGATGTTTCTGTA	0.338																																					p.D639V		.											.	ANKRD20A1	68	0			c.A1916T						.						51.0	51.0	51.0					9																	67968357		2184	4267	6451	SO:0001583	missense	84210	exon15			CACGAGATGTTTC	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.1916A>T	9.37:g.67968357A>T	ENSP00000366697:p.Asp639Val	165.0	0.0		1051.0	289.0	NM_032250	Q9H0H6	Missense_Mutation	SNP	ENST00000377477.2	37	CCDS6620.1	.	.	.	.	.	.	.	.	.	.	.	8.770	0.925587	0.18056	.	.	ENSG00000196774	ENST00000377477	T	0.20881	2.04	1.88	1.88	0.25563	.	.	.	.	.	T	0.31827	0.0809	M	0.82323	2.585	0.35366	D	0.788668	D	0.69078	0.997	P	0.48738	0.588	T	0.51521	-0.8695	9	0.87932	D	0	.	7.5099	0.27566	1.0:0.0:0.0:0.0	.	639	Q5TYW2	A20A1_HUMAN	V	639	ENSP00000366697:D639V	ENSP00000366697:D639V	D	+	2	0	ANKRD20A1	67558177	1.000000	0.71417	0.726000	0.30738	0.006000	0.05464	3.455000	0.52993	0.885000	0.36088	0.092000	0.15492	GAT	.		0.338	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083800.1		
APBA1	320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	72064664	72064664	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:72064664C>A	ENST00000265381.4	-	10	2239	c.2017G>T	c.(2017-2019)Gag>Tag	p.E673*		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	673	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CAGCCAGACTCCACAATCACC	0.493																																					p.E673X		.											.	APBA1	91	0			c.G2017T						.						87.0	79.0	82.0					9																	72064664		2203	4300	6503	SO:0001587	stop_gained	320	exon10			CAGACTCCACAAT	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.2017G>T	9.37:g.72064664C>A	ENSP00000265381:p.Glu673*	48.0	0.0		98.0	38.0	NM_001163	O14914|O60570|Q5VYR8	Nonsense_Mutation	SNP	ENST00000265381.4	37	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	C	41	9.140791	0.99078	.	.	ENSG00000107282	ENST00000265381	.	.	.	5.78	5.78	0.91487	.	0.052003	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.4807	20.0124	0.97464	0.0:1.0:0.0:0.0	.	.	.	.	X	673	.	ENSP00000265381:E673X	E	-	1	0	APBA1	71254484	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.749000	0.94314	0.655000	0.94253	GAG	.		0.493	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
APPL1	26060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57283493	57283493	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:57283493G>T	ENST00000288266.3	+	11	1116	c.969G>T	c.(967-969)atG>atT	p.M323I		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	323	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		GCCTGGCCATGGACATAGACA	0.458																																					p.M323I		.											.	APPL1	153	0			c.G969T						.						155.0	141.0	146.0					3																	57283493		2203	4300	6503	SO:0001583	missense	26060	exon11			GGCCATGGACATA	AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.969G>T	3.37:g.57283493G>T	ENSP00000288266:p.Met323Ile	77.0	0.0		162.0	66.0	NM_012096	Q9P2B9	Missense_Mutation	SNP	ENST00000288266.3	37	CCDS2882.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536840	0.45176	.	.	ENSG00000157500	ENST00000288266	T	0.33654	1.4	6.06	6.06	0.98353	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.038358	0.85682	D	0.000000	T	0.37265	0.0997	L	0.49126	1.545	0.58432	D	0.999998	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.10847	-1.0612	10	0.21540	T	0.41	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	306;323	B4DQX8;Q9UKG1	.;DP13A_HUMAN	I	323	ENSP00000288266:M323I	ENSP00000288266:M323I	M	+	3	0	APPL1	57258533	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.565000	0.67365	2.880000	0.98712	0.650000	0.86243	ATG	.		0.458	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	
ARHGEF2	9181	broad.mit.edu;mdanderson.org	37	1	155931469	155931469	+	Missense_Mutation	SNP	G	G	T	rs576936245		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:155931469G>T	ENST00000361247.4	-	11	1550	c.1451C>A	c.(1450-1452)gCg>gAg	p.A484E	ARHGEF2_ENST00000368316.1_Missense_Mutation_p.A456E|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.A456E|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.A485E|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.A483E|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.A529E	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	484	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GCGCCCCGTCGCTGTCTTCCA	0.587																																					p.A484E	Melanoma(178;35 2768 6610 28839)	.											.	ARHGEF2	228	0			c.C1451A						.						66.0	64.0	64.0					1																	155931469		2203	4300	6503	SO:0001583	missense	9181	exon11			CCCGTCGCTGTCT	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1451C>A	1.37:g.155931469G>T	ENSP00000354837:p.Ala484Glu	11.0	0.0		37.0	6.0	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	37	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461216	0.63513	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	4.95	4.01	0.46588	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.143337	0.32175	N	0.006476	T	0.72763	0.3501	M	0.82923	2.615	0.35590	D	0.807038	D;D;D	0.69078	0.997;0.992;0.996	D;P;D	0.68192	0.956;0.823;0.927	T	0.79465	-0.1792	10	0.72032	D	0.01	-16.0243	13.135	0.59403	0.0:0.1621:0.8379:0.0	.	528;484;483	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	E	456;484;485;456;483	ENSP00000315325:A456E;ENSP00000354837:A484E;ENSP00000357298:A485E;ENSP00000357299:A456E;ENSP00000314787:A483E	ENSP00000314787:A483E	A	-	2	0	ARHGEF2	154198093	0.994000	0.37717	0.163000	0.22734	0.530000	0.34684	2.873000	0.48475	1.379000	0.46325	0.655000	0.94253	GCG	.		0.587	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
ATXN3L	92552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	13337139	13337139	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:13337139G>T	ENST00000380622.2	-	1	1379	c.915C>A	c.(913-915)ggC>ggA	p.G305G	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	305					protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						ATGAACTGTGGCCCGGCAGAT	0.468																																					p.G305G		.											.	ATXN3L	542	0			c.C915A						.						193.0	155.0	166.0					X																	13337139		1568	3582	5150	SO:0001819	synonymous_variant	92552	exon1			ACTGTGGCCCGGC		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.915C>A	X.37:g.13337139G>T		141.0	0.0		457.0	213.0	NM_001135995	B2RNY8	Silent	SNP	ENST00000380622.2	37	CCDS48080.1																																																																																			.		0.468	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995	
ARHGEF9	23229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	62926264	62926264	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:62926264G>T	ENST00000253401.6	-	3	1055	c.255C>A	c.(253-255)gaC>gaA	p.D85E	ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374878.1_Missense_Mutation_p.D83E|ARHGEF9_ENST00000374870.4_5'UTR|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.D64E|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.D32E	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	85					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						CTGAATTGGGGTCCAGGTGTC	0.547																																					p.D85E		.											.	ARHGEF9	233	0			c.C255A						.						99.0	70.0	80.0					X																	62926264		2203	4299	6502	SO:0001583	missense	23229	exon3			ATTGGGGTCCAGG	AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.255C>A	X.37:g.62926264G>T	ENSP00000253401:p.Asp85Glu	49.0	0.0		102.0	45.0	NM_015185	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	ENST00000253401.6	37	CCDS35315.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806466	0.31961	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374872	T;T;T;T	0.72282	1.0;1.0;-0.64;1.0	5.73	1.97	0.26223	Src homology-3 domain (1);	0.051722	0.85682	D	0.000000	T	0.41971	0.1182	N	0.04959	-0.14	0.80722	D	1	B;B;B	0.13594	0.002;0.008;0.001	B;B;B	0.17722	0.003;0.019;0.003	T	0.04565	-1.0942	10	0.17369	T	0.5	.	5.1822	0.15165	0.3076:0.0:0.5572:0.1352	.	32;83;85	B4DHC7;B1AMR4;O43307	.;.;ARHG9_HUMAN	E	85;83;32;64	ENSP00000253401:D85E;ENSP00000364012:D83E;ENSP00000399994:D32E;ENSP00000364006:D64E	ENSP00000253401:D85E	D	-	3	2	ARHGEF9	62842989	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	0.945000	0.29056	-0.036000	0.13669	-0.176000	0.13171	GAC	.		0.547	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056937.1		
ARHGEF6	9459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135767930	135767930	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:135767930G>C	ENST00000250617.6	-	12	2503	c.1298C>G	c.(1297-1299)tCc>tGc	p.S433C	ARHGEF6_ENST00000535227.1_Missense_Mutation_p.S306C|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.S279C|ARHGEF6_ENST00000370620.1_Missense_Mutation_p.S279C	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	433					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					AATAGGTTCGGACAGTATCTG	0.393																																					p.S433C		.											.	ARHGEF6	227	0			c.C1298G						.						160.0	128.0	139.0					X																	135767930		2203	4300	6503	SO:0001583	missense	9459	exon12			GGTTCGGACAGTA	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1298C>G	X.37:g.135767930G>C	ENSP00000250617:p.Ser433Cys	103.0	0.0		320.0	118.0	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	g	16.81	3.225349	0.58668	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.36	5.36	0.76844	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.58509	0.2127	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.57257	0.979;0.979	P;P	0.57204	0.643;0.815	T	0.61530	-0.7044	10	0.59425	D	0.04	.	18.1967	0.89825	0.0:0.0:1.0:0.0	.	306;433	B7Z3C7;Q15052	.;ARHG6_HUMAN	C	433;279;279;279;306	ENSP00000250617:S433C;ENSP00000359654:S279C;ENSP00000359656:S279C;ENSP00000439483:S306C	ENSP00000250617:S433C	S	-	2	0	ARHGEF6	135595596	1.000000	0.71417	0.865000	0.33974	0.090000	0.18270	9.866000	0.99616	2.235000	0.73313	0.519000	0.50382	TCC	.		0.393	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
BCAT1	586	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	24989464	24989464	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:24989464A>G	ENST00000261192.7	-	8	1410	c.884T>C	c.(883-885)cTg>cCg	p.L295P	RP11-625L16.3_ENST00000545410.1_RNA|BCAT1_ENST00000539780.1_Missense_Mutation_p.L258P|BCAT1_ENST00000544418.1_5'UTR|BCAT1_ENST00000538118.1_Missense_Mutation_p.L294P|BCAT1_ENST00000539282.1_Missense_Mutation_p.L307P|BCAT1_ENST00000342945.5_Missense_Mutation_p.L234P	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	295					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	TGCCAGGTCCAGAATGCACCG	0.413																																					p.L307P		.											.	BCAT1	522	0			c.T920C						.						69.0	66.0	67.0					12																	24989464		1916	4122	6038	SO:0001583	missense	586	exon8			AGGTCCAGAATGC		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.884T>C	12.37:g.24989464A>G	ENSP00000261192:p.Leu295Pro	80.0	0.0		171.0	67.0	NM_001178093	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	ENST00000261192.7	37	CCDS44845.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.059333	0.76074	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.11	5.11	0.69529	.	0.083454	0.49916	D	0.000134	T	0.71592	0.3358	H	0.98314	4.2	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.995;0.996;0.995;0.998;0.998	D	0.83931	0.0306	10	0.87932	D	0	-25.8717	15.2341	0.73416	1.0:0.0:0.0:0.0	.	258;307;234;295;294	B7Z5L0;F5H5E4;B3KY27;P54687;Q68DQ7	.;.;.;BCAT1_HUMAN;.	P	295;294;234;307;258	ENSP00000261192:L295P;ENSP00000440817:L294P;ENSP00000339805:L234P;ENSP00000443459:L307P;ENSP00000440827:L258P	ENSP00000261192:L295P	L	-	2	0	BCAT1	24880731	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.840000	0.86819	2.054000	0.61138	0.528000	0.53228	CTG	.		0.413	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402080.1	NM_005504	
BEND3	57673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	107391941	107391941	+	Missense_Mutation	SNP	C	C	T	rs142662918	byFrequency	TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:107391941C>T	ENST00000369042.1	-	4	644	c.454G>A	c.(454-456)Gtg>Atg	p.V152M	BEND3_ENST00000429433.2_Missense_Mutation_p.V152M			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	152										central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						AGCTCGTACACGTTTAGCAGG	0.582																																					p.V152M		.											.	BEND3	71	0			c.G454A						.						128.0	123.0	124.0					6																	107391941		2203	4300	6503	SO:0001583	missense	57673	exon5			CGTACACGTTTAG	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.454G>A	6.37:g.107391941C>T	ENSP00000358038:p.Val152Met	54.0	0.0		144.0	59.0	NM_001080450	A2RRH2|Q9HCL9	Missense_Mutation	SNP	ENST00000369042.1	37	CCDS34507.1	.	.	.	.	.	.	.	.	.	.	T	1.798	-0.477781	0.04414	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	4.88	-0.588	0.11687	.	0.828604	0.10973	N	0.613676	T	0.04182	0.0116	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39482	-0.9612	9	0.33141	T	0.24	-3.1766	0.5191	0.00609	0.1837:0.2269:0.1882:0.4012	.	152	Q5T5X7	BEND3_HUMAN	M	152	.	ENSP00000358038:V152M	V	-	1	0	BEND3	107498634	0.001000	0.12720	0.002000	0.10522	0.032000	0.12392	0.243000	0.18106	-0.951000	0.03654	-3.115000	0.00062	GTG	C|1.000;G|0.000		0.582	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
BCLAF1	9774	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	136589325	136589325	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:136589325C>A	ENST00000531224.1	-	10	2624	c.2372G>T	c.(2371-2373)gGa>gTa	p.G791V	BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000530767.1_Missense_Mutation_p.G618V|BCLAF1_ENST00000031135.9_Missense_Mutation_p.G9V|BCLAF1_ENST00000353331.4_Missense_Mutation_p.G789V|BCLAF1_ENST00000527536.1_Missense_Mutation_p.G791V|BCLAF1_ENST00000527759.1_Missense_Mutation_p.G789V|BCLAF1_ENST00000392348.2_Missense_Mutation_p.G789V	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	791					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCGGCTAACTCCTGCAAAGCC	0.378																																					p.G791V	Colon(142;1534 1789 5427 7063 28491)	.											.	BCLAF1	228	0			c.G2372T						.						195.0	182.0	186.0					6																	136589325		2203	4300	6503	SO:0001583	missense	9774	exon10			CTAACTCCTGCAA	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2372G>T	6.37:g.136589325C>A	ENSP00000435210:p.Gly791Val	106.0	0.0		333.0	37.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.12|19.12	3.765070|3.765070	0.69878|0.69878	.|.	.|.	ENSG00000029363|ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000031135;ENST00000392348|ENST00000534762	T;T;T;T;T;T;T|.	0.46819|.	2.9;2.79;2.79;2.49;2.9;0.86;2.79|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|.	0.64402|.	D|.	0.000014|.	T|T	0.47284|0.47284	0.1437|0.1437	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;1.0;0.999;0.999;1.0|.	D;D;D;D;D|.	0.87578|.	0.964;0.993;0.964;0.964;0.998|.	T|T	0.40961|0.40961	-0.9535|-0.9535	10|5	0.52906|.	T|.	0.07|.	-12.0323|-12.0323	18.9333|18.9333	0.92576|0.92576	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	789;119;789;791;618|.	Q9NYF8-2;B7Z8J9;Q9NYF8-3;Q9NYF8;Q9NYF8-4|.	.;.;.;BCLF1_HUMAN;.|.	V|S	791;789;791;618;789;9;789|57	ENSP00000435210:G791V;ENSP00000229446:G789V;ENSP00000435441:G791V;ENSP00000436501:G618V;ENSP00000434826:G789V;ENSP00000031135:G9V;ENSP00000376159:G789V|.	ENSP00000031135:G9V|.	G|R	-|-	2|3	0|2	BCLAF1|BCLAF1	136631018|136631018	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.211000|4.211000	0.58507|0.58507	2.492000|2.492000	0.84095|0.84095	0.484000|0.484000	0.47621|0.47621	GGA|AGG	.		0.378	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
BPIFA1	51297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	31825880	31825880	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr20:31825880G>T	ENST00000354297.4	+	3	251	c.180G>T	c.(178-180)ctG>ctT	p.L60L	BPIFA1_ENST00000375422.2_Silent_p.L60L|BPIFA1_ENST00000375413.4_Silent_p.L60L	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	60					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										ATGGCCTGCTGTCTGGGGGCC	0.597																																					p.L60L		.											.	.	.	0			c.G180T						.						49.0	50.0	50.0					20																	31825880		2203	4300	6503	SO:0001819	synonymous_variant	51297	exon3			CCTGCTGTCTGGG	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.180G>T	20.37:g.31825880G>T		37.0	0.0		95.0	38.0	NM_016583	A8K9R3|E1P5M9|Q9NZT0	Silent	SNP	ENST00000354297.4	37	CCDS13217.1																																																																																			.		0.597	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
C4orf26	152816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	76489342	76489342	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:76489342C>T	ENST00000311623.4	+	2	121	c.86C>T	c.(85-87)aCg>aTg	p.T29M	C4orf26_ENST00000435974.2_Missense_Mutation_p.R44C	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	29						extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GAGGTATTTACGCCTCCTGGA	0.527																																					p.R44C		.											.	C4orf26	90	0			c.C130T						.						67.0	71.0	70.0					4																	76489342		2203	4300	6503	SO:0001583	missense	152816	exon3			TATTTACGCCTCC	AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.86C>T	4.37:g.76489342C>T	ENSP00000311307:p.Thr29Met	46.0	0.0		71.0	36.0	NM_001206981	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	ENST00000311623.4	37	CCDS3569.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.382|7.382	0.628915|0.628915	0.14257|0.14257	.|.	.|.	ENSG00000174792|ENSG00000174792	ENST00000435974|ENST00000311623	T|T	0.50813|0.39592	0.73|1.07	4.6|4.6	1.05|1.05	0.20165|0.20165	.|.	.|0.365474	.|0.21557	.|N	.|0.072634	T|T	0.39384|0.39384	0.1076|0.1076	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B|D	0.06786|0.89917	0.001|1.0	B|P	0.04013|0.58660	0.001|0.843	T|T	0.19418|0.19418	-1.0306|-1.0306	9|10	0.87932|0.87932	D|D	0|0	.|.	4.1083|4.1083	0.10047|0.10047	0.181:0.61:0.0:0.209|0.181:0.61:0.0:0.209	.|.	44|29	E7ETQ0|Q17RF5	.|CD026_HUMAN	C|M	44|29	ENSP00000406925:R44C|ENSP00000311307:T29M	ENSP00000406925:R44C|ENSP00000311307:T29M	R|T	+|+	1|2	0|0	C4orf26|C4orf26	76708366|76708366	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.212000|0.212000	0.24457|0.24457	-0.328000|-0.328000	0.07945|0.07945	0.054000|0.054000	0.16065|0.16065	0.551000|0.551000	0.68910|0.68910	CGC|ACG	.		0.527	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252410.1	NM_178497	
CABLES2	81928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60968622	60968622	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr20:60968622G>T	ENST00000279101.5	-	6	762	c.754C>A	c.(754-756)Ctg>Atg	p.L252M		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	252					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TGTGTGACCAGGGCGTTGGTG	0.597																																					p.L252M		.											.	CABLES2	91	0			c.C754A						.						113.0	112.0	112.0					20																	60968622		2203	4300	6503	SO:0001583	missense	81928	exon6			TGACCAGGGCGTT	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.754C>A	20.37:g.60968622G>T	ENSP00000279101:p.Leu252Met	52.0	0.0		120.0	57.0	NM_031215	Q5JWL0|Q9BYK0	Missense_Mutation	SNP	ENST00000279101.5	37	CCDS33503.1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247863	0.59103	.	.	ENSG00000149679	ENST00000370560;ENST00000279101	T	0.52057	0.68	5.42	2.35	0.29111	.	0.000000	0.85682	D	0.000000	T	0.48205	0.1487	M	0.63428	1.95	0.53005	D	0.999966	P	0.50710	0.938	P	0.47162	0.54	T	0.44205	-0.9343	10	0.54805	T	0.06	-25.2009	9.534	0.39211	0.2245:0.0:0.7755:0.0	.	252	Q9BTV7	CABL2_HUMAN	M	40;252	ENSP00000279101:L252M	ENSP00000279101:L252M	L	-	1	2	CABLES2	60402017	0.987000	0.35691	0.997000	0.53966	0.901000	0.52897	1.159000	0.31749	0.245000	0.21373	0.563000	0.77884	CTG	.		0.597	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265	
CASK	8573	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	41428985	41428985	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:41428985T>C	ENST00000378163.1	-	16	1992	c.1518A>G	c.(1516-1518)aaA>aaG	p.K506K	CASK_ENST00000378166.4_Silent_p.K506K|CASK_ENST00000378158.1_Silent_p.K506K|CASK_ENST00000421587.2_Silent_p.K500K|CASK_ENST00000472704.1_5'UTR|CASK_ENST00000378154.1_Silent_p.K506K|CASK_ENST00000361962.4_Silent_p.K506K|RNU6-1321P_ENST00000390905.1_RNA|CASK_ENST00000442742.2_Silent_p.K506K|CASK_ENST00000318588.9_Silent_p.K506K			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	506	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						GTTCATTCATTTTTAAAGTGA	0.303																																					p.K506K	NSCLC(42;104 1086 3090 27189 35040)	.											.	CASK	616	0			c.A1518G						.						90.0	87.0	88.0					X																	41428985		2202	4300	6502	SO:0001819	synonymous_variant	8573	exon16			ATTCATTTTTAAA	AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1518A>G	X.37:g.41428985T>C		137.0	0.0		411.0	162.0	NM_001126054	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Silent	SNP	ENST00000378163.1	37																																																																																				.		0.303	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000056285.1	NM_003688	
CCDC129	223075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	31691634	31691634	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:31691634G>T	ENST00000407970.3	+	13	2831	c.2793G>T	c.(2791-2793)cgG>cgT	p.R931R	CCDC129_ENST00000409210.1_Silent_p.R839R|CCDC129_ENST00000319386.3_Silent_p.R783R|CCDC129_ENST00000451887.2_Silent_p.R957R	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	931										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TAGGAGACCGGGCTCAGCAAA	0.493																																					p.R957R		.											.	.	.	0			c.G2871T						.						73.0	60.0	64.0					7																	31691634		2203	4300	6503	SO:0001819	synonymous_variant	223075	exon13			AGACCGGGCTCAG	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2793G>T	7.37:g.31691634G>T		113.0	0.0		444.0	210.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	ENST00000407970.3	37	CCDS5435.2																																																																																			.		0.493	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
CDH18	1016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	19612615	19612615	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:19612615C>A	ENST00000507958.1	-	8	1729	c.739G>T	c.(739-741)Ggg>Tgg	p.G247W	CDH18_ENST00000274170.4_Missense_Mutation_p.G247W|CDH18_ENST00000502796.1_Missense_Mutation_p.G247W|CDH18_ENST00000382275.1_Missense_Mutation_p.G247W|CDH18_ENST00000506372.1_Missense_Mutation_p.G247W|CDH18_ENST00000511273.1_Missense_Mutation_p.G247W			Q13634	CAD18_HUMAN	cadherin 18, type 2	247	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCTGAAAGCCCTCCAACTTGC	0.433																																					p.G247W		.											.	CDH18	159	0			c.G739T						.						163.0	147.0	153.0					5																	19612615		2203	4300	6503	SO:0001583	missense	1016	exon6			AAAGCCCTCCAAC	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.739G>T	5.37:g.19612615C>A	ENSP00000425093:p.Gly247Trp	91.0	0.0		375.0	192.0	NM_001167667	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	37	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559048	0.86335	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55	5.95	5.95	0.96441	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.78407	0.4278	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80571	-0.1323	9	.	.	.	.	18.9386	0.92597	0.0:1.0:0.0:0.0	.	247;247	B4DHG6;Q13634	.;CAD18_HUMAN	W	247;247;247;247;247;247;193;247	ENSP00000371710:G247W;ENSP00000425093:G247W;ENSP00000274170:G247W;ENSP00000424931:G247W;ENSP00000422138:G247W;ENSP00000427383:G193W;ENSP00000425854:G247W	.	G	-	1	0	CDH18	19648372	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.672000	0.83956	2.817000	0.96982	0.563000	0.77884	GGG	.		0.433	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	26906920	26906920	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:26906920G>A	ENST00000231021.4	-	4	723	c.551C>T	c.(550-552)aCa>aTa	p.T184I		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATCTGCATCTGTTGCAGTTAC	0.388																																					p.T184I	Melanoma(8;187 585 15745 40864 52829)	.											.	CDH9	99	0			c.C551T						.						130.0	115.0	120.0					5																	26906920		2203	4300	6503	SO:0001583	missense	1007	exon4			GCATCTGTTGCAG	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.551C>T	5.37:g.26906920G>A	ENSP00000231021:p.Thr184Ile	67.0	0.0		228.0	121.0	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.224327	0.39300	.	.	ENSG00000113100	ENST00000231021	T	0.55588	0.51	5.69	5.69	0.88448	Cadherin (5);Cadherin-like (1);	0.226724	0.44097	D	0.000494	T	0.53190	0.1781	L	0.58101	1.795	0.09310	N	1	B	0.22746	0.074	B	0.35813	0.211	T	0.46582	-0.9181	9	.	.	.	.	11.8036	0.52141	0.0804:0.0:0.9196:0.0	.	184	Q9ULB4	CADH9_HUMAN	I	184	ENSP00000231021:T184I	.	T	-	2	0	CDH9	26942677	0.998000	0.40836	0.359000	0.25824	0.958000	0.62258	2.649000	0.46656	2.677000	0.91161	0.655000	0.94253	ACA	.		0.388	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CDHR2	54825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176003023	176003023	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:176003023T>C	ENST00000510636.1	+	12	1305	c.1031T>C	c.(1030-1032)aTg>aCg	p.M344T	CDHR2_ENST00000261944.5_Missense_Mutation_p.M344T|CDHR2_ENST00000506348.1_Missense_Mutation_p.M344T	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	344	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GTGAGAGTGATGGACGTCAAT	0.582																																					p.M344T		.											.	CDHR2	70	0			c.T1031C						.						139.0	115.0	124.0					5																	176003023		2203	4300	6503	SO:0001583	missense	54825	exon12			GAGTGATGGACGT	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.1031T>C	5.37:g.176003023T>C	ENSP00000424565:p.Met344Thr	42.0	0.0		110.0	34.0	NM_017675	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.364629	0.00015	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.59364	0.27;0.27;0.27	4.54	0.571	0.17352	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.23289	0.0563	N	0.00985	-1.075	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24764	-1.0151	9	0.16420	T	0.52	0.0026	8.0838	0.30760	0.0:0.6847:0.0:0.3153	.	344	Q9BYE9	CDHR2_HUMAN	T	344	ENSP00000424565:M344T;ENSP00000261944:M344T;ENSP00000421078:M344T	ENSP00000261944:M344T	M	+	2	0	CDHR2	175935629	0.004000	0.15560	0.002000	0.10522	0.003000	0.03518	0.036000	0.13819	-0.049000	0.13379	-1.182000	0.01712	ATG	.		0.582	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	104060948	104060948	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:104060948T>C	ENST00000265148.3	-	38	6291	c.6202A>G	c.(6202-6204)Aga>Gga	p.R2068G	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2068					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GAACTCACTCTAGCTATCATT	0.318																																					p.R2068G		.											.	CENPE	277	0			c.A6202G						.						123.0	122.0	122.0					4																	104060948		2203	4300	6503	SO:0001583	missense	1062	exon38			TCACTCTAGCTAT	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6202A>G	4.37:g.104060948T>C	ENSP00000265148:p.Arg2068Gly	114.0	0.0		227.0	153.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	8.637	0.895010	0.17613	.	.	ENSG00000138778	ENST00000265148;ENST00000394771	T	0.70869	-0.52	5.16	-0.361	0.12564	.	.	.	.	.	T	0.54532	0.1864	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35574	-0.9783	9	0.21540	T	0.41	.	5.6326	0.17518	0.0:0.2301:0.1344:0.6355	.	2068	Q02224	CENPE_HUMAN	G	2068	ENSP00000265148:R2068G	ENSP00000265148:R2068G	R	-	1	2	CENPE	104280397	0.000000	0.05858	0.346000	0.25655	0.957000	0.61999	0.072000	0.14617	0.281000	0.22233	0.450000	0.29827	AGA	.		0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CEP170B	283638	hgsc.bcm.edu;broad.mit.edu	37	14	105351860	105351860	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:105351860delC	ENST00000414716.3	+	10	2153	c.1925delC	c.(1924-1926)gccfs	p.A642fs	CEP170B_ENST00000453495.1_Frame_Shift_Del_p.A643fs|CEP170B_ENST00000556508.1_Frame_Shift_Del_p.A572fs|CEP170B_ENST00000418279.1_Frame_Shift_Del_p.A572fs	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	642						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CTGGGTGCGGCCCCCCAGGCG	0.697																																					p.A642fs		.											.	.	.	0			c.1925delC						.						11.0	13.0	12.0					14																	105351860		1897	4093	5990	SO:0001589	frameshift_variant	283638	exon10			GTGCGGCCCCCCA	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.1925delC	14.37:g.105351860delC	ENSP00000404151:p.Ala642fs	8.0	0.0		32.0	16.0	NM_001112726	Q2KHR7|Q86TI7	Frame_Shift_Del	DEL	ENST00000414716.3	37	CCDS45175.1																																																																																			.		0.697	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
CEP290	80184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	88486497	88486497	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:88486497A>G	ENST00000552810.1	-	29	3765	c.3422T>C	c.(3421-3423)tTa>tCa	p.L1141S	CEP290_ENST00000309041.7_Missense_Mutation_p.L1143S|CEP290_ENST00000397838.3_Missense_Mutation_p.L201S|CEP290_ENST00000547691.2_Missense_Mutation_p.L201S	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	1141					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATTCTTCTCTAATTCTAGAAT	0.348																																					p.L1141S		.											.	CEP290	96	0			c.T3422C						.						190.0	176.0	181.0					12																	88486497		1906	4140	6046	SO:0001583	missense	80184	exon29			TTCTCTAATTCTA	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.3422T>C	12.37:g.88486497A>G	ENSP00000448012:p.Leu1141Ser	119.0	0.0		366.0	150.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.204154	0.79127	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.75260	-0.38;-0.92;-0.91;-0.38	5.83	5.83	0.93111	.	0.065233	0.64402	D	0.000007	D	0.84356	0.5454	M	0.71581	2.175	0.44359	D	0.997257	D	0.76494	0.999	D	0.72338	0.977	T	0.82092	-0.0628	10	0.24483	T	0.36	.	16.192	0.81996	1.0:0.0:0.0:0.0	.	1141	O15078	CE290_HUMAN	S	201;1141;1143;201	ENSP00000446905:L201S;ENSP00000448012:L1141S;ENSP00000308021:L1143S;ENSP00000380938:L201S	ENSP00000308021:L1143S	L	-	2	0	CEP290	87010628	1.000000	0.71417	0.998000	0.56505	0.719000	0.41307	8.548000	0.90669	2.229000	0.72834	0.482000	0.46254	TTA	.		0.348	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
CHD1L	9557	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	146714372	146714372	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:146714372A>G	ENST00000369258.4	+	1	39	c.19A>G	c.(19-21)Act>Gct	p.T7A	CHD1L_ENST00000431239.1_Missense_Mutation_p.T7A|CHD1L_ENST00000361293.5_5'UTR|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000369259.3_Missense_Mutation_p.T7A|RP11-337C18.10_ENST00000606856.1_RNA	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	7					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					CGCGGGCGCTACTAGCCGCGG	0.746																																					p.T7A		.											.	CHD1L	231	0			c.A19G						.						4.0	7.0	6.0					1																	146714372		1931	3882	5813	SO:0001583	missense	9557	exon1			GGCGCTACTAGCC	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.19A>G	1.37:g.146714372A>G	ENSP00000358262:p.Thr7Ala	9.0	0.0		37.0	14.0	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	ENST00000369258.4	37	CCDS927.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921404	0.33908	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258	D;T;D	0.88509	-2.39;-1.25;-2.29	2.18	0.152	0.14893	.	1.259300	0.06027	N	0.652309	T	0.50137	0.1598	N	0.08118	0	0.09310	N	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43147	-0.9409	10	0.10111	T	0.7	.	2.8512	0.05558	0.3183:0.2455:0.4362:0.0	.	7;7;7	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	A	7	ENSP00000389031:T7A;ENSP00000358263:T7A;ENSP00000358262:T7A	ENSP00000358262:T7A	T	+	1	0	CHD1L	145180996	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.032000	0.13732	-0.244000	0.09639	-0.493000	0.04662	ACT	.		0.746	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
CLDN1	9076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	190030689	190030689	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:190030689G>T	ENST00000295522.3	-	2	628	c.360C>A	c.(358-360)gtC>gtA	p.V120V		NM_021101.4	NP_066924.1	O95832	CLD1_HUMAN	claudin 1	120					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|cell-cell junction organization (GO:0045216)|establishment of skin barrier (GO:0061436)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			lung(9)	9	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		CACCCCCAATGACAGCCATCC	0.478																																					p.V120V		.											.	CLDN1	91	0			c.C360A						.						244.0	201.0	216.0					3																	190030689		2203	4300	6503	SO:0001819	synonymous_variant	9076	exon2			CCCAATGACAGCC	AF101051	CCDS3295.1	3q28-q29	2008-07-18			ENSG00000163347	ENSG00000163347		"""Claudins"""	2032	protein-coding gene	gene with protein product	"""senescence-associated epithelial membrane protein 1"""	603718				10828592, 9892664	Standard	NM_021101		Approved	SEMP1, ILVASC	uc003fsh.3	O95832	OTTHUMG00000156214	ENST00000295522.3:c.360C>A	3.37:g.190030689G>T		67.0	0.0		155.0	53.0	NM_021101		Silent	SNP	ENST00000295522.3	37	CCDS3295.1																																																																																			.		0.478	CLDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343516.2	NM_021101	
CMYA5	202333	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	79027939	79027953	+	In_Frame_Del	DEL	ATATTTAGAGCCTGA	ATATTTAGAGCCTGA	-	rs200267723		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	ATATTTAGAGCCTGA	ATATTTAGAGCCTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:79027939_79027953delATATTTAGAGCCTGA	ENST00000446378.2	+	2	3382_3396	c.3351_3365delATATTTAGAGCCTGA	c.(3349-3366)gcatatttagagcctgag>gcg	p.YLEPE1118del		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1118					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)		p.E1122V(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAACTCAAGCATATTTAGAGCCTGAGTCTGAAGAC	0.414																																					p.1117_1122del		.											.	CMYA5	77	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.3351_3365del						.																																			SO:0001651	inframe_deletion	202333	exon2			TCAAGCATATTTA	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.3351_3365delATATTTAGAGCCTGA	5.37:g.79027939_79027953delATATTTAGAGCCTGA	ENSP00000394770:p.Tyr1118_Glu1122del	90.0	0.0		191.0	28.0	NM_153610	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	In_Frame_Del	DEL	ENST00000446378.2	37	CCDS47238.1																																																																																			.		0.414	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
COL4A5	1287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107807134	107807134	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:107807134C>A	ENST00000361603.2	+	4	498	c.254C>A	c.(253-255)cCa>cAa	p.P85Q	COL4A5_ENST00000328300.6_Missense_Mutation_p.P85Q	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	85	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ATTCCAGGGCCACCAGGACCA	0.328									Alport syndrome with Diffuse Leiomyomatosis																												p.P85Q		.											.	COL4A5	133	0			c.C254A						.						66.0	65.0	65.0					X																	107807134		2203	4300	6503	SO:0001583	missense	1287	exon4	Familial Cancer Database		CAGGGCCACCAGG	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.254C>A	X.37:g.107807134C>A	ENSP00000354505:p.Pro85Gln	148.0	0.0		498.0	220.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837414	0.50951	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96716	-4.1;-4.1	5.67	4.8	0.61643	.	0.129886	0.52532	D	0.000072	D	0.95564	0.8558	L	0.48260	1.515	0.36193	D	0.850221	D;D	0.53462	0.96;0.96	P;P	0.55455	0.776;0.776	D	0.94553	0.7755	10	0.13108	T	0.6	.	12.6549	0.56782	0.0:0.9169:0.0:0.0831	.	85;85	E7EVY4;P29400	.;CO4A5_HUMAN	Q	85	ENSP00000331902:P85Q;ENSP00000354505:P85Q	ENSP00000331902:P85Q	P	+	2	0	COL4A5	107693790	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	4.049000	0.57397	1.153000	0.42468	0.600000	0.82982	CCA	.		0.328	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
CORIN	10699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47746441	47746441	+	Silent	SNP	A	A	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:47746441A>C	ENST00000273857.4	-	5	776	c.777T>G	c.(775-777)ccT>ccG	p.P259P	CORIN_ENST00000508498.1_Silent_p.P120P|CORIN_ENST00000502252.1_Silent_p.P192P|CORIN_ENST00000505909.1_Silent_p.P259P|CORIN_ENST00000504584.1_Silent_p.P259P	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	259	FZ 1. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TTTCCTGCTGAGGTGAGAAGC	0.393																																					p.P259P		.											.	CORIN	91	0			c.T777G						.						166.0	167.0	166.0					4																	47746441		2203	4300	6503	SO:0001819	synonymous_variant	10699	exon5			CTGCTGAGGTGAG	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.777T>G	4.37:g.47746441A>C		61.0	0.0		127.0	41.0	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Silent	SNP	ENST00000273857.4	37	CCDS3477.1																																																																																			.		0.393	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
CRIP3	401262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43273593	43273593	+	3'UTR	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:43273593C>G	ENST00000274990.4	-	0	769				ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.G192R			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3						T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			ATGTAGCAGCCCACATCGCCA	0.537																																					p.G192R		.											.	CRIP3	91	0			c.G574C						.						85.0	90.0	88.0					6																	43273593		2185	4290	6475	SO:0001624	3_prime_UTR_variant	401262	exon8			AGCAGCCCACATC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.*111G>C	6.37:g.43273593C>G		74.0	0.0		178.0	56.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	37		.	.	.	.	.	.	.	.	.	.	C	26.0	4.693798	0.88735	.	.	ENSG00000146215	ENST00000372569	D	0.92495	-3.05	5.66	5.66	0.87406	.	.	.	.	.	D	0.95806	0.8635	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95910	0.8922	8	0.72032	D	0.01	.	17.2419	0.87015	0.0:1.0:0.0:0.0	.	192	Q6Q6R5-3	.	R	192	ENSP00000361650:G192R	ENSP00000361650:G192R	G	-	1	0	CRIP3	43381571	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.469000	0.73555	2.668000	0.90789	0.655000	0.94253	GGC	.		0.537	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
CRYM-AS1	400508	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	21328280	21328280	+	lincRNA	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:21328280A>G	ENST00000444326.1	+	0	396							A6NIL9	CRAS1_HUMAN	CRYM antisense RNA 1							integral component of membrane (GO:0016021)											ATAAATAAGAACGGACCTTTC	0.438																																					.		.											.	.	.	0			.						.						224.0	205.0	211.0					16																	21328280		1873	4120	5993			400508	.			ATAAGAACGGACC			16p12.2	2012-10-12	2012-08-15	2011-08-11	ENSG00000189149	ENSG00000189149		"""Long non-coding RNAs"""	34405	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 169"", ""CRYM antisense RNA 1 (non-protein coding)"""	NCRNA00169			Standard	NR_026675		Approved	FLJ41766	uc010bwr.1	A6NIL9	OTTHUMG00000156701		16.37:g.21328280A>G		76.0	0.0		182.0	59.0	.	B3KVZ2	RNA	SNP	ENST00000444326.1	37																																																																																				.		0.438	CRYM-AS1-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000345335.1	NR_026675	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2976080	2976080	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr8:2976080G>T	ENST00000520002.1	-	43	6829	c.6274C>A	c.(6274-6276)Ccc>Acc	p.P2092T	CSMD1_ENST00000542608.1_Missense_Mutation_p.P2091T|CSMD1_ENST00000602557.1_Missense_Mutation_p.P2092T|CSMD1_ENST00000537824.1_Missense_Mutation_p.P2091T|CSMD1_ENST00000602723.1_Missense_Mutation_p.P2092T|CSMD1_ENST00000400186.3_Missense_Mutation_p.P2092T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2092	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGAAATGGGGGTGGATCTGGA	0.408																																					p.P2091T		.											.	CSMD1	86	0			c.C6271A						.						125.0	120.0	121.0					8																	2976080		1951	4136	6087	SO:0001583	missense	64478	exon42			ATGGGGGTGGATC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6274C>A	8.37:g.2976080G>T	ENSP00000430733:p.Pro2092Thr	57.0	0.0		140.0	55.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.18|11.18	1.563363|1.563363	0.27915|0.27915	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608|ENST00000335551	T;T;T;T|.	0.66995|.	-0.24;-0.24;-0.24;-0.24|.	5.03|5.03	5.03|5.03	0.67393|0.67393	Complement control module (2);Sushi/SCR/CCP (3);|.	0.144744|.	0.46758|.	D|.	0.000261|.	T|T	0.50274|0.50274	0.1606|0.1606	L|L	0.38531|0.38531	1.155|1.155	0.21527|0.21527	N|N	0.999656|0.999656	D;B;B|.	0.57257|.	0.979;0.047;0.321|.	P;B;B|.	0.57846|.	0.828;0.216;0.205|.	T|T	0.44559|0.44559	-0.9320|-0.9320	10|5	0.52906|.	T|.	0.07|.	.|.	18.734|18.734	0.91748|0.91748	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2092;2092;2091|.	E5RIG2;Q96PZ7;F5H2I8|.	.;CSMD1_HUMAN;.|.	T|N	2092;2092;1953;2091;2091|1571	ENSP00000383047:P2092T;ENSP00000430733:P2092T;ENSP00000441462:P2091T;ENSP00000446243:P2091T|.	ENSP00000320445:P1953T|.	P|T	-|-	1|2	0|0	CSMD1|CSMD1	2963487|2963487	0.891000|0.891000	0.30450|0.30450	0.111000|0.111000	0.21465|0.21465	0.976000|0.976000	0.68499|0.68499	3.294000|3.294000	0.51787|0.51787	2.481000|2.481000	0.83766|0.83766	0.563000|0.563000	0.77884|0.77884	CCC|ACC	.		0.408	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSNK1A1L	122011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	37678916	37678916	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr13:37678916A>T	ENST00000379800.3	-	1	887	c.478T>A	c.(478-480)Ttg>Atg	p.L160M		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TTTTTGGCCAAACCAAAATCA	0.428																																					p.L160M		.											.	CSNK1A1L	396	0			c.T478A						.						223.0	204.0	211.0					13																	37678916		2203	4300	6503	SO:0001583	missense	122011	exon1			TGGCCAAACCAAA	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.478T>A	13.37:g.37678916A>T	ENSP00000369126:p.Leu160Met	152.0	0.0		743.0	336.0	NM_145203	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	CCDS9363.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.793775	0.50102	.	.	ENSG00000180138	ENST00000379800	T	0.13089	2.62	1.08	1.08	0.20341	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.41419	0.1158	H	0.94423	3.535	0.38146	D	0.938581	D	0.89917	1.0	D	0.97110	1.0	T	0.46952	-0.9154	10	0.87932	D	0	.	6.2671	0.20932	1.0:0.0:0.0:0.0	.	160	Q8N752	KC1AL_HUMAN	M	160	ENSP00000369126:L160M	ENSP00000369126:L160M	L	-	1	2	CSNK1A1L	36576916	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.407000	0.52644	0.725000	0.32318	0.459000	0.35465	TTG	.		0.428	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
CTNNA3	29119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	67829142	67829142	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr10:67829142C>A	ENST00000433211.2	-	15	2257	c.2083G>T	c.(2083-2085)Gat>Tat	p.D695Y	CTNNA3_ENST00000373735.1_5'UTR|CTNNA3_ENST00000373744.4_Missense_Mutation_p.D695Y	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						CTTGTATCATCCCATATCTCA	0.403																																					p.D695Y		.											.	CTNNA3	234	0			c.G2083T						.						281.0	236.0	251.0					10																	67829142		2203	4300	6503	SO:0001583	missense	29119	exon15			TATCATCCCATAT	AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2083G>T	10.37:g.67829142C>A	ENSP00000389714:p.Asp695Tyr	121.0	0.0		354.0	140.0	NM_001127384		Missense_Mutation	SNP	ENST00000433211.2	37	CCDS7269.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288651	0.80914	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.44083	0.93;0.93;0.93	5.29	5.29	0.74685	.	0.000000	0.56097	D	0.000035	T	0.71307	0.3324	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78125	-0.2326	10	0.87932	D	0	-16.2886	16.4194	0.83753	0.0:1.0:0.0:0.0	.	695	Q9UI47	CTNA3_HUMAN	Y	695;695;34	ENSP00000389714:D695Y;ENSP00000362849:D695Y;ENSP00000362840:D34Y	ENSP00000362840:D34Y	D	-	1	0	CTNNA3	67499148	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.529000	0.81952	2.483000	0.83821	0.591000	0.81541	GAT	.		0.403	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048282.2	NM_013266	
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117375351	117375351	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:117375351G>T	ENST00000160373.3	-	15	3751	c.3660C>A	c.(3658-3660)agC>agA	p.S1220R		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1220					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GGCTTTCAGTGCTGCGATTTT	0.388																																					p.S1220R		.											.	CTTNBP2	94	0			c.C3660A						.						68.0	74.0	72.0					7																	117375351		2203	4300	6503	SO:0001583	missense	83992	exon15			TTCAGTGCTGCGA		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3660C>A	7.37:g.117375351G>T	ENSP00000160373:p.Ser1220Arg	72.0	0.0		151.0	67.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	37	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.18|17.18	3.323752|3.323752	0.60634|0.60634	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|T	.|0.48522	.|0.81	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.242732	.|0.56097	.|D	.|0.000039	T|T	0.48352|0.48352	0.1495|0.1495	M|M	0.81802|0.81802	2.56|2.56	0.40475|0.40475	D|D	0.980382|0.980382	.|P	.|0.39717	.|0.684	.|B	.|0.32393	.|0.145	T|T	0.59794|0.59794	-0.7387|-0.7387	5|10	.|0.72032	.|D	.|0.01	-1.2748|-1.2748	13.5357|13.5357	0.61646|0.61646	0.0809:0.0:0.9191:0.0|0.0809:0.0:0.9191:0.0	.|.	.|1220	.|Q8WZ74	.|CTTB2_HUMAN	N|R	708|1220	.|ENSP00000160373:S1220R	.|ENSP00000160373:S1220R	H|S	-|-	1|3	0|2	CTTNBP2|CTTNBP2	117162587|117162587	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	2.355000|2.355000	0.44107|0.44107	2.745000|2.745000	0.94114|0.94114	0.655000|0.655000	0.94253|0.94253	CAC|AGC	.		0.388	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CUL9	23113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43153266	43153266	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:43153266G>A	ENST00000252050.4	+	3	752	c.668G>A	c.(667-669)cGc>cAc	p.R223H	CUL9_ENST00000354495.3_Missense_Mutation_p.R223H|CUL9_ENST00000372647.2_Missense_Mutation_p.R223H	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	223					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TTTGACAGTCGCTATACATTG	0.502																																					p.R223H		.											.	CUL9	529	0			c.G668A						.						144.0	118.0	127.0					6																	43153266		2203	4300	6503	SO:0001583	missense	23113	exon3			ACAGTCGCTATAC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.668G>A	6.37:g.43153266G>A	ENSP00000252050:p.Arg223His	37.0	0.0		121.0	52.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843852	0.71488	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.49432	0.78;0.78;0.78	4.36	4.36	0.52297	.	0.198282	0.43919	D	0.000502	T	0.62295	0.2416	M	0.71036	2.16	0.38358	D	0.944525	D;D;D	0.89917	1.0;1.0;1.0	P;P;D	0.91635	0.877;0.877;0.999	T	0.68926	-0.5280	10	0.87932	D	0	-8.5472	17.0698	0.86570	0.0:0.0:1.0:0.0	.	223;223;223	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	H	223	ENSP00000252050:R223H;ENSP00000346490:R223H;ENSP00000361730:R223H	ENSP00000252050:R223H	R	+	2	0	CUL9	43261244	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.612000	0.98347	2.262000	0.75019	0.462000	0.41574	CGC	.		0.502	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
DBN1	1627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176887553	176887553	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:176887553C>T	ENST00000309007.5	-	10	1054	c.835G>A	c.(835-837)Gca>Aca	p.A279T	DBN1_ENST00000393565.1_Missense_Mutation_p.A279T|DBN1_ENST00000512501.1_Missense_Mutation_p.A11T|DBN1_ENST00000292385.5_Missense_Mutation_p.A281T|DBN1_ENST00000393563.4_Missense_Mutation_p.A11T	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	279					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATAGCTGCTGCCTCCTGAGGG	0.617																																					p.A281T		.											.	DBN1	587	0			c.G841A						.						157.0	149.0	152.0					5																	176887553		2203	4300	6503	SO:0001583	missense	1627	exon11			CTGCTGCCTCCTG		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.835G>A	5.37:g.176887553C>T	ENSP00000308532:p.Ala279Thr	53.0	0.0		144.0	69.0	NM_080881	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881097	0.91740	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563;ENST00000477391	T;T;T;T;T	0.62639	1.07;1.09;1.58;0.01;0.43	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.74831	0.3768	L	0.55834	1.745	0.54753	D	0.999988	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.87578	0.995;0.998;0.996;0.998	T	0.75616	-0.3256	10	0.48119	T	0.1	-7.3028	16.2304	0.82332	0.0:1.0:0.0:0.0	.	229;279;279;281	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	T	279;281;279;11;11;278	ENSP00000308532:A279T;ENSP00000292385:A281T;ENSP00000377195:A279T;ENSP00000423208:A11T;ENSP00000377193:A11T	ENSP00000292385:A281T	A	-	1	0	DBN1	176820159	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	6.514000	0.73746	2.368000	0.80403	0.561000	0.74099	GCA	.		0.617	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
DCAF8L1	139425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	27998516	27998516	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:27998516G>A	ENST00000441525.1	-	1	1050	c.936C>T	c.(934-936)ttC>ttT	p.F312F		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	312										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GGTCAATGGTGAACACAACGG	0.493																																					p.F312F		.											.	DCAF8L1	112	0			c.C936T						.						86.0	75.0	79.0					X																	27998516		2202	4300	6502	SO:0001819	synonymous_variant	139425	exon1			AATGGTGAACACA		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.936C>T	X.37:g.27998516G>A		64.0	0.0		183.0	59.0	NM_001017930	B3KXX1	Silent	SNP	ENST00000441525.1	37	CCDS35222.1																																																																																			.		0.493	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056150.2	XM_066690	
DDR2	4921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	162731029	162731029	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:162731029G>T	ENST00000367922.3	+	10	1322	c.884G>T	c.(883-885)gGt>gTt	p.G295V	DDR2_ENST00000367921.3_Missense_Mutation_p.G295V	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	295					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	TTTGCTAAAGGTGTGAAGATC	0.507																																					p.G295V	NSCLC(161;314 2006 8283 19651 23192)	.											.	DDR2	1464	0			c.G884T						.						169.0	123.0	139.0					1																	162731029		2203	4300	6503	SO:0001583	missense	4921	exon10			CTAAAGGTGTGAA	AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.884G>T	1.37:g.162731029G>T	ENSP00000356899:p.Gly295Val	83.0	0.0		307.0	71.0	NM_001014796	Q7Z730	Missense_Mutation	SNP	ENST00000367922.3	37	CCDS1241.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258986	0.80246	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	T;T	0.70869	-0.52;-0.52	5.89	5.89	0.94794	.	0.106287	0.64402	D	0.000005	T	0.80182	0.4576	M	0.76574	2.34	0.37495	D	0.916527	D	0.60575	0.988	P	0.60345	0.873	T	0.81686	-0.0820	9	0.87932	D	0	.	18.8112	0.92058	0.0:0.0:1.0:0.0	.	295	Q16832	DDR2_HUMAN	V	295	ENSP00000356899:G295V;ENSP00000356898:G295V	ENSP00000356898:G295V	G	+	2	0	DDR2	160997653	1.000000	0.71417	0.975000	0.42487	0.997000	0.91878	5.841000	0.69409	2.763000	0.94921	0.655000	0.94253	GGT	.		0.507	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083213.2	NM_006182	
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	31200854	31200854	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:31200854C>A	ENST00000357033.4	-	68	10181		c.e68+1		DMD_ENST00000378677.2_Splice_Site|DMD_ENST00000378723.3_Splice_Site|DMD_ENST00000343523.2_Splice_Site|DMD_ENST00000474231.1_Splice_Site|DMD_ENST00000378702.4_Splice_Site|DMD_ENST00000378707.3_Splice_Site|DMD_ENST00000541735.1_Splice_Site|DMD_ENST00000359836.1_Splice_Site|DMD_ENST00000378680.2_Splice_Site|DMD_ENST00000361471.4_Splice_Site	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTTCCTAATACCTGAATCCAA	0.418																																					.		.											.	DMD	265	0			c.770+1G>T	GRCh37	CS071228	DMD	S		.						92.0	85.0	87.0					X																	31200854		2202	4300	6502	SO:0001630	splice_region_variant	1756	exon8			CTAATACCTGAAT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9974+1G>T	X.37:g.31200854C>A		75.0	0.0		151.0	57.0	NM_004016	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Splice_Site	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871204	0.72065	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000465285;ENST00000474231;ENST00000361471;ENST00000378680;ENST00000378705	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2593	0.90030	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DMD	31110775	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.651000	0.83577	2.506000	0.84524	0.600000	0.82982	.	.		0.418	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	Intron
DSTYK	25778	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	205180511	205180511	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:205180511G>A	ENST00000367162.3	-	1	183	c.153C>T	c.(151-153)ttC>ttT	p.F51F	DSTYK_ENST00000367161.3_Silent_p.F51F|DSTYK_ENST00000367160.4_Silent_p.F51F	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	51					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TGTCGCGGAAGAACTTCTGGG	0.701																																					p.F51F		.											.	DSTYK	333	0			c.C153T						.						35.0	32.0	33.0					1																	205180511		2203	4300	6503	SO:0001819	synonymous_variant	25778	exon1			GCGGAAGAACTTC	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.153C>T	1.37:g.205180511G>A		8.0	0.0		30.0	12.0	NM_199462	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	ENST00000367162.3	37	CCDS1451.1																																																																																			.		0.701	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
DYNC1H1	1778	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102467528	102467528	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:102467528G>A	ENST00000360184.4	+	20	4396	c.4232G>A	c.(4231-4233)cGc>cAc	p.R1411H		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1411	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CTTAAAGACCGCCATTGGAAA	0.428																																					p.R1411H		.											.	DYNC1H1	98	0			c.G4232A						.						244.0	248.0	247.0					14																	102467528		2203	4300	6503	SO:0001583	missense	1778	exon20			AAGACCGCCATTG	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4232G>A	14.37:g.102467528G>A	ENSP00000348965:p.Arg1411His	109.0	2.0		261.0	90.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	35	5.453091	0.96223	.	.	ENSG00000197102	ENST00000360184	T	0.66995	-0.24	5.85	5.85	0.93711	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.88584	0.6476	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91336	0.5093	10	0.87932	D	0	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	1411	Q14204	DYHC1_HUMAN	H	1411	ENSP00000348965:R1411H	ENSP00000348965:R1411H	R	+	2	0	DYNC1H1	101537281	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	9.741000	0.98843	2.767000	0.95098	0.563000	0.77884	CGC	.		0.428	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
EOMES	8320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	27758974	27758974	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:27758974T>A	ENST00000295743.4	-	6	1851	c.1648A>T	c.(1648-1650)Att>Ttt	p.I550F	EOMES_ENST00000537516.1_Missense_Mutation_p.I274F|EOMES_ENST00000449599.1_Missense_Mutation_p.I569F|EOMES_ENST00000461503.1_5'Flank			O95936	EOMES_HUMAN	eomesodermin	550					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						AAGGATTTAATGCCATATGGG	0.517																																					p.I550F		.											.	EOMES	156	0			c.A1648T						.						104.0	108.0	106.0					3																	27758974		2203	4300	6503	SO:0001583	missense	8320	exon6			ATTTAATGCCATA	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.1648A>T	3.37:g.27758974T>A	ENSP00000295743:p.Ile550Phe	66.0	0.0		187.0	67.0	NM_005442	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	ENST00000295743.4	37	CCDS2646.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.818918	0.32145	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000537516;ENST00000535713	D;D;D	0.86230	-2.04;-2.09;-1.78	4.72	3.57	0.40892	.	0.165611	0.52532	D	0.000069	T	0.79364	0.4433	L	0.31065	0.9	0.58432	D	0.999999	B;B;B	0.23058	0.001;0.079;0.047	B;B;B	0.25884	0.004;0.064;0.029	T	0.72896	-0.4153	10	0.37606	T	0.19	.	10.5323	0.44983	0.0:0.0778:0.0:0.9222	.	283;569;550	B7Z4I2;G3XAI5;O95936	.;.;EOMES_HUMAN	F	550;569;274;434	ENSP00000295743:I550F;ENSP00000388620:I569F;ENSP00000442097:I274F	ENSP00000295743:I550F	I	-	1	0	EOMES	27733978	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	5.895000	0.69814	0.915000	0.36847	0.383000	0.25322	ATT	.		0.517	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
ERCC8	1161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	60200656	60200656	+	Silent	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:60200656A>G	ENST00000265038.5	-	5	486	c.444T>C	c.(442-444)caT>caC	p.H148H	ERCC8_ENST00000426742.2_Silent_p.H90H|ERCC8_ENST00000462279.1_5'UTR|ERCC8_ENST00000543101.1_Intron	NM_000082.3	NP_000073.1	Q13216	ERCC8_HUMAN	excision repair cross-complementation group 8	148					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|positive regulation of DNA repair (GO:0045739)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|transcription-coupled nucleotide-excision repair (GO:0006283)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|protein complex (GO:0043234)	protein complex binding (GO:0032403)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				CTGGAGACATATGATGACTAT	0.313																																					p.H148H		.											.	ERCC8	227	0			c.T444C						.						116.0	117.0	117.0					5																	60200656		2203	4297	6500	SO:0001819	synonymous_variant	1161	exon5			AGACATATGATGA	U28413	CCDS3978.1	5q12.1	2014-09-17	2014-03-07		ENSG00000049167	ENSG00000049167		"""WD repeat domain containing"""	3439	protein-coding gene	gene with protein product		609412	"""Cockayne syndrome 1 (classical)"", ""excision repair cross-complementing rodent repair deficiency, complementation group 8"""	CKN1		8596535	Standard	NM_000082		Approved	CSA	uc003jsm.3	Q13216	OTTHUMG00000097741	ENST00000265038.5:c.444T>C	5.37:g.60200656A>G		108.0	0.0		322.0	130.0	NM_000082	B2RB64|Q6FHX5|Q96GB9	Silent	SNP	ENST00000265038.5	37	CCDS3978.1																																																																																			.		0.313	ERCC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214971.2	NM_000082	
FAM180A	389558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135418945	135418945	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:135418945G>T	ENST00000338588.3	-	3	565	c.300C>A	c.(298-300)agC>agA	p.S100R	FAM180A_ENST00000415751.1_Missense_Mutation_p.S100R|FAM180A_ENST00000435869.1_Intron	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	100						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						TGTCTGGGATGCTCTTGGGGA	0.597																																					p.S100R		.											.	FAM180A	92	0			c.C300A						.						131.0	120.0	124.0					7																	135418945		2203	4300	6503	SO:0001583	missense	389558	exon3			TGGGATGCTCTTG	AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.300C>A	7.37:g.135418945G>T	ENSP00000342336:p.Ser100Arg	41.0	0.0		93.0	41.0	NM_205855	B2RP85	Missense_Mutation	SNP	ENST00000338588.3	37	CCDS5841.1	.	.	.	.	.	.	.	.	.	.	G	7.017	0.557989	0.13436	.	.	ENSG00000189320	ENST00000338588;ENST00000415751	T;T	0.30182	1.54;1.54	5.44	4.55	0.56014	.	0.544661	0.23063	N	0.052359	T	0.19846	0.0477	N	0.22421	0.69	0.34191	D	0.672043	B	0.06786	0.001	B	0.04013	0.001	T	0.19976	-1.0289	10	0.21014	T	0.42	2.6297	11.0861	0.48089	0.0915:0.0:0.9084:0.0	.	100	Q6UWF9	F180A_HUMAN	R	100	ENSP00000342336:S100R;ENSP00000395467:S100R	ENSP00000342336:S100R	S	-	3	2	FAM180A	135069485	1.000000	0.71417	0.995000	0.50966	0.463000	0.32649	2.834000	0.48167	1.278000	0.44430	0.561000	0.74099	AGC	.		0.597	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340554.2	NM_205855	
FAM186A	121006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50724480	50724480	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:50724480T>A	ENST00000327337.5	-	7	6909	c.6910A>T	c.(6910-6912)Ata>Tta	p.I2304L	FAM186A_ENST00000543096.1_Missense_Mutation_p.I315L|FAM186A_ENST00000543111.1_Missense_Mutation_p.I2304L	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	2304																	TTCTCTGCTATTGGGTAGCTT	0.488																																					p.I2304L	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A	68	0			c.A6910T						.						137.0	107.0	116.0					12																	50724480		692	1591	2283	SO:0001583	missense	121006	exon7			CTGCTATTGGGTA		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.6910A>T	12.37:g.50724480T>A	ENSP00000329995:p.Ile2304Leu	92.0	0.0		285.0	110.0	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	37	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.077345	0.76415	.	.	ENSG00000185958	ENST00000543111;ENST00000543096;ENST00000327337	T;T;T	0.26373	2.23;1.74;2.23	4.15	2.96	0.34315	.	0.000000	0.56097	D	0.000023	T	0.33527	0.0866	L	0.60455	1.87	0.22457	N	0.999085	P;P	0.50943	0.94;0.94	P;P	0.53450	0.726;0.726	T	0.09228	-1.0684	10	0.66056	D	0.02	.	6.702	0.23230	0.0:0.1079:0.0:0.8921	.	2304;2304	F5GYN0;A6NE01	.;F186A_HUMAN	L	2304;315;2304	ENSP00000441337:I2304L;ENSP00000443703:I315L;ENSP00000329995:I2304L	ENSP00000329995:I2304L	I	-	1	0	FAM186A	49010747	0.988000	0.35896	1.000000	0.80357	0.997000	0.91878	0.311000	0.19380	0.893000	0.36288	0.482000	0.46254	ATA	.		0.488	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48780612	48780612	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:48780612C>T	ENST00000316623.5	-	26	3616	c.3161G>A	c.(3160-3162)aGg>aAg	p.R1054K		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1054	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCTGTCACACCTGCACTTAAA	0.468																																					p.R1054K		.											.	FBN1	92	0			c.G3161A						.						91.0	85.0	87.0					15																	48780612		2198	4296	6494	SO:0001583	missense	2200	exon26			TCACACCTGCACT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3161G>A	15.37:g.48780612C>T	ENSP00000325527:p.Arg1054Lys	40.0	0.0		123.0	52.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789568	0.70337	.	.	ENSG00000166147	ENST00000316623	D	0.92149	-2.98	6.17	6.17	0.99709	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.85513	0.5714	N	0.17564	0.495	0.80722	D	1	B	0.12013	0.005	B	0.19946	0.027	T	0.79291	-0.1864	10	0.26408	T	0.33	.	14.6223	0.68594	0.0:0.9304:0.0:0.0696	.	1054	P35555	FBN1_HUMAN	K	1054	ENSP00000325527:R1054K	ENSP00000325527:R1054K	R	-	2	0	FBN1	46567904	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.590000	0.46154	2.941000	0.99782	0.655000	0.94253	AGG	.		0.468	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FOXO4	4303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70316754	70316754	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:70316754C>G	ENST00000374259.3	+	1	708	c.376C>G	c.(376-378)Cag>Gag	p.Q126E	FOXO4_ENST00000341558.3_Missense_Mutation_p.Q71E|FOXO4_ENST00000466874.1_3'UTR	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	126					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					GACACTTGCCCAGATCTACGA	0.542																																					p.Q126E		.											.	FOXO4	986	0			c.C376G						.						61.0	59.0	60.0					X																	70316754		2188	4296	6484	SO:0001583	missense	4303	exon1			CTTGCCCAGATCT		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.376C>G	X.37:g.70316754C>G	ENSP00000363377:p.Gln126Glu	91.0	0.0		283.0	115.0	NM_005938	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Missense_Mutation	SNP	ENST00000374259.3	37	CCDS43969.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023877	0.75390	.	.	ENSG00000184481	ENST00000374259;ENST00000341558	D;D	0.94650	-3.48;-3.48	5.02	5.02	0.67125	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.93520	0.7932	N	0.13235	0.315	0.80722	D	1	B;P;P	0.46395	0.272;0.877;0.844	B;B;D	0.63113	0.332;0.38;0.911	D	0.92885	0.6326	10	0.28530	T	0.3	-27.8271	15.999	0.80275	0.0:1.0:0.0:0.0	.	126;71;126	B4DTB6;P98177-2;P98177	.;.;FOXO4_HUMAN	E	126;71	ENSP00000363377:Q126E;ENSP00000342209:Q71E	ENSP00000342209:Q71E	Q	+	1	0	FOXO4	70233479	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.388000	0.79795	2.077000	0.62373	0.523000	0.50628	CAG	.		0.542	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938	
FRG1B	284802	broad.mit.edu;ucsc.edu	37	20	29625935	29625935	+	Missense_Mutation	SNP	A	A	G	rs62198354	byFrequency	TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr20:29625935A>G	ENST00000278882.3	+	5	559	c.179A>G	c.(178-180)cAt>cGt	p.H60R	FRG1B_ENST00000358464.4_Missense_Mutation_p.H60R|FRG1B_ENST00000439954.2_Missense_Mutation_p.H65R			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	60										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CTTGTTGGGCATTCAGATGCA	0.343																																					.		.											.	FRG1B	22	0			.						.																																			SO:0001583	missense	284802	.			TTGGGCATTCAGA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.179A>G	20.37:g.29625935A>G	ENSP00000278882:p.His60Arg	81.0	1.0		343.0	157.0	.	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	0	-2.806684	0.00074	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.37752	1.18	1.68	0.695	0.18070	.	0.109676	0.64402	N	0.000005	T	0.12732	0.0309	.	.	.	0.46131	P	0.0011130000000000306	B	0.02656	0.0	B	0.04013	0.001	T	0.38045	-0.9679	8	0.02654	T	1	.	6.5055	0.22192	0.1743:0.0:0.8257:0.0	rs62198354	65	F5H5R5	.	R	60;65;60	ENSP00000408863:H65R	ENSP00000278882:H60R	H	+	2	0	FRG1B	28239596	1.000000	0.71417	0.997000	0.53966	0.021000	0.10359	5.229000	0.65316	0.267000	0.21916	-1.392000	0.01152	CAT	A|0.417;G|0.583		0.343	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
FRMPD4	9758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	12712563	12712563	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:12712563T>C	ENST00000380682.1	+	9	1429	c.923T>C	c.(922-924)cTc>cCc	p.L308P		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	308	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TTCGAGTATCTCTATGTTCAG	0.373																																					p.L308P		.											.	FRMPD4	263	0			c.T923C						.						106.0	91.0	96.0					X																	12712563		2203	4300	6503	SO:0001583	missense	9758	exon9			AGTATCTCTATGT	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.923T>C	X.37:g.12712563T>C	ENSP00000370057:p.Leu308Pro	103.0	0.0		328.0	132.0	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.105780	0.77096	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.53857	0.6	5.02	5.02	0.67125	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.64402	D	0.000003	T	0.73281	0.3567	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.77963	-0.2390	10	0.87932	D	0	.	14.1021	0.65062	0.0:0.0:0.0:1.0	.	300;308	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	P	308;299;297	ENSP00000370057:L308P	ENSP00000304583:L297P	L	+	2	0	FRMPD4	12622484	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.578000	0.82498	1.775000	0.52247	0.417000	0.27973	CTC	.		0.373	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
G6PC3	92579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42152763	42152763	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:42152763G>A	ENST00000269097.4	+	5	852	c.621G>A	c.(619-621)atG>atA	p.M207I		NM_138387.3	NP_612396.1	Q9BUM1	G6PC3_HUMAN	glucose 6 phosphatase, catalytic, 3	207					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphatase activity (GO:0004346)			endometrium(2)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	11		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TGGCCCTCATGCTAGGCACCA	0.577																																					p.M207I		.											.	G6PC3	91	0			c.G621A						.						174.0	146.0	156.0					17																	42152763		2203	4300	6503	SO:0001583	missense	92579	exon5			CCTCATGCTAGGC	BC021574	CCDS11476.1	17q21.31	2014-09-17				ENSG00000141349			24861	protein-coding gene	gene with protein product		611045				12370122, 12965222	Standard	NM_138387		Approved	UGRP	uc002iex.3	Q9BUM1		ENST00000269097.4:c.621G>A	17.37:g.42152763G>A	ENSP00000269097:p.Met207Ile	93.0	0.0		286.0	99.0	NM_138387	Q8WU15	Missense_Mutation	SNP	ENST00000269097.4	37	CCDS11476.1	.	.	.	.	.	.	.	.	.	.	G	9.508	1.105100	0.20632	.	.	ENSG00000141349	ENST00000269097	T	0.74632	-0.86	5.27	3.3	0.37823	.	0.277563	0.35067	N	0.003464	T	0.60157	0.2247	L	0.29908	0.895	0.30631	N	0.757485	B	0.06786	0.001	B	0.04013	0.001	T	0.56902	-0.7902	10	0.37606	T	0.19	-17.7143	9.6863	0.40100	0.1524:0.0:0.8476:0.0	.	207	Q9BUM1	G6PC3_HUMAN	I	207	ENSP00000269097:M207I	ENSP00000269097:M207I	M	+	3	0	G6PC3	39508289	1.000000	0.71417	0.998000	0.56505	0.108000	0.19459	2.196000	0.42686	0.815000	0.34398	0.563000	0.77884	ATG	.		0.577	G6PC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457675.1	NM_138387	
GABRA4	2557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	46967062	46967062	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:46967062C>A	ENST00000264318.3	-	8	2041	c.1059G>T	c.(1057-1059)agG>agT	p.R353S		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	353					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TTGATGTCTTCCTTTTGGCTT	0.458																																					p.R353S	Ovarian(6;283 369 8234 12290 33402)	.											.	GABRA4	156	0			c.G1059T						.						113.0	115.0	114.0					4																	46967062		2203	4299	6502	SO:0001583	missense	2557	exon8			TGTCTTCCTTTTG		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1059G>T	4.37:g.46967062C>A	ENSP00000264318:p.Arg353Ser	165.0	0.0		620.0	230.0	NM_000809	Q8IYR7	Missense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569578	0.65765	.	.	ENSG00000109158	ENST00000264318	D	0.86366	-2.11	4.81	3.95	0.45737	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.432470	0.01856	N	0.036295	D	0.86694	0.5994	L	0.37800	1.135	0.43199	D	0.995048	B	0.30361	0.277	B	0.38655	0.278	T	0.67217	-0.5726	10	0.38643	T	0.18	.	12.5658	0.56308	0.0:0.918:0.0:0.082	.	353	P48169	GBRA4_HUMAN	S	353	ENSP00000264318:R353S	ENSP00000264318:R353S	R	-	3	2	GABRA4	46661819	0.995000	0.38212	0.998000	0.56505	0.851000	0.48451	3.224000	0.51238	2.481000	0.83766	0.591000	0.81541	AGG	.		0.458	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
GABRR2	2570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	90009577	90009577	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:90009577A>G	ENST00000402938.3	-	2	254	c.121T>C	c.(121-123)Tat>Cat	p.Y41H	GABRR2_ENST00000602808.1_5'UTR|GABRR2_ENST00000602399.1_Missense_Mutation_p.Y66H	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	41					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TTCTTCTTATATAAGTGACTG	0.473																																					p.Y41H		.											.	GABRR2	68	0			c.T121C						.						107.0	97.0	100.0					6																	90009577		2203	4300	6503	SO:0001583	missense	2570	exon2			TCTTATATAAGTG		CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.121T>C	6.37:g.90009577A>G	ENSP00000386029:p.Tyr41His	74.0	0.0		190.0	79.0	NM_002043	A2BDE4|Q9H153	Missense_Mutation	SNP	ENST00000402938.3	37	CCDS5020.3	.	.	.	.	.	.	.	.	.	.	A	1.614	-0.523251	0.04141	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.42	1.69	0.24217	.	0.544065	0.20224	N	0.096628	T	0.09379	0.0231	L	0.36672	1.1	0.09310	N	1	B	0.32543	0.375	B	0.32624	0.149	T	0.26121	-1.0112	8	.	.	.	.	5.6197	0.17450	0.7324:0.0:0.141:0.1267	.	66	P28476	GBRR2_HUMAN	H	66	.	.	Y	-	1	0	GABRR2	90066296	0.007000	0.16637	0.000000	0.03702	0.024000	0.10985	2.324000	0.43831	0.052000	0.16007	-0.360000	0.07572	TAT	.		0.473	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041482.3		
GANAB	23193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62407128	62407128	+	Silent	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:62407128A>G	ENST00000356638.3	-	2	130	c.114T>C	c.(112-114)ttT>ttC	p.F38F	GANAB_ENST00000534779.1_Intron|GANAB_ENST00000346178.4_Silent_p.F38F|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_5'UTR	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	38					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CACAGGTCTTAAAGTTGCTTC	0.463																																					p.F38F	Melanoma(23;1005 1074 15747 18937)	.											.	GANAB	94	0			c.T114C						.						84.0	83.0	84.0					11																	62407128		2202	4299	6501	SO:0001819	synonymous_variant	23193	exon2			GGTCTTAAAGTTG	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.114T>C	11.37:g.62407128A>G		90.0	0.0		194.0	86.0	NM_198334	A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	37	CCDS8026.1																																																																																			.		0.463	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
GART	2618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34876612	34876612	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr21:34876612T>A	ENST00000381831.3	-	22	3115	c.2852A>T	c.(2851-2853)gAt>gTt	p.D951V	GART_ENST00000543717.1_Missense_Mutation_p.D503V|GART_ENST00000381839.3_Missense_Mutation_p.D951V|GART_ENST00000381815.4_Missense_Mutation_p.D951V	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	951	10-formyltetrahydrofolate binding.|GART.	Raises pKa of active site His. {ECO:0000250}.			'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CTGTCCAGCATCCACATCTTC	0.358																																					p.D951V		.											.	GART	91	0			c.A2852T						.						60.0	60.0	60.0					21																	34876612		2203	4300	6503	SO:0001583	missense	2618	exon22			CCAGCATCCACAT	M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2852A>T	21.37:g.34876612T>A	ENSP00000371253:p.Asp951Val	46.0	0.0		99.0	35.0	NM_001136005	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	ENST00000381831.3	37	CCDS13627.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489056	0.84962	.	.	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000543717	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.76	5.76	0.90799	Formyl transferase, N-terminal (3);	0.105526	0.64402	D	0.000005	D	0.98617	0.9537	H	0.99325	4.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99741	1.1015	10	0.87932	D	0	-36.3836	16.3634	0.83296	0.0:0.0:0.0:1.0	.	951	P22102	PUR2_HUMAN	V	951;951;951;503	ENSP00000371236:D951V;ENSP00000371253:D951V;ENSP00000371261:D951V;ENSP00000443579:D503V	ENSP00000371236:D951V	D	-	2	0	GART	33798482	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.466000	0.80914	2.324000	0.78689	0.533000	0.62120	GAT	.		0.358	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140626.3	NM_000819	
GPR112	139378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135487872	135487872	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:135487872T>C	ENST00000394143.1	+	23	8967	c.8676T>C	c.(8674-8676)tcT>tcC	p.S2892S	GPR112_ENST00000412101.1_Silent_p.S2687S|GPR112_ENST00000287534.4_Silent_p.S2645S|GPR112_ENST00000394141.1_Silent_p.S2687S|GPR112_ENST00000370652.1_Silent_p.S2892S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2892					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AAGATGATTCTATCTTTTACA	0.358																																					p.S2892S		.											.	GPR112	183	0			c.T8676C						.						175.0	138.0	151.0					X																	135487872		2203	4300	6503	SO:0001819	synonymous_variant	139378	exon23			TGATTCTATCTTT	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8676T>C	X.37:g.135487872T>C		143.0	0.0		487.0	173.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	ENST00000394143.1	37	CCDS35409.1																																																																																			.		0.358	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GPR179	440435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	36483358	36483358	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:36483358C>A	ENST00000342292.4	-	11	6114	c.6094G>T	c.(6094-6096)Gtg>Ttg	p.V2032L	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2032					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TGCCTTGACACCCCTTTGACA	0.502																																					p.V2032L		.											.	GPR179	93	0			c.G6094T						.						115.0	109.0	111.0					17																	36483358		1938	4150	6088	SO:0001583	missense	440435	exon11			TTGACACCCCTTT		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6094G>T	17.37:g.36483358C>A	ENSP00000345060:p.Val2032Leu	70.0	0.0		142.0	57.0	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	C	6.818	0.519989	0.13005	.	.	ENSG00000188888	ENST00000342292	T	0.49139	0.79	4.88	-1.29	0.09288	.	0.965211	0.08475	N	0.940342	T	0.30198	0.0757	L	0.29908	0.895	0.09310	N	1	B	0.18013	0.025	B	0.14023	0.01	T	0.22452	-1.0216	10	0.25751	T	0.34	-0.3936	5.4542	0.16582	0.0:0.401:0.1444:0.4546	.	2032	Q6PRD1	GP179_HUMAN	L	2032	ENSP00000345060:V2032L	ENSP00000345060:V2032L	V	-	1	0	GPR179	33736884	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-0.211000	0.09332	-0.043000	0.13513	-0.291000	0.09656	GTG	.		0.502	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
GRIK4	2900	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	120827654	120827654	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:120827654T>C	ENST00000527524.2	+	16	2153	c.1866T>C	c.(1864-1866)agT>agC	p.S622S	GRIK4_ENST00000438375.2_Silent_p.S622S	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	622					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GCTGTGTCAGTGGCGTCTGGT	0.637																																					p.S622S		.											.	GRIK4	92	0			c.T1866C						.						31.0	25.0	27.0					11																	120827654		2203	4298	6501	SO:0001819	synonymous_variant	2900	exon14			TGTCAGTGGCGTC	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1866T>C	11.37:g.120827654T>C		15.0	0.0		24.0	14.0	NM_014619	A8K9L1	Silent	SNP	ENST00000527524.2	37	CCDS8433.1																																																																																			.		0.637	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
GRIN2B	2904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	13720174	13720174	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:13720174G>A	ENST00000609686.1	-	12	2592	c.2383C>T	c.(2383-2385)Ctc>Ttc	p.L795F		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	795					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTGAGCCAGAGAGCTTCCAGT	0.502																																					p.L795F		.											.	GRIN2B	231	0			c.C2383T						.						72.0	70.0	71.0					12																	13720174		2203	4300	6503	SO:0001583	missense	2904	exon12			GCCAGAGAGCTTC		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2383C>T	12.37:g.13720174G>A	ENSP00000477455:p.Leu795Phe	61.0	0.0		172.0	69.0	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217128	0.79352	.	.	ENSG00000150086	ENST00000279593	T	0.27256	1.68	5.59	5.59	0.84812	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.30978	0.0782	N	0.03324	-0.35	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.52320	-0.8591	10	0.66056	D	0.02	.	19.5854	0.95488	0.0:0.0:1.0:0.0	.	795	Q13224	NMDE2_HUMAN	F	795	ENSP00000279593:L795F	ENSP00000279593:L795F	L	-	1	0	GRIN2B	13611441	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.634000	0.74290	2.630000	0.89119	0.650000	0.86243	CTC	.		0.502	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
HARS2	23438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140077173	140077173	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:140077173G>A	ENST00000230771.3	+	11	1440	c.1217G>A	c.(1216-1218)cGg>cAg	p.R406Q	HARS2_ENST00000432671.2_Missense_Mutation_p.R292Q|HARS2_ENST00000448069.2_Missense_Mutation_p.R234Q|HARS2_ENST00000508522.1_Missense_Mutation_p.R381Q|HARS2_ENST00000435019.2_Missense_Mutation_p.R366Q|HARS2_ENST00000437649.2_Missense_Mutation_p.R332Q|ZMAT2_ENST00000274712.3_5'Flank	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	406					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGAAGGTGCGGACTACAGAG	0.403																																					p.R406Q		.											.	HARS2	90	0			c.G1217A						.						91.0	95.0	94.0					5																	140077173		2203	4300	6503	SO:0001583	missense	23438	exon11			AGGTGCGGACTAC	U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.1217G>A	5.37:g.140077173G>A	ENSP00000230771:p.Arg406Gln	63.0	0.0		162.0	63.0	NM_012208	B4DDY8	Missense_Mutation	SNP	ENST00000230771.3	37	CCDS4238.1	.	.	.	.	.	.	.	.	.	.	g	20.9	4.066559	0.76187	.	.	ENSG00000112855	ENST00000230771;ENST00000435019;ENST00000437649;ENST00000432671;ENST00000508522;ENST00000448069;ENST00000427675	T;T;T;T;T;T	0.43294	0.95;0.96;0.96;0.98;0.97;0.99	5.67	4.62	0.57501	Aminoacyl-tRNA synthetase, class II (1);	0.050034	0.85682	D	0.000000	T	0.47192	0.1432	M	0.81179	2.53	0.80722	D	1	B;P;P;P;P	0.45078	0.374;0.82;0.85;0.82;0.82	B;B;B;B;B	0.39904	0.087;0.187;0.313;0.135;0.187	T	0.57081	-0.7872	10	0.49607	T	0.09	-1.1028	15.5187	0.75846	0.077:0.0:0.923:0.0	.	259;234;332;381;406	E9PD60;B4DQ67;E9PG66;B4DDY8;P49590	.;.;.;.;SYHM_HUMAN	Q	406;366;332;292;381;234;245	ENSP00000230771:R406Q;ENSP00000412887:R366Q;ENSP00000411708:R332Q;ENSP00000415007:R292Q;ENSP00000423616:R381Q;ENSP00000407105:R234Q	ENSP00000230771:R406Q	R	+	2	0	HARS2	140057357	1.000000	0.71417	0.978000	0.43139	0.186000	0.23388	7.911000	0.87458	2.673000	0.90976	0.655000	0.94253	CGG	G|1.000;A|0.000		0.403	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2	NM_012208	
HEATR2	54919	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	810170	810170	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:810170T>C	ENST00000297440.6	+	9	1866	c.1846T>C	c.(1846-1848)Tcc>Ccc	p.S616P	HEATR2_ENST00000403952.3_Missense_Mutation_p.S41P|HEATR2_ENST00000313147.5_Missense_Mutation_p.S616P	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	616						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		TCTGCAGCCCTCCCAAGACCC	0.647																																					p.S616P		.											.	HEATR2	69	0			c.T1846C						.						72.0	58.0	63.0					7																	810170		2203	4300	6503	SO:0001583	missense	54919	exon9			CAGCCCTCCCAAG	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.1846T>C	7.37:g.810170T>C	ENSP00000297440:p.Ser616Pro	54.0	2.0		228.0	133.0	NM_017802	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	ENST00000297440.6	37	CCDS34580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.002|7.002	0.555024|0.555024	0.13436|0.13436	.|.	.|.	ENSG00000164818|ENSG00000164818	ENST00000440747|ENST00000297440;ENST00000313147;ENST00000537862;ENST00000403952	.|T;T;T	.|0.70282	.|-0.47;-0.47;-0.47	4.7|4.7	-2.17|-2.17	0.07059|0.07059	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.643670	.|0.16782	.|N	.|0.199724	T|T	0.47488|0.47488	0.1448|0.1448	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.42692	.|0.682;0.627;0.787	.|B;B;B	.|0.34242	.|0.086;0.139;0.178	T|T	0.42582|0.42582	-0.9443|-0.9443	5|10	.|0.44086	.|T	.|0.13	-11.2492|-11.2492	4.8124|4.8124	0.13349|0.13349	0.4904:0.0:0.1168:0.3928|0.4904:0.0:0.1168:0.3928	.|.	.|616;41;362	.|Q86Y56;E9PGY2;F5H8D4	.|HEAT2_HUMAN;.;.	P|P	417|616;616;362;41	.|ENSP00000297440:S616P;ENSP00000321451:S616P;ENSP00000384884:S41P	.|ENSP00000297440:S616P	L|S	+|+	2|1	0|0	HEATR2|HEATR2	776696|776696	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.031000|0.031000	0.12232|0.12232	0.337000|0.337000	0.19841|0.19841	-0.538000|-0.538000	0.06281|0.06281	-0.213000|-0.213000	0.12676|0.12676	CTC|TCC	.		0.647	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	185950141	185950141	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:185950141T>G	ENST00000271588.4	+	17	2827	c.2598T>G	c.(2596-2598)atT>atG	p.I866M	HMCN1_ENST00000367492.2_Missense_Mutation_p.I866M|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	866	Ig-like C2-type 5.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAACCTATATTTGTGAAGCTG	0.388																																					p.I866M		.											.	HMCN1	113	0			c.T2598G						.						156.0	163.0	161.0					1																	185950141		2203	4300	6503	SO:0001583	missense	83872	exon17			CTATATTTGTGAA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.2598T>G	1.37:g.185950141T>G	ENSP00000271588:p.Ile866Met	64.0	0.0		204.0	51.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.798796	0.70567	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.30182	1.54;1.54	5.81	1.03	0.20045	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.228696	0.44483	D	0.000459	T	0.33265	0.0857	L	0.31294	0.92	0.37495	D	0.916531	P;D	0.76494	0.906;0.999	P;D	0.83275	0.704;0.996	T	0.31916	-0.9926	10	0.46703	T	0.11	.	2.5891	0.04838	0.1401:0.4117:0.1451:0.303	.	250;866	Q96RW7-3;Q96RW7	.;HMCN1_HUMAN	M	866	ENSP00000271588:I866M;ENSP00000356462:I866M	ENSP00000271588:I866M	I	+	3	3	HMCN1	184216764	0.985000	0.35326	0.997000	0.53966	0.997000	0.91878	0.162000	0.16501	0.144000	0.18951	0.533000	0.62120	ATT	.		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121416711	121416714	+	Frame_Shift_Del	DEL	GGGA	GGGA	-			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	GGGA	GGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:121416711_121416714delGGGA	ENST00000257555.6	+	1	366_369	c.140_143delGGGA	c.(139-144)ggggagfs	p.GE47fs	HNF1A_ENST00000543427.1_Intron|HNF1A-AS1_ENST00000433033.2_RNA|HNF1A_ENST00000544413.1_Frame_Shift_Del_p.GE47fs|HNF1A_ENST00000402929.1_Frame_Shift_Del_p.GE47fs|HNF1A_ENST00000400024.2_Frame_Shift_Del_p.GE47fs|HNF1A_ENST00000541395.1_Frame_Shift_Del_p.GE47fs|HNF1A-AS1_ENST00000535301.1_RNA|HNF1A_ENST00000538626.1_Intron|HNF1A-AS1_ENST00000537361.1_RNA			P20823	HNF1A_HUMAN	HNF1 homeobox A	47					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.D45fs*9(1)|p.D45fs*102(1)|p.Y36fs*107(1)|p.?(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTGGACAAGGGGGAGTCCTGCGGC	0.691									Hepatic Adenoma, Familial Clustering of																												p.47_48del		.											.	HNF1A	1745	4	Deletion - Frameshift(2)|Unknown(1)|Complex - frameshift(1)	liver(3)|endometrium(1)	c.140_143del	GRCh37	CD013206|CM030524|CM981895	HNF1A	D|M		.																																			SO:0001589	frameshift_variant	6927	exon1	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	ACAAGGGGGAGTC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.140_143delGGGA	12.37:g.121416711_121416714delGGGA	ENSP00000257555:p.Gly47fs	42.0	0.0		96.0	33.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Del	DEL	ENST00000257555.6	37	CCDS9209.1																																																																																			.		0.691	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	121432014	121432014	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:121432014T>A	ENST00000257555.6	+	4	987	c.761T>A	c.(760-762)cTg>cAg	p.L254Q	HNF1A_ENST00000543427.1_Missense_Mutation_p.L137Q|HNF1A_ENST00000544413.1_Missense_Mutation_p.L254Q|HNF1A_ENST00000402929.1_Missense_Mutation_p.L254Q|HNF1A_ENST00000400024.2_Missense_Mutation_p.L254Q|HNF1A_ENST00000541395.1_Missense_Mutation_p.L254Q|HNF1A_ENST00000538626.1_Intron			P20823	HNF1A_HUMAN	HNF1 homeobox A	254			L -> M (in late-onset NIDDM; low penetrance; unknown pathological significance). {ECO:0000269|PubMed:9287055}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q250_G255del(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCACAGGGGCTGGGCTCCAAC	0.612									Hepatic Adenoma, Familial Clustering of																												p.L254Q		.											.	HNF1A	1745	2	Deletion - In frame(2)	liver(2)	c.T761A						.						40.0	40.0	40.0					12																	121432014		2203	4300	6503	SO:0001583	missense	6927	exon4	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	AGGGGCTGGGCTC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.761T>A	12.37:g.121432014T>A	ENSP00000257555:p.Leu254Gln	34.0	0.0		71.0	21.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.585079	0.86748	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.95788	-3.81;-3.81;-3.81;-3.81	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.50627	D	0.000101	D	0.97259	0.9104	M	0.73598	2.24	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.999;0.999;0.999;0.994	D	0.97877	1.0289	10	0.87932	D	0	-15.4213	13.6279	0.62178	0.0:0.0:0.0:1.0	.	254;254;254;254	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	Q	254;254;254;254;254;137;254;254;254;254;254	ENSP00000257555:L254Q;ENSP00000439721:L137Q;ENSP00000443112:L254Q;ENSP00000438804:L254Q	ENSP00000257555:L254Q	L	+	2	0	HNF1A	119916397	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.630000	0.83225	1.820000	0.53075	0.335000	0.21663	CTG	.		0.612	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HTATSF1	27336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135582923	135582923	+	Silent	SNP	T	T	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:135582923T>G	ENST00000218364.4	+	4	690	c.516T>G	c.(514-516)ctT>ctG	p.L172L	HTATSF1_ENST00000535601.1_Silent_p.L172L	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	172	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					AGGTCAAACTTTACAAAGATA	0.318																																					p.L172L		.											.	HTATSF1	132	0			c.T516G						.						100.0	104.0	103.0					X																	135582923		2203	4293	6496	SO:0001819	synonymous_variant	27336	exon5			CAAACTTTACAAA	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.516T>G	X.37:g.135582923T>G		155.0	0.0		579.0	246.0	NM_001163280	D3DWG9|Q59G06|Q99730	Silent	SNP	ENST00000218364.4	37	CCDS14657.1																																																																																			.		0.318	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
IDH3A	3419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78454584	78454584	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:78454584T>C	ENST00000299518.2	+	6	569	c.486T>C	c.(484-486)gaT>gaC	p.D162D	IDH3A_ENST00000441490.2_Silent_p.D53D|IDH3A_ENST00000561366.1_5'Flank|IDH3A_ENST00000558535.1_3'UTR|IDH3A_ENST00000558554.1_Silent_p.D127D|IDH3A_ENST00000559205.1_Intron	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	162					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						AGATTGTTGATGGAGTCGTGC	0.542																																					p.D162D		.											.	IDH3A	226	0			c.T486C						.						127.0	100.0	109.0					15																	78454584		2196	4293	6489	SO:0001819	synonymous_variant	3419	exon6			TGTTGATGGAGTC		CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.486T>C	15.37:g.78454584T>C		26.0	0.0		106.0	64.0	NM_005530	D3DW83|Q9H3X0	Silent	SNP	ENST00000299518.2	37	CCDS10297.1																																																																																			.		0.542	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289799.4	NM_005530	
IL12A	3592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	159708075	159708075	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:159708075G>T	ENST00000305579.2	+	2	547	c.240G>T	c.(238-240)agG>agT	p.R80S	IL12A_ENST00000480787.1_Missense_Mutation_p.R80S|IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Missense_Mutation_p.R80S	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	46					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ACCTGCTGAGGGCCGTCAGCA	0.602																																					p.R80S		.											.	IL12A	90	0			c.G240T						.						108.0	97.0	101.0					3																	159708075		2203	4300	6503	SO:0001583	missense	3592	exon2			GCTGAGGGCCGTC	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.240G>T	3.37:g.159708075G>T	ENSP00000303231:p.Arg80Ser	45.0	0.0		142.0	40.0	NM_000882	Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	37	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.578661	0.28180	.	.	ENSG00000168811	ENST00000305579;ENST00000480787;ENST00000466512	.	.	.	4.72	-3.89	0.04193	.	1.413900	0.03810	N	0.265822	T	0.30103	0.0754	L	0.43152	1.355	0.09310	N	1	B	0.30114	0.269	B	0.22601	0.04	T	0.11717	-1.0576	9	0.35671	T	0.21	0.0114	5.4577	0.16600	0.4687:0.2656:0.2657:0.0	.	80	O60595	.	S	80	.	ENSP00000303231:R80S	R	+	3	2	IL12A	161190769	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.410000	0.07151	-0.981000	0.03520	-0.291000	0.09656	AGG	.		0.602	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882	
ING2	3622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	184431731	184431731	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:184431731A>G	ENST00000302327.3	+	2	671	c.469A>G	c.(469-471)Acc>Gcc	p.T157A	ING2_ENST00000434682.2_Missense_Mutation_p.T117A	NM_001564.2	NP_001555.1	Q9H160	ING2_HUMAN	inhibitor of growth family, member 2	157					chromatin modification (GO:0016568)|male germ-line stem cell asymmetric division (GO:0048133)|male meiosis I (GO:0007141)|negative regulation of cell proliferation (GO:0008285)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cellular senescence (GO:2000772)|regulation of growth (GO:0040008)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|seminiferous tubule development (GO:0072520)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleus (GO:0005634)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.T157S(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	7		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|all_hematologic(60;0.0207)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CAGGCAGCGGACCAGTGAAAG	0.448																																					p.T157A		.											.	ING2	91	1	Substitution - Missense(1)	lung(1)	c.A469G						.						58.0	60.0	59.0					4																	184431731		2203	4300	6503	SO:0001583	missense	3622	exon2			CAGCGGACCAGTG	AB012853	CCDS3833.1	4q35.1	2013-01-28	2005-02-10	2005-02-11	ENSG00000168556	ENSG00000168556		"""Zinc fingers, PHD-type"""	6063	protein-coding gene	gene with protein product		604215	"""inhibitor of growth family, member 1-like"""	ING1L		10072587	Standard	XM_005262982		Approved	p33ING2	uc003ivs.1	Q9H160	OTTHUMG00000150502	ENST00000302327.3:c.469A>G	4.37:g.184431731A>G	ENSP00000307183:p.Thr157Ala	75.0	0.0		211.0	79.0	NM_001564	B6ZDS1|O95698	Missense_Mutation	SNP	ENST00000302327.3	37	CCDS3833.1	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559034	0.45590	.	.	ENSG00000168556	ENST00000302327;ENST00000412117;ENST00000434682	.	.	.	5.55	5.55	0.83447	.	0.224702	0.43919	D	0.000506	T	0.48537	0.1505	L	0.43923	1.385	0.36952	D	0.892894	B;B	0.29037	0.231;0.231	B;B	0.29785	0.107;0.107	T	0.50268	-0.8848	9	0.08179	T	0.78	-24.9453	15.8583	0.79000	1.0:0.0:0.0:0.0	.	117;157	B6ZDS1;Q9H160	.;ING2_HUMAN	A	157;117;117	.	ENSP00000307183:T157A	T	+	1	0	ING2	184668725	1.000000	0.71417	0.987000	0.45799	0.967000	0.64934	8.722000	0.91452	2.326000	0.78906	0.533000	0.62120	ACC	.		0.448	ING2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318652.1	NM_001564	
ITGA10	8515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145528004	145528004	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:145528004G>C	ENST00000369304.3	+	3	416	c.241G>C	c.(241-243)Gcc>Ccc	p.A81P	ITGA10_ENST00000538811.1_Intron|ITGA10_ENST00000539363.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	81					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGTAGGGGGGGCCCACAATGC	0.592																																					p.A81P		.											.	ITGA10	231	0			c.G241C						.						8.0	10.0	10.0					1																	145528004		2172	4279	6451	SO:0001583	missense	8515	exon3			GGGGGGGCCCACA	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.241G>C	1.37:g.145528004G>C	ENSP00000358310:p.Ala81Pro	50.0	0.0		253.0	146.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256782	0.22965	.	.	ENSG00000143127	ENST00000369304;ENST00000543043	T	0.71934	-0.61	5.61	-6.68	0.01778	.	1.143750	0.06345	N	0.708697	T	0.23649	0.0572	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.31943	-0.9925	10	0.52906	T	0.07	.	7.6532	0.28360	0.0:0.1924:0.4447:0.363	.	47;81;81	F5H3T9;O75578;O75578-2	.;ITA10_HUMAN;.	P	81;47	ENSP00000358310:A81P	ENSP00000358310:A81P	A	+	1	0	ITGA10	144239361	0.000000	0.05858	0.000000	0.03702	0.707000	0.40811	-0.339000	0.07832	-1.187000	0.02709	-0.344000	0.07964	GCC	.		0.592	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
ITPRIP	85450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106075119	106075119	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr10:106075119G>A	ENST00000337478.1	-	2	862	c.691C>T	c.(691-693)Cgc>Tgc	p.R231C	RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000358187.2_Missense_Mutation_p.R231C|ITPRIP_ENST00000278071.2_Missense_Mutation_p.R231C	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	231						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						GGCACTGAGCGGCCGGAGCAC	0.657																																					p.R231C		.											.	ITPRIP	90	0			c.C691T						.						38.0	41.0	40.0					10																	106075119		2203	4300	6503	SO:0001583	missense	85450	exon2			CTGAGCGGCCGGA	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.691C>T	10.37:g.106075119G>A	ENSP00000337178:p.Arg231Cys	38.0	0.0		77.0	43.0	NM_001272013	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.811038	0.32053	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.24538	1.85;1.85;1.85	5.25	4.22	0.49857	.	0.878856	0.10244	N	0.698087	T	0.24470	0.0593	L	0.46157	1.445	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.05289	-1.0894	10	0.56958	D	0.05	-16.0835	9.5846	0.39508	0.0:0.1709:0.6579:0.1713	.	231	Q8IWB1	IPRI_HUMAN	C	231	ENSP00000337178:R231C;ENSP00000278071:R231C;ENSP00000350915:R231C	ENSP00000278071:R231C	R	-	1	0	ITPRIP	106065109	0.005000	0.15991	0.869000	0.34112	0.849000	0.48306	1.705000	0.37867	2.601000	0.87937	0.467000	0.42956	CGC	.		0.657	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
ITPRIP	85450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106075611	106075611	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr10:106075611C>G	ENST00000337478.1	-	2	370	c.199G>C	c.(199-201)Gag>Cag	p.E67Q	RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000358187.2_Missense_Mutation_p.E67Q|ITPRIP_ENST00000278071.2_Missense_Mutation_p.E67Q	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	67						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						TCCAGTGCCTCCTTTTCGGCC	0.642																																					p.E67Q		.											.	ITPRIP	90	0			c.G199C						.						69.0	67.0	68.0					10																	106075611		2203	4300	6503	SO:0001583	missense	85450	exon2			GTGCCTCCTTTTC	AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.199G>C	10.37:g.106075611C>G	ENSP00000337178:p.Glu67Gln	30.0	0.0		80.0	25.0	NM_001272013	D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	ENST00000337478.1	37	CCDS7557.1	.	.	.	.	.	.	.	.	.	.	C	7.020	0.558557	0.13436	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187;ENST00000458723	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.44	4.53	0.55603	.	0.556674	0.19045	N	0.124184	T	0.05181	0.0138	N	0.14661	0.345	0.24609	N	0.99373	P	0.50272	0.933	B	0.44108	0.441	T	0.25047	-1.0143	10	0.02654	T	1	-19.7616	5.153	0.15019	0.0:0.7158:0.0:0.2842	.	67	Q8IWB1	IPRI_HUMAN	Q	67	ENSP00000337178:E67Q;ENSP00000278071:E67Q;ENSP00000350915:E67Q;ENSP00000414141:E67Q	ENSP00000278071:E67Q	E	-	1	0	ITPRIP	106065601	1.000000	0.71417	1.000000	0.80357	0.293000	0.27360	2.633000	0.46519	2.560000	0.86352	0.563000	0.77884	GAG	.		0.642	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050204.1	NM_033397	
KAT5	10524	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65479799	65479799	+	Intron	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:65479799A>G	ENST00000377046.3	+	1	284				KAT5_ENST00000352980.4_Intron|KAT5_ENST00000534650.1_5'Flank|KAT5_ENST00000341318.4_Missense_Mutation_p.R21G|KAT5_ENST00000530446.1_Missense_Mutation_p.R21G	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5						androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						GGAGGTGGGTAGAGCCCGAGG	0.721																																					p.R21G		.											.	KAT5	90	0			c.A61G						.						12.0	15.0	14.0					11																	65479799		2184	4281	6465	SO:0001627	intron_variant	10524	exon1			GTGGGTAGAGCCC	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.12+49A>G	11.37:g.65479799A>G		56.0	0.0		104.0	37.0	NM_182710	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Missense_Mutation	SNP	ENST00000377046.3	37	CCDS31610.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.655700	0.47467	.	.	ENSG00000172977	ENST00000341318;ENST00000530446	T;T	0.43294	0.97;0.95	4.78	3.64	0.41730	.	0.295993	0.28499	N	0.015121	T	0.25827	0.0629	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.05716	-1.0868	9	0.22706	T	0.39	-2.548	7.1587	0.25652	0.8984:0.0:0.1016:0.0	.	21;21	B4E3C7;Q92993-3	.;.	G	21	ENSP00000340330:R21G;ENSP00000434765:R21G	ENSP00000340330:R21G	R	+	1	2	KAT5	65236375	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.646000	0.37249	0.961000	0.38030	0.459000	0.35465	AGA	.		0.721	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	44176879	44176879	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:44176879G>A	ENST00000360029.3	-	2	1633	c.1350C>T	c.(1348-1350)atC>atT	p.I450I		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	450					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CTGGAATGTGGATTTTTTTAA	0.378										HNSCC(17;0.042)																											p.I450I		.											.	KCTD8	92	0			c.C1350T						.						125.0	133.0	130.0					4																	44176879		2203	4300	6503	SO:0001819	synonymous_variant	386617	exon2			AATGTGGATTTTT	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1350C>T	4.37:g.44176879G>A		93.0	0.0		210.0	98.0	NM_198353	A2RU39	Silent	SNP	ENST00000360029.3	37	CCDS3467.1																																																																																			.		0.378	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
KDM2A	22992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66975117	66975117	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:66975117T>A	ENST00000529006.2	+	6	890	c.444T>A	c.(442-444)ttT>ttA	p.F148L	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Missense_Mutation_p.F148L	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	148	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GCCTCGAGTTTAGCCACACCA	0.478																																					p.F148L		.											.	KDM2A	661	0			c.T444A						.						63.0	66.0	65.0					11																	66975117		1978	4146	6124	SO:0001583	missense	22992	exon6			CGAGTTTAGCCAC	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.444T>A	11.37:g.66975117T>A	ENSP00000432786:p.Phe148Leu	42.0	0.0		125.0	50.0	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.742863	0.89573	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	T;T	0.69806	-0.43;-0.43	5.34	0.0679	0.14368	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	T	0.81564	0.4849	H	0.94582	3.555	0.80722	D	1	D	0.69078	0.997	P	0.61533	0.89	T	0.81391	-0.0954	10	0.59425	D	0.04	-9.7026	9.1103	0.36723	0.0:0.5684:0.0:0.4316	.	148	Q9Y2K7	KDM2A_HUMAN	L	148	ENSP00000381640:F148L;ENSP00000432786:F148L	ENSP00000381640:F148L	F	+	3	2	KDM2A	66731693	0.997000	0.39634	0.999000	0.59377	0.974000	0.67602	0.528000	0.23002	0.023000	0.15187	0.533000	0.62120	TTT	.		0.478	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
KDM2A	22992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66986855	66986855	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:66986855A>G	ENST00000529006.2	+	10	1384	c.938A>G	c.(937-939)aAc>aGc	p.N313S	snoU13_ENST00000459034.1_RNA|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Missense_Mutation_p.N313S	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	313	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						AAAATATACAACATTGAAGAT	0.383																																					p.N313S		.											.	KDM2A	661	0			c.A938G						.						64.0	63.0	63.0					11																	66986855		1860	4098	5958	SO:0001583	missense	22992	exon10			TATACAACATTGA	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.938A>G	11.37:g.66986855A>G	ENSP00000432786:p.Asn313Ser	58.0	0.0		153.0	65.0	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	37	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	A	8.080	0.772219	0.16051	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	T;T	0.71222	-0.55;-0.55	5.65	3.21	0.36854	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.175408	0.64402	N	0.000012	T	0.48095	0.1481	N	0.16368	0.405	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33420	-0.9869	10	0.30078	T	0.28	-11.8304	4.8899	0.13722	0.66:0.1616:0.1783:0.0	.	313	Q9Y2K7	KDM2A_HUMAN	S	313	ENSP00000381640:N313S;ENSP00000432786:N313S	ENSP00000381640:N313S	N	+	2	0	KDM2A	66743431	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.869000	0.27996	1.100000	0.41517	0.528000	0.53228	AAC	.		0.383	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
KDM4C	23081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	6981046	6981046	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:6981046C>T	ENST00000381309.3	+	9	1608	c.1043C>T	c.(1042-1044)cCt>cTt	p.P348L	KDM4C_ENST00000381306.3_Missense_Mutation_p.P348L|KDM4C_ENST00000543771.1_Missense_Mutation_p.P348L|KDM4C_ENST00000536108.1_Missense_Mutation_p.P167L|KDM4C_ENST00000428870.2_Missense_Mutation_p.P35L|KDM4C_ENST00000442236.2_Missense_Mutation_p.P167L|KDM4C_ENST00000535193.1_Missense_Mutation_p.P370L|RP11-403H13.1_ENST00000445708.1_RNA	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	348					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						CACACGAAGCCTACTCCAGCA	0.458																																					p.P370L		.											.	KDM4C	228	0			c.C1109T						.						118.0	108.0	111.0					9																	6981046		2203	4300	6503	SO:0001583	missense	23081	exon9			CGAAGCCTACTCC	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1043C>T	9.37:g.6981046C>T	ENSP00000370710:p.Pro348Leu	38.0	0.0		92.0	45.0	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696839	0.88830	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870	T;T;T;T;T;T;T	0.19938	2.28;2.28;2.46;2.37;2.63;2.11;3.35	5.54	5.54	0.83059	.	0.370310	0.27792	N	0.017829	T	0.47340	0.1440	M	0.63428	1.95	0.80722	D	1	D;D;P;P;D	0.89917	0.999;1.0;0.956;0.93;0.979	D;D;P;P;P	0.83275	0.927;0.996;0.822;0.647;0.887	T	0.42137	-0.9469	10	0.87932	D	0	-7.4993	19.4631	0.94927	0.0:1.0:0.0:0.0	.	167;348;370;348;348	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	L	370;348;348;348;167;167;35	ENSP00000442382:P370L;ENSP00000445427:P348L;ENSP00000370710:P348L;ENSP00000370707:P348L;ENSP00000409353:P167L;ENSP00000440656:P167L;ENSP00000405739:P35L	ENSP00000370707:P348L	P	+	2	0	KDM4C	6971046	0.998000	0.40836	0.994000	0.49952	0.984000	0.73092	6.010000	0.70753	2.594000	0.87642	0.585000	0.79938	CCT	.		0.458	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
KIAA0907	22889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155899509	155899509	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:155899509T>G	ENST00000368321.3	-	3	401	c.378A>C	c.(376-378)caA>caC	p.Q126H	KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368319.3_Missense_Mutation_p.Q126H|KIAA0907_ENST00000368320.3_Missense_Mutation_p.Q126H	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	126							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TCACCTCGTCTTGAGTCTGTC	0.453																																					p.Q126H		.											.	KIAA0907	90	0			c.A378C						.						144.0	127.0	133.0					1																	155899509		2203	4300	6503	SO:0001583	missense	22889	exon3			CTCGTCTTGAGTC	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.378A>C	1.37:g.155899509T>G	ENSP00000357304:p.Gln126His	59.0	0.0		219.0	68.0	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	37	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	T	19.86	3.904848	0.72868	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.42513	0.97;0.97;0.97	5.02	-1.31	0.09230	.	0.000000	0.85682	D	0.000000	T	0.51635	0.1686	M	0.84219	2.685	0.53005	D	0.999965	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.997;0.997	D;D;D;D;D;D	0.91635	0.998;0.999;0.996;0.999;0.995;0.995	T	0.60821	-0.7187	10	0.62326	D	0.03	-9.3075	11.1425	0.48411	0.0:0.662:0.0:0.338	.	126;126;126;126;126;126	D3DVA4;Q7Z7F0-4;A8K1I7;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;.;.;K0907_HUMAN	H	126	ENSP00000357304:Q126H;ENSP00000357303:Q126H;ENSP00000357302:Q126H	ENSP00000357302:Q126H	Q	-	3	2	KIAA0907	154166133	0.994000	0.37717	0.997000	0.53966	0.846000	0.48090	0.343000	0.19944	-0.101000	0.12219	0.460000	0.39030	CAA	.		0.453	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
KIF27	55582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86457172	86457172	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:86457172C>T	ENST00000297814.2	-	17	3844	c.3701G>A	c.(3700-3702)cGg>cAg	p.R1234Q	KIF27_ENST00000334204.2_Missense_Mutation_p.R1137Q|KIF27_ENST00000413982.1_Missense_Mutation_p.R1168Q|RP11-575L7.4_ENST00000591217.1_RNA	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	1234					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TGCTAGTTGCCGCCGAATTGC	0.408																																					p.R1234Q		.											.	KIF27	523	0			c.G3701A						.						77.0	68.0	71.0					9																	86457172		2203	4300	6503	SO:0001583	missense	55582	exon17			AGTTGCCGCCGAA	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.3701G>A	9.37:g.86457172C>T	ENSP00000297814:p.Arg1234Gln	138.0	0.0		603.0	245.0	NM_017576	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	37	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.793026	0.31685	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.69040	-0.37;-0.33;-0.2	4.24	2.22	0.28083	.	1.256500	0.05800	N	0.611956	T	0.49236	0.1545	L	0.28274	0.84	0.09310	N	1	B;B;B	0.18166	0.017;0.026;0.026	B;B;B	0.06405	0.001;0.002;0.001	T	0.33292	-0.9874	10	0.26408	T	0.33	.	2.9014	0.05707	0.0:0.4491:0.2395:0.3114	.	1137;1168;1234	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	Q	1234;1168;1137	ENSP00000297814:R1234Q;ENSP00000401688:R1168Q;ENSP00000333928:R1137Q	ENSP00000297814:R1234Q	R	-	2	0	KIF27	85646992	0.150000	0.22732	0.055000	0.19348	0.831000	0.47069	0.349000	0.20055	1.011000	0.39340	-0.385000	0.06624	CGG	.		0.408	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
KRTAP10-6	386674	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	46011435	46011435	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr21:46011435C>A	ENST00000400368.1	-	1	951	c.931G>T	c.(931-933)Gtg>Ttg	p.V311L	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	311	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GACTTGCACACAGGGTGGCAG	0.672																																					p.V311L		.											.	KRTAP10-6	90	0			c.G931T						.						72.0	83.0	80.0					21																	46011435		2203	4299	6502	SO:0001583	missense	386674	exon1			TGCACACAGGGTG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.931G>T	21.37:g.46011435C>A	ENSP00000383219:p.Val311Leu	95.0	0.0		306.0	119.0	NM_198688		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	c	12.41	1.928713	0.34002	.	.	ENSG00000188155	ENST00000400368	T	0.01422	4.91	2.8	2.8	0.32819	.	.	.	.	.	T	0.06280	0.0162	M	0.72576	2.205	0.27005	N	0.964812	D	0.64830	0.994	D	0.71656	0.974	T	0.10989	-1.0606	9	0.52906	T	0.07	.	9.205	0.37285	0.0:1.0:0.0:0.0	.	311	P60371	KR106_HUMAN	L	311	ENSP00000383219:V311L	ENSP00000383219:V311L	V	-	1	0	KRTAP10-6	44835863	.	.	1.000000	0.80357	0.028000	0.11728	.	.	1.583000	0.49898	0.194000	0.17425	GTG	.		0.672	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
KRTAP5-8	57830	hgsc.bcm.edu;bcgsc.ca	37	11	71249121	71249121	+	Missense_Mutation	SNP	C	C	G	rs200585722		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:71249121C>G	ENST00000398534.3	+	1	51	c.20C>G	c.(19-21)tCt>tGt	p.S7C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	7						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						TGTGGCTGCTCTGGAGGCTGT	0.657																																					p.S7C		.											.	KRTAP5-8	44	0			c.C20G						.						47.0	66.0	60.0					11																	71249121		2189	4282	6471	SO:0001583	missense	57830	exon1			GCTGCTCTGGAGG	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.20C>G	11.37:g.71249121C>G	ENSP00000420723:p.Ser7Cys	72.0	0.0		325.0	17.0	NM_021046	Q6L8G7|Q6UTX6	Missense_Mutation	SNP	ENST00000398534.3	37	CCDS41683.1	.	.	.	.	.	.	.	.	.	.	c	3.358	-0.131059	0.06753	.	.	ENSG00000241233	ENST00000398534	T	0.01527	4.8	1.57	1.57	0.23409	.	.	.	.	.	T	0.03564	0.0102	M	0.74389	2.26	0.09310	N	1	P	0.39094	0.659	B	0.43225	0.412	T	0.34204	-0.9838	9	0.62326	D	0.03	.	3.9595	0.09404	0.0:0.775:0.0:0.225	.	7	O75690	KRA58_HUMAN	C	7	ENSP00000420723:S7C	ENSP00000420723:S7C	S	+	2	0	KRTAP5-8	70926769	0.030000	0.19436	0.804000	0.32291	0.223000	0.24884	-0.589000	0.05767	1.182000	0.42928	0.514000	0.50259	TCT	.		0.657	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
LAMC1	3915	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183106886	183106886	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:183106886A>G	ENST00000258341.4	+	26	4654	c.4397A>G	c.(4396-4398)aAg>aGg	p.K1466R	RP11-181K3.4_ENST00000457852.3_RNA	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1466	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						AATATGTTGAAGCAACTGCAG	0.418																																					p.K1466R		.											.	LAMC1	252	0			c.A4397G						.						81.0	77.0	78.0					1																	183106886		2203	4300	6503	SO:0001583	missense	3915	exon26			TGTTGAAGCAACT	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.4397A>G	1.37:g.183106886A>G	ENSP00000258341:p.Lys1466Arg	129.0	1.0		524.0	149.0	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	37	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	A	10.25	1.299659	0.23650	.	.	ENSG00000135862	ENST00000258341	T	0.77229	-1.08	5.64	0.636	0.17729	.	0.262407	0.44285	N	0.000473	T	0.51907	0.1702	N	0.08118	0	0.27351	N	0.95624	B	0.02656	0.0	B	0.01281	0.0	T	0.34179	-0.9839	10	0.13853	T	0.58	.	8.7338	0.34516	0.662:0.0:0.338:0.0	.	1466	P11047	LAMC1_HUMAN	R	1466	ENSP00000258341:K1466R	ENSP00000258341:K1466R	K	+	2	0	LAMC1	181373509	0.999000	0.42202	0.859000	0.33776	0.937000	0.57800	2.354000	0.44098	-0.126000	0.11682	0.533000	0.62120	AAG	.		0.418	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
NPIPB5	100132247	broad.mit.edu;bcgsc.ca	37	16	22545897	22545897	+	Missense_Mutation	SNP	G	G	T	rs143579045		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:22545897G>T	ENST00000517539.1	+	8	1668	c.1593G>T	c.(1591-1593)aaG>aaT	p.K531N	NPIPB5_ENST00000424340.1_Missense_Mutation_p.K531N|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	531	Pro-rich.					integral component of membrane (GO:0016021)											ATAATATCAAGACACCTGCCG	0.597																																					p.K531N		.											.	.	.	0			c.G1593T						.						11.0	7.0	8.0					16																	22545897		686	1576	2262	SO:0001583	missense	0	exon7			TATCAAGACACCT		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1593G>T	16.37:g.22545897G>T	ENSP00000430633:p.Lys531Asn	26.0	0.0		55.0	8.0	NM_001135865	B4DK13	Missense_Mutation	SNP	ENST00000517539.1	37	CCDS45443.1	.	.	.	.	.	.	.	.	.	.	.	0.526	-0.859889	0.02610	.	.	ENSG00000243716	ENST00000415833;ENST00000424340;ENST00000342168;ENST00000503072;ENST00000517539;ENST00000528249	T;T;T;T	0.20069	2.18;2.1;2.1;2.18	.	.	.	.	.	.	.	.	T	0.17195	0.0413	L	0.50333	1.59	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.25082	-1.0142	6	0.42905	T	0.14	.	.	.	.	.	531;531	F5GWX0;A8MRT5	.;K220L_HUMAN	N	531;531;531;409;531;531	ENSP00000445388:K531N;ENSP00000440703:K531N;ENSP00000430633:K531N;ENSP00000431553:K531N	ENSP00000441680:K531N	K	+	3	2	RP11-368J21.2	22453398	.	.	.	.	.	.	.	.	.	.	.	.	AAG	.		0.597	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374343.2	NM_001135865	
TIMP2	7077	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76886840	76886840	+	Intron	SNP	G	G	A	rs571031295		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:76886840G>A	ENST00000262768.7	-	2	429				DDC8_ENST00000322630.2_Silent_p.D582D|TIMP2_ENST00000536189.2_Intron	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			TGTGCCGGTCGTCGTCGGCGA	0.582													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17339	0.0		0.0	False		,,,				2504	0.0				p.D582D		.											.	.	.	0			c.C1746T						.																																			SO:0001627	intron_variant	0	exon3			CCGGTCGTCGTCG		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-16839C>T	17.37:g.76886840G>A		120.0	0.0		599.0	126.0	NM_001243540	Q16121|Q93006|Q9UDF7	Silent	SNP	ENST00000262768.7	37	CCDS11758.1																																																																																			.		0.582	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
LPIN2	9663	ucsc.edu;bcgsc.ca	37	18	2923820	2923820	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr18:2923820T>C	ENST00000261596.4	-	16	2365	c.2127A>G	c.(2125-2127)aaA>aaG	p.K709K	RP11-737O24.5_ENST00000608032.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	709	C-LIP.				cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GGGTCCAGTCTTTGCCCAGCT	0.483																																					p.K709K		.											.	LPIN2	227	0			c.A2127G						.						161.0	145.0	150.0					18																	2923820		2203	4300	6503	SO:0001819	synonymous_variant	9663	exon16			CCAGTCTTTGCCC	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.2127A>G	18.37:g.2923820T>C		28.0	0.0		45.0	4.0	NM_014646	A7MD25|D3DUH3	Silent	SNP	ENST00000261596.4	37	CCDS11829.1																																																																																			.		0.483	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
LRCH3	84859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	197592314	197592314	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:197592314T>C	ENST00000425562.2	+	16	1737	c.1737T>C	c.(1735-1737)gcT>gcC	p.A579A	LRCH3_ENST00000536618.1_Silent_p.A174A|LRCH3_ENST00000334859.4_Silent_p.A579A|LRCH3_ENST00000441090.2_Silent_p.A425A|LRCH3_ENST00000414675.2_Silent_p.A527A|LRCH3_ENST00000438796.2_Silent_p.A579A			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	579						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		GACCTAATGCTCTATTAAGTT	0.264																																					p.A579A		.											.	LRCH3	91	0			c.T1737C						.						39.0	38.0	39.0					3																	197592314		2203	4300	6503	SO:0001819	synonymous_variant	84859	exon16			TAATGCTCTATTA	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1737T>C	3.37:g.197592314T>C		107.0	0.0		253.0	93.0	NM_032773	B4E0T7|Q96FP9|Q9NT52	Silent	SNP	ENST00000425562.2	37																																																																																				.		0.264	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773	
MAEL	84944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	166974345	166974345	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:166974345G>A	ENST00000367872.4	+	7	925	c.681G>A	c.(679-681)ttG>ttA	p.L227L	RNA5SP65_ENST00000363166.1_RNA|MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Silent_p.L196L	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	227					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						ACTGGTGTTTGAAGCATATGG	0.358																																					p.L227L		.											.	MAEL	91	0			c.G681A						.						66.0	67.0	67.0					1																	166974345		2203	4300	6503	SO:0001819	synonymous_variant	84944	exon7			GTGTTTGAAGCAT	AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.681G>A	1.37:g.166974345G>A		113.0	0.0		398.0	104.0	NM_032858	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Silent	SNP	ENST00000367872.4	37	CCDS1257.1																																																																																			.		0.358	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083239.1	NM_032858	
MAGEL2	54551	broad.mit.edu;mdanderson.org	37	15	23889987	23889987	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:23889987C>A	ENST00000532292.1	-	1	1188	c.1094G>T	c.(1093-1095)aGt>aTt	p.S365I		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	248	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTCCCAGGCACTCAGGGCCCA	0.667																																					p.S968I		.											.	.	.	0			c.G2903T						.						19.0	20.0	20.0					15																	23889987		1847	4102	5949	SO:0001583	missense	54551	exon1			CAGGCACTCAGGG	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1094G>T	15.37:g.23889987C>A	ENSP00000433433:p.Ser365Ile	10.0	0.0		17.0	6.0	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	37		.	.	.	.	.	.	.	.	.	.	C	10.41	1.342947	0.24339	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.1	1.18	0.20946	.	.	.	.	.	T	0.38026	0.1025	L	0.50333	1.59	0.19945	N	0.999944	.	.	.	.	.	.	T	0.28713	-1.0035	5	.	.	.	.	5.4088	0.16336	0.0:0.7329:0.0:0.2671	.	.	.	.	L	397	.	.	V	-	1	0	MAGEL2	21441080	0.284000	0.24287	0.921000	0.36526	0.678000	0.39670	-0.029000	0.12329	0.342000	0.23796	0.655000	0.94253	GTG	.		0.667	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
MAOB	4129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	43652777	43652777	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:43652777G>T	ENST00000378069.4	-	8	964	c.817C>A	c.(817-819)Cac>Aac	p.H273N	MAOB_ENST00000536181.1_Missense_Mutation_p.H257N|MAOB_ENST00000538942.1_Missense_Mutation_p.H257N	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	273					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	GGATTGAAGTGAATCTTCATG	0.398																																					p.H273N		.											.	MAOB	555	0			c.C817A						.						135.0	112.0	120.0					X																	43652777		2203	4300	6503	SO:0001583	missense	4129	exon8			TGAAGTGAATCTT		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.817C>A	X.37:g.43652777G>T	ENSP00000367309:p.His273Asn	142.0	0.0		461.0	152.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	37	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.599667	0.87055	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	D;D;D	0.92149	-2.98;-2.98;-2.98	5.97	5.97	0.96955	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.94918	0.8357	M	0.69358	2.11	0.80722	D	1	D;D	0.63880	0.993;0.986	D;D	0.63703	0.917;0.913	D	0.92601	0.6091	10	0.18276	T	0.48	-20.7527	19.371	0.94484	0.0:0.0:1.0:0.0	.	257;273	B7Z5H3;P27338	.;AOFB_HUMAN	N	273;257;257	ENSP00000367309:H273N;ENSP00000441613:H257N;ENSP00000442240:H257N	ENSP00000367309:H273N	H	-	1	0	MAOB	43537721	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.265000	0.95647	2.527000	0.85204	0.600000	0.82982	CAC	.		0.398	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
MCCC1	56922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	182756877	182756877	+	Silent	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:182756877G>C	ENST00000265594.4	-	12	1460	c.1314C>G	c.(1312-1314)gtC>gtG	p.V438V	MCCC1_ENST00000489909.1_5'Flank|MCCC1_ENST00000539926.1_Silent_p.V303V|MCCC1_ENST00000492597.1_Silent_p.V329V	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	438	Biotin carboxylation.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CTGCCCACACGACCAGCTTCG	0.483																																					p.V438V		.											.	MCCC1	92	0			c.C1314G						.						130.0	110.0	117.0					3																	182756877		2203	4300	6503	SO:0001819	synonymous_variant	56922	exon12			CCACACGACCAGC	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1314C>G	3.37:g.182756877G>C		70.0	0.0		194.0	89.0	NM_020166	Q59ES4|Q9H959|Q9NS97	Silent	SNP	ENST00000265594.4	37	CCDS3241.1																																																																																			.		0.483	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
MEF2C	4208	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	88025144	88025144	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:88025144G>T	ENST00000437473.2	-	9	1272	c.855C>A	c.(853-855)tcC>tcA	p.S285S	MEF2C_ENST00000508569.1_Silent_p.S277S|MEF2C_ENST00000510942.1_Silent_p.S277S|MEF2C_ENST00000504921.2_Silent_p.S285S|MEF2C_ENST00000340208.5_Silent_p.S295S|MEF2C_ENST00000424173.2_Silent_p.S275S|MEF2C_ENST00000514028.1_Silent_p.S285S|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000514015.1_Silent_p.S285S|MEF2C_ENST00000539796.1_Silent_p.S229S|MEF2C_ENST00000506554.1_Silent_p.S285S	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	285					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		GAGCCGACTGGGAGTTATTTA	0.343										HNSCC(66;0.2)																											p.S295S		.											.	MEF2C	704	0			c.C885A						.						58.0	63.0	61.0					5																	88025144		1810	4074	5884	SO:0001819	synonymous_variant	4208	exon10			CGACTGGGAGTTA	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.855C>A	5.37:g.88025144G>T		54.0	0.0		119.0	43.0	NM_001193347	C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	ENST00000437473.2	37	CCDS47245.1																																																																																			.		0.343	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
MEIS2	4212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	37329148	37329148	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:37329148T>A	ENST00000561208.1	-	8	1185	c.767A>T	c.(766-768)gAc>gTc	p.D256V	MEIS2_ENST00000444725.1_Missense_Mutation_p.D256V|MEIS2_ENST00000557796.2_Missense_Mutation_p.D243V|MEIS2_ENST00000340545.5_Missense_Mutation_p.D243V|MEIS2_ENST00000338564.5_Missense_Mutation_p.D256V|MEIS2_ENST00000382766.2_Missense_Mutation_p.D256V|MEIS2_ENST00000219869.9_Missense_Mutation_p.D110V|MEIS2_ENST00000397624.3_Missense_Mutation_p.D168V|MEIS2_ENST00000397620.2_Missense_Mutation_p.D168V|MEIS2_ENST00000559085.1_Missense_Mutation_p.D243V|MEIS2_ENST00000424352.2_Missense_Mutation_p.D256V|MEIS2_ENST00000559561.1_Missense_Mutation_p.D256V			O14770	MEIS2_HUMAN	Meis homeobox 2	256	Asp/Glu-rich (acidic).				eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		TACACTGTTGTCTAAACCATC	0.413																																					p.D256V		.											.	MEIS2	92	0			c.A767T						.						142.0	126.0	131.0					15																	37329148		2201	4297	6498	SO:0001583	missense	4212	exon8			CTGTTGTCTAAAC	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.767A>T	15.37:g.37329148T>A	ENSP00000453793:p.Asp256Val	83.0	0.0		236.0	114.0	NM_170676	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	ENST00000561208.1	37	CCDS10044.1	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843516	0.51057	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624;ENST00000397620;ENST00000219869	T;D;D;D;D;D;D;D	0.89617	1.83;-2.28;-2.28;-2.19;-2.25;-2.25;-2.25;-2.54	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.93828	0.8026	M	0.75264	2.295	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.997;1.0;0.998;0.999;0.994;0.996;0.999;0.991	P;D;D;D;P;D;D;D	0.87578	0.898;0.991;0.969;0.991;0.869;0.944;0.998;0.944	D	0.93904	0.7191	10	0.49607	T	0.09	-11.808	15.2495	0.73532	0.0:0.0:0.0:1.0	.	243;256;256;256;256;110;168;243	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP81;B3KPQ6;B3KP98	.;.;MEIS2_HUMAN;.;.;.;.;.	V	256;256;256;256;256;243;243;168;110	ENSP00000326296:D256V;ENSP00000341400:D256V;ENSP00000372216:D256V;ENSP00000404185:D256V;ENSP00000391887:D256V;ENSP00000339549:D243V;ENSP00000380745:D168V;ENSP00000219869:D110V	ENSP00000219869:D110V	D	-	2	0	MEIS2	35116440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.068000	0.61886	0.528000	0.53228	GAC	.		0.413	MEIS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252003.2	NM_170677	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42059127	42059127	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:42059127G>A	ENST00000570161.1	+	23	8847	c.8847G>A	c.(8845-8847)aaG>aaA	p.K2949K	MGA_ENST00000389936.4_Silent_p.K2910K|MGA_ENST00000219905.7_Silent_p.K2949K|MGA_ENST00000545763.1_Silent_p.K2740K|MGA_ENST00000566586.1_Silent_p.K2740K			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATGGAGGGAAGAATACTTCTG	0.483																																					p.K2949K		.											.	MGA	522	0			c.G8847A						.						54.0	55.0	55.0					15																	42059127		1924	4116	6040	SO:0001819	synonymous_variant	23269	exon24			AGGGAAGAATACT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8847G>A	15.37:g.42059127G>A		49.0	0.0		80.0	26.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	37	CCDS55959.1																																																																																			.		0.483	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MGAT4C	25834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	86374008	86374008	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:86374008C>A	ENST00000604798.1	-	8	1700	c.496G>T	c.(496-498)Gca>Tca	p.A166S	MGAT4C_ENST00000549405.2_Missense_Mutation_p.A166S|MGAT4C_ENST00000332156.1_Missense_Mutation_p.A166S|MGAT4C_ENST00000552808.2_Missense_Mutation_p.A166S|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000393205.2_Missense_Mutation_p.A195S|MGAT4C_ENST00000548651.1_Missense_Mutation_p.A166S			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	166					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AATCTTCCTGCAATAATATGG	0.398																																					p.A166S		.											.	MGAT4C	93	0			c.G496T						.						99.0	97.0	98.0					12																	86374008		2203	4300	6503	SO:0001583	missense	25834	exon7			TTCCTGCAATAAT		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.496G>T	12.37:g.86374008C>A	ENSP00000474896:p.Ala166Ser	44.0	0.0		109.0	48.0	NM_013244	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	ENST00000604798.1	37	CCDS9030.1	.	.	.	.	.	.	.	.	.	.	C	13.85	2.360069	0.41801	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225	T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18	5.58	5.58	0.84498	.	0.061260	0.64402	D	0.000005	T	0.34861	0.0912	N	0.19112	0.55	0.54753	D	0.999982	D;D	0.58970	0.984;0.984	P;P	0.54140	0.743;0.676	T	0.03957	-1.0989	10	0.02654	T	1	-21.5613	19.5899	0.95506	0.0:1.0:0.0:0.0	.	195;166	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	S	166;195;166;166;166;166;166	ENSP00000331664:A166S;ENSP00000376900:A195S;ENSP00000449022:A166S;ENSP00000446647:A166S;ENSP00000447253:A166S;ENSP00000449172:A166S	ENSP00000331664:A166S	A	-	1	0	MGAT4C	84898139	1.000000	0.71417	0.996000	0.52242	0.025000	0.11179	4.772000	0.62324	2.612000	0.88384	0.655000	0.94253	GCA	.		0.398	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244	
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18273818	18273818	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr22:18273818C>T	ENST00000441493.2	-	31	6122	c.5770G>A	c.(5770-5772)Gaa>Aaa	p.E1924K	XXbac-B461K10.4_ENST00000476405.1_RNA|MICAL3_ENST00000580469.1_5'UTR	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1924					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TGCCGGTCTTCCAGCTCCAGC	0.652																																					p.E1924K		.											.	MICAL3	68	0			c.G5770A						.						35.0	42.0	39.0					22																	18273818		2109	4230	6339	SO:0001583	missense	57553	exon31			GGTCTTCCAGCTC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.5770G>A	22.37:g.18273818C>T	ENSP00000416015:p.Glu1924Lys	21.0	0.0		52.0	21.0	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	ENST00000441493.2	37	CCDS46659.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.40|18.40	3.616072|3.616072	0.66672|0.66672	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000441493|ENST00000252134	T|.	0.58060|.	0.36|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Domain of unknown function DUF3585 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.84674|.	0.5524|.	M|M	0.89414|0.89414	3.03|3.03	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.83275|.	0.996|.	D|.	0.87007|.	0.2120|.	10|.	0.87932|.	D|.	0|.	.|.	19.0447|19.0447	0.93015|0.93015	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1924|.	Q7RTP6|.	MICA3_HUMAN|.	K|X	1924|905	ENSP00000416015:E1924K|.	ENSP00000416015:E1924K|.	E|W	-|-	1|3	0|0	XXbac-B461K10.4|XXbac-B461K10.4	16653818|16653818	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.813000|7.813000	0.86123|0.86123	2.510000|2.510000	0.84645|0.84645	0.591000|0.591000	0.81541|0.81541	GAA|TGG	.		0.652	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MLF1	4291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	158322940	158322940	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:158322940G>C	ENST00000355893.5	+	7	894	c.756G>C	c.(754-756)ttG>ttC	p.L252F	MLF1_ENST00000478894.2_Missense_Mutation_p.L242F|MLF1_ENST00000392822.3_Missense_Mutation_p.L283F|MLF1_ENST00000359117.5_Missense_Mutation_p.L227F|MLF1_ENST00000469452.1_Missense_Mutation_p.L184F|MLF1_ENST00000484955.1_Missense_Mutation_p.L227F|MLF1_ENST00000482628.1_Missense_Mutation_p.L227F|MLF1_ENST00000497004.1_3'UTR|MLF1_ENST00000471745.1_Missense_Mutation_p.L242F	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	252					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)			large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			CAAATGTTTTGGGGGACAAAC	0.333			T	NPM1	AML																																p.L283F		.		Dom	yes		3	3q25.1	4291	myeloid leukemia factor 1		L	.	MLF1	658	0			c.G849C						.						69.0	73.0	72.0					3																	158322940		2203	4300	6503	SO:0001583	missense	4291	exon9			TGTTTTGGGGGAC	L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.756G>C	3.37:g.158322940G>C	ENSP00000348157:p.Leu252Phe	102.0	0.0		267.0	119.0	NM_001195432	E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Missense_Mutation	SNP	ENST00000355893.5	37	CCDS3182.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.560334	0.00910	.	.	ENSG00000178053	ENST00000491767;ENST00000355893;ENST00000484955;ENST00000359117;ENST00000471745;ENST00000469452;ENST00000482628;ENST00000478894;ENST00000392822	T;T;T;T;T;T;T;T;T	0.43688	1.0;1.02;1.02;1.02;1.01;1.02;1.02;1.01;0.94	5.47	3.1	0.35709	.	0.617004	0.15501	N	0.259020	T	0.14141	0.0342	N	0.01874	-0.695	0.21473	N	0.999671	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.30621	-0.9972	10	0.08179	T	0.78	-1.7527	6.4442	0.21867	0.0:0.0832:0.1659:0.7509	.	184;283;252	Q2TLE5;Q8N8F8;P58340	.;.;MLF1_HUMAN	F	178;252;227;227;242;184;227;242;283	ENSP00000420410:L178F;ENSP00000348157:L252F;ENSP00000417835:L227F;ENSP00000352025:L227F;ENSP00000420134:L242F;ENSP00000418595:L184F;ENSP00000417141:L227F;ENSP00000417777:L242F;ENSP00000376568:L283F	ENSP00000348157:L252F	L	+	3	2	MLF1	159805634	0.998000	0.40836	0.468000	0.27192	0.013000	0.08279	1.858000	0.39408	0.386000	0.24997	-0.485000	0.04761	TTG	.		0.333	MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443	
MMP16	4325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	89339405	89339405	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr8:89339405G>C	ENST00000286614.6	-	1	312	c.31C>G	c.(31-33)Cgg>Ggg	p.R11G	RP11-586K2.1_ENST00000523254.1_RNA|RP11-586K2.1_ENST00000521433.1_RNA|RP11-586K2.1_ENST00000520849.1_RNA|MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	11					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	AAATCCAACCGTCTTCCAGTG	0.488																																					p.R11G		.											.	MMP16	231	0			c.C31G						.						182.0	159.0	167.0					8																	89339405		2203	4300	6503	SO:0001583	missense	4325	exon1			CCAACCGTCTTCC	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.31C>G	8.37:g.89339405G>C	ENSP00000286614:p.Arg11Gly	65.0	0.0		113.0	32.0	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288698	0.40494	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.52983	2.34;0.64	5.44	3.6	0.41247	.	0.359425	0.26590	N	0.023524	T	0.27798	0.0684	N	0.08118	0	0.43729	D	0.996214	B;B	0.29253	0.239;0.001	B;B	0.32211	0.142;0.006	T	0.10428	-1.0630	10	0.66056	D	0.02	.	8.543	0.33404	0.0776:0.0:0.7657:0.1567	.	11;11	P51512-2;P51512	.;MMP16_HUMAN	G	11;28	ENSP00000286614:R11G;ENSP00000429147:R28G	ENSP00000286614:R11G	R	-	1	2	MMP16	89408521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.630000	0.54273	0.613000	0.30089	0.563000	0.77884	CGG	.		0.488	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
MPEG1	219972	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	58979138	58979139	+	Frame_Shift_Ins	INS	-	-	G	rs528545112		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:58979138_58979139insG	ENST00000361050.3	-	1	1285_1286	c.1200_1201insC	c.(1198-1203)ttggagfs	p.E401fs	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	401						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				TTCTTCTGCTCCAACTTTTGGC	0.54																																					p.E401fs		.											.	MPEG1	70	0			c.1201_1202insC						.																																			SO:0001589	frameshift_variant	219972	exon1			TCTGCTCCAACTT	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1200_1201insC	11.37:g.58979138_58979139insG	ENSP00000354335:p.Glu401fs	55.0	0.0		127.0	36.0	NM_001039396	Q2M1T6|Q8TEF8	Frame_Shift_Ins	INS	ENST00000361050.3	37	CCDS41650.1																																																																																			.		0.540	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
MTBP	27085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	121530146	121530146	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr8:121530146A>G	ENST00000305949.1	+	19	2347	c.2302A>G	c.(2302-2304)Aat>Gat	p.N768D		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	768	Interaction with MDM2. {ECO:0000250}.				cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TGGTAATAGTAATCACTATCA	0.393																																					p.N768D		.											.	MTBP	228	0			c.A2302G						.						99.0	79.0	86.0					8																	121530146		2203	4299	6502	SO:0001583	missense	27085	exon19			AATAGTAATCACT		CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.2302A>G	8.37:g.121530146A>G	ENSP00000303398:p.Asn768Asp	34.0	0.0		108.0	46.0	NM_022045	B4DUR5|Q9HA89	Missense_Mutation	SNP	ENST00000305949.1	37	CCDS6333.1	.	.	.	.	.	.	.	.	.	.	a	10.38	1.334468	0.24253	.	.	ENSG00000172167	ENST00000305949	.	.	.	5.32	-5.81	0.02340	.	1.054780	0.07326	N	0.878357	T	0.28001	0.0690	L	0.44542	1.39	0.09310	N	1	B	0.29037	0.231	B	0.26969	0.075	T	0.25433	-1.0132	9	0.19590	T	0.45	-1.2426	8.2711	0.31844	0.2955:0.4052:0.2992:0.0	.	768	Q96DY7	MTBP_HUMAN	D	768	.	ENSP00000303398:N768D	N	+	1	0	MTBP	121599327	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.143000	0.10296	-0.820000	0.04318	-1.479000	0.00991	AAT	.		0.393	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381530.1	NM_022045	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	3240505	3240505	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:3240505T>A	ENST00000217939.6	-	5	3375	c.3221A>T	c.(3220-3222)gAg>gTg	p.E1074V		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1074						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGGGTCTCCCTCTAGCATATT	0.453																																					p.E1074V		.											.	MXRA5	136	0			c.A3221T						.						138.0	114.0	122.0					X																	3240505		2203	4300	6503	SO:0001583	missense	25878	exon5			TCTCCCTCTAGCA	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3221A>T	X.37:g.3240505T>A	ENSP00000217939:p.Glu1074Val	132.0	0.0		520.0	190.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	t	7.332	0.619181	0.14129	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.66638	-0.22	3.14	-3.12	0.05282	.	0.652332	0.12390	U	0.473099	T	0.44705	0.1306	N	0.24115	0.695	0.09310	N	1	D	0.54964	0.969	B	0.41135	0.348	T	0.44003	-0.9356	10	0.45353	T	0.12	.	5.8116	0.18469	0.0:0.2541:0.1321:0.6138	.	1074	Q9NR99	MXRA5_HUMAN	V	1074	ENSP00000217939:E1074V	ENSP00000217939:E1074V	E	-	2	0	MXRA5	3250505	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.071000	0.11505	-1.909000	0.01085	-3.202000	0.00054	GAG	.		0.453	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	23897841	23897841	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:23897841G>A	ENST00000355349.3	-	15	1608	c.1446C>T	c.(1444-1446)aaC>aaT	p.N482N		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	482	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GCAGCTTCTCGTTGGTGAAGT	0.537																																					p.N482N		.											.	MYH7	94	0			c.C1446T						.						129.0	102.0	111.0					14																	23897841		2203	4300	6503	SO:0001819	synonymous_variant	4625	exon15			CTTCTCGTTGGTG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1446C>T	14.37:g.23897841G>A		96.0	0.0		381.0	19.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																			.		0.537	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYO16	23026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	109540788	109540788	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr13:109540788G>T	ENST00000357550.2	+	13	1597	c.1556G>T	c.(1555-1557)gGc>gTc	p.G519V	MYO16_ENST00000457511.2_Missense_Mutation_p.G31V|MYO16_ENST00000251041.5_Missense_Mutation_p.G519V|MYO16_ENST00000356711.2_Missense_Mutation_p.G519V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGCAGGGCTGGCGCCAGCAGG	0.433																																					p.G541V		.											.	MYO16	142	0			c.G1622T						.						72.0	79.0	77.0					13																	109540788		2203	4300	6503	SO:0001583	missense	23026	exon14			GGGCTGGCGCCAG		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1556G>T	13.37:g.109540788G>T	ENSP00000350160:p.Gly519Val	69.0	0.0		202.0	81.0	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	9.038	0.989015	0.18966	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857;ENST00000457511	D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3	5.18	1.2	0.21068	Myosin head, motor domain (2);	0.977084	0.08301	U	0.966834	D	0.88232	0.6381	M	0.79805	2.47	0.09310	N	1	P;B;P	0.40360	0.666;0.061;0.714	B;B;B	0.40982	0.311;0.1;0.345	T	0.76206	-0.3044	9	.	.	.	.	12.0628	0.53572	0.0711:0.3319:0.5969:0.0	.	31;519;519	F8W883;Q9Y6X6-2;Q9Y6X6	.;.;MYO16_HUMAN	V	519;519;519;519;307;31	ENSP00000349145:G519V;ENSP00000350160:G519V;ENSP00000251041:G519V;ENSP00000401633:G31V	.	G	+	2	0	MYO16	108338789	0.024000	0.19004	0.000000	0.03702	0.002000	0.02628	0.810000	0.27183	0.027000	0.15297	-0.795000	0.03280	GGC	.		0.433	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27493801	27493801	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:27493801T>C	ENST00000527372.1	-	2	338	c.158A>G	c.(157-159)aAg>aGg	p.K53R	MYO18A_ENST00000533112.1_Missense_Mutation_p.K53R|MYO18A_ENST00000354329.4_Missense_Mutation_p.K53R|MYO18A_ENST00000531253.1_Missense_Mutation_p.K53R	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	53	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GGATTCACGCTTGGAGGAGCG	0.567																																					p.K53R	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A	22	0			c.A158G						.						46.0	54.0	51.0					17																	27493801		2164	4271	6435	SO:0001583	missense	399687	exon2			TCACGCTTGGAGG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.158A>G	17.37:g.27493801T>C	ENSP00000437073:p.Lys53Arg	79.0	0.0		225.0	81.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433922	0.83776	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372	D;D;D;D	0.90261	-2.52;-2.64;-2.52;-2.52	4.94	4.94	0.65067	.	0.056975	0.64402	N	0.000003	D	0.92231	0.7536	L	0.32530	0.975	0.46609	D	0.999121	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.80764	0.994;0.994;0.985	D	0.93333	0.6703	10	0.87932	D	0	.	14.7704	0.69671	0.0:0.0:0.0:1.0	.	53;53;53	Q92614-3;Q92614-4;Q92614	.;.;MY18A_HUMAN	R	53	ENSP00000346291:K53R;ENSP00000435932:K53R;ENSP00000434228:K53R;ENSP00000437073:K53R	ENSP00000346291:K53R	K	-	2	0	MYO18A	24517927	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.630000	0.67805	2.084000	0.62774	0.383000	0.25322	AAG	.		0.567	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26423608	26423608	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr22:26423608T>C	ENST00000407587.2	+	43	7840	c.7671T>C	c.(7669-7671)gaT>gaC	p.D2557D	MYO18B_ENST00000335473.7_Silent_p.D2556D|MYO18B_ENST00000536101.1_Silent_p.D2556D			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2556						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AAGACGACGATGTTGCGAGCA	0.552																																					p.D2556D		.											.	MYO18B	142	0			c.T7668C						.						54.0	53.0	53.0					22																	26423608		1959	4139	6098	SO:0001819	synonymous_variant	84700	exon43			CGACGATGTTGCG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7671T>C	22.37:g.26423608T>C		39.0	0.0		93.0	35.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	T	0.490	-0.875937	0.02550	.	.	ENSG00000133454	ENST00000543971	.	.	.	4.44	-7.16	0.01516	.	.	.	.	.	T	0.58906	0.2155	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62798	-0.6778	4	.	.	.	.	12.7127	0.57098	0.0:0.3476:0.0:0.6524	.	.	.	.	T	506	.	.	M	+	2	0	MYO18B	24753608	0.000000	0.05858	0.015000	0.15790	0.005000	0.04900	-4.219000	0.00272	-1.303000	0.02332	-0.366000	0.07423	ATG	.		0.552	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MYO1C	4641	ucsc.edu;bcgsc.ca	37	17	1381481	1381481	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:1381481T>C	ENST00000575158.1	-	12	1372	c.1196A>G	c.(1195-1197)gAg>gGg	p.E399G	MYO1C_ENST00000361007.2_Missense_Mutation_p.E399G|MYO1C_ENST00000573198.1_5'Flank|MYO1C_ENST00000545534.2_Missense_Mutation_p.E410G|MYO1C_ENST00000438665.2_Missense_Mutation_p.E415G|MYO1C_ENST00000359786.5_Missense_Mutation_p.E434G			Q12965	MYO1E_HUMAN	myosin IC	401	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCAGAACTGCTCAAAGCTGTA	0.582																																					p.E434G		.											.	MYO1C	90	0			c.A1301G						.						64.0	59.0	60.0					17																	1381481		2203	4300	6503	SO:0001583	missense	4641	exon12			AACTGCTCAAAGC	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.1196A>G	17.37:g.1381481T>C	ENSP00000459174:p.Glu399Gly	35.0	0.0		32.0	4.0	NM_001080779	Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.275587	0.59649	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.37	5.37	0.77165	Myosin head, motor domain (3);	0.147083	0.64402	D	0.000011	D	0.97164	0.9073	H	0.99859	4.855	0.80722	D	1	B;B;B	0.33120	0.118;0.398;0.096	B;B;B	0.43867	0.211;0.434;0.134	D	0.97507	1.0064	10	0.87932	D	0	.	14.5251	0.67881	0.0:0.0:0.0:1.0	.	410;434;415	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	G	434;415;415;399;410;399	ENSP00000352834:E434G;ENSP00000412197:E415G;ENSP00000354283:E399G;ENSP00000437685:E410G	ENSP00000352834:E434G	E	-	2	0	MYO1C	1328231	1.000000	0.71417	0.998000	0.56505	0.415000	0.31203	7.970000	0.88000	2.026000	0.59711	0.460000	0.39030	GAG	.		0.582	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
NAA15	80155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	140272693	140272693	+	Silent	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:140272693A>G	ENST00000296543.5	+	9	1265	c.942A>G	c.(940-942)ctA>ctG	p.L314L	NAA15_ENST00000398947.1_Silent_p.L314L|NAA15_ENST00000480277.2_3'UTR	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	314					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						ATAAGTTCCTAAGGATGAATT	0.303																																					p.L314L		.											.	NAA15	92	0			c.A942G						.						106.0	104.0	105.0					4																	140272693		1803	4074	5877	SO:0001819	synonymous_variant	80155	exon9			GTTCCTAAGGATG	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.942A>G	4.37:g.140272693A>G		86.0	0.0		216.0	96.0	NM_057175	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Silent	SNP	ENST00000296543.5	37	CCDS43270.1																																																																																			.		0.303	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	
NAALADL2	254827	broad.mit.edu;bcgsc.ca	37	3	175293976	175293976	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:175293976G>T	ENST00000454872.1	+	10	1928		c.e10+1		NAALADL2_ENST00000473253.1_Splice_Site	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2							integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AACATTAGAGGTGATTGTTCC	0.358																																					.		.											.	NAALADL2	47	0			c.1800+1G>T						.						148.0	143.0	145.0					3																	175293976		1868	4108	5976	SO:0001630	splice_region_variant	254827	exon10			TTAGAGGTGATTG		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1800+1G>T	3.37:g.175293976G>T		57.0	0.0		169.0	7.0	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Splice_Site	SNP	ENST00000454872.1	37	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744837	0.49151	.	.	ENSG00000177694	ENST00000454872	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1772	0.98182	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAALADL2	176776670	1.000000	0.71417	0.996000	0.52242	0.349000	0.29174	7.040000	0.76551	2.778000	0.95560	0.655000	0.94253	.	.		0.358	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	Intron
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	35672500	35672500	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr13:35672500G>T	ENST00000400445.3	+	11	2172	c.1638G>T	c.(1636-1638)ctG>ctT	p.L546L	NBEA_ENST00000310336.4_Silent_p.L546L|NBEA_ENST00000379939.2_Silent_p.L546L|NBEA_ENST00000540320.1_Silent_p.L546L	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	546					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AACAGATGCTGGGTGGAAAAG	0.383																																					p.L546L		.											.	NBEA	144	0			c.G1638T						.						94.0	85.0	87.0					13																	35672500		1877	4124	6001	SO:0001819	synonymous_variant	26960	exon11			GATGCTGGGTGGA	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1638G>T	13.37:g.35672500G>T		70.0	0.0		178.0	64.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	ENST00000400445.3	37	CCDS45026.1																																																																																			.		0.383	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NCR2	9436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41309741	41309741	+	Intron	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:41309741G>T	ENST00000373089.5	+	4	618				NCR2_ENST00000373083.4_Intron|NCR2_ENST00000373086.3_Silent_p.P178P	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2						cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					TCCCCAGCCCGTCCTCTCCCC	0.657																																					p.P178P		.											.	NCR2	91	0			c.G534T						.						104.0	98.0	100.0					6																	41309741		2203	4300	6503	SO:0001627	intron_variant	9436	exon4			CAGCCCGTCCTCT	AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.531-33G>T	6.37:g.41309741G>T		29.0	0.0		63.0	27.0	NM_001199509	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Silent	SNP	ENST00000373089.5	37	CCDS4855.1																																																																																			.		0.657	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040511.3		
NELFB	25920	ucsc.edu;bcgsc.ca	37	9	140157661	140157661	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:140157661A>G	ENST00000343053.4	+	5	1107	c.770A>G	c.(769-771)gAc>gGc	p.D257G		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	257					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGCACCGTGGACCCGTGCCAC	0.657																																					p.D257G		.											.	.	.	0			c.A770G						.						154.0	130.0	138.0					9																	140157661		2203	4300	6503	SO:0001583	missense	25920	exon5			CCGTGGACCCGTG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.770A>G	9.37:g.140157661A>G	ENSP00000339495:p.Asp257Gly	30.0	0.0		41.0	4.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	a	17.31	3.356313	0.61293	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.79299	0.4422	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82548	-0.0402	9	0.87932	D	0	-40.9643	13.4838	0.61353	1.0:0.0:0.0:0.0	.	257	Q8WX92	NELFB_HUMAN	G	257	.	ENSP00000339495:D257G	D	+	2	0	COBRA1	139277482	1.000000	0.71417	1.000000	0.80357	0.306000	0.27790	9.243000	0.95416	1.852000	0.53769	0.248000	0.18094	GAC	.		0.657	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
NES	10763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156640645	156640645	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:156640645C>A	ENST00000368223.3	-	4	3467	c.3335G>T	c.(3334-3336)gGc>gTc	p.G1112V		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1112	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGTCAGATGGCCTGGGTCCCC	0.637																																					p.G1112V		.											.	NES	520	0			c.G3335T						.						33.0	34.0	34.0					1																	156640645		2202	4299	6501	SO:0001583	missense	10763	exon4			AGATGGCCTGGGT	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3335G>T	1.37:g.156640645C>A	ENSP00000357206:p.Gly1112Val	37.0	0.0		141.0	43.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	ENST00000368223.3	37	CCDS1151.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582779	0.46006	.	.	ENSG00000132688	ENST00000368223	D	0.85955	-2.05	4.82	-1.18	0.09617	.	0.524091	0.14422	N	0.320573	T	0.70675	0.3251	L	0.56769	1.78	0.09310	N	0.999995	D	0.54964	0.969	P	0.45506	0.483	T	0.64554	-0.6380	10	0.66056	D	0.02	.	6.4028	0.21648	0.0:0.5142:0.1307:0.3552	.	1112	P48681	NEST_HUMAN	V	1112	ENSP00000357206:G1112V	ENSP00000357206:G1112V	G	-	2	0	NES	154907269	0.000000	0.05858	0.001000	0.08648	0.103000	0.19146	-0.250000	0.08830	0.102000	0.17638	0.557000	0.71058	GGC	.		0.637	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
NEUROG1	4762	ucsc.edu;bcgsc.ca	37	5	134871330	134871330	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:134871330G>A	ENST00000314744.4	-	1	309	c.51C>T	c.(49-51)agC>agT	p.S17S		NM_006161.2	NP_006152.2	Q92886	NGN1_HUMAN	neurogenin 1	17					cell fate commitment (GO:0045165)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perikaryon (GO:0043204)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			endometrium(1)|liver(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CACTGCCGCTGCTGCTGGCGC	0.677																																					p.S17S		.											.	NEUROG1	90	0			c.C51T						.						24.0	22.0	22.0					5																	134871330		1969	3951	5920	SO:0001819	synonymous_variant	4762	exon1			GCCGCTGCTGCTG	U63842	CCDS4187.1	5q23-q31	2013-05-21			ENSG00000181965	ENSG00000181965		"""Basic helix-loop-helix proteins"""	7764	protein-coding gene	gene with protein product	"""neurogenic differentiation 3"""	601726		NEUROD3		9119405	Standard	NM_006161		Approved	AKA, Math4C, ngn1, bHLHa6	uc003lax.3	Q92886	OTTHUMG00000129138	ENST00000314744.4:c.51C>T	5.37:g.134871330G>A		31.0	0.0		48.0	4.0	NM_006161	Q5U0Q9|Q96HE1	Silent	SNP	ENST00000314744.4	37	CCDS4187.1																																																																																			.		0.677	NEUROG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251192.1	NM_006161	
NGEF	25791	ucsc.edu;bcgsc.ca	37	2	233745877	233745877	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr2:233745877T>C	ENST00000264051.3	-	14	2199	c.1921A>G	c.(1921-1923)Atc>Gtc	p.I641V	NGEF_ENST00000539537.1_Missense_Mutation_p.I364V|NGEF_ENST00000373552.4_Missense_Mutation_p.I549V	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	641	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TTGTCCAGGATGTTGAGGATG	0.652																																					p.I641V		.											.	NGEF	313	0			c.A1921G						.						91.0	89.0	90.0					2																	233745877		2203	4300	6503	SO:0001583	missense	25791	exon14			CCAGGATGTTGAG	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.1921A>G	2.37:g.233745877T>C	ENSP00000264051:p.Ile641Val	33.0	0.0		46.0	4.0	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	ENST00000264051.3	37	CCDS2500.1	.	.	.	.	.	.	.	.	.	.	T	1.529	-0.544732	0.04024	.	.	ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537	T;T;T	0.36699	1.24;1.24;1.24	4.65	3.5	0.40072	Src homology-3 domain (4);	0.202670	0.43416	N	0.000565	T	0.09642	0.0237	N	0.01076	-1.035	0.43841	D	0.996423	B;B	0.09022	0.0;0.002	B;B	0.06405	0.001;0.002	T	0.24048	-1.0171	10	0.02654	T	1	-14.5667	7.3285	0.26569	0.0:0.1719:0.0:0.8281	.	549;641	E9PC42;Q8N5V2	.;NGEF_HUMAN	V	641;549;531;364	ENSP00000264051:I641V;ENSP00000362653:I549V;ENSP00000439035:I364V	ENSP00000264051:I641V	I	-	1	0	NGEF	233454121	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.887000	0.28254	0.648000	0.30732	0.379000	0.24179	ATC	.		0.652	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
NID2	22795	broad.mit.edu;mdanderson.org	37	14	52535526	52535526	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:52535526T>A	ENST00000216286.5	-	1	186	c.187A>T	c.(187-189)Aat>Tat	p.N63Y	NID2_ENST00000541773.1_Missense_Mutation_p.N10Y	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	63					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TGCAGGGGATTCGCCAGCTTC	0.627																																					p.N63Y		.											.	NID2	158	0			c.A187T						.						105.0	89.0	95.0					14																	52535526		2203	4300	6503	SO:0001583	missense	22795	exon1			GGGGATTCGCCAG	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.187A>T	14.37:g.52535526T>A	ENSP00000216286:p.Asn63Tyr	17.0	0.0		33.0	10.0	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.560483	0.27827	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.22945	1.93;1.93	4.81	-2.46	0.06461	.	1.541880	0.03610	N	0.234679	T	0.13286	0.0322	N	0.08118	0	0.09310	N	1	B;B;B	0.32409	0.143;0.37;0.122	B;B;B	0.28849	0.095;0.064;0.043	T	0.28364	-1.0046	10	0.59425	D	0.04	.	7.8372	0.29376	0.0:0.1738:0.5742:0.252	.	10;65;63	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	Y	63;63;10;65	ENSP00000216286:N63Y;ENSP00000443730:N10Y	ENSP00000216286:N63Y	N	-	1	0	NID2	51605276	0.000000	0.05858	0.002000	0.10522	0.453000	0.32348	0.023000	0.13533	-0.446000	0.07149	0.374000	0.22700	AAT	.		0.627	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
NPAS2	4862	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	101554302	101554302	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr2:101554302delC	ENST00000335681.5	+	5	646	c.361delC	c.(361-363)ccgfs	p.P121fs	NPAS2_ENST00000542504.1_Frame_Shift_Del_p.P186fs|NPAS2_ENST00000486017.1_3'UTR	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	121	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGGGCATTTACCGGTGAGTTT	0.488																																					p.P121fs		.											.	NPAS2	94	0			c.361delC						.						219.0	189.0	199.0					2																	101554302		2203	4300	6503	SO:0001589	frameshift_variant	4862	exon5			CATTTACCGGTGA	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.361delC	2.37:g.101554302delC	ENSP00000338283:p.Pro121fs	72.0	0.0		222.0	97.0	NM_002518	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Frame_Shift_Del	DEL	ENST00000335681.5	37	CCDS2048.1																																																																																			.		0.488	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
OR10A5	144124	hgsc.bcm.edu;mdanderson.org	37	11	6867462	6867462	+	Silent	SNP	G	G	A	rs543931840		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:6867462G>A	ENST00000299454.4	+	1	580	c.549G>A	c.(547-549)ccG>ccA	p.P183P	OR10A5_ENST00000379831.2_Silent_p.P187P			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	183					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183P(2)		endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGACAGCCCGCCTGTGCTGA	0.527													A|||	1	0.000199681	0.0	0.0	5008	,	,		23000	0.001		0.0	False		,,,				2504	0.0				p.P183P	Pancreas(44;21 1072 25662 28041 45559)	.											.	OR10A5	71	2	Substitution - coding silent(2)	kidney(2)	c.G549A						.						180.0	152.0	161.0					11																	6867462		2201	4296	6497	SO:0001819	synonymous_variant	144124	exon1			CAGCCCGCCTGTG	AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.549G>A	11.37:g.6867462G>A		105.0	0.0		433.0	30.0	NM_178168	O95223|Q52M66|Q96R21|Q96R22	Silent	SNP	ENST00000299454.4	37	CCDS7773.1																																																																																			.		0.527	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385983.1	NM_178168	
OR10R2	343406	broad.mit.edu;mdanderson.org	37	1	158450632	158450632	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:158450632G>T	ENST00000368152.1	+	1	965	c.965G>T	c.(964-966)aGa>aTa	p.R322I	RP11-144L1.4_ENST00000419738.1_RNA|RP11-144L1.4_ENST00000426251.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	322						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CTTGCTATCAGAAAAGTGTTG	0.338																																					p.R322I		.											.	OR10R2	161	0			c.G965T						.						69.0	65.0	67.0					1																	158450632		2203	4300	6503	SO:0001583	missense	343406	exon1			CTATCAGAAAAGT	AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.965G>T	1.37:g.158450632G>T	ENSP00000357134:p.Arg322Ile	48.0	0.0		100.0	24.0	NM_001004472	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	ENST00000368152.1	37	CCDS30898.1	.	.	.	.	.	.	.	.	.	.	g	12.08	1.829699	0.32329	.	.	ENSG00000198965	ENST00000368152	T	0.39056	1.1	4.2	-1.36	0.09085	.	.	.	.	.	T	0.14700	0.0355	L	0.28504	0.86	0.09310	N	1	P	0.41710	0.76	B	0.43386	0.418	T	0.12243	-1.0555	9	0.62326	D	0.03	.	6.2959	0.21085	0.5597:0.1418:0.2984:0.0	.	322	Q8NGX6	O10R2_HUMAN	I	322	ENSP00000357134:R322I	ENSP00000357134:R322I	R	+	2	0	OR10R2	156717256	0.000000	0.05858	0.001000	0.08648	0.951000	0.60555	-0.109000	0.10840	-0.534000	0.06315	-0.136000	0.14681	AGA	.		0.338	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051847.2	NM_001004472	
OR2AG2	338755	broad.mit.edu;bcgsc.ca	37	11	6790153	6790153	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:6790153G>A	ENST00000338569.2	-	1	133	c.36C>T	c.(34-36)ttC>ttT	p.F12F		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCACCAAGATGAAGCCGCTTC	0.448																																					p.F12F		.											.	OR2AG2	71	0			c.C36T						.						85.0	84.0	85.0					11																	6790153		2201	4296	6497	SO:0001819	synonymous_variant	338755	exon1			CAAGATGAAGCCG	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.36C>T	11.37:g.6790153G>A		53.0	0.0		155.0	7.0	NM_001004490		Silent	SNP	ENST00000338569.2	37	CCDS31413.1																																																																																			.		0.448	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
OR1S1	219959	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57983007	57983007	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:57983007T>A	ENST00000309433.6	+	1	791	c.791T>A	c.(790-792)tTc>tAc	p.F264Y		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				GTATTACTGTTCTACGGAACC	0.488																																					p.F264Y		.											.	OR1S1	113	0			c.T791A						.						169.0	135.0	147.0					11																	57983007		2201	4295	6496	SO:0001583	missense	219959	exon1			TACTGTTCTACGG	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.791T>A	11.37:g.57983007T>A	ENSP00000311688:p.Phe264Tyr	91.0	1.0		255.0	112.0	NM_001004458	Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	37	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	T	10.41	1.343780	0.24339	.	.	ENSG00000172774	ENST00000309433	T	0.00282	8.31	3.23	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000084	T	0.00440	0.0014	L	0.48260	1.515	0.24408	N	0.994671	D	0.89917	1.0	D	0.91635	0.999	T	0.54951	-0.8216	10	0.54805	T	0.06	.	10.883	0.46951	0.0:0.0:0.0:1.0	.	264	Q8NH92	OR1S1_HUMAN	Y	264	ENSP00000311688:F264Y	ENSP00000311688:F264Y	F	+	2	0	OR1S1	57739583	0.010000	0.17322	0.417000	0.26559	0.170000	0.22686	0.615000	0.24329	1.345000	0.45676	0.392000	0.25879	TTC	.		0.488	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458	
OR4K2	390431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20344661	20344661	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:20344661C>A	ENST00000298642.2	+	1	271	c.235C>A	c.(235-237)Cca>Aca	p.P79T		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTCGCCACCCCAAAGATGAT	0.413																																					p.P79T		.											.	OR4K2	72	0			c.C235A						.						270.0	264.0	266.0					14																	20344661		2203	4300	6503	SO:0001583	missense	390431	exon1			GCCACCCCAAAGA		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.235C>A	14.37:g.20344661C>A	ENSP00000298642:p.Pro79Thr	124.0	0.0		413.0	119.0	NM_001005501	B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	37	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	20.9	4.070178	0.76301	.	.	ENSG00000165762	ENST00000298642	T	0.01854	4.6	5.27	5.27	0.74061	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000151	T	0.28962	0.0719	H	0.99650	4.68	0.53005	D	0.999963	D	0.89917	1.0	D	0.83275	0.996	T	0.57493	-0.7802	10	0.87932	D	0	.	16.4283	0.83832	0.0:1.0:0.0:0.0	.	79	Q8NGD2	OR4K2_HUMAN	T	79	ENSP00000298642:P79T	ENSP00000298642:P79T	P	+	1	0	OR4K2	19414501	0.998000	0.40836	1.000000	0.80357	0.943000	0.58893	4.477000	0.60223	2.740000	0.93945	0.563000	0.77884	CCA	.		0.413	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1		
OR4K1	79544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20404418	20404418	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:20404418T>G	ENST00000285600.4	+	1	652	c.593T>G	c.(592-594)aTg>aGg	p.M198R		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		ATGGAAATTATGACCCTAACG	0.453																																					p.M198R		.											.	OR4K1	71	0			c.T593G						.						159.0	161.0	160.0					14																	20404418		2203	4300	6503	SO:0001583	missense	79544	exon1			AAATTATGACCCT		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.593T>G	14.37:g.20404418T>G	ENSP00000285600:p.Met198Arg	132.0	0.0		284.0	74.0	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Missense_Mutation	SNP	ENST00000285600.4	37	CCDS32025.1	.	.	.	.	.	.	.	.	.	.	.	7.015	0.557492	0.13436	.	.	ENSG00000155249	ENST00000285600	T	0.37235	1.21	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.340024	0.26170	N	0.025939	T	0.50446	0.1616	M	0.84511	2.7	0.09310	N	1	B	0.30542	0.284	B	0.40038	0.317	T	0.54118	-0.8341	10	0.87932	D	0	.	12.3562	0.55176	0.0:0.0:0.0:1.0	.	198	Q8NGD4	OR4K1_HUMAN	R	198	ENSP00000285600:M198R	ENSP00000285600:M198R	M	+	2	0	OR4K1	19474258	0.866000	0.29940	0.125000	0.21846	0.350000	0.29205	4.403000	0.59729	2.011000	0.59026	0.460000	0.39030	ATG	.		0.453	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
OSBPL11	114885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	125295107	125295107	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:125295107C>A	ENST00000296220.5	-	5	881	c.592G>T	c.(592-594)Gtt>Ttt	p.V198F		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	198					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						GAATGTCCAACATTAAAAAAA	0.378																																					p.V198F		.											.	OSBPL11	135	0			c.G592T						.						127.0	131.0	130.0					3																	125295107		2203	4300	6503	SO:0001583	missense	114885	exon5			GTCCAACATTAAA	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.592G>T	3.37:g.125295107C>A	ENSP00000296220:p.Val198Phe	84.0	0.0		196.0	74.0	NM_022776	A8K9I7	Missense_Mutation	SNP	ENST00000296220.5	37	CCDS3033.1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925542	0.52759	.	.	ENSG00000144909	ENST00000296220	T	0.46819	0.86	5.06	5.06	0.68205	.	0.555483	0.18719	N	0.133080	T	0.35098	0.0920	L	0.48642	1.525	0.46654	D	0.999146	P	0.45902	0.868	B	0.30251	0.113	T	0.25745	-1.0123	10	0.29301	T	0.29	-17.4662	14.3282	0.66534	0.0:0.8519:0.1481:0.0	.	198	Q9BXB4	OSB11_HUMAN	F	198	ENSP00000296220:V198F	ENSP00000296220:V198F	V	-	1	0	OSBPL11	126777797	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.424000	0.59868	2.645000	0.89757	0.552000	0.68991	GTT	.		0.378	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80761993	80761993	+	Silent	SNP	A	A	G	rs370122451		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:80761993A>G	ENST00000547103.1	+	54	6462	c.6456A>G	c.(6454-6456)gtA>gtG	p.V2152V	OTOGL_ENST00000458043.2_Silent_p.V2164V|OTOGL_ENST00000546620.1_Silent_p.V183V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2152					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						AGCACCAGGTATATACTCCAT	0.353																																					p.V2164V		.											.	.	.	0			c.A6492G						.	A		0,4406		0,0,2203	131.0	117.0	122.0		6492	-4.3	0.1	12		122	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OTOGL	NM_173591.3		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		2164/2345	80761993	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	283310	exon54			CCAGGTATATACT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6456A>G	12.37:g.80761993A>G		90.0	0.0		207.0	74.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	A	7.554	0.663357	0.14710	0.0	1.16E-4	ENSG00000165899	ENST00000298820	.	.	.	5.47	-4.34	0.03666	.	.	.	.	.	T	0.51126	0.1656	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49799	-0.8901	4	.	.	.	.	8.5452	0.33417	0.4137:0.0:0.474:0.1123	.	.	.	.	C	572	.	.	Y	+	2	0	OTOGL	79286124	0.000000	0.05858	0.082000	0.20525	0.898000	0.52572	-2.168000	0.01270	-0.885000	0.03971	-0.386000	0.06593	TAT	.		0.353	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PARM1	25849	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	75971384	75971384	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:75971384A>G	ENST00000307428.7	+	4	1072	c.860A>G	c.(859-861)tAt>tGt	p.Y287C	PARM1_ENST00000513238.1_Missense_Mutation_p.Y45C	NM_015393.3	NP_056208.2	Q6UWI2	PARM1_HUMAN	prostate androgen-regulated mucin-like protein 1	287					positive regulation of telomerase activity (GO:0051973)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|lung(4)|ovary(1)	8						CATTCCTCCTATGGAAGACTT	0.498																																					p.Y287C		.											.	PARM1	1	0			c.A860G						.						100.0	100.0	100.0					4																	75971384		2081	4240	6321	SO:0001583	missense	25849	exon4			CCTCCTATGGAAG	AK022311	CCDS47077.1	4q13.3-q21.3	2010-02-17	2009-09-28		ENSG00000169116	ENSG00000169116			24536	protein-coding gene	gene with protein product	"""Prostatic androgen-repressed message 1"", ""Castration-induced prostatic apoptosis-related protein 1"", ""WSC4, cell wall integrity and stress response component 4 homolog (S. cerevisiae)"""					10499539, 12772192, 18027867	Standard	NM_015393		Approved	DKFZP564O0823, Cipar1, WSC4	uc003hih.2	Q6UWI2	OTTHUMG00000160827	ENST00000307428.7:c.860A>G	4.37:g.75971384A>G	ENSP00000370224:p.Tyr287Cys	89.0	1.0		219.0	83.0	NM_015393	B3KMQ9|Q96DV8|Q9Y4S1	Missense_Mutation	SNP	ENST00000307428.7	37	CCDS47077.1	.	.	.	.	.	.	.	.	.	.	A	18.59	3.657524	0.67586	.	.	ENSG00000169116	ENST00000513238;ENST00000307428	T;T	0.26223	1.75;1.75	5.51	5.51	0.81932	.	0.000000	0.49305	D	0.000153	T	0.38054	0.1026	L	0.27053	0.805	0.45883	D	0.998735	D	0.89917	1.0	D	0.91635	0.999	T	0.23868	-1.0176	10	0.87932	D	0	-14.7579	13.6279	0.62178	1.0:0.0:0.0:0.0	.	287	Q6UWI2	PARM1_HUMAN	C	45;287	ENSP00000424276:Y45C;ENSP00000370224:Y287C	ENSP00000370224:Y287C	Y	+	2	0	PARM1	76190408	0.999000	0.42202	0.964000	0.40570	0.848000	0.48234	5.770000	0.68873	2.317000	0.78254	0.459000	0.35465	TAT	.		0.498	PARM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362494.1	NM_015393	
PARS2	25973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	55223846	55223846	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:55223846C>T	ENST00000371279.3	-	2	1071	c.989G>A	c.(988-990)gGc>gAc	p.G330D		NM_152268.3	NP_689481.2	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase 2, mitochondrial (putative)	330					gene expression (GO:0010467)|prolyl-tRNA aminoacylation (GO:0006433)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|proline-tRNA ligase activity (GO:0004827)			breast(1)|endometrium(3)|kidney(2)|lung(4)|ovary(2)|prostate(2)|skin(1)	15					L-Proline(DB00172)	GGTTGGTTTGCCACAGACATT	0.507																																					p.G330D		.											.	PARS2	92	0			c.G989A						.						100.0	101.0	101.0					1																	55223846		2203	4300	6503	SO:0001583	missense	25973	exon2			GGTTTGCCACAGA	AK025585	CCDS597.1	1p32.2	2011-07-01	2007-02-23		ENSG00000162396	ENSG00000162396	6.1.1.15	"""Aminoacyl tRNA synthetases / Class II"""	30563	protein-coding gene	gene with protein product	"""proline tRNA ligase 2, mitochondrial (putative)"""	612036				15779907	Standard	NM_152268		Approved	DKFZp727A071	uc001cxy.3	Q7L3T8	OTTHUMG00000009915	ENST00000371279.3:c.989G>A	1.37:g.55223846C>T	ENSP00000360327:p.Gly330Asp	54.0	0.0		165.0	66.0	NM_152268	A8K0W4|Q9H6S5|Q9UFT1	Missense_Mutation	SNP	ENST00000371279.3	37	CCDS597.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061515	0.36373	.	.	ENSG00000162396	ENST00000371279	D	0.82167	-1.58	5.66	5.66	0.87406	Aminoacyl-tRNA synthetase, class II (1);	0.163532	0.51477	D	0.000085	D	0.89301	0.6676	M	0.91300	3.195	0.48901	D	0.999725	D	0.58268	0.982	P	0.54664	0.758	D	0.90315	0.4340	10	0.66056	D	0.02	-21.6053	7.4017	0.26967	0.0:0.8011:0.0:0.1989	.	330	Q7L3T8	SYPM_HUMAN	D	330	ENSP00000360327:G330D	ENSP00000360327:G330D	G	-	2	0	PARS2	54996434	1.000000	0.71417	0.048000	0.18961	0.019000	0.09904	4.858000	0.62947	2.665000	0.90641	0.655000	0.94253	GGC	.		0.507	PARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027436.1	NM_152268	
PBX1	5087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	164768965	164768965	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:164768965G>T	ENST00000420696.2	+	4	728	c.540G>T	c.(538-540)atG>atT	p.M180I	PBX1_ENST00000367897.1_Missense_Mutation_p.M180I|PBX1_ENST00000560641.1_Missense_Mutation_p.M75I|PBX1_ENST00000401534.1_Missense_Mutation_p.M180I|PBX1_ENST00000540246.1_Missense_Mutation_p.M75I|PBX1_ENST00000559240.1_Missense_Mutation_p.M180I|PBX1_ENST00000540236.1_Missense_Mutation_p.M180I	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	180					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CCCACGTGATGAATCTCCTGC	0.542			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.M180I		.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	659	0			c.G540T						.						89.0	81.0	84.0					1																	164768965		2203	4300	6503	SO:0001583	missense	5087	exon4			CGTGATGAATCTC	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.540G>T	1.37:g.164768965G>T	ENSP00000405890:p.Met180Ile	56.0	0.0		211.0	68.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	37	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919683	0.92249	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59	5.76	5.76	0.90799	PBX (1);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	M	0.70275	2.135	0.80722	D	1	B;B;B;B	0.33549	0.011;0.109;0.417;0.041	B;B;B;B	0.37943	0.038;0.064;0.261;0.055	T	0.04413	-1.0953	10	0.33141	T	0.24	-15.6208	19.571	0.95419	0.0:0.0:1.0:0.0	.	75;180;180;180	B7Z774;F5H4U9;P40424;Q53YC7	.;.;PBX1_HUMAN;.	I	180;180;180;180;75	ENSP00000405890:M180I;ENSP00000356872:M180I;ENSP00000439943:M180I;ENSP00000384856:M180I;ENSP00000440869:M75I	ENSP00000356872:M180I	M	+	3	0	PBX1	163035589	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.338000	0.96553	2.713000	0.92767	0.655000	0.94253	ATG	.		0.542	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
PCDHB11	56125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140580796	140580796	+	Silent	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:140580796C>T	ENST00000354757.3	+	1	1449	c.1449C>T	c.(1447-1449)aaC>aaT	p.N483N	PCDHB11_ENST00000536699.1_Silent_p.N118N	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	483	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGGCACCAACGCCCAGGTCA	0.627																																					p.N483N		.											.	PCDHB11	96	0			c.C1449T						.						139.0	135.0	137.0					5																	140580796		2203	4300	6503	SO:0001819	synonymous_variant	56125	exon1			CACCAACGCCCAG	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1449C>T	5.37:g.140580796C>T		64.0	0.0		171.0	65.0	NM_018931	B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	CCDS4253.1																																																																																			.		0.627	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
PCNA	5111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	5096123	5096123	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr20:5096123T>C	ENST00000379160.3	-	6	920	c.678A>G	c.(676-678)acA>acG	p.T226T	TMEM230_ENST00000379283.2_5'Flank|PCNA_ENST00000379143.5_Silent_p.T226T|TMEM230_ENST00000379279.2_5'Flank|TMEM230_ENST00000492419.1_5'Flank|TMEM230_ENST00000342308.5_5'Flank|Y_RNA_ENST00000516558.1_RNA|TMEM230_ENST00000379286.2_5'Flank|TMEM230_ENST00000379277.2_5'Flank|TMEM230_ENST00000202834.7_5'Flank	NM_002592.2	NP_002583.1	P12004	PCNA_HUMAN	proliferating cell nuclear antigen	226					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|epithelial cell differentiation (GO:0030855)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|leading strand elongation (GO:0006272)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of deoxyribonuclease activity (GO:0032077)|regulation of DNA replication (GO:0006275)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cadmium ion (GO:0046686)|response to lipid (GO:0033993)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)|translesion synthesis (GO:0019985)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|nuclear replication fork (GO:0043596)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA complex (GO:0043626)|PCNA-p21 complex (GO:0070557)	dinucleotide insertion or deletion binding (GO:0032139)|DNA polymerase binding (GO:0070182)|DNA polymerase processivity factor activity (GO:0030337)|identical protein binding (GO:0042802)|MutLalpha complex binding (GO:0032405)|purine-specific mismatch base pair DNA N-glycosylase activity (GO:0000701)|receptor tyrosine kinase binding (GO:0030971)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)	9						ACATACTGAGTGTCACCGTTG	0.388								DNA polymerases (catalytic subunits)																													p.T226T		.											.	PCNA	651	0			c.A678G						.						192.0	181.0	185.0					20																	5096123		2203	4300	6503	SO:0001819	synonymous_variant	5111	exon6			ACTGAGTGTCACC	J04718	CCDS13087.1	20p13-p12.3	2013-09-19			ENSG00000132646	ENSG00000132646			8729	protein-coding gene	gene with protein product		176740				2565339	Standard	NM_002592		Approved		uc002wlp.3	P12004	OTTHUMG00000031798	ENST00000379160.3:c.678A>G	20.37:g.5096123T>C		93.0	0.0		239.0	104.0	NM_002592	B2R897|D3DW02	Silent	SNP	ENST00000379160.3	37	CCDS13087.1																																																																																			.		0.388	PCNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077852.2		
PDCD7	10081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65426109	65426109	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:65426109G>A	ENST00000204549.4	-	1	65	c.11C>T	c.(10-12)cCa>cTa	p.P4L		NM_005707.1	NP_005698.1	Q8N8D1	PDCD7_HUMAN	programmed cell death 7	4	Pro-rich.				apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of T cell apoptotic process (GO:0070234)|response to glucocorticoid (GO:0051384)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)				endometrium(4)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7						GAAGAATGGTGGCAGGGCCAT	0.657																																					p.P4L		.											.	PDCD7	227	0			c.C11T						.						7.0	8.0	7.0					15																	65426109		2020	4140	6160	SO:0001583	missense	10081	exon1			AATGGTGGCAGGG	AF083930	CCDS10201.1	15q22.2	2012-06-07			ENSG00000090470	ENSG00000090470			8767	protein-coding gene	gene with protein product	"""U11/U12 snRNP 59K"""	608138				10037816	Standard	NM_005707		Approved	HES18, ES18	uc002aol.3	Q8N8D1	OTTHUMG00000133117	ENST00000204549.4:c.11C>T	15.37:g.65426109G>A	ENSP00000204549:p.Pro4Leu	26.0	0.0		71.0	29.0	NM_005707	Q96AK8|Q9Y6D7	Missense_Mutation	SNP	ENST00000204549.4	37	CCDS10201.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432041	0.43122	.	.	ENSG00000090470	ENST00000204549	.	.	.	4.49	4.49	0.54785	.	0.080527	0.48286	D	0.000184	T	0.53753	0.1816	N	0.19112	0.55	0.51482	D	0.999923	D	0.65815	0.995	P	0.58721	0.844	T	0.61163	-0.7118	9	0.87932	D	0	-3.5192	15.043	0.71805	0.0:0.0:1.0:0.0	.	4	Q8N8D1	PDCD7_HUMAN	L	4	.	ENSP00000204549:P4L	P	-	2	0	PDCD7	63213162	1.000000	0.71417	0.995000	0.50966	0.094000	0.18550	3.034000	0.49751	2.201000	0.70794	0.491000	0.48974	CCA	.		0.657	PDCD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256784.2	NM_005707	
PDE4DIP	9659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	144852472	144852472	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:144852472T>C	ENST00000369354.3	-	44	7216	c.7027A>G	c.(7027-7029)Act>Gct	p.T2343A	PDE4DIP_ENST00000530740.1_Missense_Mutation_p.T2428A|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.T2237A|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.T2479A			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2343					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGGCTGGAGTACATGGCAGA	0.512			T	PDGFRB	MPD																																p.T2343A		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	663	0			c.A7027G						.						54.0	53.0	53.0					1																	144852472		2203	4293	6496	SO:0001583	missense	9659	exon44			CTGGAGTACATGG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.7027A>G	1.37:g.144852472T>C	ENSP00000358360:p.Thr2343Ala	63.0	0.0		180.0	36.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	.	8.960	0.970237	0.18659	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000530740;ENST00000369359	T;T;T;T	0.01685	4.69;4.79;4.79;4.79	4.47	-1.12	0.09808	.	.	.	.	.	T	0.00666	0.0022	L	0.47716	1.5	0.48511	D	0.999669	B;B	0.11235	0.004;0.0	B;B	0.09377	0.004;0.001	T	0.43327	-0.9398	9	0.49607	T	0.09	.	4.0432	0.09761	0.0:0.3064:0.1814:0.5122	.	2237;2343	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	A	2237;2343;2428;2479	ENSP00000327209:T2237A;ENSP00000358360:T2343A;ENSP00000435654:T2428A;ENSP00000358366:T2479A	ENSP00000327209:T2237A	T	-	1	0	PDE4DIP	143563829	0.204000	0.23447	0.722000	0.30670	0.403000	0.30841	-0.491000	0.06474	-0.050000	0.13356	0.449000	0.29647	ACT	.		0.512	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PDGFD	80310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103870889	103870889	+	Silent	SNP	G	G	A	rs200239592		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:103870889G>A	ENST00000393158.2	-	2	398	c.219C>T	c.(217-219)taC>taT	p.Y73Y	PDGFD_ENST00000302251.5_Silent_p.Y67Y			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	73	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		GGTTCCTGGGGTAGCTGTTCG	0.488																																					p.Y73Y		.											.	PDGFD	723	0			c.C219T						.						196.0	179.0	185.0					11																	103870889		2202	4299	6501	SO:0001819	synonymous_variant	80310	exon2			CCTGGGGTAGCTG	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.219C>T	11.37:g.103870889G>A		113.0	0.0		423.0	163.0	NM_025208	A8K9T6|Q9BWV5	Silent	SNP	ENST00000393158.2	37	CCDS41703.1																																																																																			G|0.999;C|0.000		0.488	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
PDPR	55066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70190496	70190496	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:70190496G>T	ENST00000288050.4	+	19	3311	c.2354G>T	c.(2353-2355)tGg>tTg	p.W785L	PDPR_ENST00000568530.1_Missense_Mutation_p.W785L|RP11-296I10.3_ENST00000502126.1_RNA|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000567046.1_Missense_Mutation_p.W143L|PDPR_ENST00000542659.1_Missense_Mutation_p.W130L|PDPR_ENST00000398122.3_Missense_Mutation_p.W685L	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	785					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		TGGCCTTGGTGGGGAGAGCCC	0.567																																					p.W785L		.											.	PDPR	135	0			c.G2354T						.						232.0	255.0	247.0					16																	70190496		2088	4212	6300	SO:0001583	missense	55066	exon19			CTTGGTGGGGAGA		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2354G>T	16.37:g.70190496G>T	ENSP00000288050:p.Trp785Leu	65.0	0.0		177.0	24.0	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	37	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	G	34	5.406594	0.96051	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055;ENST00000542659	T;T;T	0.75938	-0.98;-0.98;-0.98	6.03	6.03	0.97812	Glycine cleavage T-protein, C-terminal barrel (1);	0.062767	0.64402	D	0.000001	T	0.81389	0.4812	L	0.36672	1.1	0.80722	D	1	D;D	0.71674	0.998;0.984	D;P	0.68039	0.955;0.845	T	0.80867	-0.1190	10	0.54805	T	0.06	.	19.5634	0.95382	0.0:0.0:1.0:0.0	.	452;785	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	L	785;685;452;130	ENSP00000288050:W785L;ENSP00000381190:W685L;ENSP00000441690:W130L	ENSP00000205055:W452L	W	+	2	0	PDPR	68747997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.793000	0.99091	2.868000	0.98415	0.557000	0.71058	TGG	.		0.567	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
PHIP	55023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	79688429	79688429	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:79688429C>A	ENST00000275034.4	-	24	2937		c.e24-1		PHIP_ENST00000479165.1_Splice_Site	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CAGCCAATCTCTGACAAAATT	0.308																																					.		.											.	PHIP	579	0			c.2770-1G>T						.						57.0	57.0	57.0					6																	79688429		2203	4300	6503	SO:0001630	splice_region_variant	55023	exon25			CAATCTCTGACAA	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2770-1G>T	6.37:g.79688429C>A		61.0	0.0		151.0	61.0	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Splice_Site	SNP	ENST00000275034.4	37	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.979471	0.53827	.	.	ENSG00000146247	ENST00000275034	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3848	0.83501	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHIP	79745148	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	5.024000	0.64090	2.527000	0.85204	0.655000	0.94253	.	.		0.308	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		Intron
PDSS2	57107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	107475922	107475922	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:107475922G>C	ENST00000369037.4	-	8	1378	c.1101C>G	c.(1099-1101)taC>taG	p.Y367*	PDSS2_ENST00000453874.2_Nonsense_Mutation_p.Y265*	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	367					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		TGTTTCCATGGTAACGACACA	0.443																																					p.Y367X		.											.	PDSS2	92	0			c.C1101G						.						80.0	75.0	77.0					6																	107475922		2203	4300	6503	SO:0001587	stop_gained	57107	exon8			TCCATGGTAACGA	AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.1101C>G	6.37:g.107475922G>C	ENSP00000358033:p.Tyr367*	51.0	0.0		122.0	53.0	NM_020381	Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Nonsense_Mutation	SNP	ENST00000369037.4	37	CCDS5059.1	.	.	.	.	.	.	.	.	.	.	G	37	6.102109	0.97286	.	.	ENSG00000164494	ENST00000369037;ENST00000453874	.	.	.	5.53	5.53	0.82687	.	0.423542	0.28606	N	0.014745	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	19.4936	0.95062	0.0:0.0:1.0:0.0	.	.	.	.	X	367;265	.	ENSP00000358033:Y367X	Y	-	3	2	PDSS2	107582615	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.009000	0.88606	2.605000	0.88082	0.655000	0.94253	TAC	.		0.443	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131954.1	NM_020381	
PIK3C2B	5287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	204408086	204408086	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:204408086G>C	ENST00000367187.3	-	24	4049	c.3493C>G	c.(3493-3495)Cct>Gct	p.P1165A	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.P1137A	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1165	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TCCTCCCCAGGGTTGTGTTTC	0.592																																					p.P1165A		.											.	PIK3C2B	1310	0			c.C3493G						.						132.0	94.0	107.0					1																	204408086		2203	4300	6503	SO:0001583	missense	5287	exon24			CCCCAGGGTTGTG	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3493C>G	1.37:g.204408086G>C	ENSP00000356155:p.Pro1165Ala	43.0	0.0		111.0	22.0	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	32	5.147449	0.94603	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.77229	-1.08;-1.08	5.5	5.5	0.81552	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.054940	0.85682	D	0.000000	D	0.86159	0.5866	L	0.54323	1.7	0.58432	D	0.999997	P;D	0.89917	0.863;1.0	P;D	0.87578	0.493;0.998	D	0.85599	0.1251	10	0.48119	T	0.1	.	18.9895	0.92786	0.0:0.0:1.0:0.0	.	1137;1165	F5GWN5;O00750	.;P3C2B_HUMAN	A	1165;1137	ENSP00000356155:P1165A;ENSP00000400561:P1137A	ENSP00000356155:P1165A	P	-	1	0	PIK3C2B	202674709	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.832000	0.99423	2.582000	0.87167	0.563000	0.77884	CCT	.		0.592	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
PIPSL	266971	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95719360	95719360	+	RNA	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr10:95719360C>T	ENST00000480546.1	-	0	1937					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										CCGGGTTTCCCACAAAGGCAA	0.488																																					.		.											.	.	.	0			.						.																																					266971	.			GTTTCCCACAAAG	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95719360C>T		101.0	0.0		273.0	119.0	.	Q6NUK8	RNA	SNP	ENST00000480546.1	37																																																																																				.		0.488	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene	OTTHUMT00000351483.1	NR_002319	
PLAA	9373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	26923264	26923264	+	Silent	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:26923264C>A	ENST00000397292.3	-	7	1368	c.951G>T	c.(949-951)ctG>ctT	p.L317L	PLAA_ENST00000520884.1_Silent_p.L317L	NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	317					inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTGCGTGAGACAGTTCTTTTT	0.388																																					p.L317L	Melanoma(175;2670 2735 14091 35526)	.											.	PLAA	514	0			c.G951T						.						191.0	172.0	179.0					9																	26923264		2203	4300	6503	SO:0001819	synonymous_variant	9373	exon7			GTGAGACAGTTCT	AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.951G>T	9.37:g.26923264C>A		111.0	0.0		343.0	122.0	NM_001031689	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Silent	SNP	ENST00000397292.3	37	CCDS35000.1																																																																																			.		0.388	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
PLCXD3	345557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	41381972	41381972	+	Silent	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:41381972C>T	ENST00000377801.3	-	2	842	c.768G>A	c.(766-768)gtG>gtA	p.V256V	PLCXD3_ENST00000328457.3_Silent_p.V256V			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	256					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						CCCCTTTGACCACAGTGCTAG	0.413																																					p.V256V		.											.	PLCXD3	229	0			c.G768A						.						81.0	86.0	84.0					5																	41381972		2203	4300	6503	SO:0001819	synonymous_variant	345557	exon2			TTTGACCACAGTG		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.768G>A	5.37:g.41381972C>T		72.0	0.0		291.0	162.0	NM_001005473	A6NL04	Silent	SNP	ENST00000377801.3	37	CCDS34150.1																																																																																			.		0.413	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875	
PLOD2	5352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	145828234	145828234	+	Splice_Site	SNP	A	A	G	rs376517611		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:145828234A>G	ENST00000360060.3	-	4	517	c.340T>C	c.(340-342)Ttt>Ctt	p.F114L	PLOD2_ENST00000282903.5_Splice_Site_p.F114L|PLOD2_ENST00000494950.1_Splice_Site_p.F59L	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	114					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	ATGACATCAAAGCTGTTCAAT	0.358																																					p.F114L		.											.	PLOD2	92	0			c.T340C						.						77.0	77.0	77.0					3																	145828234		2203	4300	6503	SO:0001630	splice_region_variant	5352	exon4			CATCAAAGCTGTT	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.339-1T>C	3.37:g.145828234A>G		61.0	0.0		109.0	47.0	NM_182943	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	37	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839074	0.71373	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950;ENST00000469350	T;T;T;T	0.14391	2.51;2.51;2.51;2.51	5.0	5.0	0.66597	.	0.058788	0.64402	D	0.000001	T	0.14227	0.0344	L	0.34521	1.04	0.48696	D	0.999693	B;B;B	0.22909	0.055;0.077;0.064	B;B;B	0.28916	0.033;0.066;0.096	T	0.04413	-1.0953	10	0.72032	D	0.01	-41.3085	14.7082	0.69208	1.0:0.0:0.0:0.0	.	59;114;114	E7ETU9;O00469;O00469-2	.;PLOD2_HUMAN;.	L	114;114;59;86	ENSP00000282903:F114L;ENSP00000353170:F114L;ENSP00000420094:F59L;ENSP00000419963:F86L	ENSP00000282903:F114L	F	-	1	0	PLOD2	147310924	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	8.597000	0.90847	1.872000	0.54250	0.377000	0.23210	TTT	.		0.358	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	Missense_Mutation
PLXNA4	91584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	131883315	131883315	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:131883315G>T	ENST00000359827.3	-	13	3629	c.2667C>A	c.(2665-2667)gaC>gaA	p.D889E	PLXNA4_ENST00000321063.4_Missense_Mutation_p.D889E			Q9HCM2	PLXA4_HUMAN	plexin A4	889	IPT/TIG 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGGAGGCGATGTCGCGAAATT	0.572																																					p.D889E		.											.	PLXNA4	91	0			c.C2667A						.						76.0	78.0	77.0					7																	131883315		1979	4170	6149	SO:0001583	missense	91584	exon13			GGCGATGTCGCGA	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2667C>A	7.37:g.131883315G>T	ENSP00000352882:p.Asp889Glu	23.0	0.0		41.0	9.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	8.524	0.869477	0.17322	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.76709	-1.04;-1.04	5.94	5.07	0.68467	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.050751	0.85682	D	0.000000	T	0.59851	0.2224	N	0.13235	0.315	0.47214	D	0.999352	B	0.06786	0.001	B	0.13407	0.009	T	0.55062	-0.8199	10	0.34782	T	0.22	.	7.9778	0.30166	0.1355:0.0:0.7345:0.13	.	889	Q9HCM2	PLXA4_HUMAN	E	889	ENSP00000323194:D889E;ENSP00000352882:D889E	ENSP00000323194:D889E	D	-	3	2	PLXNA4	131533855	1.000000	0.71417	1.000000	0.80357	0.307000	0.27823	1.079000	0.30766	1.521000	0.48983	0.650000	0.86243	GAC	.		0.572	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
POMT2	29954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	77751296	77751296	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:77751296T>A	ENST00000261534.4	-	14	1775	c.1573A>T	c.(1573-1575)Aag>Tag	p.K525*		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	525						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CACTCACACTTGGGATTGATA	0.463																																					p.K525X		.											.	POMT2	91	0			c.A1573T						.						106.0	96.0	99.0					14																	77751296		2203	4300	6503	SO:0001587	stop_gained	29954	exon14			CACACTTGGGATT	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1573A>T	14.37:g.77751296T>A	ENSP00000261534:p.Lys525*	52.0	0.0		126.0	50.0	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Nonsense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.	.	.	.	.	.	.	.	.	.	T	39	7.682920	0.98431	.	.	ENSG00000009830	ENST00000261534	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0609	0.71951	0.0:0.0:0.0:1.0	.	.	.	.	X	525	.	ENSP00000261534:K525X	K	-	1	0	POMT2	76821049	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.628000	0.83189	2.026000	0.59711	0.533000	0.62120	AAG	.		0.463	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
PPP1R32	220004	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	61249803	61249803	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:61249803C>T	ENST00000338608.2	+	3	255	c.130C>T	c.(130-132)Cgt>Tgt	p.R44C	PPP1R32_ENST00000432063.2_Missense_Mutation_p.R44C|RP11-286N22.8_ENST00000543044.1_3'UTR|RP11-286N22.8_ENST00000544880.1_Intron	NM_145017.2	NP_659454.2	Q7Z5V6	PPR32_HUMAN	protein phosphatase 1, regulatory subunit 32	44							phosphatase binding (GO:0019902)										TTTCAAGCCCCGTGTGGGCAG	0.617											OREG0021002	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R44C		.											.	.	.	0			c.C130T						.						59.0	59.0	59.0					11																	61249803		2202	4299	6501	SO:0001583	missense	220004	exon3			AAGCCCCGTGTGG	AK057333	CCDS8008.1, CCDS53641.1	11q12.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000162148	ENSG00000162148		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28869	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 66"""	C11orf66		12477932	Standard	NM_145017		Approved	IIIG9, FLJ32771	uc001nru.2	Q7Z5V6	OTTHUMG00000168176	ENST00000338608.2:c.130C>T	11.37:g.61249803C>T	ENSP00000344140:p.Arg44Cys	31.0	0.0	1052	71.0	22.0	NM_001170753	Q4G0P4|Q96M77	Missense_Mutation	SNP	ENST00000338608.2	37	CCDS8008.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818735	0.50633	.	.	ENSG00000162148	ENST00000432063;ENST00000338608	T;T	0.54071	0.59;1.17	5.04	4.1	0.47936	.	0.670270	0.13266	N	0.400890	T	0.66896	0.2836	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65773	0.911;0.938	T	0.66364	-0.5942	10	0.87932	D	0	-6.7839	12.1234	0.53903	0.1722:0.8278:0.0:0.0	.	44;44	Q7Z5V6-2;Q7Z5V6	.;PPR32_HUMAN	C	44	ENSP00000391560:R44C;ENSP00000344140:R44C	ENSP00000344140:R44C	R	+	1	0	C11orf66	61006379	0.886000	0.30341	0.655000	0.29622	0.241000	0.25554	1.704000	0.37857	1.207000	0.43291	0.655000	0.94253	CGT	.		0.617	PPP1R32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398621.1	NM_145017	
PREB	10113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27355507	27355507	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr2:27355507G>A	ENST00000260643.2	-	5	969	c.716C>T	c.(715-717)aCc>aTc	p.T239I	PREB_ENST00000416802.1_5'Flank|PREB_ENST00000406567.3_Missense_Mutation_p.T239I	NM_013388.4	NP_037520.1	Q9HCU5	PREB_HUMAN	prolactin regulatory element binding	239					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTGGAAAAGGTGGGTCCATT	0.557																																					p.T239I		.											.	PREB	91	0			c.C716T						.						111.0	104.0	106.0					2																	27355507		2203	4300	6503	SO:0001583	missense	10113	exon5			GAAAAGGTGGGTC		CCDS1738.1	2p23	2013-01-10			ENSG00000138073	ENSG00000138073		"""WD repeat domain containing"""	9356	protein-coding gene	gene with protein product		606395				10194769, 12735795	Standard	NM_013388		Approved	SEC12	uc002rix.1	Q9HCU5	OTTHUMG00000097076	ENST00000260643.2:c.716C>T	2.37:g.27355507G>A	ENSP00000260643:p.Thr239Ile	62.0	0.0		191.0	61.0	NM_013388	Q53SZ8|Q9UH94	Missense_Mutation	SNP	ENST00000260643.2	37	CCDS1738.1	.	.	.	.	.	.	.	.	.	.	G	6.445	0.450330	0.12223	.	.	ENSG00000138073	ENST00000260643;ENST00000406567;ENST00000546336	T;T	0.79749	1.6;-1.3	5.76	3.91	0.45181	Quinonprotein alcohol dehydrogenase-like (1);	0.367176	0.32068	N	0.006631	T	0.65831	0.2729	N	0.19112	0.55	0.09310	N	1	B;B	0.23735	0.09;0.09	B;B	0.16289	0.015;0.015	T	0.57335	-0.7829	10	0.52906	T	0.07	-6.3764	9.2763	0.37700	0.0:0.1586:0.6765:0.1649	.	239;239	B5MC98;Q9HCU5	.;PREB_HUMAN	I	239	ENSP00000260643:T239I;ENSP00000384032:T239I	ENSP00000260643:T239I	T	-	2	0	PREB	27209011	0.717000	0.27966	0.950000	0.38849	0.501000	0.33797	0.779000	0.26746	0.739000	0.32628	0.655000	0.94253	ACC	.		0.557	PREB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214195.1	NM_013388	
PREX1	57580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47269916	47269916	+	Missense_Mutation	SNP	G	G	A	rs371398821		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr20:47269916G>A	ENST00000371941.3	-	20	2351	c.2329C>T	c.(2329-2331)Cgg>Tgg	p.R777W	PREX1_ENST00000396220.1_Missense_Mutation_p.R777W	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	777					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TCTTCGCGCCGACTCCGGAAT	0.582																																					p.R777W		.											.	PREX1	231	0			c.C2329T						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	84.0	86.0	85.0		2329	3.0	0.2	20		85	0,8600		0,0,4300	no	missense	PREX1	NM_020820.3	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	777/1660	47269916	1,13005	2203	4300	6503	SO:0001583	missense	57580	exon20			CGCGCCGACTCCG	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2329C>T	20.37:g.47269916G>A	ENSP00000361009:p.Arg777Trp	22.0	0.0		55.0	27.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709441	0.48517	2.27E-4	0.0	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.38560	1.13;1.13	5.12	2.95	0.34219	PDZ/DHR/GLGF (1);	1.252740	0.06178	U	0.678964	T	0.49609	0.1567	L	0.42245	1.32	0.22142	N	0.999336	P;D	0.63046	0.918;0.992	B;P	0.52710	0.368;0.707	T	0.46735	-0.9170	10	0.87932	D	0	.	11.6856	0.51483	0.0:0.0:0.6956:0.3044	.	777;74	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	W	777	ENSP00000361009:R777W;ENSP00000379522:R777W	ENSP00000361009:R777W	R	-	1	2	PREX1	46703323	0.578000	0.26717	0.188000	0.23233	0.355000	0.29361	1.778000	0.38614	2.386000	0.81285	0.462000	0.41574	CGG	.		0.582	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48839799	48839799	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr8:48839799T>C	ENST00000314191.2	-	21	2430	c.2374A>G	c.(2374-2376)Att>Gtt	p.I792V	PRKDC_ENST00000338368.3_Missense_Mutation_p.I792V|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	792					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CAGGGGAGAATGTCTTTGTAA	0.413								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						105.0	95.0	98.0					8																	48839799		1889	4118	6007	SO:0001583	missense	5591	.			GGAGAATGTCTTT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.2374A>G	8.37:g.48839799T>C	ENSP00000313420:p.Ile792Val	58.0	0.0		139.0	59.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	T	11.13	1.548269	0.27652	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.67865	-0.15;-0.29	5.83	4.65	0.58169	Armadillo-type fold (1);	0.243728	0.34507	N	0.003904	T	0.54759	0.1878	.	.	.	0.33805	D	0.627144	B;B;B	0.24258	0.057;0.1;0.034	B;B;B	0.23419	0.046;0.038;0.026	T	0.60747	-0.7202	9	0.44086	T	0.13	.	7.8404	0.29395	0.0:0.0765:0.1398:0.7838	.	792;792;792	P78527-2;E7EUY0;P78527	.;.;PRKDC_HUMAN	V	792	ENSP00000313420:I792V;ENSP00000345182:I792V	ENSP00000313420:I792V	I	-	1	0	PRKDC	49002352	1.000000	0.71417	0.785000	0.31869	0.719000	0.41307	1.398000	0.34554	0.989000	0.38761	0.460000	0.39030	ATT	.		0.413	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PTPRB	5787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	70970186	70970186	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:70970186G>T	ENST00000261266.5	-	9	2193	c.2164C>A	c.(2164-2166)Cac>Aac	p.H722N	PTPRB_ENST00000538708.1_Missense_Mutation_p.H722N|PTPRB_ENST00000451516.2_Missense_Mutation_p.H632N|PTPRB_ENST00000551525.1_Missense_Mutation_p.H939N|PTPRB_ENST00000550857.1_Missense_Mutation_p.H632N|PTPRB_ENST00000334414.6_Missense_Mutation_p.H940N|PTPRB_ENST00000550358.1_Intron	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	722	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTGAAGGAGTGATTTTCATAC	0.517																																					p.H940N		.											.	PTPRB	226	0			c.C2818A						.						63.0	64.0	64.0					12																	70970186		2010	4185	6195	SO:0001583	missense	5787	exon11			AGGAGTGATTTTC	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2164C>A	12.37:g.70970186G>T	ENSP00000261266:p.His722Asn	88.0	0.0		234.0	81.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.280305	0.23392	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T	0.04156	4.2;4.22;4.25;4.22;4.25;3.69;3.73	5.98	4.14	0.48551	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.551006	0.21078	N	0.080530	T	0.10252	0.0251	L	0.60455	1.87	0.29608	N	0.84713	P;P;P;B;P;P	0.47604	0.696;0.696;0.898;0.275;0.696;0.741	P;P;P;B;P;P	0.53809	0.457;0.457;0.735;0.117;0.535;0.593	T	0.02950	-1.1090	10	0.12430	T	0.62	.	10.6081	0.45406	0.2049:0.0:0.7951:0.0	.	632;722;819;939;940;722	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467	.;.;.;.;.;PTPRB_HUMAN	N	940;632;722;632;722;939;819	ENSP00000334928:H940N;ENSP00000393028:H632N;ENSP00000438927:H722N;ENSP00000447302:H632N;ENSP00000261266:H722N;ENSP00000448349:H939N;ENSP00000446982:H819N	ENSP00000261266:H722N	H	-	1	0	PTPRB	69256453	1.000000	0.71417	0.181000	0.23098	0.301000	0.27625	2.579000	0.46059	1.529000	0.49120	0.650000	0.86243	CAC	.		0.517	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PXDNL	137902	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	52321693	52321693	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr8:52321693G>A	ENST00000356297.4	-	17	2591	c.2491C>T	c.(2491-2493)Ccg>Tcg	p.P831S	PXDNL_ENST00000543296.1_Missense_Mutation_p.P831S	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	831					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GAGCTGCACGGCCGCCCATCC	0.667																																					p.P831S		.											.	PXDNL	70	0			c.C2491T						.						16.0	20.0	19.0					8																	52321693		2112	4214	6326	SO:0001583	missense	137902	exon17			TGCACGGCCGCCC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2491C>T	8.37:g.52321693G>A	ENSP00000348645:p.Pro831Ser	25.0	1.0		67.0	35.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	0.653	-0.808697	0.02819	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.72282	-0.64;-0.64	3.56	2.31	0.28768	.	0.293276	0.24412	N	0.038748	T	0.45034	0.1322	N	0.12637	0.245	0.27826	N	0.941625	B	0.14012	0.009	B	0.18263	0.021	T	0.16867	-1.0388	10	0.34782	T	0.22	.	3.0687	0.06222	0.2076:0.2764:0.516:0.0	.	831	A1KZ92	PXDNL_HUMAN	S	831	ENSP00000348645:P831S;ENSP00000444865:P831S	ENSP00000348645:P831S	P	-	1	0	PXDNL	52484246	0.029000	0.19370	0.026000	0.17262	0.004000	0.04260	2.128000	0.42045	1.697000	0.51169	0.650000	0.86243	CCG	.		0.667	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
RALGDS	5900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135984101	135984101	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:135984101G>A	ENST00000372050.3	-	5	758	c.737C>T	c.(736-738)gCc>gTc	p.A246V	RALGDS_ENST00000542690.1_Missense_Mutation_p.A317V|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000372062.3_Missense_Mutation_p.A217V|RALGDS_ENST00000372047.3_Missense_Mutation_p.A234V|RALGDS_ENST00000393157.3_Missense_Mutation_p.A245V|RALGDS_ENST00000393160.3_Missense_Mutation_p.A191V	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	246	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		CTCCAGCTGGGCCAGGAGAAG	0.647			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																p.A246V	Melanoma(189;762 2088 15384 21931 52515)	.		Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	.	RALGDS	722	0			c.C737T						.						65.0	61.0	62.0					9																	135984101		2203	4300	6503	SO:0001583	missense	5900	exon5			AGCTGGGCCAGGA	AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.737C>T	9.37:g.135984101G>A	ENSP00000361120:p.Ala246Val	33.0	0.0		50.0	32.0	NM_006266	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Missense_Mutation	SNP	ENST00000372050.3	37	CCDS6959.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387448	0.82902	.	.	ENSG00000160271	ENST00000372050;ENST00000372047;ENST00000393160;ENST00000372051;ENST00000393157;ENST00000542690;ENST00000372062	T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58	5.67	4.75	0.60458	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	0.175728	0.40302	N	0.001124	T	0.47266	0.1436	L	0.44542	1.39	0.35272	D	0.780525	D;D;D;P;P;P;P;P	0.69078	0.997;0.961;0.986;0.919;0.851;0.919;0.919;0.919	D;P;P;B;B;B;B;B	0.73380	0.98;0.572;0.843;0.253;0.253;0.253;0.253;0.253	T	0.60125	-0.7324	10	0.56958	D	0.05	.	14.8459	0.70259	0.0:0.0:0.8554:0.1446	.	317;217;246;234;191;245;234;246	F5H6M6;E7ER93;Q12967-2;Q8TEK9;Q6KH11;E7ERZ0;Q6PCE1;Q12967	.;.;.;.;.;.;.;GNDS_HUMAN	V	246;234;191;15;245;317;217	ENSP00000361120:A246V;ENSP00000361117:A234V;ENSP00000376867:A191V;ENSP00000376864:A245V;ENSP00000437518:A317V;ENSP00000361132:A217V	ENSP00000361117:A234V	A	-	2	0	RALGDS	134973922	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.409000	0.66374	1.349000	0.45751	0.655000	0.94253	GCC	.		0.647	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054837.1	NM_006266	
RBKS	64080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	28065967	28065967	+	Silent	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr2:28065967A>G	ENST00000302188.3	-	5	1233	c.481T>C	c.(481-483)Ttg>Ctg	p.L161L	RBKS_ENST00000444339.2_Silent_p.L161L	NM_022128.1	NP_071411.1	Q9H477	RBSK_HUMAN	ribokinase	161					D-ribose catabolic process (GO:0019303)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ribokinase activity (GO:0004747)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(172;0.155)					AGGGCTTCCAAAGAAGTTGCT	0.403																																					p.L161L		.											.	RBKS	92	0			c.T481C						.						85.0	85.0	85.0					2																	28065967		2203	4300	6503	SO:0001819	synonymous_variant	64080	exon5			CTTCCAAAGAAGT	BC017425	CCDS1762.1	2p23.3	2008-02-05			ENSG00000171174	ENSG00000171174	2.7.1.15		30325	protein-coding gene	gene with protein product		611132				8382990	Standard	NM_022128		Approved	DKFZp686G13268, RBSK	uc002rlo.1	Q9H477	OTTHUMG00000097833	ENST00000302188.3:c.481T>C	2.37:g.28065967A>G		56.0	0.0		151.0	44.0	NM_022128	A9UK04|B4DV96	Silent	SNP	ENST00000302188.3	37	CCDS1762.1	.	.	.	.	.	.	.	.	.	.	A	9.462	1.093234	0.20471	.	.	ENSG00000171174	ENST00000458185	.	.	.	5.87	-2.38	0.06622	.	.	.	.	.	T	0.58264	0.2110	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58064	-0.7702	4	.	.	.	-10.3574	12.4755	0.55811	0.3923:0.0:0.6077:0.0	.	.	.	.	S	21	.	.	F	-	2	0	RBKS	27919471	1.000000	0.71417	0.993000	0.49108	0.966000	0.64601	0.780000	0.26760	-0.226000	0.09899	-1.003000	0.02500	TTT	.		0.403	RBKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215118.1	NM_022128	
RPS6KA1	6195	ucsc.edu;bcgsc.ca	37	1	26898357	26898357	+	Silent	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:26898357C>T	ENST00000374168.2	+	19	1924	c.1770C>T	c.(1768-1770)ggC>ggT	p.G590G	RPS6KA1_ENST00000530003.1_Silent_p.G574G|RPS6KA1_ENST00000531382.1_Silent_p.G599G|RPS6KA1_ENST00000374166.4_Silent_p.G579G|RPS6KA1_ENST00000374162.2_Silent_p.G498G|RPS6KA1_ENST00000526792.1_Silent_p.G498G	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	590	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGCGCCAGGGCTACGATGAAG	0.632																																					p.G599G		.											.	RPS6KA1	510	0			c.C1797T						.						51.0	45.0	47.0					1																	26898357		2203	4300	6503	SO:0001819	synonymous_variant	6195	exon18			CCAGGGCTACGAT	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1770C>T	1.37:g.26898357C>T		27.0	0.0		44.0	4.0	NM_001006665	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																			.		0.632	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
RGSL1	353299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182443063	182443063	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:182443063G>T	ENST00000294854.8	+	6	837	c.817G>T	c.(817-819)Gat>Tat	p.D273Y	RGSL1_ENST00000542961.1_Missense_Mutation_p.D308Y	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	273					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						TCTCAAGCCAGATGCTATTGG	0.458																																					p.D273Y	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	.											.	RGSL1	226	0			c.G817T						.						124.0	117.0	119.0					1																	182443063		692	1591	2283	SO:0001583	missense	353299	exon6			AAGCCAGATGCTA	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.817G>T	1.37:g.182443063G>T	ENSP00000457748:p.Asp273Tyr	66.0	0.0		200.0	67.0	NM_001137669	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	37	CCDS58049.1																																																																																			.		0.458	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
RPS6KA2	6196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	166944752	166944752	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:166944752G>A	ENST00000265678.4	-	3	489	c.266C>T	c.(265-267)gCc>gTc	p.A89V	RPS6KA2_ENST00000405189.3_5'UTR|RPS6KA2_ENST00000481261.2_5'UTR|Z98049.1_ENST00000598601.1_5'Flank|RPS6KA2_ENST00000366863.2_5'UTR|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.A114V|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.A97V	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	89	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GACCTTCATGGCGTAGAGCTG	0.507																																					p.A97V		.											.	RPS6KA2	1405	0			c.C290T						.						104.0	110.0	108.0					6																	166944752		2203	4300	6503	SO:0001583	missense	6196	exon4			TTCATGGCGTAGA	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.266C>T	6.37:g.166944752G>A	ENSP00000265678:p.Ala89Val	47.0	0.0		108.0	34.0	NM_001006932	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.960598	0.74016	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000507371;ENST00000506565	T;T;T;T;T	0.76186	0.14;0.14;0.14;-1.0;-1.0	4.4	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	M	0.76002	2.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.993	D;D;P	0.75020	0.985;0.974;0.835	D	0.85252	0.1045	10	0.87932	D	0	.	16.0683	0.80903	0.0:0.0:1.0:0.0	.	114;97;89	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	V	89;114;97;73;114	ENSP00000265678:A89V;ENSP00000422435:A114V;ENSP00000427015:A97V;ENSP00000423114:A73V;ENSP00000425148:A114V	ENSP00000265678:A89V	A	-	2	0	RPS6KA2	166864742	1.000000	0.71417	0.951000	0.38953	0.279000	0.26890	8.425000	0.90270	2.440000	0.82611	0.563000	0.77884	GCC	.		0.507	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
RTN1	6252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	60074128	60074128	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:60074128G>T	ENST00000267484.5	-	4	2183	c.1848C>A	c.(1846-1848)acC>acA	p.T616T	RTN1_ENST00000342503.4_Silent_p.T48T|RTN1_ENST00000395090.1_Silent_p.T33T|RTN1_ENST00000557422.1_5'UTR	NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	616	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CGCTGAACTGGGTCAGGGAGA	0.557																																					p.T616T		.											.	RTN1	516	0			c.C1848A						.						71.0	64.0	66.0					14																	60074128		2203	4300	6503	SO:0001819	synonymous_variant	6252	exon4			GAACTGGGTCAGG	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1848C>A	14.37:g.60074128G>T		18.0	0.0		78.0	33.0	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Silent	SNP	ENST00000267484.5	37	CCDS9740.1																																																																																			.		0.557	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
RTN1	6252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	60097163	60097163	+	Intron	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:60097163C>A	ENST00000267484.5	-	4	2101				RTN1_ENST00000342503.4_Splice_Site|RTN1_ENST00000395090.1_Splice_Site|RTN1_ENST00000557422.1_Splice_Site	NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1						neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		AAAGAGAATACCCTGACTTTT	0.582																																					.		.											.	RTN1	516	0			c.61+1G>T						.						138.0	146.0	143.0					14																	60097163		2203	4300	6503	SO:0001627	intron_variant	6252	exon2			AGAATACCCTGAC	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1766-22953G>T	14.37:g.60097163C>A		31.0	0.0		78.0	23.0	NM_206852	Q16800|Q16801|Q5BKZ4|Q9BQ59	Splice_Site	SNP	ENST00000267484.5	37	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673967	0.47781	.	.	ENSG00000139970	ENST00000342503	.	.	.	4.34	3.44	0.39384	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.687	0.56954	0.166:0.834:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RTN1	59166916	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.971000	0.63749	1.012000	0.39366	-0.182000	0.12963	.	.		0.582	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237580423	237580423	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:237580423C>T	ENST00000366574.2	+	11	1165	c.848C>T	c.(847-849)gCg>gTg	p.A283V	RYR2_ENST00000542537.1_Splice_Site_p.A267V|RYR2_ENST00000360064.6_Splice_Site_p.A281V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	283					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTAAGAGTTGCGTAAGTAGAA	0.453																																					p.A283V		.											.	RYR2	158	0			c.C848T						.						113.0	111.0	111.0					1																	237580423		2056	4222	6278	SO:0001630	splice_region_variant	6262	exon11			GAGTTGCGTAAGT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.848+1C>T	1.37:g.237580423C>T		57.0	0.0		177.0	68.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786594	0.49997	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.87571	-2.27;-2.27;-2.27	5.98	5.98	0.97165	MIR (2);	0.090634	0.44097	D	0.000498	T	0.69797	0.3151	N	0.00926	-1.1	0.80722	D	1	B	0.15473	0.013	B	0.12156	0.007	T	0.67385	-0.5684	10	0.41790	T	0.15	.	15.8847	0.79238	0.0:0.8654:0.1346:0.0	.	283	Q92736	RYR2_HUMAN	V	283;281;267	ENSP00000355533:A283V;ENSP00000353174:A281V;ENSP00000443798:A267V	ENSP00000353174:A281V	A	+	2	0	RYR2	235647046	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.252000	0.43196	2.835000	0.97688	0.650000	0.86243	GCG	.		0.453	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	Missense_Mutation
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237972285	237972285	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:237972285A>G	ENST00000366574.2	+	100	14700	c.14383A>G	c.(14383-14385)Aaa>Gaa	p.K4795E	RYR2_ENST00000542537.1_Missense_Mutation_p.K4779E|RYR2_ENST00000360064.6_Missense_Mutation_p.K4801E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4795					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATTCTACAATAAAAGTGAAGA	0.353																																					p.K4795E		.											.	RYR2	158	0			c.A14383G						.						244.0	238.0	240.0					1																	237972285		1845	4084	5929	SO:0001583	missense	6262	exon100			TACAATAAAAGTG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14383A>G	1.37:g.237972285A>G	ENSP00000355533:p.Lys4795Glu	101.0	0.0		308.0	133.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323155	0.81580	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000536033	D;D;D	0.92397	-3.03;-3.03;-3.03	4.88	4.88	0.63580	Ion transport (1);	0.000000	0.64402	U	0.000016	D	0.93475	0.7918	L	0.37630	1.12	0.54753	D	0.999983	P;D	0.69078	0.904;0.997	P;D	0.77004	0.615;0.989	D	0.93994	0.7269	10	0.56958	D	0.05	.	14.7797	0.69756	1.0:0.0:0.0:0.0	.	228;4795	F5H3C7;Q92736	.;RYR2_HUMAN	E	4795;4801;4779;228	ENSP00000355533:K4795E;ENSP00000353174:K4801E;ENSP00000443798:K4779E	ENSP00000353174:K4801E	K	+	1	0	RYR2	236038908	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.287000	0.95975	1.953000	0.56701	0.460000	0.39030	AAA	.		0.353	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SCML1	6322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	17768332	17768332	+	Missense_Mutation	SNP	G	G	T	rs199560760		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:17768332G>T	ENST00000380041.3	+	6	950	c.622G>T	c.(622-624)Ggg>Tgg	p.G208W	SCML1_ENST00000380043.3_Missense_Mutation_p.G181W|SCML1_ENST00000380045.3_Missense_Mutation_p.G87W|SCML1_ENST00000398080.1_Missense_Mutation_p.G87W	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	208					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					TTCTTCTTCAGGGCTCTGCCT	0.537																																					p.G208W		.											.	SCML1	290	0			c.G622T						.						115.0	90.0	98.0					X																	17768332		2203	4300	6503	SO:0001583	missense	6322	exon6			TCTTCAGGGCTCT		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.622G>T	X.37:g.17768332G>T	ENSP00000369380:p.Gly208Trp	77.0	0.0		173.0	58.0	NM_001037540	B0FZN6|B2RA08|Q5H968|Q5H969	Missense_Mutation	SNP	ENST00000380041.3	37	CCDS35210.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.261749	0.23051	.	.	ENSG00000047634	ENST00000380045;ENST00000380041;ENST00000380043;ENST00000398080	.	.	.	3.03	-6.07	0.02158	.	1.937890	0.02845	N	0.128439	T	0.19886	0.0478	N	0.08118	0	0.09310	N	1	D;P	0.54047	0.964;0.939	P;B	0.49387	0.609;0.405	T	0.28138	-1.0053	9	0.40728	T	0.16	-0.0138	6.1285	0.20192	0.2717:0.3744:0.3539:0.0	.	181;208	Q9UN30-2;Q9UN30	.;SCML1_HUMAN	W	87;208;181;87	.	ENSP00000369380:G208W	G	+	1	0	SCML1	17678253	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.683000	0.00199	-2.254000	0.00697	-1.028000	0.02416	GGG	G|1.000;A|0.000		0.537	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	NM_006746	
SEC22B	9554	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	145109670	145109670	+	RNA	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:145109670C>A	ENST00000453618.1	+	0	659							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CGACCCTATTCCTTTATTGAA	0.403																																					.		.											.	.	.	0			.						.						600.0	596.0	597.0					1																	145109670		1970	4153	6123			9554	.			CCTATTCCTTTAT	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109670C>A		146.0	0.0		887.0	65.0	.	A8K1G0	RNA	SNP	ENST00000453618.1	37																																																																																				.		0.403	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892	
SEZ6L	23544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26706636	26706636	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr22:26706636G>A	ENST00000248933.6	+	7	1610	c.1515G>A	c.(1513-1515)agG>agA	p.R505R	SEZ6L_ENST00000403121.1_Splice_Site_p.R278R|SEZ6L_ENST00000343706.4_Splice_Site_p.R505R|SEZ6L_ENST00000529632.2_Splice_Site_p.R505R|SEZ6L_ENST00000360929.3_Splice_Site_p.R505R|SEZ6L_ENST00000404234.3_Splice_Site_p.R505R|SEZ6L_ENST00000402979.1_Splice_Site_p.R278R			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	505	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCACTGCCAGGATGACGGTTC	0.562																																					p.R505R		.											.	SEZ6L	95	0			c.G1515A						.						129.0	100.0	110.0					22																	26706636		2203	4300	6503	SO:0001630	splice_region_variant	23544	exon7			TGCCAGGATGACG	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1515-1G>A	22.37:g.26706636G>A		44.0	0.0		102.0	36.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	37	CCDS13833.1																																																																																			.		0.562	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		Silent
SGCZ	137868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	13965672	13965672	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr8:13965672C>T	ENST00000382080.1	-	6	1335	c.620G>A	c.(619-621)aGg>aAg	p.R207K	SGCZ_ENST00000421524.2_Splice_Site_p.R160K	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	194					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		AAGCCCTTACCTGAGATCTTG	0.448																																					p.R207K		.											.	SGCZ	93	0			c.G620A						.						98.0	87.0	91.0					8																	13965672		2203	4300	6503	SO:0001630	splice_region_variant	137868	exon6			CCTTACCTGAGAT	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.620+1G>A	8.37:g.13965672C>T		76.0	0.0		178.0	64.0	NM_139167	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	C	10.95	1.497027	0.26861	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.94613	-3.47;-3.47	5.39	3.11	0.35812	.	0.178901	0.64402	N	0.000015	D	0.85115	0.5623	N	0.12853	0.265	0.42529	D	0.993038	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.77405	-0.2600	9	.	.	.	.	7.5185	0.27614	0.0:0.7315:0.0:0.2685	.	160;207	Q08AT0;Q96LD1-2	.;.	K	207;160	ENSP00000371512:R207K;ENSP00000405224:R160K	.	R	-	2	0	SGCZ	14010043	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	1.534000	0.36051	1.337000	0.45525	0.655000	0.94253	AGG	.		0.448	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	Missense_Mutation
SIL1	64374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	138287486	138287486	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:138287486T>C	ENST00000394817.2	-	8	994	c.855A>G	c.(853-855)gcA>gcG	p.A285A	SIL1_ENST00000265195.5_Silent_p.A285A|SIL1_ENST00000509534.1_Silent_p.A292A|SIL1_ENST00000515008.1_5'UTR	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor	285					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCTTCTTCTTTGCAGTGAGCG	0.612									Marinesco-Sjgren syndrome																												p.A285A		.											.	SIL1	90	0			c.A855G						.						126.0	106.0	113.0					5																	138287486		2203	4300	6503	SO:0001819	synonymous_variant	64374	exon9	Familial Cancer Database	Marinesco-Sjogren syndrome	CTTCTTTGCAGTG	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.855A>G	5.37:g.138287486T>C		17.0	0.0		64.0	22.0	NM_001037633	D3DQC2|Q8N2L3	Silent	SNP	ENST00000394817.2	37	CCDS4209.1																																																																																			.		0.612	SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251319.1	NM_022464	
SIRT4	23409	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	120741415	120741415	+	Silent	SNP	C	C	T	rs199859894		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr12:120741415C>T	ENST00000202967.4	+	2	110	c.51C>T	c.(49-51)atC>atT	p.I17I		NM_012240.2	NP_036372.1			sirtuin 4											haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCGTTGGATCGCAAACCCCA	0.483																																					p.I17I		.											.	SIRT4	226	0			c.C51T						.						94.0	98.0	97.0					12																	120741415		2203	4300	6503	SO:0001819	synonymous_variant	23409	exon2			TTGGATCGCAAAC	AF083109	CCDS9194.1	12q24.31	2010-06-25	2010-06-25		ENSG00000089163	ENSG00000089163			14932	protein-coding gene	gene with protein product		604482	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 4"", ""sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae)"""			10381378	Standard	NM_012240		Approved	SIR2L4	uc001tyc.3	Q9Y6E7	OTTHUMG00000169028	ENST00000202967.4:c.51C>T	12.37:g.120741415C>T		40.0	0.0		86.0	25.0	NM_012240		Silent	SNP	ENST00000202967.4	37	CCDS9194.1																																																																																			.		0.483	SIRT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402003.1	NM_012240	
SLC27A2	11001	broad.mit.edu;bcgsc.ca	37	15	50518239	50518239	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr15:50518239C>T	ENST00000267842.5	+	6	1454	c.1222C>T	c.(1222-1224)Cgt>Tgt	p.R408C	SLC27A2_ENST00000380902.4_Missense_Mutation_p.R355C|SLC27A2_ENST00000544960.1_Missense_Mutation_p.R173C	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	408					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		TGAACCTGTCCGTGATGAAAA	0.328																																					p.R408C		.											.	SLC27A2	92	0			c.C1222T						.						96.0	91.0	93.0					15																	50518239		2196	4295	6491	SO:0001583	missense	11001	exon6			CCTGTCCGTGATG	D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1222C>T	15.37:g.50518239C>T	ENSP00000267842:p.Arg408Cys	75.0	0.0		197.0	8.0	NM_003645	A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	ENST00000267842.5	37	CCDS10133.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.732567	0.69189	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;D	0.86097	-0.17;-0.12;-2.07	5.53	5.53	0.82687	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.94991	0.8379	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95944	0.8949	10	0.87932	D	0	.	11.9874	0.53155	0.1729:0.827:0.0:0.0	.	355;408	Q6PF09;O14975	.;S27A2_HUMAN	C	355;408;173	ENSP00000370289:R355C;ENSP00000267842:R408C;ENSP00000444549:R173C	ENSP00000267842:R408C	R	+	1	0	SLC27A2	48305531	0.927000	0.31430	0.837000	0.33122	0.845000	0.48019	0.779000	0.26746	2.593000	0.87608	0.655000	0.94253	CGT	.		0.328	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254539.2	NM_003645	
SLC27A6	28965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	128368891	128368891	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:128368891C>A	ENST00000262462.4	+	10	2786	c.1776C>A	c.(1774-1776)taC>taA	p.Y592*	SLC27A6_ENST00000395266.1_Nonsense_Mutation_p.Y592*|SLC27A6_ENST00000506176.1_Nonsense_Mutation_p.Y592*			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	592					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		AACCACTTTACTTCATGGATA	0.318																																					p.Y592X		.											.	SLC27A6	90	0			c.C1776A						.						63.0	62.0	62.0					5																	128368891		2201	4295	6496	SO:0001587	stop_gained	28965	exon10			ACTTTACTTCATG	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1776C>A	5.37:g.128368891C>A	ENSP00000262462:p.Tyr592*	123.0	0.0		422.0	160.0	NM_001017372	Q6IAM5|Q7Z6E6|Q86YF6	Nonsense_Mutation	SNP	ENST00000262462.4	37	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	C	38	7.270356	0.98179	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	.	.	.	3.95	3.04	0.35103	.	0.220594	0.39909	N	0.001224	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.8007	4.8991	0.13766	0.0:0.5993:0.0:0.4007	.	.	.	.	X	592	.	.	Y	+	3	2	SLC27A6	128396790	0.988000	0.35896	1.000000	0.80357	0.947000	0.59692	0.159000	0.16442	1.193000	0.43086	0.585000	0.79938	TAC	.		0.318	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031	
SMC5	23137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	72879327	72879327	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr9:72879327C>G	ENST00000361138.5	+	2	351	c.293C>G	c.(292-294)gCt>gGt	p.A98G		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	98					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						CTTGGTTTAGCTGGAAAACCT	0.378																																					p.A98G		.											.	SMC5	229	0			c.C293G						.						155.0	148.0	151.0					9																	72879327		2203	4300	6503	SO:0001583	missense	23137	exon2			GTTTAGCTGGAAA	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.293C>G	9.37:g.72879327C>G	ENSP00000354957:p.Ala98Gly	92.0	0.0		331.0	155.0	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044858	0.55110	.	.	ENSG00000198887	ENST00000361138	T	0.49139	0.79	5.77	4.82	0.62117	RecF/RecN/SMC (1);	0.051736	0.85682	D	0.000000	T	0.26955	0.0660	N	0.10837	0.055	0.80722	D	1	P	0.49447	0.924	B	0.41764	0.366	T	0.16748	-1.0392	10	0.02654	T	1	-21.2983	16.2955	0.82768	0.0:0.8676:0.1324:0.0	.	98	Q8IY18	SMC5_HUMAN	G	98	ENSP00000354957:A98G	ENSP00000354957:A98G	A	+	2	0	SMC5	72069147	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.475000	0.60210	2.885000	0.99019	0.655000	0.94253	GCT	.		0.378	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
SMR3A	26952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71232505	71232505	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:71232505C>A	ENST00000226460.4	+	3	295	c.199C>A	c.(199-201)Ctt>Att	p.L67I		NM_012390.3	NP_036522.3	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3A	67	Pro-rich.					extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)	15		all_hematologic(202;0.196)				TCCACCACCCCTTTCTCCACC	0.552																																					p.L67I		.											.	SMR3A	90	0			c.C199A						.						158.0	147.0	151.0					4																	71232505		2203	4300	6503	SO:0001583	missense	26952	exon3			CCACCCCTTTCTC	D89501	CCDS34000.1	4q13.3	2009-04-17	2008-02-27	2005-02-07	ENSG00000109208	ENSG00000109208			19216	protein-coding gene	gene with protein product			"""proline rich 5 (salivary)"", ""submaxillary gland androgen regulated protein 3 homolog A (mouse)"""	PROL5		9354371, 17512016	Standard	NM_012390		Approved	PBI, PRL5	uc003hfg.1	Q99954	OTTHUMG00000160839	ENST00000226460.4:c.199C>A	4.37:g.71232505C>A	ENSP00000226460:p.Leu67Ile	105.0	0.0		307.0	119.0	NM_012390		Missense_Mutation	SNP	ENST00000226460.4	37	CCDS34000.1	.	.	.	.	.	.	.	.	.	.	C	4.157	0.027601	0.08054	.	.	ENSG00000109208	ENST00000226460	T	0.29917	1.55	2.58	1.69	0.24217	.	.	.	.	.	T	0.13628	0.0330	N	0.08118	0	0.09310	N	1	B	0.29716	0.255	B	0.26416	0.069	T	0.25152	-1.0140	9	0.25106	T	0.35	.	7.2636	0.26217	0.0:0.7239:0.2761:0.0	.	67	Q99954	SMR3A_HUMAN	I	67	ENSP00000226460:L67I	ENSP00000226460:L67I	L	+	1	0	SMR3A	71267094	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.341000	0.19909	0.634000	0.30469	0.313000	0.20887	CTT	.		0.552	SMR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362574.1	NM_012390	
SORBS2	8470	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	186533094	186533094	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr4:186533094C>T	ENST00000284776.7	-	18	3433	c.2924G>A	c.(2923-2925)tGg>tAg	p.W975*	SORBS2_ENST00000449407.2_Nonsense_Mutation_p.W519*|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000437304.2_Nonsense_Mutation_p.W699*|SORBS2_ENST00000448662.2_Nonsense_Mutation_p.W536*|SORBS2_ENST00000393528.3_Nonsense_Mutation_p.W541*|SORBS2_ENST00000431808.1_Nonsense_Mutation_p.W975*|SORBS2_ENST00000319471.9_Nonsense_Mutation_p.W606*|SORBS2_ENST00000355634.5_Nonsense_Mutation_p.W1075*|SORBS2_ENST00000418609.1_Nonsense_Mutation_p.W879*	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	975	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ACCTTCATACCAGTTTTGATC	0.368																																					p.W1075X	Esophageal Squamous(153;41 2433 9491 36028)	.											.	SORBS2	91	0			c.G3224A						.						162.0	148.0	152.0					4																	186533094		2203	4300	6503	SO:0001587	stop_gained	8470	exon21			TCATACCAGTTTT		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.2924G>A	4.37:g.186533094C>T	ENSP00000284776:p.Trp975*	113.0	0.0		351.0	22.0	NM_001270771	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Nonsense_Mutation	SNP	ENST00000284776.7	37	CCDS3845.1	.	.	.	.	.	.	.	.	.	.	C	46	12.545387	0.99676	.	.	ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.2526	19.0851	0.93200	0.0:1.0:0.0:0.0	.	.	.	.	X	975;536;975;879;699;606;519;1075;541;566	.	ENSP00000284776:W975X	W	-	2	0	SORBS2	186770088	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.736000	0.93811	0.591000	0.81541	TGG	.		0.368	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
SPTY2D1	144108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18638422	18638422	+	Splice_Site	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:18638422C>G	ENST00000336349.5	-	2	410	c.175G>C	c.(175-177)Gcc>Ccc	p.A59P	SPTY2D1_ENST00000543776.1_5'UTR	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	59										breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						AGATACATACCTTTTCGTCTC	0.398																																					p.A59P		.											.	SPTY2D1	90	0			c.G175C						.						144.0	132.0	136.0					11																	18638422		2198	4293	6491	SO:0001630	splice_region_variant	144108	exon2			ACATACCTTTTCG	BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.175+1G>C	11.37:g.18638422C>G		103.0	0.0		255.0	107.0	NM_194285	Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Missense_Mutation	SNP	ENST00000336349.5	37	CCDS31441.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085053	0.76642	.	.	ENSG00000179119	ENST00000336349;ENST00000333429	T	0.26373	1.74	5.54	3.47	0.39725	.	0.127779	0.52532	D	0.000072	T	0.29976	0.0750	M	0.66939	2.045	0.43000	D	0.994511	P	0.43169	0.8	B	0.41860	0.368	T	0.05162	-1.0902	9	.	.	.	-1.5863	13.0466	0.58931	0.0:0.8895:0.0:0.1105	.	59	Q68D10	SPT2_HUMAN	P	59	ENSP00000337991:A59P	.	A	-	1	0	SPTY2D1	18594998	1.000000	0.71417	0.997000	0.53966	0.799000	0.45148	1.843000	0.39259	0.565000	0.29255	0.655000	0.94253	GCC	.		0.398	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395941.1	NM_194285	Missense_Mutation
SPATA19	219938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	133714431	133714431	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr11:133714431G>T	ENST00000299140.3	-	3	294	c.240C>A	c.(238-240)ggC>ggA	p.G80G	SPATA19_ENST00000532889.1_Silent_p.G80G	NM_174927.1	NP_777587.1	Q7Z5L4	SPT19_HUMAN	spermatogenesis associated 19	80					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	mitochondrial outer membrane (GO:0005741)				cervix(1)|endometrium(2)|large_intestine(2)|lung(5)|prostate(1)	11	all_hematologic(175;0.127)	all_cancers(12;5.59e-17)|all_epithelial(12;2.65e-12)|all_lung(97;0.00045)|Lung NSC(97;0.000861)|Breast(109;0.000873)|Medulloblastoma(222;0.0425)|Esophageal squamous(93;0.0844)|all_neural(223;0.117)		Epithelial(10;4.36e-10)|all cancers(11;7.1e-09)|BRCA - Breast invasive adenocarcinoma(10;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00286)|Lung(977;0.207)		GGATGTCCTGGCCATGGGTGG	0.557																																					p.G80G		.											.	SPATA19	90	0			c.C240A						.						142.0	131.0	135.0					11																	133714431		2201	4297	6498	SO:0001819	synonymous_variant	219938	exon3			GTCCTGGCCATGG	AK098717	CCDS8493.1	11q25	2010-04-23				ENSG00000166118			30614	protein-coding gene	gene with protein product	"""spergen 1"", ""cancer/testis antigen 132"""	609805				12477932	Standard	XM_005271448		Approved	FLJ25851, spergen1, SPAS1, CT132	uc001qgv.1	Q7Z5L4		ENST00000299140.3:c.240C>A	11.37:g.133714431G>T		78.0	0.0		219.0	91.0	NM_174927	Q8N7A9	Silent	SNP	ENST00000299140.3	37	CCDS8493.1																																																																																			.		0.557	SPATA19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393281.1	NM_174927	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30750324	30750324	+	Missense_Mutation	SNP	C	C	T	rs369907818		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:30750324C>T	ENST00000262518.4	+	34	9348	c.8963C>T	c.(8962-8964)aCt>aTt	p.T2988I	SRCAP_ENST00000395059.2_Missense_Mutation_p.T2926I|SRCAP_ENST00000344771.4_Missense_Mutation_p.T2830I|RP11-2C24.4_ENST00000483578.1_lincRNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2988	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCCACTGCTACTGTTGCCAAC	0.597																																					p.T2988I		.											.	SRCAP	94	0			c.C8963T						.	C	ILE/THR	0,4394		0,0,2197	155.0	113.0	127.0		8963	4.2	1.0	16		127	1,8599	1.2+/-3.3	0,1,4299	no	missense	SRCAP	NM_006662.2	89	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	benign	2988/3231	30750324	1,12993	2197	4300	6497	SO:0001583	missense	10847	exon34			CTGCTACTGTTGC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.8963C>T	16.37:g.30750324C>T	ENSP00000262518:p.Thr2988Ile	40.0	0.0		91.0	35.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	6.871	0.530105	0.13127	0.0	1.16E-4	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91237	-2.79;-2.81;-2.8	5.18	4.22	0.49857	.	0.531483	0.15849	N	0.241628	T	0.80660	0.4665	N	0.08118	0	0.25338	N	0.98897	B;B	0.25609	0.13;0.023	B;B	0.21360	0.034;0.015	T	0.72984	-0.4125	10	0.54805	T	0.06	-0.6423	11.9673	0.53042	0.0:0.8259:0.174:0.0	.	2926;2988	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	I	2988;2926;2830	ENSP00000262518:T2988I;ENSP00000378499:T2926I;ENSP00000343042:T2830I	ENSP00000262518:T2988I	T	+	2	0	SRCAP	30657825	0.968000	0.33430	0.994000	0.49952	0.943000	0.58893	2.014000	0.40951	1.536000	0.49237	0.655000	0.94253	ACT	.		0.597	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SRSF1	6426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56083127	56083127	+	Intron	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:56083127T>C	ENST00000258962.4	-	3	761				RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000582730.2_Missense_Mutation_p.N196S|SRSF1_ENST00000585096.1_Intron|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000584773.1_Intron	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1						cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGTATCCAATTCTGGTCAAA	0.368																																					p.N196S		.											.	SRSF1	290	0			c.A587G						.						95.0	85.0	88.0					17																	56083127		2203	4300	6503	SO:0001627	intron_variant	6426	exon3			ATCCAATTCTGGT		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.552+34A>G	17.37:g.56083127T>C		58.0	0.0		117.0	39.0	NM_001078166	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	ENST00000258962.4	37	CCDS11600.1																																																																																			.		0.368	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
SSR2	6746	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155988138	155988138	+	Silent	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:155988138T>C	ENST00000295702.4	-	3	248	c.177A>G	c.(175-177)ctA>ctG	p.L59L	SSR2_ENST00000496742.1_Intron|SSR2_ENST00000480567.1_Silent_p.L59L|SSR2_ENST00000529008.1_Silent_p.L59L	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	59					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AATCATCAGATAGTTCCACGT	0.468																																					p.L59L		.											.	SSR2	90	0			c.A177G						.						108.0	100.0	103.0					1																	155988138		2203	4300	6503	SO:0001819	synonymous_variant	6746	exon3			ATCAGATAGTTCC	BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.177A>G	1.37:g.155988138T>C		30.0	0.0		94.0	33.0	NM_003145	B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Silent	SNP	ENST00000295702.4	37	CCDS1126.1																																																																																			.		0.468	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046172.2	NM_003145	
SUCO	51430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	172557990	172557990	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:172557990G>C	ENST00000263688.3	+	18	1968	c.1749G>C	c.(1747-1749)gaG>gaC	p.E583D	SUCO_ENST00000608151.1_Missense_Mutation_p.E735D|SUCO_ENST00000610051.1_Missense_Mutation_p.E546D|SUCO_ENST00000367723.4_Missense_Mutation_p.E734D	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	583					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											TAGTTCAAGAGGAGGAAGAGG	0.453																																					p.E583D		.											.	.	.	0			c.G1749C						.						75.0	65.0	68.0					1																	172557990		2203	4300	6503	SO:0001583	missense	51430	exon18			TCAAGAGGAGGAA	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1749G>C	1.37:g.172557990G>C	ENSP00000263688:p.Glu583Asp	69.0	0.0		262.0	75.0	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	G	12.82	2.052312	0.36181	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.44	1.97	0.26223	.	0.146153	0.64402	D	0.000013	T	0.29817	0.0745	L	0.58669	1.825	0.44570	D	0.997538	B;B;B;B	0.27068	0.024;0.167;0.167;0.167	B;B;B;B	0.25987	0.012;0.038;0.065;0.038	T	0.11084	-1.0602	9	0.34782	T	0.22	-13.8134	5.2296	0.15414	0.3303:0.1513:0.5183:0.0	.	546;583;735;583	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	D	735;583	.	ENSP00000263688:E583D	E	+	3	2	C1orf9	170824613	0.995000	0.38212	1.000000	0.80357	0.991000	0.79684	0.192000	0.17096	0.586000	0.29626	0.557000	0.71058	GAG	.		0.453	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
SUGT1	10910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	53254291	53254291	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr13:53254291G>T	ENST00000343788.6	+	13	1078		c.e13+1		SUGT1_ENST00000310528.8_Splice_Site|SUGT1_ENST00000535397.1_Splice_Site	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)						innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		CAAATCCTTTGTAAGAATATA	0.333																																					.		.											.	SUGT1	226	0			c.996+1G>T						.						68.0	74.0	72.0					13																	53254291		2203	4300	6503	SO:0001630	splice_region_variant	10910	exon13			TCCTTTGTAAGAA	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.996+1G>T	13.37:g.53254291G>T		76.0	0.0		142.0	44.0	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Splice_Site	SNP	ENST00000343788.6	37	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253380	0.80135	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.149	0.93481	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SUGT1	52152292	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	9.420000	0.97426	2.592000	0.87571	0.467000	0.42956	.	.		0.333	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		Intron
TACC2	10579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123846536	123846536	+	Silent	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr10:123846536G>T	ENST00000369005.1	+	4	4861	c.4521G>T	c.(4519-4521)cgG>cgT	p.R1507R	TACC2_ENST00000515603.1_Silent_p.R1507R|TACC2_ENST00000334433.3_Silent_p.R1507R|TACC2_ENST00000453444.2_Silent_p.R1507R|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515273.1_Silent_p.R1507R|TACC2_ENST00000513429.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1507					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCTGGGAGCGGAACTTGCCAG	0.627																																					p.R1507R		.											.	TACC2	296	0			c.G4521T						.						46.0	47.0	47.0					10																	123846536		2203	4300	6503	SO:0001819	synonymous_variant	10579	exon4			GGAGCGGAACTTG	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.4521G>T	10.37:g.123846536G>T		27.0	0.0		53.0	17.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	CCDS7626.1																																																																																			.		0.627	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
TBC1D4	9882	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	76055603	76055603	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr13:76055603C>T	ENST00000377636.3	-	1	647	c.301G>A	c.(301-303)Gcc>Acc	p.A101T	TBC1D4_ENST00000431480.2_Missense_Mutation_p.A101T|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Missense_Mutation_p.A101T	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	101	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		CCCCCCGAGGCCCCAGCGCCC	0.716																																					p.A101T		.											.	TBC1D4	95	0			c.G301A						.						39.0	46.0	44.0					13																	76055603		1962	4147	6109	SO:0001583	missense	9882	exon1			CCGAGGCCCCAGC	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.301G>A	13.37:g.76055603C>T	ENSP00000366863:p.Ala101Thr	26.0	0.0		80.0	39.0	NM_014832	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	37	CCDS41901.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964745	0.34659	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.03152	4.04;4.04;4.03	4.03	4.03	0.46877	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);	1.455410	0.05029	N	0.474285	T	0.02610	0.0079	N	0.08118	0	0.80722	D	1	B;B;B	0.25609	0.001;0.13;0.079	B;B;B	0.18561	0.003;0.022;0.01	T	0.32745	-0.9895	10	0.05833	T	0.94	-2.0177	13.6942	0.62567	0.0:1.0:0.0:0.0	.	101;101;101	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	T	101	ENSP00000366863:A101T;ENSP00000395986:A101T;ENSP00000366852:A101T	ENSP00000366852:A101T	A	-	1	0	TBC1D4	74953604	.	.	0.810000	0.32431	0.720000	0.41350	.	.	2.062000	0.61559	0.462000	0.41574	GCC	.		0.716	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832	
TCF25	22980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89960138	89960138	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:89960138C>G	ENST00000263346.8	+	7	756	c.700C>G	c.(700-702)Ctg>Gtg	p.L234V	TCF25_ENST00000263347.7_5'UTR	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	234					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CCTCCCAGGTCTGTCCATGCG	0.607																																					p.L234V		.											.	TCF25	90	0			c.C700G						.						67.0	62.0	64.0					16																	89960138		2198	4300	6498	SO:0001583	missense	22980	exon7			CCAGGTCTGTCCA	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.700C>G	16.37:g.89960138C>G	ENSP00000263346:p.Leu234Val	30.0	0.0		153.0	42.0	NM_014972	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	37	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414671	0.42817	.	.	ENSG00000141002	ENST00000263346	.	.	.	5.42	2.15	0.27550	.	0.055782	0.64402	D	0.000001	T	0.34803	0.0910	L	0.39898	1.24	0.80722	D	1	B	0.33379	0.41	B	0.25884	0.064	T	0.19289	-1.0310	9	0.66056	D	0.02	.	4.4948	0.11831	0.3378:0.4669:0.0:0.1953	.	234	Q9BQ70	TCF25_HUMAN	V	234	.	ENSP00000263346:L234V	L	+	1	2	TCF25	88487639	1.000000	0.71417	0.973000	0.42090	0.970000	0.65996	3.148000	0.50647	0.659000	0.30945	0.561000	0.74099	CTG	.		0.607	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	
TECTB	6975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	114046139	114046139	+	Missense_Mutation	SNP	A	A	G	rs538658987		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr10:114046139A>G	ENST00000369422.3	+	4	473	c.473A>G	c.(472-474)aAc>aGc	p.N158S		NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	158	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		CTGTCTCTCAACTTCTACACT	0.493																																					p.N158S		.											.	TECTB	90	0			c.A473G						.						133.0	104.0	113.0					10																	114046139		2203	4300	6503	SO:0001583	missense	6975	exon4			CTCTCAACTTCTA	AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.473A>G	10.37:g.114046139A>G	ENSP00000358430:p.Asn158Ser	66.0	0.0		142.0	55.0	NM_058222	Q5VW53	Missense_Mutation	SNP	ENST00000369422.3	37	CCDS7571.1	.	.	.	.	.	.	.	.	.	.	A	15.25	2.776326	0.49786	.	.	ENSG00000119913	ENST00000369422	D	0.81739	-1.53	6.17	5.03	0.67393	Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	D	0.85111	0.5622	L	0.57536	1.79	0.58432	D	0.999997	D	0.71674	0.998	D	0.71656	0.974	T	0.81621	-0.0850	10	0.09084	T	0.74	.	13.7445	0.62868	0.8716:0.1283:0.0:0.0	.	158	Q96PL2	TECTB_HUMAN	S	158	ENSP00000358430:N158S	ENSP00000358430:N158S	N	+	2	0	TECTB	114036129	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	1.137000	0.42214	0.533000	0.62120	AAC	.		0.493	TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1	NM_058222	
TEX35	84066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	178489807	178489807	+	Splice_Site	SNP	G	G	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:178489807G>C	ENST00000319416.2	+	7	453		c.e7-1		TEX35_ENST00000367642.3_3'UTR|TEX35_ENST00000258298.2_Splice_Site|TEX35_ENST00000367643.3_Splice_Site|TEX35_ENST00000367641.3_Splice_Site|TEX35_ENST00000367639.1_Splice_Site	NM_032126.4	NP_115502.2			testis expressed 35																		TCCTCCCCCAGTCCCCTTAGA	0.562																																					.		.											.	.	.	0			c.342-1G>C						.						29.0	31.0	30.0					1																	178489807		2203	4300	6503	SO:0001630	splice_region_variant	84066	exon7			CCCCCAGTCCCCT	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000319416.2:c.342-1G>C	1.37:g.178489807G>C		38.0	0.0		105.0	22.0	NM_001170724		Splice_Site	SNP	ENST00000319416.2	37	CCDS1323.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669926	0.47677	.	.	ENSG00000240021	ENST00000319416;ENST00000258298;ENST00000367643;ENST00000367641;ENST00000367639	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0039	0.53248	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf49	176756430	0.795000	0.28851	0.996000	0.52242	0.413000	0.31143	2.432000	0.44784	2.284000	0.76573	0.536000	0.68110	.	.		0.562	TEX35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084917.1	NM_032126	Intron
TFEC	22797	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	115624439	115624439	+	Silent	SNP	C	C	A	rs34738022	byFrequency	TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:115624439C>A	ENST00000265440.7	-	2	237	c.57G>T	c.(55-57)gtG>gtT	p.V19V	TFEC_ENST00000393485.1_Silent_p.V19V|TFEC_ENST00000320239.7_Silent_p.V19V|TFEC_ENST00000484212.1_Silent_p.V109V	NM_012252.3	NP_036384.1	O14948	TFEC_HUMAN	transcription factor EC	19	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			CACCACTTGGCACTGCAGGTT	0.483																																					p.V19V		.											.	TFEC	153	0			c.G57T						.						187.0	166.0	173.0					7																	115624439		2203	4300	6503	SO:0001819	synonymous_variant	22797	exon2			ACTTGGCACTGCA	D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000265440.7:c.57G>T	7.37:g.115624439C>A		127.0	0.0		393.0	158.0	NM_001018058	B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Silent	SNP	ENST00000265440.7	37	CCDS5762.1																																																																																			C|0.983;T|0.017		0.483	TFEC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000059839.4	NM_012252	
TGIF2LX	90316	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	89177576	89177576	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:89177576G>T	ENST00000561129.2	+	1	622	c.492G>T	c.(490-492)aaG>aaT	p.K164N	TGIF2LX_ENST00000283891.5_Missense_Mutation_p.K164N			Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(29)|ovary(1)|skin(3)|urinary_tract(1)	40						CCTTGCCAAAGGGCCAGATGT	0.592																																					p.K164N		.											.	TGIF2LX	92	0			c.G492T						.						34.0	39.0	37.0					X																	89177576		2203	4296	6499	SO:0001583	missense	90316	exon2			GCCAAAGGGCCAG	AF497480	CCDS14459.1	Xq21.31	2014-05-14	2007-02-07		ENSG00000153779	ENSG00000153779		"""Homeoboxes / TALE class"""	18570	protein-coding gene	gene with protein product		300411	"""TGFB-induced factor 2-like, X-linked"""				Standard	NM_138960		Approved		uc004efe.3	Q8IUE1	OTTHUMG00000021954	ENST00000561129.2:c.492G>T	X.37:g.89177576G>T	ENSP00000453704:p.Lys164Asn	68.0	0.0		165.0	65.0	NM_138960	Q5JRM9|Q8TD48	Missense_Mutation	SNP	ENST00000561129.2	37	CCDS14459.1	.	.	.	.	.	.	.	.	.	.	G	1.707	-0.500112	0.04291	.	.	ENSG00000153779	ENST00000283891	T	0.63744	-0.06	2.8	-1.23	0.09465	.	.	.	.	.	T	0.45895	0.1365	L	0.51422	1.61	0.09310	N	1	P	0.34462	0.454	B	0.23275	0.045	T	0.16571	-1.0398	8	.	.	.	-18.4385	6.378	0.21519	0.5672:0.0:0.4328:0.0	.	164	Q8IUE1	TF2LX_HUMAN	N	164	ENSP00000355119:K164N	.	K	+	3	2	TGIF2LX	89064232	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.146000	0.16180	-0.472000	0.06881	-0.287000	0.09952	AAG	.		0.592	TGIF2LX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417911.2	NM_138960	
THSD7A	221981	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	11464348	11464348	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:11464348C>G	ENST00000423059.4	-	16	3609	c.3358G>C	c.(3358-3360)Gag>Cag	p.E1120Q	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1120	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGCACGCCCTCTCCACAGTTC	0.488										HNSCC(18;0.044)																											p.E1120Q		.											.	THSD7A	71	0			c.G3358C						.						240.0	226.0	231.0					7																	11464348		1984	4170	6154	SO:0001583	missense	221981	exon15			CGCCCTCTCCACA		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3358G>C	7.37:g.11464348C>G	ENSP00000406482:p.Glu1120Gln	57.0	0.0		153.0	14.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000125	0.93227	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.60797	0.16	5.85	5.85	0.93711	.	0.045982	0.85682	D	0.000000	T	0.70002	0.3174	L	0.49778	1.585	0.80722	D	1	D	0.53745	0.962	D	0.65987	0.94	T	0.60459	-0.7259	10	0.15066	T	0.55	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	1120	Q9UPZ6	THS7A_HUMAN	Q	1120	ENSP00000406482:E1120Q	ENSP00000262042:E1120Q	E	-	1	0	THSD7A	11430873	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.247000	0.78257	2.767000	0.95098	0.655000	0.94253	GAG	.		0.488	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578554	7578554	+	Splice_Site	SNP	A	A	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:7578554A>C	ENST00000269305.4	-	5	565	c.376T>G	c.(376-378)Tac>Gac	p.Y126D	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site_p.Y126D|TP53_ENST00000359597.4_Splice_Site_p.Y126D|TP53_ENST00000445888.2_Splice_Site_p.Y126D|TP53_ENST00000413465.2_Splice_Site_p.Y126D|TP53_ENST00000455263.2_Splice_Site_p.Y126D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	126	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y126D(9)|p.0?(8)|p.Y126N(6)|p.Y126_K132delYSPALNK(6)|p.Y126_N131delYSPALN(3)|p.Y33D(2)|p.V73fs*9(1)|p.?(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGGGAGTACTGTAGGAAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y126D	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,+2	TP53	70225	40	Substitution - Missense(17)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(4)|Insertion - In frame(1)|Unknown(1)	central_nervous_system(6)|haematopoietic_and_lymphoid_tissue(6)|upper_aerodigestive_tract(4)|large_intestine(4)|lung(4)|prostate(4)|bone(4)|breast(3)|ovary(2)|stomach(1)|liver(1)|oesophagus(1)	c.T376G	GRCh37	CI004819	TP53	I		.						42.0	43.0	43.0					17																	7578554		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGGAGTACTGTAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1T>G	17.37:g.7578554A>C		17.0	0.0		21.0	14.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443641	0.83993	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90483	3.12	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.971;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-28.2517	13.8301	0.63375	1.0:0.0:0.0:0.0	.	87;126;126;33;126;126;126	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	D	126;126;126;126;126;126;115;33;33;126;126	ENSP00000410739:Y126D;ENSP00000352610:Y126D;ENSP00000269305:Y126D;ENSP00000398846:Y126D;ENSP00000391127:Y126D;ENSP00000391478:Y126D;ENSP00000423862:Y33D;ENSP00000424104:Y126D;ENSP00000426252:Y126D	ENSP00000269305:Y126D	Y	-	1	0	TP53	7519279	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.240000	0.95396	2.206000	0.71126	0.533000	0.62120	TAC	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Missense_Mutation
TRMU	55687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46751486	46751486	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr22:46751486G>A	ENST00000290846.4	+	9	1358		c.e9+1		TRMU_ENST00000381019.3_Splice_Site	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase						tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		ATGGCACTAGGTGACTGACGG	0.637											OREG0026654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	TRMU	23	0			c.1018+1G>A						.						47.0	45.0	45.0					22																	46751486		2203	4300	6503	SO:0001630	splice_region_variant	55687	exon9			CACTAGGTGACTG	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.1018+1G>A	22.37:g.46751486G>A		27.0	0.0	941	53.0	39.0	NM_018006	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Splice_Site	SNP	ENST00000290846.4	37	CCDS14075.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553422	0.86127	.	.	ENSG00000100416	ENST00000290846;ENST00000381019	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7114	0.91658	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRMU	45130150	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.096000	0.94182	2.597000	0.87782	0.563000	0.77884	.	.		0.637	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006	Intron
TTC14	151613	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	180325533	180325533	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:180325533delA	ENST00000296015.4	+	10	1402	c.1270delA	c.(1270-1272)aaafs	p.K424fs	TTC14_ENST00000412756.2_Frame_Shift_Del_p.K424fs|TTC14_ENST00000382584.4_Frame_Shift_Del_p.K424fs	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	424							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGCTTTGCAGAAACTTCATAA	0.308																																					p.K424fs		.											.	TTC14	91	0			c.1270delA						.						70.0	78.0	75.0					3																	180325533		2202	4295	6497	SO:0001589	frameshift_variant	151613	exon10			TTGCAGAAACTTC	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.1270delA	3.37:g.180325533delA	ENSP00000296015:p.Lys424fs	99.0	0.0		241.0	102.0	NM_001042601	G5E9X0|Q6UWJ7|Q8TF22	Frame_Shift_Del	DEL	ENST00000296015.4	37	CCDS3237.1																																																																																			.		0.308	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179475909	179475909	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr2:179475909C>G	ENST00000591111.1	-	220	46248	c.46024G>C	c.(46024-46026)Gtt>Ctt	p.V15342L	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V8043L|TTN_ENST00000460472.2_Missense_Mutation_p.V7918L|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V8110L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V16983L|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V14415L|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15342	Ig-like 97.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGTTGGAACTGGGACAGCT	0.393																																					p.V16983L		.											.	TTN	636	0			c.G50947C						.						107.0	104.0	105.0					2																	179475909		1888	4117	6005	SO:0001583	missense	7273	exon270			TTGGAACTGGGAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46024G>C	2.37:g.179475909C>G	ENSP00000465570:p.Val15342Leu	64.0	0.0		151.0	77.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	9.559	1.118017	0.20877	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.56	3.64	0.41730	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45296	0.1335	N	0.04746	-0.17	0.25892	N	0.983461	B;B;B;B	0.16802	0.019;0.019;0.019;0.019	B;B;B;B	0.22152	0.038;0.038;0.038;0.038	T	0.33240	-0.9876	9	0.87932	D	0	.	8.6238	0.33877	0.223:0.6945:0.0:0.0824	.	7918;8043;8110;15342	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	14415;7918;8110;8043;7918	ENSP00000343764:V14415L;ENSP00000434586:V7918L;ENSP00000340554:V8110L;ENSP00000352154:V8043L	ENSP00000340554:V8110L	V	-	1	0	TTN	179184154	0.905000	0.30787	1.000000	0.80357	0.986000	0.74619	0.430000	0.21428	2.777000	0.95525	0.591000	0.81541	GTT	.		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UNC13D	201294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73836847	73836847	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr17:73836847G>T	ENST00000207549.4	-	8	1058	c.679C>A	c.(679-681)Cgc>Agc	p.R227S	UNC13D_ENST00000412096.2_Missense_Mutation_p.R227S|UNC13D_ENST00000587504.1_5'UTR	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	227					defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACGAACCTGCGAAGCCCATGC	0.597									Familial Hemophagocytic Lymphohistiocytosis																												p.R227S		.											.	UNC13D	92	0			c.C679A						.						139.0	129.0	132.0					17																	73836847		2203	4300	6503	SO:0001583	missense	201294	exon8	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	ACCTGCGAAGCCC	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.679C>A	17.37:g.73836847G>T	ENSP00000207549:p.Arg227Ser	53.0	0.0		251.0	68.0	NM_199242	B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	37	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804067	0.31869	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.70986	-0.51;-0.53	4.49	2.43	0.29744	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.183733	0.33199	N	0.005174	T	0.59224	0.2178	L	0.38175	1.15	0.09310	N	1	D;P	0.56035	0.974;0.945	P;P	0.49999	0.628;0.472	T	0.52094	-0.8621	10	0.07990	T	0.79	.	6.3405	0.21321	0.0936:0.0:0.3916:0.5148	.	227;227	B4DTQ6;Q70J99	.;UN13D_HUMAN	S	227	ENSP00000207549:R227S;ENSP00000388093:R227S	ENSP00000207549:R227S	R	-	1	0	UNC13D	71348442	0.991000	0.36638	0.912000	0.35992	0.433000	0.31745	3.825000	0.55730	0.852000	0.35287	0.551000	0.68910	CGC	.		0.597	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
UNKL	64718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	1420138	1420138	+	Silent	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:1420138G>A	ENST00000389221.4	-	12	1568	c.1569C>T	c.(1567-1569)agC>agT	p.S523S	UNKL_ENST00000248104.7_5'UTR|UNKL_ENST00000397464.1_Silent_p.S25S|UNKL_ENST00000402641.2_Silent_p.S25S|UNKL_ENST00000391893.2_5'Flank|UNKL_ENST00000403703.1_Silent_p.S25S|UNKL_ENST00000508903.2_Silent_p.S526S	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	523	Ser-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				CACCTAGGGGGCTGTAGGATG	0.692																																					p.S526S		.											.	UNKL	90	0			c.C1578T						.						20.0	24.0	23.0					16																	1420138		1812	3419	5231	SO:0001819	synonymous_variant	64718	exon12			TAGGGGGCTGTAG	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1569C>T	16.37:g.1420138G>A		11.0	0.0		33.0	13.0	NM_001193388	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Silent	SNP	ENST00000389221.4	37	CCDS53981.1																																																																																			.		0.692	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
UPP1	7378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	48147819	48147819	+	Silent	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:48147819C>T	ENST00000331803.4	+	10	1421	c.798C>T	c.(796-798)gcC>gcT	p.A266A	UPP1_ENST00000429491.2_Silent_p.A129A|UPP1_ENST00000482015.1_3'UTR|UPP1_ENST00000395564.4_Silent_p.A266A|UPP1_ENST00000341253.4_Silent_p.A266A			Q16831	UPP1_HUMAN	uridine phosphorylase 1	266					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	TTGCAGCGGCCGTGGTGTGTG	0.612																																					p.A266A		.											.	UPP1	514	0			c.C798T						.						93.0	87.0	89.0					7																	48147819		2203	4300	6503	SO:0001819	synonymous_variant	7378	exon9			AGCGGCCGTGGTG	AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.798C>T	7.37:g.48147819C>T		20.0	0.0		58.0	27.0	NM_003364	D3DVM4|Q15362	Silent	SNP	ENST00000331803.4	37	CCDS5507.1																																																																																			.		0.612	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251360.1	NM_003364	
USP48	84196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22016544	22016544	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr1:22016544C>T	ENST00000308271.9	-	24	3580	c.2932G>A	c.(2932-2934)Gat>Aat	p.D978N	USP48_ENST00000529637.1_Missense_Mutation_p.D990N|USP48_ENST00000374732.3_Missense_Mutation_p.D464N|USP48_ENST00000400301.1_Missense_Mutation_p.D926N	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	978	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATCTTTCCATCAATTGACAAA	0.388																																					p.D978N		.											.	USP48	659	0			c.G2932A						.						92.0	90.0	91.0					1																	22016544		2203	4300	6503	SO:0001583	missense	84196	exon24			TTCCATCAATTGA	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2932G>A	1.37:g.22016544C>T	ENSP00000309262:p.Asp978Asn	96.0	0.0		301.0	107.0	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229593	0.58777	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T;T	0.40476	1.03;1.09;1.03;1.09	5.61	5.61	0.85477	Ubiquitin supergroup (1);	0.042619	0.85682	D	0.000000	T	0.37625	0.1010	L	0.45137	1.4	0.80722	D	1	B;B;B;B;B;B	0.14805	0.008;0.0;0.011;0.001;0.001;0.011	B;B;B;B;B;B	0.17433	0.012;0.001;0.018;0.002;0.003;0.018	T	0.16012	-1.0417	10	0.15066	T	0.55	.	18.2065	0.89857	0.0:1.0:0.0:0.0	.	990;978;103;926;978;464	B7ZKS7;B7ZKS3;Q86UV5-6;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;.;UBP48_HUMAN;.	N	926;978;464;990	ENSP00000383157:D926N;ENSP00000309262:D978N;ENSP00000363864:D464N;ENSP00000431949:D990N	ENSP00000309262:D978N	D	-	1	0	USP48	21889131	0.999000	0.42202	1.000000	0.80357	0.978000	0.69477	4.236000	0.58675	2.650000	0.89964	0.655000	0.94253	GAT	.		0.388	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
VGLL1	51442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	135618180	135618180	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chrX:135618180A>G	ENST00000370634.3	+	2	171	c.1A>G	c.(1-3)Atg>Gtg	p.M1V		NM_016267.3	NP_057351.1	Q99990	VGLL1_HUMAN	vestigial-like family member 1	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;0.000127)					TTCACTCACAATGGAAGAAAT	0.488																																					p.M1V		.											.	VGLL1	130	0			c.A1G						.						68.0	68.0	68.0					X																	135618180		2203	4300	6503	SO:0001582	initiator_codon_variant	51442	exon2			CTCACAATGGAAG	AF137387	CCDS14658.1	Xq26.3	2014-03-03	2014-03-03		ENSG00000102243	ENSG00000102243			20985	protein-coding gene	gene with protein product		300583	"""vestigial like 1 (Drosophila)"""			10518497	Standard	NM_016267		Approved	TONDU, TDU	uc004ezy.3	Q99990	OTTHUMG00000022509	ENST00000370634.3:c.1A>G	X.37:g.135618180A>G	ENSP00000359668:p.Met1Val	32.0	0.0		46.0	23.0	NM_016267	Q5H915	Missense_Mutation	SNP	ENST00000370634.3	37	CCDS14658.1	.	.	.	.	.	.	.	.	.	.	A	8.943	0.966361	0.18659	.	.	ENSG00000102243	ENST00000370634	T	0.57907	0.37	4.67	4.67	0.58626	.	0.208500	0.48767	D	0.000171	T	0.70535	0.3235	.	.	.	0.26255	N	0.978669	D	0.63880	0.993	D	0.70935	0.971	T	0.65903	-0.6055	9	0.87932	D	0	-8.7072	13.3802	0.60762	1.0:0.0:0.0:0.0	.	1	Q99990	VGLL1_HUMAN	V	1	ENSP00000359668:M1V	ENSP00000359668:M1V	M	+	1	0	VGLL1	135445846	1.000000	0.71417	0.367000	0.25926	0.054000	0.15201	4.988000	0.63863	1.529000	0.49120	0.486000	0.48141	ATG	.		0.488	VGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058493.1	NM_016267	Missense_Mutation
VRTN	55237	hgsc.bcm.edu;broad.mit.edu	37	14	74824462	74824463	+	Frame_Shift_Ins	INS	-	-	G	rs533419765|rs201579420		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr14:74824462_74824463insG	ENST00000256362.4	+	2	1217_1218	c.976_977insG	c.(976-978)cggfs	p.R326fs		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	326					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)	p.V329fs*25(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						CAGCTTCCACCGGGGGGGCGTC	0.644																																					p.R326fs		.											.	VRTN	155	1	Insertion - Frameshift(1)	ovary(1)	c.976_977insG						.																																			SO:0001589	frameshift_variant	55237	exon2			TTCCACCGGGGGG	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.983dupG	14.37:g.74824469_74824469dupG	ENSP00000256362:p.Arg326fs	20.0	0.0		25.0	9.0	NM_018228	Q9NVC7	Frame_Shift_Ins	INS	ENST00000256362.4	37	CCDS9830.1																																																																																			.		0.644	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
XPO6	23214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28112968	28112968	+	Silent	SNP	C	C	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:28112968C>A	ENST00000304658.5	-	23	3587	c.3087G>T	c.(3085-3087)gtG>gtT	p.V1029V	XPO6_ENST00000565698.1_Silent_p.V1015V	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	1029			V -> L (in dbSNP:rs14672).		protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						CCTGGAGCAGCACGTTCACAA	0.582																																					p.V1029V		.											.	XPO6	227	0			c.G3087T						.						70.0	76.0	74.0					16																	28112968		2086	4222	6308	SO:0001819	synonymous_variant	23214	exon23			GAGCAGCACGTTC	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.3087G>T	16.37:g.28112968C>A		24.0	0.0		40.0	16.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	ENST00000304658.5	37	CCDS42135.1																																																																																			.		0.582	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
ZDHHC3	51304	broad.mit.edu;ucsc.edu	37	3	44968182	44968182	+	Silent	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr3:44968182C>T	ENST00000424952.2	-	7	1167	c.899G>A	c.(898-900)tGa>tAa	p.*300*	ZDHHC3_ENST00000342790.4_Silent_p.*334*|ZDHHC3_ENST00000296127.3_Silent_p.*328*	NM_001135179.1	NP_001128651.1	Q9NYG2	ZDHC3_HUMAN	zinc finger, DHHC-type containing 3	0					protein palmitoylation (GO:0018345)|protein targeting (GO:0006605)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)		CGGGGTCCTTCAGACCACATA	0.542																																					p.X328X		.											.	ZDHHC3	90	0			c.G983A						.						78.0	68.0	71.0					3																	44968182		2203	4300	6503	SO:0001819	synonymous_variant	51304	exon8			GTCCTTCAGACCA	AF247703	CCDS2724.1, CCDS46811.1	3p21.31	2010-02-09			ENSG00000163812	ENSG00000163812		"""Zinc fingers, DHHC-type"""	18470	protein-coding gene	gene with protein product	"""golgi-specific DHHC Zinc Finger Protein"""					19955568	Standard	NM_016598		Approved	ZNF373, GODZ	uc003cod.3	Q9NYG2	OTTHUMG00000133093	ENST00000424952.2:c.899G>A	3.37:g.44968182C>T		63.0	1.0		143.0	54.0	NM_016598	Q53A17|Q96BL0	Silent	SNP	ENST00000424952.2	37	CCDS46811.1																																																																																			.		0.542	ZDHHC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347004.1	NM_016598	
ZFP2	80108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	178358877	178358877	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:178358877G>T	ENST00000361362.2	+	5	1093	c.563G>T	c.(562-564)tGt>tTt	p.C188F	ZFP2_ENST00000520301.1_Missense_Mutation_p.C188F|ZFP2_ENST00000523286.1_Missense_Mutation_p.C188F|ZFP2_ENST00000503510.2_Missense_Mutation_p.C188F	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		CCCTATCAGTGTAAAGAGTGT	0.393																																					p.C188F		.											.	ZFP2	93	0			c.G563T						.						48.0	46.0	47.0					5																	178358877		2203	4300	6503	SO:0001583	missense	80108	exon5			ATCAGTGTAAAGA	AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.563G>T	5.37:g.178358877G>T	ENSP00000354453:p.Cys188Phe	29.0	0.0		52.0	19.0	NM_030613	A5PLN5|B7ZM23|Q9H6Z6	Missense_Mutation	SNP	ENST00000361362.2	37	CCDS4440.1	.	.	.	.	.	.	.	.	.	.	g	18.13	3.554976	0.65425	.	.	ENSG00000198939	ENST00000361362;ENST00000520301;ENST00000523286;ENST00000503510	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	4.7	4.7	0.59300	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34879	N	0.003606	D	0.95066	0.8402	H	0.97611	4.04	0.52099	D	0.999942	D	0.89917	1.0	D	0.97110	1.0	D	0.96623	0.9461	10	0.87932	D	0	-6.0403	15.1771	0.72920	0.0:0.0:1.0:0.0	.	188	Q6ZN57	ZFP2_HUMAN	F	188	ENSP00000354453:C188F;ENSP00000430980:C188F;ENSP00000430531:C188F;ENSP00000438114:C188F	ENSP00000354453:C188F	C	+	2	0	ZFP2	178291483	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.596000	0.82721	2.421000	0.82119	0.585000	0.79938	TGT	.		0.393	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253470.2	NM_030613	
ZNF322	79692	hgsc.bcm.edu;broad.mit.edu	37	6	26637760	26637762	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:26637760_26637762delTTC	ENST00000415922.2	-	4	1665_1667	c.1020_1022delGAA	c.(1018-1023)cagaaa>caa	p.K341del	ZNF322_ENST00000471278.1_In_Frame_Del_p.K341del|ZNF322_ENST00000461899.1_5'Flank|RP11-457M11.2_ENST00000456172.1_RNA	NM_024639.4	NP_078915.2	Q6U7Q0	ZN322_HUMAN	zinc finger protein 322	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGTTCTCATTTTCTGTTGGGCAA	0.419																																					p.340_341del		.											.	.	.	0			c.1020_1022del						.																																			SO:0001651	inframe_deletion	79692	exon5			CTCATTTTCTGTT	AY376736	CCDS4617.1	6p22.1	2013-01-08	2011-07-29	2011-07-29	ENSG00000181315	ENSG00000181315		"""Zinc fingers, C2H2-type"""	23640	protein-coding gene	gene with protein product		610847	"""zinc finger protein 489"", ""HLA complex group 12"", ""zinc finger protein 322A"""	ZNF489, ZNF388, HCG12, ZNF322A		15555580	Standard	NM_024639		Approved	bA457M11.3, bA457M11.2	uc021yny.1	Q6U7Q0	OTTHUMG00000014460	ENST00000415922.2:c.1020_1022delGAA	6.37:g.26637760_26637762delTTC	ENSP00000418897:p.Lys341del	193.0	0.0		2022.0	240.0	NM_001242797	A8K1X3|Q0VDH6|Q6B0G2|Q86W72|Q9H5I9	In_Frame_Del	DEL	ENST00000415922.2	37	CCDS4617.1																																																																																			.		0.419	ZNF322-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040126.2	NM_024639	
ZNF407	55628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	72346946	72346946	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr18:72346946G>A	ENST00000299687.5	+	1	3971	c.3971G>A	c.(3970-3972)gGc>gAc	p.G1324D	ZNF407_ENST00000577538.1_Missense_Mutation_p.G1324D|ZNF407_ENST00000309902.6_Missense_Mutation_p.G1324D|ZNF407_ENST00000582337.1_Missense_Mutation_p.G1324D	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GAGGAGGATGGCCCAGCTTCT	0.393																																					p.G1324D		.											.	ZNF407	92	0			c.G3971A						.						52.0	53.0	53.0					18																	72346946		1899	4120	6019	SO:0001583	missense	55628	exon1			AGGATGGCCCAGC	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.3971G>A	18.37:g.72346946G>A	ENSP00000299687:p.Gly1324Asp	48.0	0.0		104.0	48.0	NM_001146190	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	ENST00000299687.5	37	CCDS45885.1	.	.	.	.	.	.	.	.	.	.	G	8.708	0.911378	0.17833	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.11063	2.81;3.2	5.14	2.28	0.28536	.	0.511871	0.20538	N	0.090377	T	0.07954	0.0199	L	0.34521	1.04	0.22378	N	0.999152	B;B;B	0.27140	0.169;0.169;0.105	B;B;B	0.28553	0.091;0.091;0.042	T	0.31138	-0.9954	10	0.48119	T	0.1	.	5.2563	0.15548	0.0738:0.2793:0.5108:0.1361	.	1324;1324;1324	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	D	1324	ENSP00000299687:G1324D;ENSP00000310359:G1324D	ENSP00000299687:G1324D	G	+	2	0	ZNF407	70475934	0.501000	0.26099	0.098000	0.21074	0.601000	0.36947	1.431000	0.34925	-0.100000	0.12241	0.655000	0.94253	GGC	.		0.393	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu	37	16	88497694	88497695	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:88497694_88497695delAC	ENST00000437464.1	+	2	3732_3733	c.3732_3733delAC	c.(3730-3735)agacatfs	p.H1245fs	ZNF469_ENST00000565624.1_Frame_Shift_Del_p.H1273fs	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1245	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGCCCAGCAGACATGACACCGG	0.668																																					p.1244_1245del		.											.	.	.	0			c.3732_3733del						.																																			SO:0001589	frameshift_variant	84627	exon2			CAGCAGACATGAC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3732_3733delAC	16.37:g.88497694_88497695delAC	ENSP00000402343:p.His1245fs	9.0	0.0		35.0	18.0	NM_001127464		Frame_Shift_Del	DEL	ENST00000437464.1	37	CCDS45544.1																																																																																			.		0.668	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF474	133923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	121487810	121487810	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr5:121487810C>T	ENST00000296600.4	+	2	508	c.125C>T	c.(124-126)tCc>tTc	p.S42F	CTC-441N14.1_ENST00000505209.1_RNA|CTC-441N14.2_ENST00000504829.1_RNA|ZNF474_ENST00000514925.1_Intron	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	42							metal ion binding (GO:0046872)	p.S42F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		TCTAGCCTTTCCCCAGAAACA	0.388																																					p.S42F		.											.	ZNF474	90	1	Substitution - Missense(1)	large_intestine(1)	c.C125T						.						94.0	102.0	99.0					5																	121487810		2203	4300	6503	SO:0001583	missense	133923	exon2			GCCTTTCCCCAGA	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.125C>T	5.37:g.121487810C>T	ENSP00000296600:p.Ser42Phe	90.0	0.0		242.0	111.0	NM_207317	A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	C	3.023	-0.201249	0.06219	.	.	ENSG00000164185	ENST00000296600;ENST00000504912	T	0.48836	0.8	5.58	-4.06	0.03986	.	3.371230	0.01961	U	0.043330	T	0.30541	0.0768	N	0.19112	0.55	0.09310	N	1	B	0.18461	0.028	B	0.13407	0.009	T	0.14172	-1.0482	10	0.29301	T	0.29	4.1434	7.1515	0.25614	0.0:0.4522:0.3502:0.1976	.	42	Q6S9Z5	ZN474_HUMAN	F	42	ENSP00000296600:S42F	ENSP00000296600:S42F	S	+	2	0	ZNF474	121515709	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.680000	0.05197	-0.586000	0.05898	-1.004000	0.02495	TCC	.		0.388	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317	
ZNF490	57474	ucsc.edu;bcgsc.ca	37	19	12692087	12692087	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr19:12692087G>A	ENST00000311437.6	-	5	924	c.802C>T	c.(802-804)Cat>Tat	p.H268Y	CTD-2192J16.20_ENST00000593682.1_5'Flank|ZNF490_ENST00000465656.1_5'Flank	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						TTTTTTTCATGGCGCCGAAGA	0.408																																					p.H268Y		.											.	ZNF490	90	0			c.C802T						.						91.0	89.0	90.0					19																	12692087		2203	4300	6503	SO:0001583	missense	57474	exon5			TTTCATGGCGCCG	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.802C>T	19.37:g.12692087G>A	ENSP00000311521:p.His268Tyr	55.0	0.0		37.0	4.0	NM_020714		Missense_Mutation	SNP	ENST00000311437.6	37	CCDS12272.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592717	0.66219	.	.	ENSG00000188033	ENST00000311437	D	0.86769	-2.17	0.996	0.996	0.19844	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93648	0.7971	M	0.91663	3.23	0.30140	N	0.80403	D	0.89917	1.0	D	0.91635	0.999	D	0.88093	0.2814	9	0.87932	D	0	.	9.5298	0.39187	0.0:0.0:1.0:0.0	.	268	Q9ULM2	ZN490_HUMAN	Y	268	ENSP00000311521:H268Y	ENSP00000311521:H268Y	H	-	1	0	ZNF490	12553087	1.000000	0.71417	0.233000	0.24025	0.421000	0.31385	7.691000	0.84191	0.842000	0.35045	0.491000	0.48974	CAT	.		0.408	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714	
ZNF808	388558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53057994	53057994	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr19:53057994G>T	ENST00000359798.4	+	5	2005	c.1825G>T	c.(1825-1827)Gct>Tct	p.A609S		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	609					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TCAGAAATCAGCTCTTGAGTC	0.398																																					p.A609S		.											.	.	.	0			c.G1825T						.						53.0	57.0	56.0					19																	53057994		2198	4298	6496	SO:0001583	missense	388558	exon5			AAATCAGCTCTTG	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1825G>T	19.37:g.53057994G>T	ENSP00000352846:p.Ala609Ser	39.0	0.0		77.0	30.0	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	37	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.592478	0.00126	.	.	ENSG00000198482	ENST00000359798	T	0.03524	3.9	1.41	-2.83	0.05769	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01454	0.0047	N	0.03209	-0.39	0.09310	N	1	B	0.02656	0.0	B	0.17979	0.02	T	0.37641	-0.9697	9	0.17369	T	0.5	.	2.4606	0.04540	0.2016:0.3472:0.3328:0.1183	.	609	Q8N4W9	ZN808_HUMAN	S	609	ENSP00000352846:A609S	ENSP00000352846:A609S	A	+	1	0	ZNF808	57749806	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.923000	0.28757	-3.625000	0.00130	-2.619000	0.00157	GCT	.		0.398	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF611	81856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53209133	53209133	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr19:53209133T>C	ENST00000319783.1	-	7	1491	c.1175A>G	c.(1174-1176)cAt>cGt	p.H392R	ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000543227.1_Missense_Mutation_p.H392R|ZNF611_ENST00000595798.1_Missense_Mutation_p.H323R|ZNF611_ENST00000540744.1_Missense_Mutation_p.H392R|ZNF611_ENST00000602162.1_Missense_Mutation_p.H323R|ZNF611_ENST00000453741.2_Missense_Mutation_p.H323R	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		CTCTCCAGTATGAATTCTCTT	0.383																																					p.H392R		.											.	ZNF611	91	0			c.A1175G						.						62.0	62.0	62.0					19																	53209133		2203	4300	6503	SO:0001583	missense	81856	exon7			CCAGTATGAATTC	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1175A>G	19.37:g.53209133T>C	ENSP00000322427:p.His392Arg	60.0	0.0		107.0	41.0	NM_030972	B3KRD5|Q69YG9	Missense_Mutation	SNP	ENST00000319783.1	37	CCDS12855.1	.	.	.	.	.	.	.	.	.	.	.	15.95	2.983092	0.53827	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	1.62	1.62	0.23740	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.83482	0.5264	M	0.93594	3.435	0.27689	N	0.946178	D	0.89917	1.0	D	0.79108	0.992	T	0.72323	-0.4328	9	0.87932	D	0	.	8.0771	0.30722	0.0:0.0:0.0:1.0	.	392	Q8N823	ZN611_HUMAN	R	392;392;323;392	ENSP00000437616:H392R;ENSP00000439211:H392R;ENSP00000443505:H323R;ENSP00000322427:H392R	ENSP00000322427:H392R	H	-	2	0	ZNF611	57900945	1.000000	0.71417	0.011000	0.14972	0.164000	0.22412	6.180000	0.71981	0.745000	0.32763	0.163000	0.16589	CAT	.		0.383	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972	
ZSCAN32	54925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3433548	3433548	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr16:3433548T>G	ENST00000396852.4	-	7	1705	c.1398A>C	c.(1396-1398)agA>agC	p.R466S	ZSCAN32_ENST00000396846.3_Missense_Mutation_p.R466S|ZSCAN32_ENST00000304926.3_Missense_Mutation_p.R254S|NAA60_ENST00000576906.1_Intron|ZSCAN32_ENST00000439568.2_Missense_Mutation_p.R177S	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	466					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)										CTGGAGAATTTCTACATTGCC	0.458																																					p.R254S		.											.	.	.	0			c.A762C						.						110.0	103.0	105.0					16																	3433548		2197	4300	6497	SO:0001583	missense	54925	exon6			AGAATTTCTACAT	AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1398A>C	16.37:g.3433548T>G	ENSP00000380061:p.Arg466Ser	112.0	0.0		307.0	121.0	NM_017810	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	ENST00000396852.4	37		.	.	.	.	.	.	.	.	.	.	T	11.90	1.777261	0.31411	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000439568	T;T;T;T	0.08458	3.09;3.16;3.16;3.13	3.45	2.29	0.28610	.	.	.	.	.	T	0.08268	0.0206	L	0.52905	1.665	0.09310	N	1	B;B	0.25486	0.127;0.127	B;B	0.19946	0.014;0.027	T	0.36212	-0.9757	9	0.27082	T	0.32	.	6.4586	0.21944	0.0:0.0:0.2518:0.7482	.	254;466	Q9NX65;Q6WMU8	ZN434_HUMAN;.	S	254;466;466;177	ENSP00000302502:R254S;ENSP00000380061:R466S;ENSP00000380057:R466S;ENSP00000391787:R177S	ENSP00000302502:R254S	R	-	3	2	ZNF434	3373549	0.000000	0.05858	0.001000	0.08648	0.550000	0.35303	0.132000	0.15891	0.230000	0.21059	0.459000	0.35465	AGA	.		0.458	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810	
ZUFSP	221302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu	37	6	116987856	116987857	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:116987856_116987857TC>AA	ENST00000368576.3	-	2	742_743	c.499_500GA>TT	c.(499-501)GAa>TTa	p.E167L	ZUFSP_ENST00000471919.1_5'UTR|ZUFSP_ENST00000368573.1_Missense_Mutation_p.E167L	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	167							metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		TTCCATATCTTCACTGTGCTCC	0.356																																					p.E167V|p.E167X		.											.	ZUFSP	69	0			c.A500T|c.G499T						.																																			SO:0001583	missense	221302	exon2			ATATCTTCACTGT|TATCTTCACTGTG	AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.499_500delinsAA	6.37:g.116987856_116987857delinsAA	ENSP00000357565:p.Glu167Leu	95.0	0.0		284.0|286.0	25.0|26.0	NM_145062	Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000368576.3	37	CCDS5110.1																																																																																			.		0.356	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041961.1	NM_145062	
SIRPA	140885	ucsc.edu;bcgsc.ca	37	20	1896059	1896060	+	Missense_Mutation	DNP	GT	GT	AC	rs114499682|rs386811663|rs115287948	byFrequency	TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr20:1896059_1896060GT>AC	ENST00000358771.4	+	2	546_547	c.394_395GT>AC	c.(394-396)GTg>ACg	p.V132T	SIRPA_ENST00000400068.3_Missense_Mutation_p.V132T|SIRPA_ENST00000356025.3_Missense_Mutation_p.V132T	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	132	Ig-like V-type.		V -> T (requires 2 nucleotide substitutions). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CCCCGATGACGTGGAGTTTAAG	0.53																																					p.V132T	GBM(155;1668 1920 5945 42733 48121)	.											.	.	.	0			.						.																																			SO:0001583	missense	140885	.			GATGACGTGGAGT	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	Exception_encountered	20.37:g.1896059_1896060delinsAC	ENSP00000351621:p.Val132Thr	104.0	0.0		308.0	44.0	.	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	DNP	ENST00000358771.4	37	CCDS13022.1																																																																																			.		0.530	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
COL10A1	1300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	116441243	116441244	+	Missense_Mutation	DNP	GG	GG	TT	rs138831203		TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr6:116441243_116441244GG>TT	ENST00000327673.4	-	2	2442_2443	c.2035_2036CC>AA	c.(2035-2037)CCa>AAa	p.P679K	COL10A1_ENST00000243222.4_Missense_Mutation_p.P679K|AL121963.1_ENST00000430695.1_5'Flank|NT5DC1_ENST00000319550.4_Intron			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	679	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Nonhelical region (NC1).				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TACTCACATTGGAGCCACTAGG	0.455																																					p.P679K		.											.	.	.	0			.						.																																			SO:0001583	missense	1300	.			CACATTGGAGCCA		CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.2035_2036delinsTT	6.37:g.116441243_116441244delinsTT	ENSP00000327368:p.Pro679Lys	38.0	0.0		97.0	43.0	.	A1L4P2	Missense_Mutation	DNP	ENST00000327673.4	37	CCDS5105.1																																																																																			.		0.455	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041926.1		
KLHDC10	23008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	129760678	129760679	+	Nonsense_Mutation	DNP	GT	GT	TA			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:129760678_129760679GT>TA	ENST00000335420.5	+	4	699_700	c.565_566GT>TA	c.(565-567)GTg>TAg	p.V189*		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	189						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						TGTGTGTAATGTGAAGTATAAG	0.475																																					p.V189*		.											.	.	.	0			.						.																																			SO:0001587	stop_gained	23008	.			TGTAATGTGAAGT		CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	Exception_encountered	7.37:g.129760678_129760679delinsTA	ENSP00000334140:p.Val189*	74.0	0.0		326.0	76.0	.	Q86Y99|Q92554	Nonsense_Mutation	DNP	ENST00000335420.5	37	CCDS5815.1																																																																																			.		0.475	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349347.2		
GPNMB	10457	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	23296688	23296689	+	Intron	DNP	GG	GG	TT			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	GG	GG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:23296688_23296689GG>TT	ENST00000381990.2	+	4	702				GPNMB_ENST00000539136.1_Intron|GPNMB_ENST00000258733.4_Intron|GPNMB_ENST00000409458.3_Missense_Mutation_p.W182F|GPNMB_ENST00000453162.2_Intron	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb						bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			ACACTTGGTTGGCTTTTACAAA	0.401																																					p.W182F		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	10457	.			TTGGTTGGCTTTT	X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	Exception_encountered	7.37:g.23296688_23296689delinsTT		114.0	0.0		312.0	173.0	.	A4D155|Q6UVX1|Q8N1A1	Missense_Mutation	DNP	ENST00000381990.2	37	CCDS34610.1																																																																																			.		0.401	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
ARHGEF5	7984	broad.mit.edu;bcgsc.ca	37	7	144070301	144070302	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-DD-A1EB-01A-11D-A12Z-10	TCGA-DD-A1EB-10A-01D-A12Z-10	GC	GC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	90611290-e44c-438e-91aa-f3b83dae3b71	239524f2-0ff6-4bc9-b813-0bb78ff48919	g.chr7:144070301_144070302GC>TT	ENST00000056217.5	+	10	4238_4239	c.4064_4065GC>TT	c.(4063-4065)tGC>tTT	p.C1355F	ARHGEF5_ENST00000471847.2_Missense_Mutation_p.C277F	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	1355	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					ATCCGGGACTGCAATAACAATG	0.51																																					p.C1355F		.											.	.	.	0			.						.																																			SO:0001583	missense	7984	.			GGGACTGCAATAA	U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	Exception_encountered	7.37:g.144070301_144070302delinsTT	ENSP00000056217:p.Cys1355Phe	189.0	0.0		1385.0	222.0	.	A6NNJ2|Q6ZML7	Missense_Mutation	DNP	ENST00000056217.5	37	CCDS34771.1																																																																																			.		0.510	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349981.1	NM_005435	
