#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB6	10058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220079777	220079777	+	Silent	SNP	C	C	A	rs548516506		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:220079777C>A	ENST00000265316.3	-	6	1498	c.1182G>T	c.(1180-1182)acG>acT	p.T394T	ABCB6_ENST00000439002.2_Silent_p.T348T	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	394	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTCGGCCAGCGTGGGGATGA	0.507																																					p.T394T		.											.	ABCB6	153	0			c.G1182T						.						195.0	151.0	166.0					2																	220079777		2203	4300	6503	SO:0001819	synonymous_variant	10058	exon6			GGCCAGCGTGGGG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1182G>T	2.37:g.220079777C>A		110.0	0.0		102.0	22.0	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Silent	SNP	ENST00000265316.3	37	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	C	6.018	0.371776	0.11409	.	.	ENSG00000115657	ENST00000295750	.	.	.	5.44	-7.71	0.01254	.	.	.	.	.	T	0.44477	0.1295	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48703	-0.9012	4	.	.	.	-13.0275	6.026	0.19656	0.0733:0.1189:0.4318:0.376	.	.	.	.	L	242	.	.	R	-	2	0	ABCB6	219788021	0.028000	0.19301	0.630000	0.29268	0.544000	0.35116	-0.928000	0.03980	-1.414000	0.02025	-0.894000	0.02916	CGC	.		0.507	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
ACTL8	81569	ucsc.edu;bcgsc.ca	37	1	18152622	18152622	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:18152622A>G	ENST00000375406.1	+	3	925	c.709A>G	c.(709-711)Acc>Gcc	p.T237A		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	237					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		TGAGAGCAACACCTATCAGCT	0.622											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T237A		.											.	ACTL8	72	0			c.A709G						.						50.0	53.0	52.0					1																	18152622		2203	4300	6503	SO:0001583	missense	81569	exon3			AGCAACACCTATC	AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.709A>G	1.37:g.18152622A>G	ENSP00000364555:p.Thr237Ala	29.0	0.0	723	33.0	4.0	NM_030812	Q13104|Q96M75	Missense_Mutation	SNP	ENST00000375406.1	37	CCDS183.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.398119	0.42512	.	.	ENSG00000117148	ENST00000375406	D	0.94280	-3.39	4.88	-0.534	0.11883	.	1.050500	0.07526	N	0.911335	D	0.88926	0.6570	L	0.46819	1.47	0.09310	N	1	B	0.15473	0.013	B	0.14578	0.011	T	0.76900	-0.2788	10	0.87932	D	0	-10.4512	4.3521	0.11160	0.612:0.0:0.2497:0.1382	.	237	Q9H568	ACTL8_HUMAN	A	237	ENSP00000364555:T237A	ENSP00000364555:T237A	T	+	1	0	ACTL8	18025209	0.001000	0.12720	0.000000	0.03702	0.143000	0.21401	0.300000	0.19156	-0.295000	0.08960	0.533000	0.62120	ACC	.		0.622	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007143.1	NM_030812	
ADAM28	10863	hgsc.bcm.edu;bcgsc.ca	37	8	24193031	24193031	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr8:24193031T>C	ENST00000265769.4	+	14	1554	c.1444T>C	c.(1444-1446)Tct>Cct	p.S482P	ADAM28_ENST00000540823.1_Missense_Mutation_p.S249P|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.S482P|RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.S229P	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	482	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.		S -> F (in a cutaneous metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:21618342}.		spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TAATGGTAAATCTGGTAATTG	0.468																																					p.S482P	NSCLC(193;488 2149 22258 34798 40734)	.											.	ADAM28	228	0			c.T1444C						.						138.0	129.0	132.0					8																	24193031		2203	4300	6503	SO:0001583	missense	10863	exon14			GGTAAATCTGGTA	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1444T>C	8.37:g.24193031T>C	ENSP00000265769:p.Ser482Pro	230.0	0.0		120.0	8.0	NM_014265	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	37	CCDS34865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.97|14.97	2.693711|2.693711	0.48202|0.48202	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000521629|ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	.|T;T;T;T	.|0.15017	.|2.46;2.46;2.46;2.46	5.8|5.8	3.36|3.36	0.38483|0.38483	.|Blood coagulation inhibitor, Disintegrin (6);	.|.	.|.	.|.	.|.	T|T	0.54711|0.54711	0.1875|0.1875	H|H	0.97918|0.97918	4.105|4.105	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;0.999;1.0	T|T	0.63492|0.63492	-0.6625|-0.6625	5|9	.|0.87932	.|D	.|0	.|.	9.6176|9.6176	0.39701|0.39701	0.2791:0.0:0.0:0.7209|0.2791:0.0:0.0:0.7209	.|.	.|249;482;482;482	.|B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2	.|.;.;ADA28_HUMAN;.	T|P	114|482;229;249;482	.|ENSP00000265769:S482P;ENSP00000380770:S229P;ENSP00000443743:S249P;ENSP00000393699:S482P	.|ENSP00000265769:S482P	I|S	+|+	2|1	0|0	ADAM28|ADAM28	24248976|24248976	1.000000|1.000000	0.71417|0.71417	0.777000|0.777000	0.31699|0.31699	0.169000|0.169000	0.22640|0.22640	4.082000|4.082000	0.57635|0.57635	0.421000|0.421000	0.25980|0.25980	0.528000|0.528000	0.53228|0.53228	ATC|TCT	.		0.468	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	
ADIPOR1	51094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202917500	202917500	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:202917500C>A	ENST00000340990.5	-	3	488	c.190G>T	c.(190-192)Gtg>Ttg	p.V64L	ADIPOR1_ENST00000436244.1_Missense_Mutation_p.V64L|ADIPOR1_ENST00000367254.3_Missense_Mutation_p.V64L	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	64					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			AGTACCCGCACCTCCTCCTCT	0.522																																					p.V64L		.											.	ADIPOR1	90	0			c.G190T						.						123.0	104.0	111.0					1																	202917500		2203	4300	6503	SO:0001583	missense	51094	exon3			CCCGCACCTCCTC		CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.190G>T	1.37:g.202917500C>A	ENSP00000341785:p.Val64Leu	112.0	0.0		143.0	79.0	NM_015999	B3KMB0|Q53HS7|Q53YY6|Q9Y360	Missense_Mutation	SNP	ENST00000340990.5	37	CCDS1430.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258016	0.39896	.	.	ENSG00000159346	ENST00000340990;ENST00000436244;ENST00000417068;ENST00000367254;ENST00000426229	D;D;D;D;D	0.96774	-4.12;-4.12;-4.12;-4.12;-4.12	5.85	4.93	0.64822	.	0.322267	0.33496	N	0.004841	D	0.90995	0.7168	N	0.16368	0.405	0.37180	D	0.903461	B	0.02656	0.0	B	0.01281	0.0	D	0.87943	0.2718	10	0.12430	T	0.62	.	15.0724	0.72049	0.1431:0.8569:0.0:0.0	.	64	Q96A54	ADR1_HUMAN	L	64	ENSP00000341785:V64L;ENSP00000395469:V64L;ENSP00000402178:V64L;ENSP00000356223:V64L;ENSP00000392946:V64L	ENSP00000341785:V64L	V	-	1	0	ADIPOR1	201184123	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.364000	0.66110	1.461000	0.47929	-0.182000	0.12963	GTG	.		0.522	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099160.2	NM_015999	
AGBL3	340351	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	134717658	134717659	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:134717658_134717659insT	ENST00000436302.2	+	6	735_736	c.482_483insT	c.(481-486)cctgtgfs	p.V162fs	AGBL3_ENST00000435976.2_Frame_Shift_Ins_p.V162fs|AGBL3_ENST00000458078.1_Frame_Shift_Ins_p.V136fs	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	162						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TTGAAGCAGCCTGTGGATTACC	0.391																																					p.P161fs		.											.	.	.	0			c.482_483insT						.																																			SO:0001589	frameshift_variant	340351	exon6			AGCAGCCTGTGGA	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.483dupT	7.37:g.134717659_134717659dupT	ENSP00000388275:p.Val162fs	193.0	0.0		82.0	42.0	NM_178563	B7Z827|Q9H965	Frame_Shift_Ins	INS	ENST00000436302.2	37	CCDS47718.1																																																																																			.		0.391	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
AGBL3	340351	hgsc.bcm.edu;bcgsc.ca	37	7	134717660	134717660	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:134717660G>A	ENST00000436302.2	+	6	737	c.484G>A	c.(484-486)Gtg>Atg	p.V162M	AGBL3_ENST00000435976.2_Missense_Mutation_p.V162M|AGBL3_ENST00000458078.1_Missense_Mutation_p.V136M	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	162						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						GAAGCAGCCTGTGGATTACCG	0.398																																					p.V162M		.											.	.	.	0			c.G484A						.						143.0	133.0	136.0					7																	134717660		692	1591	2283	SO:0001583	missense	340351	exon6			CAGCCTGTGGATT	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.484G>A	7.37:g.134717660G>A	ENSP00000388275:p.Val162Met	195.0	0.0		82.0	44.0	NM_178563	B7Z827|Q9H965	Missense_Mutation	SNP	ENST00000436302.2	37	CCDS47718.1	.	.	.	.	.	.	.	.	.	.	G	5.466	0.271005	0.10349	.	.	ENSG00000146856	ENST00000436302;ENST00000458078;ENST00000435976	T;T;T	0.43688	0.94;0.94;0.94	5.16	0.0744	0.14395	.	0.175957	0.27535	N	0.018921	T	0.19725	0.0474	N	0.19112	0.55	0.09310	N	1	B	0.21821	0.061	B	0.19666	0.026	T	0.07083	-1.0791	10	0.28530	T	0.3	-1.0515	1.7495	0.02969	0.2426:0.104:0.4553:0.1981	.	162	Q8NEM8-4	.	M	162;136;162	ENSP00000388275:V162M;ENSP00000395969:V136M;ENSP00000401220:V162M	ENSP00000275763:V162M	V	+	1	0	AGBL3	134368200	0.000000	0.05858	0.772000	0.31596	0.366000	0.29705	0.030000	0.13688	0.086000	0.17137	-0.691000	0.03719	GTG	.		0.398	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
AKAP13	11214	ucsc.edu;bcgsc.ca	37	15	86124813	86124813	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:86124813G>T	ENST00000394518.2	+	7	3609	c.3514G>T	c.(3514-3516)Ggt>Tgt	p.G1172C	AKAP13_ENST00000361243.2_Missense_Mutation_p.G1172C|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1172					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CTGTACCATGGGTGACGCTGA	0.552																																					p.G1172C	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13	258	0			c.G3514T						.						89.0	90.0	90.0					15																	86124813		2202	4299	6501	SO:0001583	missense	11214	exon7			ACCATGGGTGACG	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.3514G>T	15.37:g.86124813G>T	ENSP00000378026:p.Gly1172Cys	55.0	0.0		34.0	4.0	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412776	0.42817	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.15718	2.4;2.4	5.05	0.891	0.19224	.	.	.	.	.	T	0.14098	0.0341	N	0.24115	0.695	0.09310	N	1	P;D	0.55385	0.951;0.971	B;P	0.50378	0.436;0.639	T	0.13980	-1.0489	9	0.49607	T	0.09	.	4.0314	0.09711	0.2737:0.0:0.5629:0.1634	.	1172;1172	Q12802;Q12802-2	AKP13_HUMAN;.	C	1172;1172;1171;1171	ENSP00000354718:G1172C;ENSP00000378026:G1172C	ENSP00000354718:G1172C	G	+	1	0	AKAP13	83925817	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.312000	0.19397	0.137000	0.18759	0.650000	0.86243	GGT	.		0.552	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
ALDH8A1	64577	broad.mit.edu;bcgsc.ca	37	6	135265028	135265028	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:135265028A>G	ENST00000265605.2	-	2	283	c.215T>C	c.(214-216)gTc>gCc	p.V72A	ALDH8A1_ENST00000367847.2_Missense_Mutation_p.V72A|RP11-349J5.2_ENST00000416448.2_RNA|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.V72A	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	72					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CTGGTTCAGGACCCGTGAGCG	0.587																																					p.V72A		.											.	ALDH8A1	94	0			c.T215C						.						51.0	54.0	53.0					6																	135265028		2203	4300	6503	SO:0001583	missense	64577	exon2			TTCAGGACCCGTG	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.215T>C	6.37:g.135265028A>G	ENSP00000265605:p.Val72Ala	47.0	1.0		54.0	5.0	NM_022568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	.	.	.	.	.	.	.	.	.	.	a	17.36	3.369196	0.61624	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.77098	-1.07;-1.07;1.51	6.07	6.07	0.98685	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.170924	0.52532	D	0.000078	T	0.58250	0.2109	N	0.13168	0.305	0.53688	D	0.999977	B;B;B	0.22211	0.066;0.053;0.066	B;B;B	0.32928	0.102;0.096;0.155	T	0.63550	-0.6612	10	0.87932	D	0	.	16.6389	0.85066	1.0:0.0:0.0:0.0	.	72;72;72	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	A	72	ENSP00000265605:V72A;ENSP00000356819:V72A;ENSP00000356821:V72A	ENSP00000265605:V72A	V	-	2	0	ALDH8A1	135306721	1.000000	0.71417	0.802000	0.32245	0.347000	0.29111	7.444000	0.80532	2.330000	0.79161	0.478000	0.44815	GTC	.		0.587	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
AMER1	139285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	63410708	63410708	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:63410708C>A	ENST00000330258.3	-	2	2731	c.2459G>T	c.(2458-2460)gGc>gTc	p.G820V	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	820					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TTCACACTTGCCTTCCCCATC	0.502																																					p.G820V		.											.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.G2459T						.						45.0	43.0	43.0					X																	63410708		2200	4296	6496	SO:0001583	missense	139285	exon2			CACTTGCCTTCCC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2459G>T	X.37:g.63410708C>A	ENSP00000329117:p.Gly820Val	56.0	0.0		62.0	58.0	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507616	0.64410	.	.	ENSG00000184675	ENST00000330258	T	0.75367	-0.93	5.0	5.0	0.66597	.	.	.	.	.	T	0.76786	0.4036	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75542	-0.3281	8	.	.	.	0.4471	16.219	0.82244	0.0:1.0:0.0:0.0	.	820	Q5JTC6	F123B_HUMAN	V	820	ENSP00000329117:G820V	.	G	-	2	0	FAM123B	63327433	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.660000	0.74417	2.484000	0.83849	0.529000	0.55759	GGC	.		0.502	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AP3B2	8120	ucsc.edu;bcgsc.ca	37	15	83346874	83346874	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:83346874C>T	ENST00000261722.3	-	11	1435	c.1228G>A	c.(1228-1230)Gtc>Atc	p.V410I	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Missense_Mutation_p.V410I|AP3B2_ENST00000535348.1_Missense_Mutation_p.V378I	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	410					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			TCCCGTAGGACAGTAGGAATG	0.577																																					p.V410I		.											.	AP3B2	94	0			c.G1228A						.						52.0	50.0	50.0					15																	83346874		1917	4133	6050	SO:0001583	missense	8120	exon11			GTAGGACAGTAGG	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.1228G>A	15.37:g.83346874C>T	ENSP00000261722:p.Val410Ile	55.0	0.0		28.0	4.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	37	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	6.784	0.513652	0.12944	.	.	ENSG00000103723	ENST00000261722;ENST00000535348;ENST00000535359	T;T;T	0.17213	2.29;2.29;2.29	4.96	4.96	0.65561	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.160506	0.52532	D	0.000063	T	0.04363	0.0120	N	0.01242	-0.935	0.80722	D	1	B;B;B	0.16166	0.005;0.015;0.016	B;B;B	0.22601	0.011;0.04;0.04	T	0.36890	-0.9729	10	0.02654	T	1	-40.0736	5.8858	0.18880	0.0:0.7768:0.0:0.2232	.	378;410;410	B7ZKR7;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	I	410;378;410	ENSP00000261722:V410I;ENSP00000438721:V378I;ENSP00000440984:V410I	ENSP00000261722:V410I	V	-	1	0	AP3B2	81143929	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.786000	0.62425	2.579000	0.87056	0.555000	0.69702	GTC	.		0.577	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
ARHGEF6	9459	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135757211	135757211	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:135757211C>G	ENST00000250617.6	-	19	3195	c.1990G>C	c.(1990-1992)Gaa>Caa	p.E664Q	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.E510Q|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.E537Q|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.E510Q	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	664					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					CAGTAGGCTTCGATCACTTTA	0.413																																					p.E664Q		.											.	ARHGEF6	227	0			c.G1990C						.						162.0	137.0	145.0					X																	135757211		2203	4300	6503	SO:0001583	missense	9459	exon19			AGGCTTCGATCAC	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1990G>C	X.37:g.135757211C>G	ENSP00000250617:p.Glu664Gln	126.0	1.0		118.0	100.0	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	37	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515693	0.64634	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.69926	-0.35;-0.23;-0.23;-0.44	5.59	5.59	0.84812	.	0.045466	0.85682	D	0.000000	D	0.83945	0.5364	M	0.82323	2.585	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.86296	0.1677	10	0.87932	D	0	.	18.6464	0.91411	0.0:1.0:0.0:0.0	.	537;664	B7Z3C7;Q15052	.;ARHG6_HUMAN	Q	664;510;510;510;537	ENSP00000250617:E664Q;ENSP00000359654:E510Q;ENSP00000359656:E510Q;ENSP00000439483:E537Q	ENSP00000250617:E664Q	E	-	1	0	ARHGEF6	135584877	1.000000	0.71417	0.925000	0.36789	0.224000	0.24922	7.153000	0.77428	2.347000	0.79759	0.600000	0.82982	GAA	.		0.413	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
ARPP21	10777	ucsc.edu;bcgsc.ca	37	3	35729300	35729300	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:35729300T>C	ENST00000187397.4	+	6	787	c.331T>C	c.(331-333)Tct>Cct	p.S111P	ARPP21_ENST00000444190.1_Missense_Mutation_p.S111P|ARPP21_ENST00000337271.5_Missense_Mutation_p.S111P|ARPP21_ENST00000417925.1_Missense_Mutation_p.S111P|ARPP21_ENST00000458225.1_Missense_Mutation_p.S111P	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	111					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GAAAGATGACTCTGAAAGAGA	0.328																																					p.S111P		.											.	ARPP21	93	0			c.T331C						.						72.0	78.0	76.0					3																	35729300		2202	4297	6499	SO:0001583	missense	10777	exon5			GATGACTCTGAAA	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.331T>C	3.37:g.35729300T>C	ENSP00000187397:p.Ser111Pro	299.0	0.0		33.0	4.0	NM_001267619	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.716644	0.48622	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.25250	1.83;1.82;1.82;1.81;1.83	5.69	1.99	0.26369	.	0.779422	0.12514	N	0.462221	T	0.20251	0.0487	L	0.52573	1.65	0.33749	D	0.620394	B;B;B	0.32128	0.001;0.357;0.0	B;B;B	0.30401	0.002;0.115;0.002	T	0.22103	-1.0226	9	.	.	.	-6.2701	5.6567	0.17647	0.1269:0.1382:0.0:0.7349	.	111;111;111	Q9UBL0-3;Q9UBL0;Q9UBL0-4	.;ARP21_HUMAN;.	P	111	ENSP00000414351:S111P;ENSP00000337792:S111P;ENSP00000405276:S111P;ENSP00000187397:S111P;ENSP00000412326:S111P	.	S	+	1	0	ARPP21	35704304	0.982000	0.34865	1.000000	0.80357	0.996000	0.88848	1.056000	0.30480	0.406000	0.25560	0.477000	0.44152	TCT	.		0.328	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
ASAH2	56624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	52005051	52005051	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:52005051C>A	ENST00000395526.4	-	2	290	c.291G>T	c.(289-291)caG>caT	p.Q97H	ASAH2_ENST00000447815.1_Missense_Mutation_p.Q97H|ASAH2_ENST00000329428.6_Missense_Mutation_p.Q78H	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	97					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						CACTGAAGTTCTGAAATAGAG	0.512																																					p.Q97H		.											.	ASAH2	90	0			c.G291T						.						180.0	185.0	183.0					10																	52005051		2203	4300	6503	SO:0001583	missense	56624	exon2			GAAGTTCTGAAAT	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.291G>T	10.37:g.52005051C>A	ENSP00000378897:p.Gln97His	361.0	0.0		339.0	178.0	NM_001143974	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	37	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409294	0.62399	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.32753	1.45;1.44;1.44	5.67	4.75	0.60458	.	0.276251	0.32952	N	0.005460	T	0.27629	0.0679	N	0.22421	0.69	0.80722	D	1	P;P	0.48503	0.911;0.906	P;B	0.47941	0.562;0.428	T	0.01561	-1.1324	10	0.46703	T	0.11	.	12.8939	0.58087	0.0:0.919:0.0:0.081	.	97;97	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	H	97;97;78	ENSP00000378897:Q97H;ENSP00000388206:Q97H;ENSP00000329886:Q78H	ENSP00000329886:Q78H	Q	-	3	2	ASAH2	51675057	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	2.840000	0.48215	2.649000	0.89929	0.655000	0.94253	CAG	.		0.512	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893	
PTCD1	26024	ucsc.edu;bcgsc.ca	37	7	99022590	99022590	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:99022590A>G	ENST00000292478.4	-	6	1815	c.1565T>C	c.(1564-1566)tTc>tCc	p.F522S	ATP5J2-PTCD1_ENST00000413834.1_Missense_Mutation_p.F571S|PTCD1_ENST00000555673.1_Missense_Mutation_p.F571S	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	522					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CGTGTTAAAGAATGTCAGGTC	0.627																																					p.F571S		.											.	.	.	0			c.T1712C						.						79.0	74.0	75.0					7																	99022590		2203	4300	6503	SO:0001583	missense	100526740	exon7			TTAAAGAATGTCA	AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1565T>C	7.37:g.99022590A>G	ENSP00000292478:p.Phe522Ser	63.0	0.0		45.0	5.0	NM_001198879	Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	ENST00000292478.4	37	CCDS34691.1	.	.	.	.	.	.	.	.	.	.	A	16.69	3.192680	0.58017	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000438524;ENST00000555673;ENST00000413834	T;T;T	0.66995	-0.24;-0.22;-0.22	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79147	-0.1923	10	0.24483	T	0.36	-30.7836	15.7336	0.77825	1.0:0.0:0.0:0.0	.	571;522	G3V325;O75127	.;PTCD1_HUMAN	S	522;304;571;571	ENSP00000292478:F522S;ENSP00000450995:F571S;ENSP00000400168:F571S	ENSP00000400168:F571S	F	-	2	0	ATP5J2-PTCD1;PTCD1	98860526	1.000000	0.71417	0.992000	0.48379	0.036000	0.12997	8.957000	0.93082	2.114000	0.64651	0.459000	0.35465	TTC	.		0.627	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336391.1	NM_015545	
ATP5SL	55101	ucsc.edu;bcgsc.ca	37	19	41939217	41939217	+	Missense_Mutation	SNP	G	G	T	rs554242107	byFrequency	TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:41939217G>T	ENST00000221943.9	-	5	561	c.556C>A	c.(556-558)Cgc>Agc	p.R186S	ATP5SL_ENST00000595425.1_Missense_Mutation_p.R159S|ATP5SL_ENST00000589970.1_Intron|ATP5SL_ENST00000301183.11_Intron|ATP5SL_ENST00000597457.1_Intron|ATP5SL_ENST00000417807.3_Missense_Mutation_p.R192S|ATP5SL_ENST00000590641.2_Missense_Mutation_p.R165S|ATP5SL_ENST00000592922.2_Missense_Mutation_p.R159S|ATP5SL_ENST00000438807.3_Intron	NM_018035.2	NP_060505.2	Q9NW81	AT5SL_HUMAN	ATP5S-like	186						mitochondrion (GO:0005739)				breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	11						TCGGAGATGCGGGGGCAACCG	0.672																																					p.R192S		.											.	ATP5SL	135	0			c.C574A						.						27.0	30.0	29.0					19																	41939217		2202	4299	6501	SO:0001583	missense	55101	exon5			AGATGCGGGGGCA	AK001103	CCDS33032.1, CCDS54269.1, CCDS54270.1, CCDS54271.1, CCDS59389.1, CCDS59390.1	19q13.2	2007-12-13				ENSG00000105341			25496	protein-coding gene	gene with protein product						12477932	Standard	NM_001167867		Approved	FLJ10241	uc002oqv.3	Q9NW81		ENST00000221943.9:c.556C>A	19.37:g.41939217G>T	ENSP00000221943:p.Arg186Ser	52.0	0.0		42.0	4.0	NM_001167867	B4DDC0|B4DMZ4|B4DP55|B4DXE8|F5H4W7|K7EMF6|Q96D43	Missense_Mutation	SNP	ENST00000221943.9	37	CCDS33032.1	.	.	.	.	.	.	.	.	.	.	G	7.883	0.730749	0.15507	.	.	ENSG00000105341	ENST00000221943;ENST00000438807;ENST00000417807;ENST00000507129	T;T	0.36340	1.26;1.26	4.43	2.19	0.27852	.	1.433050	0.04715	N	0.418222	T	0.31979	0.0814	L	0.37466	1.105	0.35666	D	0.812903	P;B;B;B	0.47191	0.891;0.425;0.295;0.295	B;B;B;B	0.41374	0.355;0.095;0.138;0.138	T	0.29941	-0.9995	10	0.27785	T	0.31	-10.6772	10.6126	0.45432	0.0:0.0:0.6381:0.3619	.	165;159;186;192	B4DFT4;E9PDC6;Q9NW81;F5H4W7	.;.;AT5SL_HUMAN;.	S	186;159;192;262	ENSP00000221943:R186S;ENSP00000403910:R192S	ENSP00000221943:R186S	R	-	1	0	ATP5SL	46631057	0.979000	0.34478	0.343000	0.25615	0.048000	0.14542	2.184000	0.42575	0.536000	0.28733	0.563000	0.77884	CGC	.		0.672	ATP5SL-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460602.1	NM_018035	
ATP6V0A1	535	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40652840	40652840	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:40652840G>T	ENST00000343619.4	+	16	1918	c.1795G>T	c.(1795-1797)Gct>Tct	p.A599S	ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.A556S|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.A556S|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.A599S|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.A245S|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.A599S|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.A606S	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	599					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GGCCTATGATGCTCATACCTC	0.378																																					p.A606S		.											.	ATP6V0A1	91	0			c.G1816T						.						215.0	195.0	202.0					17																	40652840		2203	4300	6503	SO:0001583	missense	535	exon16			TATGATGCTCATA	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1795G>T	17.37:g.40652840G>T	ENSP00000342951:p.Ala599Ser	772.0	0.0		717.0	273.0	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	37	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083018	0.76642	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-2.17	4.91	4.91	0.64330	.	0.147766	0.64402	D	0.000010	D	0.90031	0.6887	L	0.60455	1.87	0.80722	D	1	B;B;B;P;B	0.46512	0.086;0.004;0.078;0.879;0.052	B;B;B;P;B	0.52823	0.156;0.02;0.063;0.71;0.056	D	0.89406	0.3699	10	0.44086	T	0.13	-9.9702	18.6406	0.91394	0.0:0.0:1.0:0.0	.	556;556;606;599;599	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	S	599;599;599;606;556;245	ENSP00000342951:A599S;ENSP00000444676:A599S;ENSP00000377415:A599S;ENSP00000264649:A606S;ENSP00000443991:A556S;ENSP00000446377:A245S	ENSP00000264649:A606S	A	+	1	0	ATP6V0A1	37906366	1.000000	0.71417	0.874000	0.34290	0.993000	0.82548	9.601000	0.98297	2.716000	0.92895	0.561000	0.74099	GCT	.		0.378	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
DQX1	165545	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74755115	74755115	+	5'Flank	DEL	A	A	-			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:74755115delA	ENST00000404568.3	-	0	0				AUP1_ENST00000377526.3_Frame_Shift_Del_p.H230fs|HTRA2_ENST00000258080.3_5'Flank|DQX1_ENST00000393951.2_5'Flank|HTRA2_ENST00000352222.3_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						CTAGTTGGCGATGAACAGGAC	0.567																																					p.H230fs		.											.	AUP1	90	0			c.690delT						.						123.0	128.0	126.0					2																	74755115		1986	4170	6156	SO:0001631	upstream_gene_variant	550	exon7			TTGGCGATGAACA	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		2.37:g.74755115delA	Exception_encountered	155.0	0.0		128.0	27.0	NM_181575	Q6B017|Q8NAM8	Frame_Shift_Del	DEL	ENST00000404568.3	37	CCDS1949.2																																																																																			.		0.567	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
AVPR1A	552	ucsc.edu;bcgsc.ca	37	12	63544149	63544149	+	Silent	SNP	C	C	T	rs138241660	byFrequency	TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:63544149C>T	ENST00000299178.2	-	1	573	c.468G>A	c.(466-468)ccG>ccA	p.P156P		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	156					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GAGTCTTGAGCGGGTGGCACA	0.642													C|||	8	0.00159744	0.0061	0.0	5008	,	,		18387	0.0		0.0	False		,,,				2504	0.0				p.P156P		.											.	AVPR1A	946	0			c.G468A						.	C		4,4402	8.1+/-20.4	0,4,2199	36.0	42.0	40.0		468	4.9	1.0	12	dbSNP_134	40	0,8598		0,0,4299	no	coding-synonymous	AVPR1A	NM_000706.3		0,4,6498	TT,TC,CC		0.0,0.0908,0.0308		156/419	63544149	4,13000	2203	4299	6502	SO:0001819	synonymous_variant	552	exon1			CTTGAGCGGGTGG	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.468G>A	12.37:g.63544149C>T		63.0	0.0		39.0	4.0	NM_000706		Silent	SNP	ENST00000299178.2	37	CCDS8965.1																																																																																			C|1.000;T|0.000		0.642	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1		
CEP131	22994	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79172746	79172746	+	Silent	SNP	G	G	A	rs112371137	byFrequency	TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:79172746G>A	ENST00000269392.4	-	11	1465	c.1218C>T	c.(1216-1218)ccC>ccT	p.P406P	AZI1_ENST00000374782.3_Silent_p.P406P|AZI1_ENST00000450824.2_Silent_p.P406P|AZI1_ENST00000575907.1_Silent_p.P406P|RP11-455O6.2_ENST00000571085.1_RNA|AZI1_ENST00000570482.2_5'Flank	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		406					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			AGCGGTCTCCGGGGCCTGCAG	0.657													G|||	49	0.00978435	0.0333	0.0043	5008	,	,		15922	0.0		0.002	False		,,,				2504	0.0				p.P406P		.											.	AZI1	136	0			c.C1218T						.	G	,	138,4210		1,136,2037	53.0	43.0	47.0		1218,1218	-5.9	0.0	17	dbSNP_132	47	2,8572		0,2,4285	no	coding-synonymous,coding-synonymous	AZI1	NM_001009811.2,NM_014984.2	,	1,138,6322	AA,AG,GG		0.0233,3.1739,1.0834	,	406/1045,406/1081	79172746	140,12782	2174	4287	6461	SO:0001819	synonymous_variant	22994	exon11			GTCTCCGGGGCCT																												ENST00000269392.4:c.1218C>T	17.37:g.79172746G>A		59.0	1.0		58.0	20.0	NM_014984	A6NHI8|B2RN11|Q96F50	Silent	SNP	ENST00000269392.4	37																																																																																				G|0.989;A|0.011		0.657	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000256070.1		
BOD1L1	259282	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	13617012	13617012	+	Silent	SNP	C	C	A	rs56295497	byFrequency	TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr4:13617012C>A	ENST00000040738.5	-	3	618	c.483G>T	c.(481-483)acG>acT	p.T161T		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	161						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGTGATTTAGCGTGGCCAAAA	0.448																																					p.T161T		.											.	.	.	0			c.G483T						.						232.0	223.0	226.0					4																	13617012		2203	4300	6503	SO:0001819	synonymous_variant	259282	exon3			ATTTAGCGTGGCC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.483G>T	4.37:g.13617012C>A		342.0	1.0		166.0	73.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																			C|0.988;T|0.012		0.448	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
BPIFB4	149954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31672752	31672752	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:31672752C>T	ENST00000375483.3	+	4	732	c.732C>T	c.(730-732)ggC>ggT	p.G244G		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	244						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCCTGCCCGGCGTGGGTGTCT	0.667																																					p.G244G		.											.	.	.	0			c.C732T						.						54.0	43.0	46.0					20																	31672752		2203	4300	6503	SO:0001819	synonymous_variant	149954	exon4			GCCCGGCGTGGGT	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.732C>T	20.37:g.31672752C>T		60.0	0.0		51.0	18.0	NM_182519	Q5TDX6	Silent	SNP	ENST00000375483.3	37	CCDS13213.2																																																																																			.		0.667	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
C11orf65	160140	broad.mit.edu;bcgsc.ca	37	11	108253793	108253793	+	Silent	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:108253793T>C	ENST00000529391.1	-	8	906	c.897A>G	c.(895-897)gaA>gaG	p.E299E	C11orf65_ENST00000393084.1_Silent_p.E299E|C11orf65_ENST00000525729.1_Intron|C11orf65_ENST00000526725.1_Intron			Q8NCR3	CK065_HUMAN	chromosome 11 open reading frame 65	299										endometrium(1)|large_intestine(3)|lung(4)|ovary(2)	10		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		TTACATTTGGTTCTTGATAAA	0.323																																					p.E299E		.											.	C11orf65	91	0			c.A897G						.						179.0	180.0	180.0					11																	108253793		2201	4298	6499	SO:0001819	synonymous_variant	160140	exon9			ATTTGGTTCTTGA	BC059411	CCDS8340.1	11q22.3	2012-05-30			ENSG00000166323	ENSG00000166323			28519	protein-coding gene	gene with protein product						12477932	Standard	NM_152587		Approved	MGC33948	uc001pkh.3	Q8NCR3	OTTHUMG00000166489	ENST00000529391.1:c.897A>G	11.37:g.108253793T>C		260.0	1.0		232.0	12.0	NM_152587	B4DZU4|Q6PCA8	Silent	SNP	ENST00000529391.1	37	CCDS8340.1																																																																																			.		0.323	C11orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390010.3	NM_152587	
C12orf4	57102	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	4609389	4609389	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:4609389C>A	ENST00000261250.3	-	11	1442	c.1355G>T	c.(1354-1356)gGa>gTa	p.G452V	C12orf4_ENST00000545746.1_Missense_Mutation_p.G452V|C12orf4_ENST00000509318.2_5'Flank	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	452										NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		ATTTCGGAGTCCCATAATGGC	0.428																																					p.G452V		.											.	C12orf4	226	0			c.G1355T						.						141.0	127.0	132.0					12																	4609389		2203	4300	6503	SO:0001583	missense	57102	exon11			CGGAGTCCCATAA	AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.1355G>T	12.37:g.4609389C>A	ENSP00000261250:p.Gly452Val	210.0	1.0		137.0	48.0	NM_020374	D3DUQ8|Q6MZH5	Missense_Mutation	SNP	ENST00000261250.3	37	CCDS8528.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504844	0.85176	.	.	ENSG00000047621	ENST00000261250;ENST00000545746	.	.	.	5.46	4.57	0.56435	.	0.108387	0.64402	D	0.000006	T	0.75932	0.3917	M	0.85462	2.755	0.80722	D	1	P	0.49447	0.924	P	0.52627	0.704	T	0.81293	-0.0998	9	0.87932	D	0	.	15.6221	0.76813	0.1387:0.8613:0.0:0.0	.	452	Q9NQ89	CL004_HUMAN	V	452	.	ENSP00000261250:G452V	G	-	2	0	C12orf4	4479650	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.742000	0.68646	1.280000	0.44463	0.591000	0.81541	GGA	.		0.428	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398992.1	NM_020374	
OSER1	51526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	42826208	42826208	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:42826208C>A	ENST00000372970.2	-	6	543	c.363G>T	c.(361-363)ctG>ctT	p.L121L	OSER1_ENST00000255174.2_Silent_p.L121L			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1	121					cellular response to hydrogen peroxide (GO:0070301)												ATGAAATTCCCAGCCCACTGC	0.473																																					p.L121L		.											.	C20orf111	90	0			c.G363T						.						99.0	101.0	100.0					20																	42826208		2203	4300	6503	SO:0001819	synonymous_variant	51526	exon4			AATTCCCAGCCCA	AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.363G>T	20.37:g.42826208C>A		108.0	0.0		102.0	38.0	NM_016470	B2RCK4|O95912|Q9NZ84|Q9P0R8	Silent	SNP	ENST00000372970.2	37	CCDS13327.1																																																																																			.		0.473	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079334.2	NM_016470	
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	29294437	29294437	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:29294437G>A	ENST00000331664.5	-	1	2690	c.2691C>T	c.(2689-2691)acC>acT	p.T897T		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	897					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TCAGGCTGGCGGTGCTCTTGC	0.682																																					p.T897T		.											.	C2orf71	91	0			c.C2691T						.						22.0	25.0	24.0					2																	29294437		1970	4147	6117	SO:0001819	synonymous_variant	388939	exon1			GCTGGCGGTGCTC		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2691C>T	2.37:g.29294437G>A		40.0	0.0		47.0	12.0	NM_001029883		Silent	SNP	ENST00000331664.5	37	CCDS42669.1																																																																																			.		0.682	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
CACNA1B	774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140953173	140953173	+	Silent	SNP	G	G	C	rs199714779		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:140953173G>C	ENST00000371372.1	+	29	4606	c.4461G>C	c.(4459-4461)gtG>gtC	p.V1487V	CACNA1B_ENST00000371357.1_Silent_p.V1488V|CACNA1B_ENST00000277549.5_Silent_p.V683V|CACNA1B_ENST00000371363.1_Silent_p.V1487V|CACNA1B_ENST00000371355.4_Silent_p.V1488V|CACNA1B_ENST00000277551.2_Silent_p.V1487V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1487					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	ACACTGTGGTGCTGATGATGA	0.557																																					p.V1487V		.											.	CACNA1B	138	0			c.G4461C						.						53.0	49.0	50.0					9																	140953173		2050	4207	6257	SO:0001819	synonymous_variant	774	exon29			TGTGGTGCTGATG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4461G>C	9.37:g.140953173G>C		96.0	0.0		107.0	38.0	NM_001243812	B1AQK5	Silent	SNP	ENST00000371372.1	37	CCDS59522.1																																																																																			.		0.557	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CCDC43	124808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42756228	42756228	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:42756228C>G	ENST00000315286.8	-	5	679	c.671G>C	c.(670-672)cGa>cCa	p.R224P	RP11-1072C15.4_ENST00000591628.1_RNA|CCDC43_ENST00000588210.1_Missense_Mutation_p.R227P|CCDC43_ENST00000457422.2_3'UTR|C17orf104_ENST00000588805.1_Intron	NM_144609.2	NP_653210.2	Q96MW1	CCD43_HUMAN	coiled-coil domain containing 43	224										lung(2)	2		Prostate(33;0.0322)				CCAAGGTTATCGCTTTCGCTC	0.453																																					p.R224P		.											.	.	.	0			c.G671C						.						78.0	81.0	80.0					17																	42756228		1914	4123	6037	SO:0001583	missense	124808	exon5			GGTTATCGCTTTC	AK056357	CCDS45704.1, CCDS45705.1	17q21.31	2005-12-16							26472	protein-coding gene	gene with protein product						12477932	Standard	NM_001099225		Approved	FLJ31795	uc002ihc.2	Q96MW1		ENST00000315286.8:c.671G>C	17.37:g.42756228C>G	ENSP00000323782:p.Arg224Pro	465.0	0.0		400.0	157.0	NM_144609	C9JVK9	Missense_Mutation	SNP	ENST00000315286.8	37	CCDS45704.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058141	0.76074	.	.	ENSG00000180329	ENST00000315286	.	.	.	6.16	6.16	0.99307	.	0.120163	0.56097	D	0.000024	T	0.79499	0.4456	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79215	-0.1895	9	0.87932	D	0	.	19.6313	0.95704	0.0:1.0:0.0:0.0	.	224	Q96MW1	CCD43_HUMAN	P	224	.	ENSP00000323782:R224P	R	-	2	0	CCDC43	40111754	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.802000	0.75175	2.937000	0.99478	0.650000	0.86243	CGA	.		0.453	CCDC43-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457812.1	NM_144609	
CD3EAP	10849	ucsc.edu;bcgsc.ca	37	19	45911586	45911586	+	Silent	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:45911586T>C	ENST00000309424.3	+	3	848	c.360T>C	c.(358-360)ggT>ggC	p.G120G	ERCC1_ENST00000300853.3_3'UTR|CD3EAP_ENST00000589804.1_Silent_p.G122G|ERCC1_ENST00000423698.2_3'UTR|ERCC1_ENST00000588738.1_5'Flank|PPP1R13L_ENST00000418234.2_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	120					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TCCTTGAGGGTCCCCAGCAAT	0.662																																					p.G120G		.											.	CD3EAP	156	0			c.T360C						.						41.0	48.0	45.0					19																	45911586		2203	4300	6503	SO:0001819	synonymous_variant	10849	exon3			TGAGGGTCCCCAG	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.360T>C	19.37:g.45911586T>C		48.0	0.0		56.0	6.0	NM_012099	Q32N11|Q7Z5U2|Q9UPF6	Silent	SNP	ENST00000309424.3	37	CCDS12661.1																																																																																			.		0.662	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459538.1	NM_012099	
CEACAM18	729767	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51984902	51984902	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:51984902T>G	ENST00000396477.4	+	3	677	c.656T>G	c.(655-657)aTc>aGc	p.I219S	CEACAM18_ENST00000451626.1_Missense_Mutation_p.I280S	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	219										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AGTGAACGCATCTCTCTGACT	0.532																																					p.I280S		.											.	CEACAM18	23	0			c.T839G						.						64.0	60.0	62.0					19																	51984902		1966	4159	6125	SO:0001583	missense	729767	exon4			AACGCATCTCTCT			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.656T>G	19.37:g.51984902T>G	ENSP00000379738:p.Ile219Ser	91.0	0.0		99.0	32.0	NM_001080405	C9JN24	Missense_Mutation	SNP	ENST00000396477.4	37		.	.	.	.	.	.	.	.	.	.	.	12.21	1.869667	0.33069	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.78364	-1.17	2.72	2.72	0.32119	.	.	.	.	.	T	0.80491	0.4633	M	0.81497	2.545	0.09310	N	1	P	0.49961	0.93	P	0.48488	0.579	T	0.71718	-0.4508	9	0.87932	D	0	-8.0973	7.3284	0.26567	0.0:0.0:0.0:1.0	.	280	A8MTB9	CEA18_HUMAN	S	280;219;219	ENSP00000402203:I280S	ENSP00000379738:I219S	I	+	2	0	CEACAM18	56676714	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.235000	0.17948	1.514000	0.48869	0.456000	0.33151	ATC	.		0.532	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2		
CHRNA4	1137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	61981117	61981117	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:61981117C>G	ENST00000370263.4	-	5	1867	c.1646G>C	c.(1645-1647)cGc>cCc	p.R549P	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	549					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TTTGGTGCTGCGGGTCTTGAC	0.682																																					p.R549P		.											.	CHRNA4	91	0			c.G1646C						.						35.0	40.0	39.0					20																	61981117		2200	4298	6498	SO:0001583	missense	1137	exon5			GTGCTGCGGGTCT		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1646G>C	20.37:g.61981117C>G	ENSP00000359285:p.Arg549Pro	43.0	0.0		30.0	15.0	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	37	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	C	0.287	-0.982264	0.02180	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.85702	-2.02	3.7	-2.82	0.05787	Neurotransmitter-gated ion-channel transmembrane domain (2);	6.549360	0.00610	N	0.000406	T	0.79522	0.4460	L	0.39898	1.24	0.09310	N	1	P;B	0.46142	0.873;0.002	P;B	0.46172	0.506;0.005	T	0.66324	-0.5952	10	0.30078	T	0.28	.	1.2964	0.02070	0.2231:0.197:0.1213:0.4586	.	478;549	Q4VAQ5;P43681	.;ACHA4_HUMAN	P	455;549;478	ENSP00000359285:R549P	ENSP00000359280:R455P	R	-	2	0	CHRNA4	61451561	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.591000	0.02100	-1.087000	0.03081	-0.339000	0.08088	CGC	.		0.682	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
CLASRP	11129	ucsc.edu;bcgsc.ca	37	19	45555364	45555364	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:45555364C>T	ENST00000221455.3	+	3	233	c.135C>T	c.(133-135)ggC>ggT	p.G45G	CLASRP_ENST00000544944.2_Silent_p.G45G|CLASRP_ENST00000391953.4_Intron	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	45					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						AGGTACATGGCCGAGCTTGCA	0.572																																					p.G45G		.											.	CLASRP	154	0			c.C135T						.						99.0	91.0	94.0					19																	45555364		2203	4300	6503	SO:0001819	synonymous_variant	11129	exon3			ACATGGCCGAGCT	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.135C>T	19.37:g.45555364C>T		46.0	0.0		33.0	4.0	NM_007056	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Silent	SNP	ENST00000221455.3	37	CCDS12652.2																																																																																			.		0.572	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
CLSTN2	64084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	140281020	140281020	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:140281020A>T	ENST00000458420.3	+	13	2272	c.2082A>T	c.(2080-2082)ttA>ttT	p.L694F		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	694					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						TTCATAACTTAGATTTCTGTG	0.498										HNSCC(16;0.037)																											p.L694F	GBM(45;858 913 3709 36904 37282)	.											.	CLSTN2	157	0			c.A2082T						.						102.0	98.0	99.0					3																	140281020		2203	4300	6503	SO:0001583	missense	64084	exon13			TAACTTAGATTTC	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2082A>T	3.37:g.140281020A>T	ENSP00000402460:p.Leu694Phe	90.0	0.0		95.0	40.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228156	0.79576	.	.	ENSG00000158258	ENST00000458420	T	0.34072	1.38	5.43	-1.16	0.09678	.	0.000000	0.85682	D	0.000000	T	0.54806	0.1881	M	0.85630	2.765	0.46774	D	0.999195	D	0.76494	0.999	D	0.85130	0.997	T	0.54516	-0.8282	9	.	.	.	-32.6169	6.295	0.21081	0.2692:0.0:0.5783:0.1525	.	694	Q9H4D0	CSTN2_HUMAN	F	694	ENSP00000402460:L694F	.	L	+	3	2	CLSTN2	141763710	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	2.414000	0.44627	0.125000	0.18397	0.533000	0.62120	TTA	.		0.498	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
COL11A2	1302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33144991	33144991	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:33144991C>A	ENST00000374708.4	-	22	1983	c.1725G>T	c.(1723-1725)ggG>ggT	p.G575G	COL11A2_ENST00000374713.1_Silent_p.G614G|COL11A2_ENST00000361917.1_Silent_p.G554G|COL11A2_ENST00000341947.2_Silent_p.G661G|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000357486.1_Silent_p.G640G|COL11A2_ENST00000374712.1_Silent_p.G580G|COL11A2_ENST00000395197.1_Silent_p.G601G|COL11A2_ENST00000374714.1_Silent_p.G635G	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	661	Collagen-like 3.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CACCCTGGGGCCCGGGAAGAC	0.557																																					p.G661G	Melanoma(1;90 116 3946 5341 17093)	.											.	COL11A2	95	0			c.G1983T						.						48.0	56.0	53.0					6																	33144991		1508	2707	4215	SO:0001819	synonymous_variant	1302	exon24			CTGGGGCCCGGGA	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1725G>T	6.37:g.33144991C>A		65.0	0.0		63.0	16.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	37	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	C	5.857	0.342341	0.11069	.	.	ENSG00000204248	ENST00000395196	.	.	.	4.16	1.0	0.19881	.	0.000000	0.85682	D	0.000000	T	0.26376	0.0644	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17837	-1.0356	8	0.87932	D	0	.	4.8495	0.13530	0.0:0.5753:0.1849:0.2398	.	67	A2ABA7	.	V	41	.	ENSP00000378622:G41V	G	-	2	0	COL11A2	33252969	0.000000	0.05858	0.980000	0.43619	0.534000	0.34807	-2.266000	0.01171	0.381000	0.24851	0.643000	0.83706	GGC	.		0.557	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
COL18A1	80781	ucsc.edu;bcgsc.ca	37	21	46888235	46888235	+	Silent	SNP	C	C	A	rs372731688		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr21:46888235C>A	ENST00000359759.4	+	2	1452	c.1431C>A	c.(1429-1431)ccC>ccA	p.P477P	COL18A1_ENST00000400337.2_Silent_p.P62P|COL18A1_ENST00000355480.5_Silent_p.P242P			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	477	Laminin G-like.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGGATGACCCCGACGTCGGGC	0.632																																					p.P242P		.											.	COL18A1	90	0			c.C726A						.						49.0	57.0	54.0					21																	46888235		1977	4154	6131	SO:0001819	synonymous_variant	80781	exon2			TGACCCCGACGTC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.1431C>A	21.37:g.46888235C>A		73.0	0.0		38.0	4.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37																																																																																				.		0.632	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
COL6A3	1293	broad.mit.edu;bcgsc.ca	37	2	238280490	238280490	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:238280490C>T	ENST00000295550.4	-	9	4622	c.4170G>A	c.(4168-4170)tcG>tcA	p.S1390S	COL6A3_ENST00000472056.1_Silent_p.S783S|COL6A3_ENST00000346358.4_Silent_p.S1190S|COL6A3_ENST00000347401.3_Silent_p.S1189S|COL6A3_ENST00000409809.1_Silent_p.S1184S|COL6A3_ENST00000353578.4_Silent_p.S1184S|COL6A3_ENST00000392004.3_Silent_p.S1184S|COL6A3_ENST00000392003.2_Silent_p.S983S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1390	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGGTGCTCACCGAGAACACAT	0.597																																					p.S1390S		.											.	COL6A3	526	0			c.G4170A						.						79.0	77.0	77.0					2																	238280490		2203	4300	6503	SO:0001819	synonymous_variant	1293	exon9			GCTCACCGAGAAC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4170G>A	2.37:g.238280490C>T		97.0	0.0		81.0	7.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.		0.597	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
COLGALT2	23127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183938536	183938536	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:183938536G>T	ENST00000361927.4	-	5	1070	c.699C>A	c.(697-699)ccC>ccA	p.P233P	COLGALT2_ENST00000546159.1_Silent_p.P233P	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	233					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										AGTGGACCATGGGGACGGGGA	0.527																																					p.P233P		.											.	.	.	0			c.C699A						.						124.0	118.0	120.0					1																	183938536		2203	4300	6503	SO:0001819	synonymous_variant	23127	exon5			GACCATGGGGACG	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.699C>A	1.37:g.183938536G>T		156.0	0.0		145.0	85.0	NM_015101	O60327|Q9BZR0	Silent	SNP	ENST00000361927.4	37	CCDS1360.1																																																																																			.		0.527	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
COPA	1314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160305090	160305090	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:160305090C>A	ENST00000241704.7	-	4	480	c.251G>T	c.(250-252)cGc>cTc	p.R84L	COPA_ENST00000368069.3_Missense_Mutation_p.R84L	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	84					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAAAAGACAGCGCCGAAGCTT	0.378																																					p.R84L		.											.	COPA	92	0			c.G251T						.						63.0	57.0	59.0					1																	160305090		2203	4300	6503	SO:0001583	missense	1314	exon4			AGACAGCGCCGAA	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.251G>T	1.37:g.160305090C>A	ENSP00000241704:p.Arg84Leu	349.0	0.0		439.0	131.0	NM_001098398	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	37	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663848	0.88251	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.59638	0.25;0.25	4.98	4.07	0.47477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056807	0.64402	D	0.000001	T	0.58380	0.2118	L	0.42245	1.32	0.80722	D	1	D;D	0.71674	0.998;0.989	D;D	0.78314	0.991;0.951	T	0.64618	-0.6365	10	0.87932	D	0	-9.4559	12.1766	0.54188	0.0:0.9165:0.0:0.0835	.	84;84	P53621;P53621-2	COPA_HUMAN;.	L	84	ENSP00000357048:R84L;ENSP00000241704:R84L	ENSP00000241704:R84L	R	-	2	0	COPA	158571714	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.988000	0.76212	1.105000	0.41606	0.655000	0.94253	CGC	.		0.378	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
COLGALT2	23127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	183938539	183938539	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:183938539G>T	ENST00000361927.4	-	5	1067	c.696C>A	c.(694-696)gtC>gtA	p.V232V	COLGALT2_ENST00000546159.1_Silent_p.V232V	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	232					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GGACCATGGGGACGGGGAAGC	0.522																																					p.V232V		.											.	.	.	0			c.C696A						.						123.0	117.0	119.0					1																	183938539		2203	4300	6503	SO:0001819	synonymous_variant	23127	exon5			CATGGGGACGGGG	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.696C>A	1.37:g.183938539G>T		157.0	0.0		148.0	86.0	NM_015101	O60327|Q9BZR0	Silent	SNP	ENST00000361927.4	37	CCDS1360.1																																																																																			.		0.522	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
CSH1	1442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	61972411	61972411	+	Missense_Mutation	SNP	G	G	T	rs61764004		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:61972411G>T	ENST00000316193.8	-	5	766	c.625C>A	c.(625-627)Cgc>Agc	p.R209S	CSH1_ENST00000329882.8_3'UTR|CSH1_ENST00000453363.3_Missense_Mutation_p.R114S	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)	209						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.R209C(1)		central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						TCCACAGAGCGGCACTGCACC	0.607									Russell-Silver syndrome																												p.R209S		.											.	CSH1	92	1	Substitution - Missense(1)	central_nervous_system(1)	c.C625A						.						105.0	94.0	98.0					17																	61972411		2198	4299	6497	SO:0001583	missense	1442	exon5	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	CAGAGCGGCACTG	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.625C>A	17.37:g.61972411G>T	ENSP00000316416:p.Arg209Ser	270.0	0.0		185.0	85.0	NM_001317	P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	ENST00000316193.8	37	CCDS11649.1	.	.	.	.	.	.	.	.	.	.	g	10.94	1.491692	0.26774	.	.	ENSG00000136488	ENST00000316193;ENST00000453363	D;D	0.92911	-3.13;-3.13	2.56	1.57	0.23409	.	.	.	.	.	D	0.95319	0.8481	M	0.86651	2.83	0.43114	D	0.994825	D;D	0.71674	0.989;0.998	D;D	0.71414	0.973;0.955	D	0.93904	0.7191	9	0.72032	D	0.01	.	8.4239	0.32718	0.1261:0.0:0.8739:0.0	rs61764004	114;209	B1A4H2;Q6PF11	.;.	S	209;114	ENSP00000316416:R209S;ENSP00000402517:R114S	ENSP00000316416:R209S	R	-	1	0	CSH1	59326143	1.000000	0.71417	0.996000	0.52242	0.012000	0.07955	6.449000	0.73473	0.405000	0.25532	-0.671000	0.03813	CGC	G|0.993;T|0.007		0.607	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416040.1	NM_001317	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266110	41266110	+	Missense_Mutation	SNP	A	A	C	rs121913416		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:41266110A>C	ENST00000349496.5	+	3	387	c.107A>C	c.(106-108)cAt>cCt	p.H36P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.H36P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.H29P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.H36P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	36					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.H36P(24)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.H36R(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTGGAATCCATTCTGGTGCC	0.498		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.H36P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0	CTNNB1	24361	159	Deletion - In frame(104)|Substitution - Missense(27)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(119)|large_intestine(20)|stomach(7)|kidney(6)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A107C						.						95.0	80.0	85.0					3																	41266110		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GAATCCATTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.107A>C	3.37:g.41266110A>C	ENSP00000344456:p.His36Pro	251.0	0.0		134.0	54.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824526	0.50739	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.76	5.76	0.90799	.	0.093481	0.85682	D	0.000000	T	0.51210	0.1661	M	0.64170	1.965	0.80722	D	1	P	0.40398	0.716	P	0.45946	0.498	T	0.54807	-0.8238	10	0.72032	D	0.01	-2.3155	16.0676	0.80897	1.0:0.0:0.0:0.0	.	36	P35222	CTNB1_HUMAN	P	29;36;36;36;36;29;36;36;36	ENSP00000400508:H29P;ENSP00000385604:H36P;ENSP00000412219:H36P;ENSP00000379486:H36P;ENSP00000344456:H36P;ENSP00000411226:H29P;ENSP00000379488:H36P;ENSP00000409302:H36P;ENSP00000401599:H36P	ENSP00000344456:H36P	H	+	2	0	CTNNB1	41241114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNND2	1501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	11082847	11082847	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:11082847G>A	ENST00000304623.8	-	16	2938	c.2749C>T	c.(2749-2751)Cgg>Tgg	p.R917W	CTNND2_ENST00000511377.1_Missense_Mutation_p.R826W|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000458100.2_Missense_Mutation_p.R484W|CTNND2_ENST00000503622.1_Missense_Mutation_p.R580W|CTNND2_ENST00000359640.2_Missense_Mutation_p.R859W	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	917					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCCATGTTCCGCAGCGCAGTG	0.522																																					p.R917W		.											.	CTNND2	293	0			c.C2749T						.						133.0	116.0	121.0					5																	11082847		2203	4300	6503	SO:0001583	missense	1501	exon16			TGTTCCGCAGCGC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2749C>T	5.37:g.11082847G>A	ENSP00000307134:p.Arg917Trp	172.0	0.0		115.0	44.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281706	0.80692	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.209202	0.40554	N	0.001070	D	0.87485	0.6189	M	0.90542	3.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.997	D	0.90094	0.4179	10	0.87932	D	0	-22.3756	18.7557	0.91832	0.0:0.0:1.0:0.0	.	580;509;917	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	W	917;859;826;12;484;580	ENSP00000307134:R917W;ENSP00000352661:R859W;ENSP00000426510:R826W;ENSP00000391155:R484W;ENSP00000426887:R580W	ENSP00000307134:R917W	R	-	1	2	CTNND2	11135847	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	3.392000	0.52537	2.505000	0.84491	0.563000	0.77884	CGG	.		0.522	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6643329	6643329	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:6643329C>A	ENST00000299441.3	-	21	9989	c.9578G>T	c.(9577-9579)tGt>tTt	p.C3193F	TPP1_ENST00000534644.1_5'Flank|RP11-732A19.5_ENST00000526456.1_RNA|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000533371.1_5'Flank|TPP1_ENST00000299427.6_5'Flank|TPP1_ENST00000528657.1_5'Flank	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3193					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCTGGGGGACATGGCCGAGC	0.617																																					p.C3193F		.											.	DCHS1	73	0			c.G9578T						.						43.0	49.0	47.0					11																	6643329		2201	4296	6497	SO:0001583	missense	8642	exon21			GGGGGACATGGCC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9578G>T	11.37:g.6643329C>A	ENSP00000299441:p.Cys3193Phe	112.0	0.0		86.0	30.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	8.080	0.772134	0.16051	.	.	ENSG00000166341	ENST00000299441	T	0.53423	0.62	4.88	4.88	0.63580	.	0.000000	0.46145	D	0.000314	T	0.38268	0.1034	N	0.22421	0.69	0.34786	D	0.735252	D	0.56521	0.976	P	0.44518	0.452	T	0.48948	-0.8989	10	0.31617	T	0.26	.	16.7719	0.85539	0.0:1.0:0.0:0.0	.	3193	Q96JQ0	PCD16_HUMAN	F	3193	ENSP00000299441:C3193F	ENSP00000299441:C3193F	C	-	2	0	DCHS1	6599905	0.999000	0.42202	0.990000	0.47175	0.865000	0.49528	3.651000	0.54431	2.531000	0.85337	0.313000	0.20887	TGT	.		0.617	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DEFB134	613211	ucsc.edu;bcgsc.ca	37	8	11851595	11851595	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr8:11851595C>A	ENST00000526438.1	-	2	155	c.95G>T	c.(94-96)tGc>tTc	p.C32F	DEFB134_ENST00000382205.4_Missense_Mutation_p.C32F	NM_001033019.1	NP_001028191.1	Q4QY38	DB134_HUMAN	defensin, beta 134	32					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				kidney(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		ATTTTTATAGCATTTCTTGTG	0.363																																					p.C32F		.											.	DEFB134	90	0			c.G95T						.						119.0	114.0	115.0					8																	11851595		2203	4300	6503	SO:0001583	missense	613211	exon2			TTATAGCATTTCT	AY621331, DQ012024	CCDS34847.1	8p23.1	2010-04-15			ENSG00000205882	ENSG00000205882		"""Defensins, beta"""	32399	protein-coding gene	gene with protein product						16033865	Standard	NM_001033019		Approved		uc011kxn.2	Q4QY38	OTTHUMG00000158718	ENST00000526438.1:c.95G>T	8.37:g.11851595C>A	ENSP00000435010:p.Cys32Phe	99.0	0.0		47.0	4.0	NM_001033019	A1L4A4	Missense_Mutation	SNP	ENST00000526438.1	37	CCDS34847.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297276	0.23650	.	.	ENSG00000205882	ENST00000526438;ENST00000382205	D	0.84298	-1.83	3.58	3.58	0.41010	.	0.000000	0.47852	D	0.000216	D	0.90645	0.7066	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82218	-0.0566	9	0.87932	D	0	-12.5986	10.9885	0.47537	0.0:1.0:0.0:0.0	.	32	Q4QY38	DB134_HUMAN	F	32;25	ENSP00000435010:C32F	ENSP00000371640:C25F	C	-	2	0	DEFB134	11889004	0.602000	0.26916	0.076000	0.20297	0.259000	0.26198	2.253000	0.43205	2.301000	0.77427	0.563000	0.77884	TGC	.		0.363	DEFB134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351887.2	NM_001033019	
DENND4B	9909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153913916	153913916	+	Splice_Site	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:153913916C>G	ENST00000361217.4	-	7	1474	c.1056G>C	c.(1054-1056)gcG>gcC	p.A352A		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	352	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGGAGATGTGCCTGGGGGACA	0.557																																					p.A352A		.											.	DENND4B	69	0			c.G1056C						.						85.0	94.0	91.0					1																	153913916		2035	4183	6218	SO:0001630	splice_region_variant	9909	exon7			GATGTGCCTGGGG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.1056-1G>C	1.37:g.153913916C>G		73.0	0.0		88.0	45.0	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																			.		0.557	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	Silent
DMXL2	23312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	51791589	51791589	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:51791589C>G	ENST00000251076.5	-	18	4119	c.3832G>C	c.(3832-3834)Gtc>Ctc	p.V1278L	DMXL2_ENST00000449909.3_Intron|DMXL2_ENST00000543779.2_Missense_Mutation_p.V1278L|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1278						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CCAAATTTGACAGCATGCTTC	0.413																																					p.V1278L		.											.	DMXL2	99	0			c.G3832C						.						183.0	178.0	180.0					15																	51791589		2195	4293	6488	SO:0001583	missense	23312	exon18			ATTTGACAGCATG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.3832G>C	15.37:g.51791589C>G	ENSP00000251076:p.Val1278Leu	140.0	0.0		86.0	51.0	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	1.984	-0.433474	0.04669	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.20738	2.05;2.05	5.66	4.73	0.59995	.	0.164769	0.53938	D	0.000051	T	0.13970	0.0338	N	0.25647	0.755	0.80722	D	1	B;B	0.18741	0.03;0.017	B;B	0.17433	0.018;0.011	T	0.07404	-1.0774	10	0.27785	T	0.31	.	9.6847	0.40091	0.0:0.7935:0.0:0.2065	.	1278;1278	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	L	1278	ENSP00000251076:V1278L;ENSP00000441858:V1278L	ENSP00000251076:V1278L	V	-	1	0	DMXL2	49578881	0.999000	0.42202	1.000000	0.80357	0.901000	0.52897	1.791000	0.38744	2.669000	0.90835	0.591000	0.81541	GTC	.		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124305198	124305198	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:124305198G>T	ENST00000409039.3	+	23	3743	c.3718G>T	c.(3718-3720)Gct>Tct	p.A1240S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1240	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACTGGCTAACGCTGAGAAACT	0.428																																					p.A1240S		.											.	DNAH10	95	0			c.G3718T						.						123.0	125.0	125.0					12																	124305198		1907	4132	6039	SO:0001583	missense	196385	exon23			GCTAACGCTGAGA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3718G>T	12.37:g.124305198G>T	ENSP00000386770:p.Ala1240Ser	155.0	0.0		133.0	66.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622632	0.46840	.	.	ENSG00000197653	ENST00000409039	T	0.22539	1.95	5.18	5.18	0.71444	.	.	.	.	.	T	0.39572	0.1083	M	0.72479	2.2	0.53688	D	0.999971	D	0.53745	0.962	P	0.58013	0.831	T	0.19976	-1.0289	9	0.09843	T	0.71	.	18.6962	0.91601	0.0:0.0:1.0:0.0	.	1240	Q8IVF4	DYH10_HUMAN	S	1240	ENSP00000386770:A1240S	ENSP00000386770:A1240S	A	+	1	0	DNAH10	122871151	1.000000	0.71417	0.819000	0.32651	0.092000	0.18411	5.607000	0.67648	2.409000	0.81822	0.555000	0.69702	GCT	.		0.428	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH10	196385	broad.mit.edu;bcgsc.ca	37	12	124395185	124395185	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:124395185A>G	ENST00000409039.3	+	58	9771	c.9746A>G	c.(9745-9747)gAt>gGt	p.D3249G		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3249	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGCTACTGTGATGTTTTCAGA	0.458																																					p.D3249G		.											.	DNAH10	95	0			c.A9746G						.						84.0	87.0	86.0					12																	124395185		1955	4139	6094	SO:0001583	missense	196385	exon58			ACTGTGATGTTTT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9746A>G	12.37:g.124395185A>G	ENSP00000386770:p.Asp3249Gly	88.0	0.0		96.0	8.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.68|13.68	2.308529|2.308529	0.40895|0.40895	.|.	.|.	ENSG00000197653|ENSG00000197653	ENST00000409039|ENST00000540041	T|.	0.75050|.	-0.9|.	4.96|4.96	4.96|4.96	0.65561|0.65561	Dynein heavy chain, coiled coil stalk (1);|.	0.245457|.	0.40302|.	N|.	0.001133|.	T|T	0.57344|0.57344	0.2047|0.2047	L|L	0.38692|0.38692	1.165|1.165	0.58432|0.58432	D|D	0.999999|0.999999	B|.	0.14012|.	0.009|.	B|.	0.20384|.	0.029|.	T|T	0.54682|0.54682	-0.8257|-0.8257	10|5	0.18276|.	T|.	0.48|.	.|.	14.632|14.632	0.68663|0.68663	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	3249|.	Q8IVF4|.	DYH10_HUMAN|.	G|V	3249|177	ENSP00000386770:D3249G|.	ENSP00000386770:D3249G|.	D|M	+|+	2|1	0|0	DNAH10|DNAH10	122961138|122961138	1.000000|1.000000	0.71417|0.71417	0.473000|0.473000	0.27253|0.27253	0.600000|0.600000	0.36913|0.36913	9.027000|9.027000	0.93706|0.93706	1.867000|1.867000	0.54127|0.54127	0.533000|0.533000	0.62120|0.62120	GAT|ATG	.		0.458	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	38747836	38747836	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:38747836A>T	ENST00000359357.3	+	13	1737	c.1483A>T	c.(1483-1485)Aag>Tag	p.K495*	DNAH8_ENST00000449981.2_Nonsense_Mutation_p.K712*|DNAH8_ENST00000441566.1_Nonsense_Mutation_p.K495*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	495					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TGATGCTACTAAGAAGGCAAG	0.343																																					p.K712X		.											.	DNAH8	615	0			c.A2134T						.						103.0	97.0	99.0					6																	38747836		2203	4300	6503	SO:0001587	stop_gained	1769	exon15			GCTACTAAGAAGG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1483A>T	6.37:g.38747836A>T	ENSP00000352312:p.Lys495*	115.0	0.0		97.0	29.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	A	41	8.606517	0.98881	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.54	5.54	0.83059	.	0.062950	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.548	0.68047	1.0:0.0:0.0:0.0	.	.	.	.	X	700;700;495;495	.	ENSP00000333363:K700X	K	+	1	0	DNAH8	38855814	1.000000	0.71417	0.994000	0.49952	0.620000	0.37586	5.498000	0.66931	2.243000	0.73865	0.482000	0.46254	AAG	.		0.343	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DNAH9	1770	ucsc.edu;bcgsc.ca	37	17	11535903	11535903	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:11535903G>T	ENST00000262442.4	+	8	1586		c.e8-1		DNAH9_ENST00000454412.2_Splice_Site	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9						cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGTCTCTTCAGGACTTTGAAA	0.383																																					.		.											.	DNAH9	168	0			c.1519-1G>T						.						80.0	81.0	81.0					17																	11535903		2203	4300	6503	SO:0001630	splice_region_variant	1770	exon8			TCTTCAGGACTTT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.1519-1G>T	17.37:g.11535903G>T		85.0	0.0		42.0	4.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Splice_Site	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.446187	0.43429	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6299	0.76899	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH9	11476628	1.000000	0.71417	0.997000	0.53966	0.454000	0.32378	7.402000	0.79972	2.427000	0.82271	0.650000	0.86243	.	.		0.383	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	Intron
DNAJC8	22826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	28536505	28536505	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:28536505C>A	ENST00000263697.4	-	5	403	c.377G>T	c.(376-378)gGa>gTa	p.G126V	DNAJC8_ENST00000489277.1_5'UTR	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8	126					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)				kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		GTATTCTTTTCCTGCCTGAAT	0.418																																					p.G126V		.											.	DNAJC8	90	0			c.G377T						.						128.0	111.0	116.0					1																	28536505		1894	4110	6004	SO:0001583	missense	22826	exon5			TCTTTTCCTGCCT	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698		"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product						11147971	Standard	NM_014280		Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.377G>T	1.37:g.28536505C>A	ENSP00000263697:p.Gly126Val	145.0	0.0		104.0	52.0	NM_014280	B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	Missense_Mutation	SNP	ENST00000263697.4	37	CCDS41292.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825055	0.90955	.	.	ENSG00000126698	ENST00000263697	T	0.66638	-0.22	6.05	6.05	0.98169	Heat shock protein DnaJ, N-terminal (1);	0.100125	0.64402	D	0.000002	T	0.71341	0.3328	L	0.60455	1.87	0.80722	D	1	P	0.47910	0.902	P	0.45856	0.495	T	0.73855	-0.3851	10	0.87932	D	0	-12.2956	20.5934	0.99428	0.0:1.0:0.0:0.0	.	126	O75937	DNJC8_HUMAN	V	126	ENSP00000263697:G126V	ENSP00000263697:G126V	G	-	2	0	DNAJC8	28409092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.396000	0.79891	2.872000	0.98467	0.650000	0.86243	GGA	.		0.418	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009860.1	NM_014280	
DOCK3	1795	bcgsc.ca;mdanderson.org	37	3	51398052	51398052	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:51398052C>T	ENST00000266037.9	+	47	5018	c.4995C>T	c.(4993-4995)acC>acT	p.T1665T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1665					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCAAGATGACCCACCGGCACA	0.537																																					p.T1665T		.											.	DOCK3	22	0			c.C4995T						.						39.0	39.0	39.0					3																	51398052		1897	4114	6011	SO:0001819	synonymous_variant	1795	exon47			GATGACCCACCGG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4995C>T	3.37:g.51398052C>T		46.0	1.0		35.0	16.0	NM_004947	O15017	Silent	SNP	ENST00000266037.9	37	CCDS46835.1																																																																																			.		0.537	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
DOCK6	57572	ucsc.edu;bcgsc.ca	37	19	11363499	11363499	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:11363499G>T	ENST00000294618.7	-	3	279	c.268C>A	c.(268-270)Cgg>Agg	p.R90R		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	90					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CGGCATTCCCGGGGCTGCAGC	0.632																																					p.R90R		.											.	DOCK6	93	0			c.C268A						.						24.0	27.0	26.0					19																	11363499		1891	4110	6001	SO:0001819	synonymous_variant	57572	exon3			ATTCCCGGGGCTG		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.268C>A	19.37:g.11363499G>T		114.0	0.0		50.0	4.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	CCDS45975.1																																																																																			.		0.632	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
ESRRA	2101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64082291	64082291	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:64082291G>T	ENST00000405666.1	+	5	884	c.650G>T	c.(649-651)gGc>gTc	p.G217V	ESRRA_ENST00000000442.6_Missense_Mutation_p.G217V|ESRRA_ENST00000406310.1_Missense_Mutation_p.G216V	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	217	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GACCCCGCAGGCCCTGATGGG	0.577																																					p.G217V		.											.	ESRRA	90	0			c.G650T						.						62.0	63.0	62.0					11																	64082291		2060	4218	6278	SO:0001583	missense	2101	exon5			CCGCAGGCCCTGA	X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.650G>T	11.37:g.64082291G>T	ENSP00000384851:p.Gly217Val	59.0	0.0		60.0	31.0	NM_004451	Q14514	Missense_Mutation	SNP	ENST00000405666.1	37	CCDS41667.1	.	.	.	.	.	.	.	.	.	.	G	1.675	-0.507963	0.04231	.	.	ENSG00000173153	ENST00000406310;ENST00000000442;ENST00000539594;ENST00000405666	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	3.99	3.99	0.46301	Nuclear hormone receptor, ligand-binding (2);	0.279419	0.37348	N	0.002138	T	0.14485	0.0350	N	0.02539	-0.55	0.48511	D	0.999663	B;B	0.16802	0.019;0.002	B;B	0.20955	0.032;0.0	T	0.09487	-1.0672	10	0.24483	T	0.36	.	9.2555	0.37581	0.0:0.0:0.7845:0.2155	.	216;217	P11474-2;P11474	.;ERR1_HUMAN	V	216;217;74;217	ENSP00000385971:G216V;ENSP00000000442:G217V;ENSP00000439896:G74V;ENSP00000384851:G217V	ENSP00000000442:G217V	G	+	2	0	ESRRA	63838867	1.000000	0.71417	0.994000	0.49952	0.716000	0.41182	2.988000	0.49386	2.232000	0.73038	0.462000	0.41574	GGC	.		0.577	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451	
FAM213B	127281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	2520399	2520399	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:2520399C>G	ENST00000378425.5	+	6	575	c.499C>G	c.(499-501)Cca>Gca	p.P167A	FAM213B_ENST00000484099.1_3'UTR|FAM213B_ENST00000419916.2_Missense_Mutation_p.P197A|FAM213B_ENST00000537325.1_Missense_Mutation_p.P160A|FAM213B_ENST00000444521.2_Missense_Mutation_p.P185A|FAM213B_ENST00000378424.4_Missense_Mutation_p.P204R			Q8TBF2	PGFS_HUMAN	family with sequence similarity 213, member B	167					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|myelin sheath (GO:0043209)	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|prostaglandin-F synthase activity (GO:0047017)	p.P167T(1)									CCAGAAGTCCCCAGGCGACTA	0.652																																					p.P215A		.											.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C643G						.						62.0	62.0	62.0					1																	2520399		2203	4300	6503	SO:0001583	missense	127281	exon6			AAGTCCCCAGGCG	AK075273	CCDS44.1, CCDS44.2, CCDS55564.1, CCDS72690.1, CCDS72691.1	1p36.32	2011-12-08	2011-11-24	2011-11-24	ENSG00000157870	ENSG00000157870	1.11.1.20		28390	protein-coding gene	gene with protein product	"""prostamide/prostaglandin F synthase"""		"""chromosome 1 open reading frame 93"""	C1orf93		18006499	Standard	NM_152371		Approved	MGC26818	uc001ajv.2	Q8TBF2	OTTHUMG00000000847	ENST00000378425.5:c.499C>G	1.37:g.2520399C>G	ENSP00000367682:p.Pro167Ala	108.0	0.0		88.0	41.0	NM_001195736	A8K793|B3KPY3|B4DQR9|B4E0S5|B7ZAC8|B9DI90|B9DI92|J3KQD0|Q8N2H0	Missense_Mutation	SNP	ENST00000378425.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.352|6.352	0.433117|0.433117	0.12045|0.12045	.|.	.|.	ENSG00000157870|ENSG00000157870	ENST00000419916;ENST00000537325;ENST00000378425;ENST00000444521|ENST00000378424	T;T;T;T|T	0.50548|0.50548	0.99;0.74;1.01;0.89|0.74	4.44|4.44	4.44|4.44	0.53790|0.53790	.|.	1.149570|1.149570	0.06726|0.06726	N|N	0.775697|0.775697	T|T	0.42381|0.42381	0.1200|0.1200	.|.	.|.	.|.	0.50632|0.50632	D|D	0.99988|0.99988	D;D;D;D;P|P	0.89917|0.36837	1.0;0.982;0.98;0.98;0.929|0.571	D;P;P;P;B|B	0.91635|0.33254	0.999;0.831;0.79;0.838;0.408|0.16	T|T	0.33033|0.33033	-0.9884|-0.9884	9|9	0.15952|0.56958	T|D	0.53|0.05	-3.3791|-3.3791	12.413|12.413	0.55478|0.55478	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	160;131;193;185;167|156	Q8TBF2-5;Q8TBF2-4;Q8TBF2-6;Q8TBF2-3;Q8TBF2|Q8TBF2-2	.;.;.;.;PGFS_HUMAN|.	A|R	197;160;167;185|204	ENSP00000394405:P197A;ENSP00000443605:P160A;ENSP00000367682:P167A;ENSP00000413218:P185A|ENSP00000367681:P204R	ENSP00000367682:P167A|ENSP00000367681:P204R	P|P	+|+	1|2	0|0	C1orf93|C1orf93	2510259|2510259	0.975000|0.975000	0.34042|0.34042	0.701000|0.701000	0.30321|0.30321	0.011000|0.011000	0.07611|0.07611	5.228000|5.228000	0.65310|0.65310	2.301000|2.301000	0.77427|0.77427	0.313000|0.313000	0.20887|0.20887	CCA|CCC	.		0.652	FAM213B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152371	
FBN3	84467	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8186181	8186181	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:8186181C>A	ENST00000600128.1	-	25	3586	c.3172G>T	c.(3172-3174)Ggc>Tgc	p.G1058C	FBN3_ENST00000601739.1_Missense_Mutation_p.G1058C|FBN3_ENST00000270509.2_Missense_Mutation_p.G1058C			Q75N90	FBN3_HUMAN	fibrillin 3	1058	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CTCTCGTAGCCGGGAAAACAC	0.622																																					p.G1058C		.											.	FBN3	100	0			c.G3172T						.						60.0	58.0	59.0					19																	8186181		2203	4300	6503	SO:0001583	missense	84467	exon24			CGTAGCCGGGAAA		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3172G>T	19.37:g.8186181C>A	ENSP00000470498:p.Gly1058Cys	137.0	0.0		75.0	42.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.906660	0.52333	.	.	ENSG00000142449	ENST00000270509	D	0.95377	-3.69	3.91	3.91	0.45181	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.98679	0.9557	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99782	1.1028	10	0.87932	D	0	.	16.2541	0.82503	0.0:1.0:0.0:0.0	.	1058	Q75N90	FBN3_HUMAN	C	1058	ENSP00000270509:G1058C	ENSP00000270509:G1058C	G	-	1	0	FBN3	8092181	1.000000	0.71417	0.302000	0.25058	0.049000	0.14656	7.356000	0.79445	1.901000	0.55032	0.289000	0.19496	GGC	.		0.622	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
FBXW4	6468	broad.mit.edu;bcgsc.ca	37	10	103371084	103371084	+	Silent	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:103371084A>G	ENST00000331272.7	-	9	1821	c.1203T>C	c.(1201-1203)tcT>tcC	p.S401S	FBXW4_ENST00000470093.1_5'UTR	NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	401					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		GGAGGTTGTAAGACAGGGCAG	0.602																																					p.S401S		.											.	FBXW4	226	0			c.T1203C						.						90.0	85.0	86.0					10																	103371084		2203	4300	6503	SO:0001819	synonymous_variant	6468	exon9			GTTGTAAGACAGG	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.1203T>C	10.37:g.103371084A>G		155.0	0.0		117.0	7.0	NM_022039	Q5SVS1|Q96IM6	Silent	SNP	ENST00000331272.7	37	CCDS31271.1																																																																																			.		0.602	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049979.2	NM_022039	
FLOT2	2319	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27210165	27210165	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:27210165C>T	ENST00000394908.4	-	4	411	c.307G>A	c.(307-309)Gtc>Atc	p.V103I	FLOT2_ENST00000394906.2_Missense_Mutation_p.V158I|FLOT2_ENST00000577789.1_5'UTR|FLOT2_ENST00000585169.1_Missense_Mutation_p.V103I	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	103					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GTCTGCAGGACGACGTTTTTG	0.577																																					p.V103I		.											.	FLOT2	522	0			c.G307A						.						96.0	110.0	105.0					17																	27210165		2027	4187	6214	SO:0001583	missense	2319	exon4			GCAGGACGACGTT	M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.307G>A	17.37:g.27210165C>T	ENSP00000378368:p.Val103Ile	50.0	1.0		54.0	28.0	NM_004475		Missense_Mutation	SNP	ENST00000394908.4	37	CCDS11245.2	.	.	.	.	.	.	.	.	.	.	C	12.03	1.817115	0.32145	.	.	ENSG00000132589	ENST00000394906;ENST00000394908	D;D	0.93019	-3.15;-3.15	5.67	5.67	0.87782	.	0.055433	0.64402	D	0.000001	T	0.81654	0.4868	N	0.01800	-0.715	0.42780	D	0.993863	B	0.02656	0.0	B	0.08055	0.003	T	0.78355	-0.2236	10	0.02654	T	1	-34.1168	18.7645	0.91866	0.0:1.0:0.0:0.0	.	103	Q14254	FLOT2_HUMAN	I	158;103	ENSP00000378366:V158I;ENSP00000378368:V103I	ENSP00000378366:V158I	V	-	1	0	FLOT2	24234291	0.996000	0.38824	0.998000	0.56505	0.981000	0.71138	3.193000	0.50997	2.687000	0.91594	0.563000	0.77884	GTC	.		0.577	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255935.3	NM_004475	
LRRC53	100144878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	74957805	74957805	+	Intron	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:74957805A>T	ENST00000294635.4	-	2	89				TNNI3K_ENST00000370891.2_Missense_Mutation_p.S837C|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.S850C|TNNI3K_ENST00000326637.3_Missense_Mutation_p.S736C			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						ATCAAGTAACAGCAGTGGGTC	0.453																																					p.S837C		.											.	.	.	0			c.A2509T						.						201.0	202.0	202.0					1																	74957805		2203	4300	6503	SO:0001627	intron_variant	100526835	exon25			AGTAACAGCAGTG			1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-8746T>A	1.37:g.74957805A>T		284.0	0.0		92.0	16.0	NM_001112808		Missense_Mutation	SNP	ENST00000294635.4	37		.	.	.	.	.	.	.	.	.	.	A	26.5	4.741355	0.89573	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.76060	-0.99;-0.99;-0.98	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.72637	0.3485	N	0.19112	0.55	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.85130	0.993;0.997	T	0.79339	-0.1844	10	0.72032	D	0.01	.	15.9579	0.79902	1.0:0.0:0.0:0.0	.	736;837	Q59H18;Q59H18-1	TNI3K_HUMAN;.	C	837;837;736	ENSP00000450895:S837C;ENSP00000359928:S837C;ENSP00000322251:S736C	ENSP00000322251:S736C	S	+	1	0	RP11-653A5.2;AC093158.1	74730393	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.464000	0.90380	2.178000	0.69098	0.533000	0.62120	AGC	.		0.453	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000026515.2		
GALT	2592	ucsc.edu;bcgsc.ca	37	9	34649406	34649406	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:34649406G>T	ENST00000378842.3	+	10	946		c.e10-1		GALT_ENST00000450095.2_Splice_Site|GALT_ENST00000488412.2_3'UTR|IL11RA_ENST00000555003.1_5'Flank|IL11RA_ENST00000441545.2_5'Flank|GALT_ENST00000556278.1_Intron	NM_000155.3	NP_000146.2	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase						carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)|UDP-glucose catabolic process (GO:0006258)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	UDP-glucose:hexose-1-phosphate uridylyltransferase activity (GO:0008108)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(2)|lung(5)|upper_aerodigestive_tract(1)	16	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CTTTCTGTCAGGGGCTCCCAC	0.537									Galactosemia																												.		.											.	GALT	90	0			c.905-1G>T						.						88.0	91.0	90.0					9																	34649406		2203	4300	6503	SO:0001630	splice_region_variant	2592	exon10	Familial Cancer Database	Galactose-1-Phosphate Uridyltransferase Deficiency	CTGTCAGGGGCTC	M60091	CCDS6565.1, CCDS59122.1	9p13	2013-01-08			ENSG00000213930	ENSG00000213930	2.7.7.12		4135	protein-coding gene	gene with protein product		606999					Standard	NM_000155		Approved		uc003zve.4	P07902	OTTHUMG00000019836	ENST00000378842.3:c.905-1G>T	9.37:g.34649406G>T		62.0	0.0		42.0	4.0	NM_000155	B4E097|E7ET32|Q14355|Q14356|Q14357|Q14358|Q14359|Q14360|Q14361|Q14363|Q14364|Q14365|Q14369|Q14370|Q14371|Q14372|Q14373|Q14374|Q14375|Q14377|Q14378|Q14380|Q14381|Q14382|Q14383|Q14384|Q14385|Q14386|Q14387|Q14389|Q16766|Q53XK1|Q5VZ81|Q96BY1	Splice_Site	SNP	ENST00000378842.3	37	CCDS6565.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107102	0.77096	.	.	ENSG00000213930	ENST00000450095;ENST00000378842	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2554	0.87055	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALT	34639406	1.000000	0.71417	0.991000	0.47740	0.945000	0.59286	7.305000	0.78891	2.492000	0.84095	0.561000	0.74099	.	.		0.537	GALT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052231.1	NM_000155	Intron
GAPDHS	26330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36033250	36033250	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:36033250C>A	ENST00000222286.4	+	5	595	c.479C>A	c.(478-480)gCt>gAt	p.A160D	AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000590125.1_RNA|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000590717.1_RNA	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	160					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCCTGGAGGGCTGTCGGGAGC	0.617																																					p.A160D		.											.	GAPDHS	226	0			c.C479A						.						50.0	49.0	50.0					19																	36033250		2203	4300	6503	SO:0001583	missense	26330	exon5			GGAGGGCTGTCGG	AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.479C>A	19.37:g.36033250C>A	ENSP00000222286:p.Ala160Asp	76.0	0.0		64.0	29.0	NM_014364	B2RC82|O60823|Q6JTT9|Q9HCU6	Missense_Mutation	SNP	ENST00000222286.4	37	CCDS12465.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.516631	0.00151	.	.	ENSG00000105679	ENST00000222286	T	0.38077	1.16	5.0	-1.92	0.07618	Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (2);NAD(P)-binding domain (1);	1.245240	0.05109	N	0.488559	T	0.13884	0.0336	N	0.02765	-0.5	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30621	-0.9972	10	0.02654	T	1	-0.1971	9.8314	0.40944	0.4736:0.4112:0.1152:0.0	.	160	O14556	G3PT_HUMAN	D	160	ENSP00000222286:A160D	ENSP00000222286:A160D	A	+	2	0	GAPDHS	40725090	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	1.012000	0.29924	-0.284000	0.09102	-2.780000	0.00118	GCT	.		0.617	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460423.1	NM_014364	
GLTSCR2	29997	ucsc.edu;bcgsc.ca	37	19	48255773	48255773	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:48255773C>T	ENST00000246802.5	+	6	712	c.674C>T	c.(673-675)cCa>cTa	p.P225L	GLTSCR2_ENST00000598681.1_3'UTR	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	225						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		CCACAGCGGCCAGCACGCCTG	0.657																																					p.P225L	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2	514	0			c.C674T						.						53.0	48.0	50.0					19																	48255773		2203	4300	6503	SO:0001583	missense	29997	exon6			AGCGGCCAGCACG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.674C>T	19.37:g.48255773C>T	ENSP00000246802:p.Pro225Leu	36.0	0.0		36.0	4.0	NM_015710	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.150862	0.57151	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.59224	0.28	4.08	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.74191	0.3684	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.994;0.996	T	0.77734	-0.2477	10	0.87932	D	0	-19.6839	11.953	0.52966	0.0:1.0:0.0:0.0	.	225;225;223	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	L	225	ENSP00000246802:P225L	ENSP00000246802:P225L	P	+	2	0	GLTSCR2	52947585	0.999000	0.42202	0.919000	0.36401	0.128000	0.20619	5.573000	0.67417	2.275000	0.75901	0.455000	0.32223	CCA	.		0.657	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
GPR158	57512	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	25883311	25883311	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:25883311G>T	ENST00000376351.3	+	9	2342	c.1983G>T	c.(1981-1983)ttG>ttT	p.L661F	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	661					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCATTGGGTTGCTTTTGATTC	0.338																																					p.L661F		.											.	GPR158	141	0			c.G1983T						.						181.0	166.0	171.0					10																	25883311		2203	4300	6503	SO:0001583	missense	57512	exon9			TGGGTTGCTTTTG	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1983G>T	10.37:g.25883311G>T	ENSP00000365529:p.Leu661Phe	141.0	2.0		79.0	17.0	NM_020752	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569936	0.65765	.	.	ENSG00000151025	ENST00000376351	D	0.89123	-2.47	5.77	3.71	0.42584	GPCR, family 3, C-terminal (2);	0.111076	0.38720	N	0.001599	D	0.93609	0.7959	M	0.86343	2.81	0.53688	D	0.999973	D	0.89917	1.0	D	0.97110	1.0	D	0.92820	0.6271	10	0.62326	D	0.03	.	6.419	0.21732	0.3196:0.0:0.6804:0.0	.	661	Q5T848	GP158_HUMAN	F	661	ENSP00000365529:L661F	ENSP00000365529:L661F	L	+	3	2	GPR158	25923317	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.372000	0.44257	1.432000	0.47375	0.650000	0.86243	TTG	.		0.338	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
GPR180	160897	broad.mit.edu;bcgsc.ca	37	13	95257737	95257737	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr13:95257737C>A	ENST00000376958.4	+	2	263	c.238C>A	c.(238-240)Cta>Ata	p.L80I		NM_180989.5	NP_851320.1	Q86V85	GP180_HUMAN	G protein-coupled receptor 180	80					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	10	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CCAGGAATGGCTAAAGCTACA	0.393																																					p.L80I		.											.	GPR180	153	0			c.C238A						.						120.0	108.0	112.0					13																	95257737		2203	4300	6503	SO:0001583	missense	160897	exon2			GAATGGCTAAAGC	AF339823	CCDS9472.1	13q32.1	2006-04-05			ENSG00000152749	ENSG00000152749			28899	protein-coding gene	gene with protein product	"""intimal thickness related receptor"""	607787				12538434	Standard	NM_180989		Approved	ITR	uc001vly.3	Q86V85	OTTHUMG00000017207	ENST00000376958.4:c.238C>A	13.37:g.95257737C>A	ENSP00000366157:p.Leu80Ile	208.0	0.0		298.0	14.0	NM_180989	A8K1D5	Missense_Mutation	SNP	ENST00000376958.4	37	CCDS9472.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441509	0.25900	.	.	ENSG00000152749	ENST00000376958	T	0.45276	0.9	5.9	5.06	0.68205	.	0.542116	0.18643	N	0.135258	T	0.29093	0.0723	L	0.27053	0.805	0.29538	N	0.852277	B	0.18863	0.031	B	0.09377	0.004	T	0.15809	-1.0424	10	0.27785	T	0.31	-0.0432	10.5602	0.45142	0.0:0.7984:0.1326:0.069	.	80	Q86V85	GP180_HUMAN	I	80	ENSP00000366157:L80I	ENSP00000366157:L80I	L	+	1	2	GPR180	94055738	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	2.218000	0.42889	1.505000	0.48720	-0.142000	0.14014	CTA	.		0.393	GPR180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045465.3	NM_180989	
GRIN2B	2904	ucsc.edu;bcgsc.ca	37	12	13906561	13906561	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:13906561T>C	ENST00000609686.1	-	3	909	c.700A>G	c.(700-702)Aag>Gag	p.K234E		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	234					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTTCTTCCTTGGTACAGTAA	0.507																																					p.K234E		.											.	GRIN2B	231	0			c.A700G						.						135.0	135.0	135.0					12																	13906561		2203	4300	6503	SO:0001583	missense	2904	exon3			CTTCCTTGGTACA		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.700A>G	12.37:g.13906561T>C	ENSP00000477455:p.Lys234Glu	80.0	0.0		43.0	4.0	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.693648	0.88735	.	.	ENSG00000150086	ENST00000279593	D	0.92545	-3.06	5.46	5.46	0.80206	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.95255	0.8461	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.94376	0.7600	10	0.33141	T	0.24	.	15.5352	0.75996	0.0:0.0:0.0:1.0	.	234	Q13224	NMDE2_HUMAN	E	234	ENSP00000279593:K234E	ENSP00000279593:K234E	K	-	1	0	GRIN2B	13797828	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.973000	0.88032	2.068000	0.61886	0.459000	0.35465	AAG	.		0.507	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
GRIN3A	116443	ucsc.edu;bcgsc.ca	37	9	104433345	104433345	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:104433345C>A	ENST00000361820.3	-	3	1949	c.1349G>T	c.(1348-1350)aGa>aTa	p.R450I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	450					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ACCTTTTACTCTGATGGAACC	0.473																																					p.R450I		.											.	GRIN3A	96	0			c.G1349T						.						120.0	122.0	121.0					9																	104433345		2203	4300	6503	SO:0001583	missense	116443	exon3			TTTACTCTGATGG		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1349G>T	9.37:g.104433345C>A	ENSP00000355155:p.Arg450Ile	185.0	0.0		43.0	4.0	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.327742	0.24080	.	.	ENSG00000198785	ENST00000361820	D	0.86164	-2.08	5.76	-6.48	0.01896	.	0.891156	0.09864	N	0.745807	T	0.73869	0.3642	N	0.22421	0.69	0.38291	D	0.94269	B	0.09022	0.002	B	0.06405	0.002	T	0.43829	-0.9367	10	0.39692	T	0.17	.	9.284	0.37746	0.0:0.4787:0.1118:0.4095	.	450	Q8TCU5	NMD3A_HUMAN	I	450	ENSP00000355155:R450I	ENSP00000355155:R450I	R	-	2	0	GRIN3A	103473166	0.897000	0.30589	0.956000	0.39512	0.988000	0.76386	-0.083000	0.11286	-0.820000	0.04318	-0.290000	0.09829	AGA	.		0.473	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
GSG2	83903	ucsc.edu;bcgsc.ca	37	17	3627867	3627867	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:3627867A>G	ENST00000325418.4	+	1	657	c.638A>G	c.(637-639)gAc>gGc	p.D213G	CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_5'UTR	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	213					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										GTCTCCCTGGACCGAGCATCT	0.637																																					p.D213G		.											.	GSG2	297	0			c.A638G						.						67.0	75.0	72.0					17																	3627867		2203	4300	6503	SO:0001583	missense	83903	exon1			CCCTGGACCGAGC	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.638A>G	17.37:g.3627867A>G	ENSP00000325290:p.Asp213Gly	104.0	0.0		53.0	6.0	NM_031965	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.241730	0.39598	.	.	ENSG00000177602	ENST00000325418	T	0.06528	3.29	3.37	1.9	0.25705	.	0.634493	0.13777	N	0.363496	T	0.04407	0.0121	N	0.24115	0.695	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.37572	-0.9700	10	0.87932	D	0	-33.8072	4.8744	0.13650	0.6014:0.0:0.3986:0.0	.	213	Q8TF76	HASP_HUMAN	G	213	ENSP00000325290:D213G	ENSP00000325290:D213G	D	+	2	0	GSG2	3574616	0.002000	0.14202	0.012000	0.15200	0.225000	0.24961	0.040000	0.13905	0.454000	0.26884	0.533000	0.62120	GAC	.		0.637	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
HEXIM2	124790	ucsc.edu;bcgsc.ca	37	17	43240204	43240204	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:43240204C>A	ENST00000307275.3	+	3	480	c.44C>A	c.(43-45)cCa>cAa	p.P15Q	HEXIM2_ENST00000591576.1_Missense_Mutation_p.P15Q|AC002117.1_ENST00000589950.1_RNA|HEXIM2_ENST00000592695.1_Missense_Mutation_p.P15Q	NM_144608.1	NP_653209.1	Q96MH2	HEXI2_HUMAN	hexamethylene bis-acetamide inducible 2	15					negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			endometrium(1)|large_intestine(3)|lung(1)	5						GCAGAGTCACCAGTGGCCCTG	0.562																																					p.P15Q		.											.	HEXIM2	90	0			c.C44A						.						89.0	88.0	89.0					17																	43240204		2203	4300	6503	SO:0001583	missense	124790	exon3			AGTCACCAGTGGC	AK056946	CCDS11496.1	17q21.31	2011-07-29	2011-07-29			ENSG00000168517			28591	protein-coding gene	gene with protein product		615695				12832472	Standard	NM_144608		Approved	FLJ32384	uc002iih.1	Q96MH2		ENST00000307275.3:c.44C>A	17.37:g.43240204C>A	ENSP00000302276:p.Pro15Gln	34.0	0.0		36.0	4.0	NM_144608	D3DX66	Missense_Mutation	SNP	ENST00000307275.3	37	CCDS11496.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.610669	0.28712	.	.	ENSG00000168517	ENST00000307275	.	.	.	4.09	4.09	0.47781	.	0.524866	0.17764	N	0.162800	T	0.46464	0.1394	L	0.57536	1.79	0.09310	N	1	P	0.52061	0.95	P	0.48227	0.571	T	0.43540	-0.9385	9	0.72032	D	0.01	-3.4051	12.0976	0.53763	0.0:1.0:0.0:0.0	.	15	Q96MH2	HEXI2_HUMAN	Q	15	.	ENSP00000302276:P15Q	P	+	2	0	HEXIM2	40595987	0.008000	0.16893	0.008000	0.14137	0.056000	0.15407	2.926000	0.48892	2.570000	0.86706	0.655000	0.94253	CCA	.		0.562	HEXIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450181.1	NM_144608	
HPN	3249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35556780	35556780	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:35556780C>T	ENST00000262626.2	+	12	1884	c.1059C>T	c.(1057-1059)agC>agT	p.S353S	HPN_ENST00000597419.1_Silent_p.S195S|HPN_ENST00000392226.1_Silent_p.S353S|HPN-AS1_ENST00000392227.2_RNA	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	353	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	AGGGCGACAGCGGTGGTCCCT	0.657																																					p.S353S		.											.	HPN	515	0			c.C1059T						.						78.0	78.0	78.0					19																	35556780		2203	4300	6503	SO:0001819	synonymous_variant	3249	exon12			CGACAGCGGTGGT		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.1059C>T	19.37:g.35556780C>T		105.0	0.0		111.0	53.0	NM_182983	B2RDS4	Silent	SNP	ENST00000262626.2	37	CCDS32993.1																																																																																			.		0.657	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151	
IDH2	3418	ucsc.edu;bcgsc.ca	37	15	90628327	90628327	+	Missense_Mutation	SNP	G	G	A	rs368451876		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:90628327G>A	ENST00000330062.3	-	9	1197	c.1084C>T	c.(1084-1086)Cgg>Tgg	p.R362W	IDH2_ENST00000559482.1_Missense_Mutation_p.R253W|IDH2_ENST00000539790.1_Missense_Mutation_p.R232W|RP11-617F23.1_ENST00000558334.1_RNA|IDH2_ENST00000540499.2_Missense_Mutation_p.R310W	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	362					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CTGGTGGGCCGGCCCTGGGGA	0.667			M		GBM																																p.R362W		.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	.	IDH2	15118	0			c.C1084T						.	G	TRP/ARG	1,4399	2.1+/-5.4	0,1,2199	45.0	50.0	48.0		1084	5.4	1.0	15		48	0,8596		0,0,4298	no	missense	IDH2	NM_002168.2	101	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	362/453	90628327	1,12995	2200	4298	6498	SO:0001583	missense	3418	exon9			TGGGCCGGCCCTG		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.1084C>T	15.37:g.90628327G>A	ENSP00000331897:p.Arg362Trp	58.0	0.0		28.0	4.0	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	37	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197634	0.79015	2.27E-4	0.0	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	T;T;T	0.76968	-1.06;-1.06;-1.06	5.44	5.44	0.79542	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	T	0.78509	0.4294	L	0.60067	1.865	0.58432	D	0.999991	D;D	0.71674	0.997;0.998	P;P	0.49085	0.551;0.6	T	0.81138	-0.1069	10	0.87932	D	0	.	11.8019	0.52133	0.0:0.0:0.8246:0.1754	.	362;362	Q53GL5;P48735	.;IDHP_HUMAN	W	362;232;310	ENSP00000331897:R362W;ENSP00000438457:R232W;ENSP00000446147:R310W	ENSP00000331897:R362W	R	-	1	2	IDH2	88429331	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.954000	0.56708	2.550000	0.86006	0.462000	0.41574	CGG	.		0.667	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
IFIT3	3437	ucsc.edu;bcgsc.ca	37	10	91099876	91099876	+	Silent	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:91099876A>G	ENST00000371818.4	+	2	1644	c.1464A>G	c.(1462-1464)caA>caG	p.Q488Q	IFIT3_ENST00000371811.4_Silent_p.Q488Q|LIPA_ENST00000487618.1_Intron|LIPA_ENST00000371837.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	488					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						ACTCAGAGCAACTGAACTGAG	0.547																																					p.Q488Q		.											.	IFIT3	90	0			c.A1464G						.						42.0	46.0	45.0					10																	91099876		2203	4300	6503	SO:0001819	synonymous_variant	3437	exon2			AGAGCAACTGAAC	U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.1464A>G	10.37:g.91099876A>G		74.0	0.0		37.0	4.0	NM_001549	Q99634|Q9BSK7	Silent	SNP	ENST00000371818.4	37	CCDS7402.1																																																																																			.		0.547	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1	NM_001549	
IFNA2	3440	ucsc.edu;bcgsc.ca	37	9	21385252	21385252	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:21385252A>G	ENST00000380206.2	-	1	144	c.77T>C	c.(76-78)cTg>cCg	p.L26P		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	26					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GGTTTGAGGCAGATCACAGCC	0.527																																					p.L26P		.											.	IFNA2	153	0			c.T77C						.						114.0	105.0	108.0					9																	21385252		2203	4300	6503	SO:0001583	missense	3440	exon1			TGAGGCAGATCAC		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.77T>C	9.37:g.21385252A>G	ENSP00000369554:p.Leu26Pro	159.0	0.0		42.0	4.0	NM_000605	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	ENST00000380206.2	37	CCDS6506.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.088009	0.36855	.	.	ENSG00000188379	ENST00000380206	T	0.14144	2.53	3.24	2.04	0.26737	.	0.389480	0.23803	N	0.044413	T	0.30634	0.0771	M	0.74258	2.255	0.19945	N	0.999944	B	0.30763	0.294	P	0.55112	0.769	T	0.39396	-0.9616	10	0.59425	D	0.04	.	3.7247	0.08470	0.5496:0.2288:0.0:0.2216	.	26	Q6DJX8	.	P	26	ENSP00000369554:L26P	ENSP00000369554:L26P	L	-	2	0	IFNA2	21375252	1.000000	0.71417	0.010000	0.14722	0.176000	0.22953	3.115000	0.50391	0.317000	0.23160	0.397000	0.26171	CTG	.		0.527	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605	
IL17RA	23765	ucsc.edu;bcgsc.ca	37	22	17585699	17585699	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr22:17585699A>G	ENST00000319363.6	+	9	1063	c.930A>G	c.(928-930)ccA>ccG	p.P310P		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	310					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		CAGACACTCCAGGTAGGGGAC	0.597																																					p.P310P		.											.	IL17RA	92	0			c.A930G						.						72.0	60.0	64.0					22																	17585699		2203	4300	6503	SO:0001630	splice_region_variant	23765	exon9			CACTCCAGGTAGG	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.931+1A>G	22.37:g.17585699A>G		40.0	1.0		38.0	4.0	NM_014339	O43844|Q20WK1	Silent	SNP	ENST00000319363.6	37	CCDS13739.1																																																																																			.		0.597	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	Silent
IL21R	50615	broad.mit.edu;bcgsc.ca	37	16	27454318	27454318	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr16:27454318T>C	ENST00000337929.3	+	5	861	c.388T>C	c.(388-390)Ttc>Ctc	p.F130L	IL21R_ENST00000564089.1_Missense_Mutation_p.F130L|IL21R_ENST00000395755.1_Missense_Mutation_p.F130L|IL21R_ENST00000395754.4_Missense_Mutation_p.F130L	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	130	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						GACTGTGACCTTCTCAGGACA	0.493			T	BCL6	NHL																																p.F152L		.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	660	0			c.T454C						.						124.0	121.0	122.0					16																	27454318		2197	4300	6497	SO:0001583	missense	50615	exon6			GTGACCTTCTCAG	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.388T>C	16.37:g.27454318T>C	ENSP00000338010:p.Phe130Leu	178.0	1.0		129.0	8.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483889	0.63962	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	D;D;D	0.95482	-3.72;-3.72;-3.72	4.7	3.61	0.41365	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.414475	0.27447	N	0.019329	D	0.92609	0.7652	L	0.55103	1.725	0.43628	D	0.996018	P	0.42248	0.774	P	0.44946	0.465	D	0.87507	0.2437	10	0.11794	T	0.64	-27.2141	6.7672	0.23573	0.0:0.1083:0.0:0.8917	.	130	Q9HBE5	IL21R_HUMAN	L	130	ENSP00000338010:F130L;ENSP00000379104:F130L;ENSP00000379103:F130L	ENSP00000338010:F130L	F	+	1	0	IL21R	27361819	1.000000	0.71417	0.957000	0.39632	0.461000	0.32589	1.880000	0.39628	0.665000	0.31066	0.397000	0.26171	TTC	.		0.493	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
IQUB	154865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123143008	123143008	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:123143008C>T	ENST00000466202.1	-	5	1433	c.857G>A	c.(856-858)aGg>aAg	p.R286K	IQUB_ENST00000488987.1_5'UTR|IQUB_ENST00000434450.1_Missense_Mutation_p.R286K|IQUB_ENST00000324698.6_Missense_Mutation_p.R286K	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	286					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						CTGCGTATCCCTACAAAATAT	0.343																																					p.R286K		.											.	IQUB	156	0			c.G857A						.						111.0	109.0	109.0					7																	123143008		2203	4300	6503	SO:0001583	missense	154865	exon5			GTATCCCTACAAA	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.857G>A	7.37:g.123143008C>T	ENSP00000417769:p.Arg286Lys	176.0	1.0		77.0	48.0	NM_178827	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	37	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785395	0.90282	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.62788	1.07;1.07;0.0	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	M	0.87758	2.905	0.52099	D	0.99994	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.973	D	0.84288	0.0498	10	0.56958	D	0.05	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	286;286	Q8NA54-2;Q8NA54	.;IQUB_HUMAN	K	286	ENSP00000417769:R286K;ENSP00000324882:R286K;ENSP00000388498:R286K	ENSP00000324882:R286K	R	-	2	0	IQUB	122930244	0.995000	0.38212	1.000000	0.80357	0.783000	0.44284	2.517000	0.45529	2.725000	0.93324	0.655000	0.94253	AGG	.		0.343	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
IRGQ	126298	ucsc.edu;bcgsc.ca	37	19	44099395	44099395	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:44099395C>T	ENST00000602269.1	-	1	281	c.96G>A	c.(94-96)gtG>gtA	p.V32V	ZNF576_ENST00000528387.1_5'Flank|SRRM5_ENST00000526798.1_5'Flank|IRGQ_ENST00000601520.1_5'Flank|ZNF576_ENST00000533118.1_5'Flank|IRGQ_ENST00000422989.1_Silent_p.V32V|SRRM5_ENST00000607544.1_5'Flank|ZNF576_ENST00000525771.1_5'Flank|ZNF576_ENST00000391965.2_5'Flank|ZNF576_ENST00000336564.4_5'Flank|ZNF576_ENST00000529930.1_5'Flank|L34079.2_ENST00000594374.1_5'Flank			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	32										endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CGAGCGTCTCCACATCCTTGT	0.701																																					p.V32V		.											.	IRGQ	92	0			c.G96A						.						22.0	22.0	22.0					19																	44099395		2150	4195	6345	SO:0001819	synonymous_variant	126298	exon2			CGTCTCCACATCC	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.96G>A	19.37:g.44099395C>T		42.0	0.0		45.0	4.0	NM_001007561	B2RNP3	Silent	SNP	ENST00000602269.1	37	CCDS33040.1																																																																																			.		0.701	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
ITGA2	3673	ucsc.edu;bcgsc.ca	37	5	52353865	52353865	+	Silent	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:52353865A>G	ENST00000296585.5	+	10	1250	c.1107A>G	c.(1105-1107)caA>caG	p.Q369Q		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	369					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				GTACTGTTCAAGGAGGAGACA	0.373																																					p.Q369Q		.											.	ITGA2	226	0			c.A1107G						.						116.0	107.0	110.0					5																	52353865		2203	4300	6503	SO:0001819	synonymous_variant	3673	exon10			TGTTCAAGGAGGA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.1107A>G	5.37:g.52353865A>G		145.0	0.0		31.0	4.0	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																			.		0.373	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
KATNAL2	83473	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	44625671	44625671	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr18:44625671C>A	ENST00000245121.5	+	13	1247	c.1053C>A	c.(1051-1053)ccC>ccA	p.P351P	KATNAL2_ENST00000356157.7_Silent_p.P423P	NM_031303.2	NP_112593.2			katanin p60 subunit A-like 2											central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						TCGATCTCCCCAGCCGGGAGG	0.592																																					p.P351P		.											.	KATNAL2	93	0			c.C1053A						.						68.0	64.0	65.0					18																	44625671		2203	4300	6503	SO:0001819	synonymous_variant	83473	exon13			TCTCCCCAGCCGG	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000245121.5:c.1053C>A	18.37:g.44625671C>A		124.0	0.0		99.0	12.0	NM_031303		Silent	SNP	ENST00000245121.5	37	CCDS32828.1																																																																																			.		0.592	KATNAL2-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446138.2	NM_031303	
KCNIP2	30819	ucsc.edu;bcgsc.ca	37	10	103588929	103588929	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:103588929G>T	ENST00000356640.2	-	4	526	c.251C>A	c.(250-252)tCc>tAc	p.S84Y	KCNIP2_ENST00000353068.3_Missense_Mutation_p.S34Y|KCNIP2_ENST00000370046.1_Missense_Mutation_p.S34Y|KCNIP2_ENST00000343195.4_Missense_Mutation_p.S34Y|KCNIP2_ENST00000461105.1_Missense_Mutation_p.S99Y|KCNIP2_ENST00000348850.5_Missense_Mutation_p.S39Y|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000358038.3_Missense_Mutation_p.S66Y	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	84	EF-hand 1; degenerate. {ECO:0000255|PROSITE-ProRule:PRU00448}.				clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		ACACACGGTGGACAATTCAAA	0.607																																					p.S99Y		.											.	KCNIP2	90	0			c.C296A						.						67.0	55.0	59.0					10																	103588929		2203	4300	6503	SO:0001583	missense	30819	exon4			ACGGTGGACAATT		CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.251C>A	10.37:g.103588929G>T	ENSP00000349055:p.Ser84Tyr	43.0	0.0		32.0	4.0	NM_014591	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	ENST00000356640.2	37	CCDS7522.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.8|25.8	4.671360|4.671360	0.88348|0.88348	.|.	.|.	ENSG00000120049|ENSG00000120049	ENST00000359877;ENST00000434163|ENST00000348850;ENST00000358038;ENST00000370059;ENST00000356640;ENST00000370046;ENST00000353068;ENST00000461105;ENST00000343195;ENST00000239117	T|T;T;T;T;T;T;T;T	0.74106|0.70749	-0.81|-0.34;-0.51;-0.39;-0.3;-0.29;-0.46;-0.29;-0.32	4.86|4.86	3.93|3.93	0.45458|0.45458	.|.	.|0.137741	.|0.49916	.|D	.|0.000134	T|T	0.81479|0.81479	0.4831|0.4831	M|M	0.78801|0.78801	2.425|2.425	0.47276|0.47276	D|D	0.999371|0.999371	B;B|P;P;P;P;P;D;P;B;P;P	0.25609|0.55385	0.079;0.13|0.58;0.943;0.636;0.503;0.636;0.971;0.522;0.09;0.524;0.737	B;B|B;P;P;B;P;P;P;P;P;B	0.24848|0.58873	0.025;0.056|0.424;0.707;0.509;0.311;0.509;0.847;0.771;0.575;0.498;0.418	D|D	0.84202|0.84202	0.0451|0.0451	9|10	0.62326|0.87932	D|D	0.03|0	.|.	14.5422|14.5422	0.68002|0.68002	0.0:0.1478:0.8522:0.0|0.0:0.1478:0.8522:0.0	.|.	6;15|34;39;34;34;34;66;34;99;84;39	B3KSZ5;Q9NS61-8|Q9NS61-9;B4DW99;Q9NS61-5;Q3YAC7;Q9NS61-3;Q9NS61-2;Q9NS61-7;Q9NS61-6;Q9NS61;Q3YAC6	.;.|.;.;.;.;.;.;.;.;KCIP2_HUMAN;.	T|Y	6;15|39;66;66;84;34;34;99;34;34	ENSP00000411679:P15T|ENSP00000239118:S39Y;ENSP00000350733:S66Y;ENSP00000349055:S84Y;ENSP00000359063:S34Y;ENSP00000341624:S34Y;ENSP00000420040:S99Y;ENSP00000344169:S34Y;ENSP00000239117:S34Y	ENSP00000352940:P6T|ENSP00000239117:S34Y	P|S	-|-	1|2	0|0	KCNIP2|KCNIP2	103578919|103578919	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.990000|0.990000	0.78478|0.78478	6.651000|6.651000	0.74372|0.74372	1.013000|1.013000	0.39391|0.39391	0.561000|0.561000	0.74099|0.74099	CCA|TCC	.		0.607	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049973.1		
KCTD8	386617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	44177219	44177219	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr4:44177219T>C	ENST00000360029.3	-	2	1293	c.1010A>G	c.(1009-1011)aAa>aGa	p.K337R		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	337					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTTGTCATGTTTCCTATCTTC	0.408										HNSCC(17;0.042)																											p.K337R		.											.	KCTD8	92	0			c.A1010G						.						119.0	112.0	114.0					4																	44177219		2203	4300	6503	SO:0001583	missense	386617	exon2			TCATGTTTCCTAT	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1010A>G	4.37:g.44177219T>C	ENSP00000353129:p.Lys337Arg	149.0	0.0		106.0	40.0	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.13|18.13	3.556000|3.556000	0.65425|0.65425	.|.	.|.	ENSG00000183783|ENSG00000183783	ENST00000360029|ENST00000515268	T|.	0.39787|.	1.06|.	4.65|4.65	4.65|4.65	0.58169|0.58169	.|.	0.000000|.	0.51477|.	D|.	0.000081|.	T|T	0.44540|0.44540	0.1298|0.1298	N|N	0.19112|0.19112	0.55|0.55	0.37078|0.37078	D|D	0.898854|0.898854	B|.	0.33739|.	0.422|.	B|.	0.29598|.	0.104|.	T|T	0.48801|0.48801	-0.9003|-0.9003	10|5	0.72032|.	D|.	0.01|.	.|.	13.6861|13.6861	0.62517|0.62517	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	337|.	Q6ZWB6|.	KCTD8_HUMAN|.	R|D	337|73	ENSP00000353129:K337R|.	ENSP00000353129:K337R|.	K|N	-|-	2|1	0|0	KCTD8|KCTD8	43871976|43871976	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.945000|0.945000	0.59286|0.59286	6.590000|6.590000	0.74085|0.74085	2.078000|2.078000	0.62432|0.62432	0.477000|0.477000	0.44152|0.44152	AAA|AAC	.		0.408	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
KDM2B	84678	ucsc.edu;bcgsc.ca	37	12	121947800	121947800	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:121947800G>T	ENST00000377071.4	-	11	1289	c.1217C>A	c.(1216-1218)tCc>tAc	p.S406Y	KDM2B_ENST00000377069.4_Missense_Mutation_p.S375Y|KDM2B_ENST00000538046.2_Missense_Mutation_p.S316Y|KDM2B_ENST00000536437.1_Missense_Mutation_p.S289Y|KDM2B_ENST00000542973.1_5'Flank	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	406					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						CTCCAGCCAGGAATCCGAAGA	0.622																																					p.S406Y		.											.	KDM2B	638	0			c.C1217A						.						34.0	39.0	38.0					12																	121947800		1973	4148	6121	SO:0001583	missense	84678	exon11			AGCCAGGAATCCG	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1217C>A	12.37:g.121947800G>T	ENSP00000366271:p.Ser406Tyr	67.0	0.0		39.0	4.0	NM_032590	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	ENST00000377071.4	37	CCDS41850.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608670	0.87258	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000261824;ENST00000446152;ENST00000542030	T;T;T;T;T	0.48201	2.42;1.83;0.83;0.83;0.82	5.25	5.25	0.73442	.	0.000000	0.56097	D	0.000035	T	0.66107	0.2756	L	0.60455	1.87	0.52501	D	0.999951	D;D;D;D	0.76494	0.999;0.99;0.99;0.99	D;P;P;P	0.68192	0.956;0.797;0.797;0.797	T	0.66646	-0.5871	10	0.56958	D	0.05	-23.949	19.2413	0.93886	0.0:0.0:1.0:0.0	.	406;289;406;375	E7EML5;Q1RLM7;Q8NHM5;A8MRS1	.;.;KDM2B_HUMAN;.	Y	406;375;406;289;406;406;369;108	ENSP00000366269:S375Y;ENSP00000366271:S406Y;ENSP00000445196:S289Y;ENSP00000398279:S369Y;ENSP00000444846:S108Y	ENSP00000261824:S406Y	S	-	2	0	KDM2B	120432183	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.518000	0.90559	2.636000	0.89361	0.655000	0.94253	TCC	.		0.622	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402132.2	NM_032590	
KDM5B	10765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202702803	202702803	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:202702803C>A	ENST00000367265.3	-	23	4799	c.3635G>T	c.(3634-3636)gGc>gTc	p.G1212V	KDM5B_ENST00000367264.2_Missense_Mutation_p.G1248V	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1212					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GATTCGCAGGCCCTGTGAAAT	0.542																																					p.G1212V		.											.	KDM5B	273	0			c.G3635T						.						52.0	53.0	52.0					1																	202702803		2203	4300	6503	SO:0001583	missense	10765	exon23			CGCAGGCCCTGTG	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3635G>T	1.37:g.202702803C>A	ENSP00000356234:p.Gly1212Val	79.0	0.0		72.0	28.0	NM_006618	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	9.110	1.006216	0.19199	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.87966	-2.32;-2.32;-2.32	6.09	4.01	0.46588	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.449783	0.28871	N	0.013866	D	0.84826	0.5558	M	0.77486	2.375	0.47778	D	0.999517	B;B	0.27853	0.191;0.075	B;B	0.23275	0.045;0.039	T	0.79245	-0.1883	10	0.33141	T	0.24	-5.713	9.5632	0.39383	0.0:0.7531:0.0:0.2469	.	1248;1212	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	V	1212;1054;1248;1054	ENSP00000356234:G1212V;ENSP00000356233:G1248V;ENSP00000235790:G1054V	ENSP00000235790:G1054V	G	-	2	0	KDM5B	200969426	0.422000	0.25473	0.008000	0.14137	0.792000	0.44763	0.865000	0.27940	0.717000	0.32145	0.643000	0.83706	GGC	.		0.542	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10602767	10602767	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:10602767C>A	ENST00000171111.5	-	3	1358	c.811G>T	c.(811-813)Gtg>Ttg	p.V271L	KEAP1_ENST00000393623.2_Missense_Mutation_p.V271L|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	271	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TGGCAGCGCACGGCCCGCAGC	0.617																																					p.V271L		.											.	KEAP1	637	0			c.G811T						.						57.0	57.0	57.0					19																	10602767		2203	4300	6503	SO:0001583	missense	9817	exon3			AGCGCACGGCCCG	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.811G>T	19.37:g.10602767C>A	ENSP00000171111:p.Val271Leu	68.0	0.0		45.0	35.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208480	0.95069	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.76316	-1.01;-1.01	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.056422	0.64402	N	0.000001	D	0.84897	0.5574	M	0.82630	2.6	0.80722	D	1	P	0.52170	0.951	P	0.50270	0.636	D	0.87391	0.2363	10	0.87932	D	0	.	17.1459	0.86766	0.0:1.0:0.0:0.0	.	271	Q14145	KEAP1_HUMAN	L	271	ENSP00000171111:V271L;ENSP00000377245:V271L	ENSP00000171111:V271L	V	-	1	0	KEAP1	10463767	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	5.874000	0.69652	2.656000	0.90262	0.561000	0.74099	GTG	.		0.617	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
ICE1	23379	broad.mit.edu;bcgsc.ca	37	5	5466617	5466617	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:5466617T>C	ENST00000296564.7	+	14	6283		c.e14+2			NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN							positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TTAAAGAAGGTATGCTTAGAT	0.388																																					.		.											.	KIAA0947	48	0			c.6061+2T>C						.						134.0	122.0	126.0					5																	5466617		1858	4085	5943	SO:0001630	splice_region_variant	23379	exon14			AGAAGGTATGCTT																												ENST00000296564.7:c.6061+2T>C	5.37:g.5466617T>C		95.0	1.0		129.0	7.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Splice_Site	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.999337	0.74818	.	.	ENSG00000164151	ENST00000296564	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8483	0.63481	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA0947	5519617	1.000000	0.71417	0.930000	0.37139	0.795000	0.44927	6.917000	0.75782	2.161000	0.67846	0.455000	0.32223	.	.		0.388	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		Intron
KIF13A	63971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	17764367	17764367	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:17764367C>A	ENST00000259711.6	-	39	5497	c.5392G>T	c.(5392-5394)Gcc>Tcc	p.A1798S	KIF13A_ENST00000378814.5_Intron|KIF13A_ENST00000378843.2_Missense_Mutation_p.A1750S|KIF13A_ENST00000378826.2_Missense_Mutation_p.A1763S|KIF13A_ENST00000378816.5_Missense_Mutation_p.A1763S	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1798					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			ACCCAAAAGGCTGCCTCTGGA	0.488																																					p.A1798S		.											.	KIF13A	137	0			c.G5392T						.						46.0	48.0	47.0					6																	17764367		1958	4138	6096	SO:0001583	missense	63971	exon39			AAAAGGCTGCCTC	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.5392G>T	6.37:g.17764367C>A	ENSP00000259711:p.Ala1798Ser	149.0	0.0		134.0	55.0	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265412	0.40095	.	.	ENSG00000137177	ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T	0.72394	-0.57;-0.65;-0.65;-0.65	5.78	1.77	0.24775	.	1.640970	0.03369	N	0.198705	T	0.26011	0.0634	N	0.14661	0.345	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.002	B;B;B	0.17433	0.018;0.008;0.008	T	0.09751	-1.0660	10	0.15066	T	0.55	.	2.8817	0.05649	0.1414:0.5369:0.1208:0.201	.	1750;1763;1798	Q9H1H9-4;Q9H1H9-2;Q9H1H9	.;.;KI13A_HUMAN	S	1798;1763;1750;1763	ENSP00000259711:A1798S;ENSP00000368103:A1763S;ENSP00000368120:A1750S;ENSP00000368093:A1763S	ENSP00000259711:A1798S	A	-	1	0	KIF13A	17872346	0.012000	0.17670	0.035000	0.18076	0.245000	0.25701	0.020000	0.13466	0.373000	0.24621	0.591000	0.81541	GCC	.		0.488	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
KIF21B	23046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200946358	200946358	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:200946358C>A	ENST00000422435.2	-	31	4623	c.4307G>T	c.(4306-4308)cGc>cTc	p.R1436L	KIF21B_ENST00000461742.2_Missense_Mutation_p.R1436L|KIF21B_ENST00000360529.5_Missense_Mutation_p.R1423L|KIF21B_ENST00000332129.2_Missense_Mutation_p.R1423L	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1436					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CTCCCAGATGCGGACGGCATT	0.642																																					p.R1436L		.											.	KIF21B	96	0			c.G4307T						.						114.0	107.0	110.0					1																	200946358		2203	4300	6503	SO:0001583	missense	23046	exon31			CAGATGCGGACGG	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4307G>T	1.37:g.200946358C>A	ENSP00000411831:p.Arg1436Leu	53.0	0.0		63.0	23.0	NM_001252102	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630802	0.67015	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	4.88	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	M	0.86953	2.85	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;0.999;0.998	D;D;D;D	0.91635	0.997;0.999;0.997;0.994	T	0.41448	-0.9508	10	0.87932	D	0	.	18.0342	0.89294	0.0:1.0:0.0:0.0	.	1423;1436;1436;1423	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	L	1423;1423;1436;1436;1436	ENSP00000328494:R1423L;ENSP00000353724:R1423L;ENSP00000433808:R1436L;ENSP00000411831:R1436L	ENSP00000328494:R1423L	R	-	2	0	KIF21B	199212981	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	5.761000	0.68801	2.249000	0.74217	0.561000	0.74099	CGC	.		0.642	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
KLHL31	401265	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	53517092	53517092	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:53517092G>T	ENST00000407079.1	-	2	1208	c.1209C>A	c.(1207-1209)gcC>gcA	p.A403A	KLHL31_ENST00000370905.3_Silent_p.A403A			Q9H511	KLH31_HUMAN	kelch-like family member 31	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					GGTTCATGCTGGCCAGGTGTA	0.597																																					p.A403A		.											.	KLHL31	23	0			c.C1209A						.						88.0	93.0	91.0					6																	53517092		2203	4300	6503	SO:0001819	synonymous_variant	401265	exon3			CATGCTGGCCAGG		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1209C>A	6.37:g.53517092G>T		69.0	1.0		84.0	37.0	NM_001003760	A6N9J2|B2RP49	Silent	SNP	ENST00000407079.1	37	CCDS34478.1																																																																																			.		0.597	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
KRTAP10-1	386677	ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45959880	45959880	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr21:45959880G>T	ENST00000400375.1	-	1	198	c.154C>A	c.(154-156)Cgt>Agt	p.R52S	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	52	24 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						CTGGACACACGGCTCACTGGG	0.701																																					p.R52S		.											.	KRTAP10-1	91	0			c.C154A						.						46.0	55.0	52.0					21																	45959880		2201	4289	6490	SO:0001583	missense	386677	exon1			ACACACGGCTCAC	AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.154C>A	21.37:g.45959880G>T	ENSP00000383226:p.Arg52Ser	56.0	0.0		46.0	28.0	NM_198691	Q0VAR0|Q0VAR1	Missense_Mutation	SNP	ENST00000400375.1	37	CCDS42954.1	.	.	.	.	.	.	.	.	.	.	a	6.859	0.527860	0.13127	.	.	ENSG00000215455	ENST00000400375;ENST00000545982	T	0.09073	3.02	2.62	2.62	0.31277	.	.	.	.	.	T	0.05318	0.0141	N	0.22421	0.69	0.22185	N	0.999307	B	0.02656	0.0	B	0.01281	0.0	T	0.43343	-0.9397	9	0.28530	T	0.3	.	4.686	0.12758	0.7024:0.0:0.2976:0.0	.	52	P60331	KR101_HUMAN	S	52	ENSP00000383226:R52S	ENSP00000383226:R52S	R	-	1	0	KRTAP10-1	44784308	0.774000	0.28592	0.991000	0.47740	0.819000	0.46315	0.428000	0.21395	0.271000	0.22005	-0.503000	0.04515	CGT	.		0.701	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128030.1		
KRTAP3-3	85293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	39150290	39150290	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:39150290G>T	ENST00000391586.1	-	1	95	c.60C>A	c.(58-60)tgC>tgA	p.C20*		NM_033185.2	NP_149441.1	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	20	3 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			lung(2)|prostate(2)	4		Breast(137;0.00043)				TGTCAGAGGAGCAGATGGTGG	0.567																																					p.C20X		.											.	.	.	0			c.C60A						.						93.0	92.0	92.0					17																	39150290		2203	4296	6499	SO:0001587	stop_gained	85293	exon1			AGAGGAGCAGATG	AJ406933	CCDS32643.1	17q21.2	2013-06-25			ENSG00000212899	ENSG00000212899		"""Keratin associated proteins"""	18890	protein-coding gene	gene with protein product						11279113	Standard	NM_033185		Approved	KAP3.3	uc002hvr.1	Q9BYR6	OTTHUMG00000133591	ENST00000391586.1:c.60C>A	17.37:g.39150290G>T	ENSP00000375428:p.Cys20*	350.0	0.0		248.0	90.0	NM_033185	Q52LP0|Q6NTD4	Nonsense_Mutation	SNP	ENST00000391586.1	37	CCDS32643.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957773	0.53400	.	.	ENSG00000212899	ENST00000391586	.	.	.	5.62	4.65	0.58169	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.41	0.44287	0.0894:0.0:0.9106:0.0	.	.	.	.	X	20	.	ENSP00000375428:C20X	C	-	3	2	KRTAP3-3	36403816	1.000000	0.71417	0.998000	0.56505	0.210000	0.24377	2.963000	0.49184	1.380000	0.46344	0.650000	0.86243	TGC	.		0.567	KRTAP3-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257695.1		
LAMA4	3910	ucsc.edu;bcgsc.ca	37	6	112457355	112457355	+	Silent	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:112457355T>C	ENST00000230538.7	-	25	3781	c.3384A>G	c.(3382-3384)aaA>aaG	p.K1128K	LAMA4_ENST00000522006.1_Silent_p.K1121K|LAMA4_ENST00000389463.4_Silent_p.K1121K|LAMA4_ENST00000424408.2_Silent_p.K1121K	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1128	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TAATTTGAGCTTTCTTTAACG	0.363																																					p.K1128K		.											.	LAMA4	140	0			c.A3384G						.						142.0	126.0	132.0					6																	112457355		2203	4300	6503	SO:0001819	synonymous_variant	3910	exon25			TTGAGCTTTCTTT		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.3384A>G	6.37:g.112457355T>C		65.0	0.0		36.0	4.0	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Silent	SNP	ENST00000230538.7	37	CCDS43491.1																																																																																			.		0.363	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
LGALS7B	653499	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39281329	39281329	+	Splice_Site	SNP	G	G	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:39281329G>C	ENST00000314980.4	+	3	112	c.96G>C	c.(94-96)agG>agC	p.R32S		NM_001042507.3	NP_001035972.1	P47929	LEG7_HUMAN	lectin, galactoside-binding, soluble, 7B	32	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|heterophilic cell-cell adhesion (GO:0007157)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carbohydrate binding (GO:0030246)										CCTCTTCCAGGTTCCATGTAA	0.557																																					p.R32S		.											.	.	.	0			c.G96C						.						26.0	29.0	28.0					19																	39281329		2201	4299	6500	SO:0001630	splice_region_variant	653499	exon3			TTCCAGGTTCCAT		CCDS42565.1	19q13.2	2011-08-04			ENSG00000178934	ENSG00000178934		"""Lectins, galactoside-binding"""	34447	protein-coding gene	gene with protein product	"""galectin 7B"""						Standard	NM_001042507		Approved	GAL7	uc002ojf.4	P47929		ENST00000314980.4:c.96-1G>C	19.37:g.39281329G>C		205.0	0.0		174.0	15.0	NM_001042507	Q6IB87	Missense_Mutation	SNP	ENST00000314980.4	37	CCDS42565.1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573184	0.65765	.	.	ENSG00000178934	ENST00000314980	T	0.05649	3.41	4.31	1.98	0.26296	.	0.000000	0.53938	D	0.000048	T	0.08088	0.0202	.	.	.	0.46478	D	0.999061	.	.	.	.	.	.	T	0.32295	-0.9912	6	.	.	.	.	6.1752	0.20439	0.1078:0.4009:0.4913:0.0	.	.	.	.	S	32	ENSP00000313571:R32S	.	R	+	3	2	LGALS7B	43973169	1.000000	0.71417	0.824000	0.32777	0.176000	0.22953	2.023000	0.41040	1.024000	0.39682	0.650000	0.86243	AGG	.		0.557	LGALS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462638.1		Missense_Mutation
LRFN4	78999	ucsc.edu;bcgsc.ca	37	11	66625840	66625840	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:66625840G>A	ENST00000309602.4	+	1	868	c.625G>A	c.(625-627)Gct>Act	p.A209T	PC_ENST00000393955.2_Intron|LRFN4_ENST00000393952.3_Missense_Mutation_p.A209T|PC_ENST00000393958.2_Intron|PC_ENST00000393960.1_Intron	NM_024036.4	NP_076941.2	Q6PJG9	LRFN4_HUMAN	leucine rich repeat and fibronectin type III domain containing 4	209						integral component of membrane (GO:0016021)				breast(1)|lung(1)|prostate(1)	3						GGCCACGCTGGCTCCGGACCC	0.662																																					p.A209T		.											.	LRFN4	90	0			c.G625A						.						29.0	25.0	26.0					11																	66625840		2178	4276	6454	SO:0001583	missense	78999	exon1			ACGCTGGCTCCGG	BC007718	CCDS8153.1	11q13.1	2013-02-11				ENSG00000173621		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28456	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 6"""	612810				16495444, 16828986	Standard	NM_024036		Approved	MGC3103, SALM3., FIGLER6	uc001ojr.3	Q6PJG9		ENST00000309602.4:c.625G>A	11.37:g.66625840G>A	ENSP00000312535:p.Ala209Thr	33.0	0.0		61.0	6.0	NM_024036	Q4VBZ3|Q59GV4|Q8N644|Q9BWJ0	Missense_Mutation	SNP	ENST00000309602.4	37	CCDS8153.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.313923	0.40996	.	.	ENSG00000173621	ENST00000393952;ENST00000309602;ENST00000525479	T;T	0.52526	0.66;0.66	4.18	4.18	0.49190	.	0.000000	0.47852	D	0.000217	T	0.29716	0.0742	N	0.08118	0	0.45161	D	0.998176	P;P	0.41546	0.603;0.754	B;B	0.42188	0.247;0.379	T	0.18618	-1.0331	10	0.59425	D	0.04	.	10.2536	0.43383	0.0:0.2019:0.798:0.0	.	209;209	E9PLQ1;Q6PJG9	.;LRFN4_HUMAN	T	209	ENSP00000377524:A209T;ENSP00000312535:A209T	ENSP00000312535:A209T	A	+	1	0	LRFN4	66382416	1.000000	0.71417	0.974000	0.42286	0.147000	0.21601	3.563000	0.53784	2.320000	0.78422	0.313000	0.20887	GCT	.		0.662	LRFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393127.1	NM_024036	
LRG1	116844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4538450	4538450	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:4538450C>A	ENST00000306390.6	-	2	1006	c.546G>T	c.(544-546)ggG>ggT	p.G182G	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'Flank	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	182					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCCAGCAGCCCGGGGGGCA	0.622																																					p.G182G		.											.	LRG1	91	0			c.G546T						.						93.0	106.0	102.0					19																	4538450		2203	4300	6503	SO:0001819	synonymous_variant	116844	exon2			CAGCAGCCCGGGG		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.546G>T	19.37:g.4538450C>A		40.0	0.0		24.0	16.0	NM_052972	Q8N4F5|Q96QZ4	Silent	SNP	ENST00000306390.6	37	CCDS12130.1																																																																																			.		0.622	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458654.2	NM_052972	
LRIG2	9860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	113658968	113658968	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:113658968G>T	ENST00000361127.5	+	16	2788	c.2590G>T	c.(2590-2592)Gag>Tag	p.E864*	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	864					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AACGCTGTCTGAGCCACAGGA	0.483																																					p.E864X		.											.	LRIG2	229	0			c.G2590T						.						85.0	78.0	80.0					1																	113658968		2203	4300	6503	SO:0001587	stop_gained	9860	exon16			CTGTCTGAGCCAC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2590G>T	1.37:g.113658968G>T	ENSP00000355396:p.Glu864*	192.0	0.0		162.0	66.0	NM_014813	Q9NSN2	Nonsense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	G	42	9.602370	0.99216	.	.	ENSG00000198799	ENST00000361127	.	.	.	5.92	5.02	0.67125	.	0.048832	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	17.3631	0.87356	0.0:0.125:0.875:0.0	.	.	.	.	X	864	.	ENSP00000355396:E864X	E	+	1	0	LRIG2	113460491	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.033000	0.88852	1.533000	0.49186	-0.217000	0.12591	GAG	.		0.483	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
LRMP	4033	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25254117	25254117	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:25254117C>A	ENST00000354454.3	+	15	1576	c.747C>A	c.(745-747)agC>agA	p.S249R	RP11-713N11.4_ENST00000555862.1_RNA|LRMP_ENST00000547044.1_Missense_Mutation_p.S249R|LRMP_ENST00000548766.1_Missense_Mutation_p.S249R	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	305					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GCTAGGAAAGCCGGGTTAGTA	0.373																																					p.S249R		.											.	LRMP	228	0			c.C747A						.						93.0	93.0	93.0					12																	25254117		2203	4300	6503	SO:0001583	missense	4033	exon14			GGAAAGCCGGGTT		CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.747C>A	12.37:g.25254117C>A	ENSP00000346442:p.Ser249Arg	85.0	0.0		50.0	10.0	NM_001204126	A0AVM2|B4E077|Q8N301	Missense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007507	0.54361	.	.	ENSG00000118308	ENST00000354454;ENST00000536173;ENST00000548766;ENST00000547044	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.37	3.5	0.40072	.	0.044876	0.85682	D	0.000000	T	0.31888	0.0811	L	0.58669	1.825	0.44337	D	0.997226	D	0.55385	0.971	D	0.67103	0.949	T	0.02132	-1.1208	10	0.48119	T	0.1	-11.8137	8.396	0.32557	0.0:0.7559:0.0:0.2441	.	305	Q12912	LRMP_HUMAN	R	249;196;249;249	ENSP00000346442:S249R;ENSP00000444056:S196R;ENSP00000446496:S249R;ENSP00000450246:S249R	ENSP00000346442:S249R	S	+	3	2	LRMP	25145384	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	1.313000	0.33585	1.358000	0.45922	0.462000	0.41574	AGC	.		0.373	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152	
MACF1	23499	broad.mit.edu;bcgsc.ca	37	1	39788629	39788629	+	Silent	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:39788629T>C	ENST00000372915.3	+	32	4287	c.4200T>C	c.(4198-4200)acT>acC	p.T1400T	MACF1_ENST00000361689.2_Silent_p.T1400T|MACF1_ENST00000317713.7_Silent_p.T1400T|MACF1_ENST00000545844.1_Silent_p.T1400T|MACF1_ENST00000567887.1_Silent_p.T1432T|MACF1_ENST00000539005.1_Silent_p.T1400T|MACF1_ENST00000564288.1_Silent_p.T1395T|MACF1_ENST00000476350.1_3'UTR			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1400					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTTAACAACTCAGCACGTGA	0.423																																					p.T1400T		.											.	MACF1	165	0			c.T4200C						.						153.0	151.0	151.0					1																	39788629		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon34			AACAACTCAGCAC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.4200T>C	1.37:g.39788629T>C		228.0	0.0		123.0	9.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	T	9.889	1.203668	0.22121	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.99	-0.168	0.13343	.	.	.	.	.	T	0.42988	0.1227	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24333	-1.0163	4	.	.	.	.	3.0075	0.06033	0.1028:0.2161:0.4052:0.2759	.	.	.	.	P	534	.	.	S	+	1	0	MACF1	39561216	0.040000	0.19996	1.000000	0.80357	0.934000	0.57294	-0.854000	0.04299	0.151000	0.19162	-1.089000	0.02181	TCA	.		0.423	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MAGEB18	286514	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	26157602	26157602	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:26157602T>A	ENST00000325250.1	+	2	687	c.500T>A	c.(499-501)gTg>gAg	p.V167E		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	167	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						TTGAAGGAAGTGGATCCCATC	0.433																																					p.V167E		.											.	MAGEB18	130	0			c.T500A						.						57.0	45.0	49.0					X																	26157602		2202	4300	6502	SO:0001583	missense	286514	exon2			AGGAAGTGGATCC	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.500T>A	X.37:g.26157602T>A	ENSP00000314543:p.Val167Glu	85.0	2.0		90.0	81.0	NM_173699		Missense_Mutation	SNP	ENST00000325250.1	37	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.698934	0.48307	.	.	ENSG00000176774	ENST00000325250	T	0.06933	3.24	4.56	3.38	0.38709	.	0.125790	0.51477	D	0.000086	T	0.35335	0.0928	H	0.95224	3.64	0.34636	D	0.720121	D	0.76494	0.999	D	0.77004	0.989	T	0.54774	-0.8243	10	0.87932	D	0	.	7.3191	0.26517	0.0:0.0:0.2213:0.7787	.	167	Q96M61	MAGBI_HUMAN	E	167	ENSP00000314543:V167E	ENSP00000314543:V167E	V	+	2	0	MAGEB18	26067523	0.965000	0.33210	0.826000	0.32828	0.601000	0.36947	1.774000	0.38573	0.846000	0.35142	0.486000	0.48141	GTG	.		0.433	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699	
MAGI1	9223	ucsc.edu;bcgsc.ca	37	3	65438959	65438959	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:65438959T>C	ENST00000497477.2	-	6	1015	c.1016A>G	c.(1015-1017)aAg>aGg	p.K339R	MAGI1_ENST00000330909.8_Missense_Mutation_p.K339R|MAGI1_ENST00000483466.1_Missense_Mutation_p.K339R|MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000402939.2_Missense_Mutation_p.K339R			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	339					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TTCCAGTGGCTTCTGCTGCTT	0.418																																					p.K339R		.											.	MAGI1	661	0			c.A1016G						.						125.0	118.0	120.0					3																	65438959		2203	4300	6503	SO:0001583	missense	9223	exon6			AGTGGCTTCTGCT	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1016A>G	3.37:g.65438959T>C	ENSP00000424369:p.Lys339Arg	62.0	0.0		42.0	4.0	NM_001033057	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	ENST00000497477.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.65|17.65	3.442865|3.442865	0.63067|0.63067	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287|ENST00000460329	T;T;T;T;T;T;T|.	0.63255|.	-0.03;-0.03;2.18;-0.03;-0.03;2.18;1.23|.	5.78|5.78	4.6|4.6	0.57074|0.57074	.|.	0.088718|.	0.85682|.	D|.	0.000000|.	T|T	0.47820|0.47820	0.1466|0.1466	N|N	0.20807|0.20807	0.61|0.61	0.58432|0.58432	D|D	0.999998|0.999998	B;B;D;B;B;B|.	0.57899|.	0.234;0.054;0.981;0.057;0.182;0.002|.	B;B;P;B;B;B|.	0.53490|.	0.134;0.028;0.727;0.081;0.076;0.02|.	T|T	0.35574|0.35574	-0.9783|-0.9783	10|5	0.38643|.	T|.	0.18|.	-27.5538|-27.5538	12.1415|12.1415	0.54000|0.54000	0.1287:0.0:0.0:0.8713|0.1287:0.0:0.0:0.8713	.|.	339;339;339;339;339;339|.	Q96QZ7-6;Q96QZ7;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5|.	.;MAGI1_HUMAN;.;.;.;.|.	R|G	339;339;235;214;339;339;125;101|220	ENSP00000385450:K339R;ENSP00000331157:K339R;ENSP00000418177:K214R;ENSP00000420323:K339R;ENSP00000424369:K339R;ENSP00000420796:K125R;ENSP00000418044:K101R|.	ENSP00000331157:K339R|.	K|S	-|-	2|1	0|0	MAGI1|MAGI1	65413999|65413999	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.820000|5.820000	0.69250|0.69250	0.969000|0.969000	0.38237|0.38237	0.533000|0.533000	0.62120|0.62120	AAG|AGC	.		0.418	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000349132.2	NM_004742	
MEGF6	1953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3428670	3428670	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:3428670C>A	ENST00000356575.4	-	8	1102	c.876G>T	c.(874-876)ggG>ggT	p.G292G	MEGF6_ENST00000294599.4_Silent_p.G187G	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	292	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		ACTGGGCCAGCCCTGCGGCAC	0.647																																					p.G292G	Ovarian(73;978 3658)	.											.	MEGF6	90	0			c.G876T						.						56.0	66.0	62.0					1																	3428670		2122	4218	6340	SO:0001819	synonymous_variant	1953	exon8			GGCCAGCCCTGCG	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.876G>T	1.37:g.3428670C>A		174.0	0.0		177.0	65.0	NM_001409	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	37	CCDS41237.1																																																																																			.		0.647	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
MAGI3	260425	broad.mit.edu;bcgsc.ca	37	1	114137184	114137184	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:114137184T>C	ENST00000307546.9	+	6	1093		c.e6+2		MAGI3_ENST00000369611.4_Splice_Site|MAGI3_ENST00000369617.4_Splice_Site|MAGI3_ENST00000369615.1_Splice_Site	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGATGGAGGTAGAGATTCAG	0.378																																					.		.											.	MAGI3	524	0			c.1018+2T>C						.						86.0	88.0	87.0					1																	114137184		2203	4300	6503	SO:0001630	splice_region_variant	260425	exon6			TGGAGGTAGAGAT	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1018+2T>C	1.37:g.114137184T>C		263.0	1.0		222.0	11.0	NM_001142782	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Splice_Site	SNP	ENST00000307546.9	37	CCDS44196.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.677311	0.88445	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6662	0.77230	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAGI3	113938707	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.359000	0.79477	2.112000	0.64535	0.477000	0.44152	.	.		0.378	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	Intron
MERTK	10461	broad.mit.edu;bcgsc.ca	37	2	112686781	112686781	+	Missense_Mutation	SNP	C	C	A	rs567766808		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:112686781C>A	ENST00000295408.4	+	2	403	c.146C>A	c.(145-147)cCg>cAg	p.P49Q	MERTK_ENST00000421804.2_Missense_Mutation_p.P49Q|MERTK_ENST00000409780.1_Intron|RN7SL297P_ENST00000483161.2_RNA			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	49					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						GACCACACACCGCTGTTATCC	0.537																																					p.P49Q		.											.	MERTK	1463	0			c.C146A						.						89.0	78.0	82.0					2																	112686781		2203	4300	6503	SO:0001583	missense	10461	exon2			ACACACCGCTGTT	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.146C>A	2.37:g.112686781C>A	ENSP00000295408:p.Pro49Gln	162.0	0.0		140.0	7.0	NM_006343	Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824548	0.50739	.	.	ENSG00000153208	ENST00000295408;ENST00000421804	T;T	0.78481	-1.18;-1.18	3.98	3.01	0.34805	.	.	.	.	.	T	0.66076	0.2753	L	0.29908	0.895	0.09310	N	1	P	0.43431	0.807	B	0.40375	0.327	T	0.59658	-0.7413	9	0.66056	D	0.02	-0.5718	8.2748	0.31866	0.2365:0.7635:0.0:0.0	.	49	Q12866	MERTK_HUMAN	Q	49	ENSP00000295408:P49Q;ENSP00000389152:P49Q	ENSP00000295408:P49Q	P	+	2	0	MERTK	112403252	0.006000	0.16342	0.004000	0.12327	0.001000	0.01503	1.701000	0.37825	2.199000	0.70637	0.557000	0.71058	CCG	.		0.537	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MMP19	4327	ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56235006	56235006	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:56235006G>T	ENST00000322569.4	-	3	279	c.188C>A	c.(187-189)gCa>gAa	p.A63E	MMP19_ENST00000547487.1_5'UTR|MMP19_ENST00000409200.3_Missense_Mutation_p.A63E|MMP19_ENST00000548629.1_Missense_Mutation_p.A63E|MMP19_ENST00000394182.1_5'Flank	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	63					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	AAGTTCAGATGCTTCCTGAAA	0.532																																					p.A63E		.											.	MMP19	227	0			c.C188A						.						56.0	56.0	56.0					12																	56235006		2203	4300	6503	SO:0001583	missense	4327	exon3			TCAGATGCTTCCT	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.188C>A	12.37:g.56235006G>T	ENSP00000313437:p.Ala63Glu	30.0	0.0		25.0	8.0	NM_001272101	B4E030|O15278|O95606|Q99580	Missense_Mutation	SNP	ENST00000322569.4	37	CCDS8895.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.278010	0.59758	.	.	ENSG00000123342	ENST00000322569;ENST00000548629;ENST00000409200	T;T;T	0.37058	1.22;1.22;1.22	5.62	4.72	0.59763	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.243054	0.41294	D	0.000917	T	0.55305	0.1912	M	0.71581	2.175	0.80722	D	1	D;P	0.65815	0.995;0.947	D;P	0.65233	0.933;0.789	T	0.58261	-0.7667	10	0.87932	D	0	.	12.1001	0.53778	0.0826:0.0:0.9174:0.0	.	63;63	B4E030;Q99542	.;MMP19_HUMAN	E	63	ENSP00000313437:A63E;ENSP00000446979:A63E;ENSP00000386625:A63E	ENSP00000313437:A63E	A	-	2	0	MMP19	54521273	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	2.242000	0.43106	2.653000	0.90120	0.655000	0.94253	GCA	.		0.532	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
MPP4	58538	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	202557682	202557682	+	Silent	SNP	C	C	T	rs201304506		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:202557682C>T	ENST00000409474.3	-	3	357	c.150G>A	c.(148-150)gtG>gtA	p.V50V	MPP4_ENST00000409143.1_Silent_p.V50V|MPP4_ENST00000447335.2_Silent_p.V50V|MPP4_ENST00000396886.3_Silent_p.V50V|MPP4_ENST00000428900.2_Silent_p.V50V|MPP4_ENST00000315506.7_Silent_p.V50V|MPP4_ENST00000359962.5_Silent_p.V50V	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	50	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						ACAAGAGACACACTCCATTCA	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19762	0.0		0.0	False		,,,				2504	0.0				p.V50V		.											.	MPP4	22	0			c.G150A						.						73.0	75.0	74.0					2																	202557682		2021	4190	6211	SO:0001819	synonymous_variant	58538	exon3			GAGACACACTCCA	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.150G>A	2.37:g.202557682C>T		113.0	0.0		43.0	8.0	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Silent	SNP	ENST00000409474.3	37	CCDS46491.1																																																																																			C|0.999;T|0.000		0.547	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
MYADML2	255275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79899539	79899539	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:79899539C>T	ENST00000409745.2	-	3	433	c.79G>A	c.(79-81)Gtg>Atg	p.V27M	AC137723.5_ENST00000415556.1_RNA|MYADML2_ENST00000330655.3_Missense_Mutation_p.V27M	NM_001145113.2	NP_001138585.2	A6NDP7	MADL2_HUMAN	myeloid-associated differentiation marker-like 2	27	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)	1						AGCTGCAGCACGCGGGCTGTG	0.692																																					p.V27M		.											.	MYADML2	68	0			c.G79A						.						10.0	16.0	14.0					17																	79899539		688	1582	2270	SO:0001583	missense	255275	exon3			GCAGCACGCGGGC	AC137723, BC029306	CCDS45815.1	17q25.3	2008-10-15			ENSG00000185105	ENSG00000185105			34548	protein-coding gene	gene with protein product							Standard	NM_001145113		Approved	LOC255275	uc010wvf.1	A6NDP7	OTTHUMG00000154388	ENST00000409745.2:c.79G>A	17.37:g.79899539C>T	ENSP00000386702:p.Val27Met	46.0	0.0		51.0	23.0	NM_001145113		Missense_Mutation	SNP	ENST00000409745.2	37	CCDS45815.1	.	.	.	.	.	.	.	.	.	.	C	3.094	-0.186261	0.06340	.	.	ENSG00000185105	ENST00000409745;ENST00000330655	T;T	0.28895	1.59;1.59	4.85	0.45	0.16624	Marvel (1);MARVEL-like domain (1);	0.352986	0.32258	N	0.006358	T	0.07908	0.0198	N	0.01576	-0.805	0.09310	N	0.999994	B	0.11235	0.004	B	0.10450	0.005	T	0.17048	-1.0382	10	0.33940	T	0.23	.	0.0388	0.00008	0.2737:0.2405:0.1978:0.288	.	27	A6NDP7	MADL2_HUMAN	M	27	ENSP00000386702:V27M;ENSP00000327718:V27M	ENSP00000327718:V27M	V	-	1	0	MYADML2	77492830	0.000000	0.05858	0.791000	0.31998	0.210000	0.24377	-0.522000	0.06237	0.237000	0.21200	-0.333000	0.08304	GTG	.		0.692	MYADML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335008.2	XR_041347	
MYH7	4625	ucsc.edu;bcgsc.ca	37	14	23894544	23894544	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr14:23894544G>T	ENST00000355349.3	-	21	2532	c.2370C>A	c.(2368-2370)gcC>gcA	p.A790A		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	790	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTCGGGACTGGGCCTGGATAC	0.592																																					p.A790A		.											.	MYH7	94	0			c.C2370A						.						99.0	82.0	88.0					14																	23894544		2203	4300	6503	SO:0001819	synonymous_variant	4625	exon21			GGACTGGGCCTGG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2370C>A	14.37:g.23894544G>T		105.0	0.0		45.0	5.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																			.		0.592	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYOD1	4654	broad.mit.edu;mdanderson.org	37	11	17741511	17741511	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:17741511A>G	ENST00000250003.3	+	1	397	c.182A>G	c.(181-183)gAg>gGg	p.E61G		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	61					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						AAACCCGAAGAGCACTCGCAC	0.701																																					p.E61G		.											.	MYOD1	154	0			c.A182G						.						24.0	25.0	25.0					11																	17741511		2199	4293	6492	SO:0001583	missense	4654	exon1			CCGAAGAGCACTC	AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.182A>G	11.37:g.17741511A>G	ENSP00000250003:p.Glu61Gly	29.0	0.0		26.0	11.0	NM_002478	O75321	Missense_Mutation	SNP	ENST00000250003.3	37	CCDS7826.1	.	.	.	.	.	.	.	.	.	.	A	14.51	2.557469	0.45590	.	.	ENSG00000129152	ENST00000250003	D	0.97620	-4.46	4.87	4.87	0.63330	Myogenic basic muscle-specific protein (2);	0.232081	0.43747	D	0.000533	D	0.90906	0.7142	N	0.05124	-0.11	0.45837	D	0.998709	B	0.22346	0.068	B	0.21360	0.034	D	0.87943	0.2718	10	0.24483	T	0.36	-20.8366	13.1998	0.59761	1.0:0.0:0.0:0.0	.	61	P15172	MYOD1_HUMAN	G	61	ENSP00000250003:E61G	ENSP00000250003:E61G	E	+	2	0	MYOD1	17698087	1.000000	0.71417	0.987000	0.45799	0.505000	0.33919	2.976000	0.49289	2.040000	0.60383	0.533000	0.62120	GAG	.		0.701	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389387.1	NM_002478	
NAGS	162417	ucsc.edu;bcgsc.ca	37	17	42084822	42084822	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:42084822T>C	ENST00000293404.3	+	5	1346	c.1228T>C	c.(1228-1230)Tcg>Ccg	p.S410P	PYY_ENST00000360085.2_5'Flank	NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	410	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.		S -> P (in NAGSD; markedly decreases activity). {ECO:0000269|PubMed:15878741}.		arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CTACCTGGCCTCGCTGCGCCC	0.672											OREG0024449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S410P		.											.	NAGS	90	0			c.T1228C	GRCh37	CM052023	NAGS	M		.						40.0	44.0	43.0					17																	42084822		2198	4295	6493	SO:0001583	missense	162417	exon5			CTGGCCTCGCTGC	AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.1228T>C	17.37:g.42084822T>C	ENSP00000293404:p.Ser410Pro	32.0	0.0	906	38.0	5.0	NM_153006	B2RAZ9|Q8IWR4	Missense_Mutation	SNP	ENST00000293404.3	37	CCDS11473.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338944	0.81911	.	.	ENSG00000161653	ENST00000541745;ENST00000293404	D	0.92397	-3.03	5.56	4.42	0.53409	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);Domain of unknown function DUF619 (1);	0.159578	0.42053	D	0.000762	D	0.92485	0.7614	L	0.44542	1.39	0.39264	D	0.964267	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	D	0.91740	0.5403	10	0.49607	T	0.09	-17.8992	5.9378	0.19175	0.1633:0.0:0.1703:0.6664	.	244;410	Q2NKP2;Q8N159	.;NAGS_HUMAN	P	244;410	ENSP00000293404:S410P	ENSP00000293404:S410P	S	+	1	0	NAGS	39440348	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.275000	0.43399	2.119000	0.64992	0.459000	0.35465	TCG	.		0.672	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457660.1	NM_153006	
NPHS1	4868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36340537	36340537	+	Silent	SNP	T	T	A	rs111277506		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:36340537T>A	ENST00000378910.5	-	6	626	c.627A>T	c.(625-627)tcA>tcT	p.S209S	NPHS1_ENST00000353632.6_Silent_p.S209S|NPHS1_ENST00000591817.1_5'Flank	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	209	Ig-like C2-type 2.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCTATTATCTGAGCTCCGGG	0.537																																					p.S209S		.											.	NPHS1	49	0			c.A627T						.						68.0	67.0	68.0					19																	36340537		2203	4300	6503	SO:0001819	synonymous_variant	4868	exon6			ATTATCTGAGCTC		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.627A>T	19.37:g.36340537T>A		72.0	0.0		59.0	17.0	NM_004646	A6NDH2|C3RX61	Silent	SNP	ENST00000378910.5	37	CCDS32996.1																																																																																			T|0.500;C|0.500		0.537	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
NT5DC1	221294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	116542390	116542390	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:116542390G>A	ENST00000319550.4	+	7	785	c.703G>A	c.(703-705)Ggg>Agg	p.G235R		NM_152729.2	NP_689942.2	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase domain containing 1	235							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|stomach(1)	8		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		ATATATTCTTGGGTGAGTGAT	0.358																																					p.G235R	Colon(128;1440 1664 38087 41475 42869)	.											.	NT5DC1	226	0			c.G703A						.						81.0	82.0	81.0					6																	116542390		2203	4300	6503	SO:0001630	splice_region_variant	221294	exon7			ATTCTTGGGTGAG	BC015138	CCDS5104.1	6q22.31	2008-02-05	2006-01-27	2006-01-27	ENSG00000178425	ENSG00000178425			21556	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic II-like 1"""	NT5C2L1			Standard	NM_152729		Approved	dJ486I3.1, MGC24302	uc003pwj.3	Q5TFE4	OTTHUMG00000015428	ENST00000319550.4:c.704+1G>A	6.37:g.116542390G>A		370.0	0.0		188.0	63.0	NM_152729	B2RND9|B3KR35|Q6XYD5	Missense_Mutation	SNP	ENST00000319550.4	37	CCDS5104.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827017	0.90955	.	.	ENSG00000178425	ENST00000319550	T	0.23552	1.9	5.62	5.62	0.85841	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	M	0.88842	2.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.61257	-0.7099	10	0.66056	D	0.02	-13.0406	18.6578	0.91460	0.0:0.0:1.0:0.0	.	185;235;235	B3KR35;A8K2Z3;Q5TFE4	.;.;NT5D1_HUMAN	R	235	ENSP00000326858:G235R	ENSP00000326858:G235R	G	+	1	0	NT5DC1	116649083	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.145000	0.94634	2.665000	0.90641	0.585000	0.79938	GGG	.		0.358	NT5DC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041931.3	NM_152729	Missense_Mutation
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228474710	228474710	+	Missense_Mutation	SNP	G	G	T	rs558072959		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:228474710G>T	ENST00000422127.1	+	35	9558	c.9514G>T	c.(9514-9516)Gcc>Tcc	p.A3172S	OBSCN_ENST00000366709.4_Missense_Mutation_p.A291S|OBSCN_ENST00000570156.2_Missense_Mutation_p.A3601S|OBSCN_ENST00000366707.4_Missense_Mutation_p.A291S|OBSCN_ENST00000359599.6_Missense_Mutation_p.A2019S|OBSCN_ENST00000284548.11_Missense_Mutation_p.A3172S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3172	Ig-like 31.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCTGGGGGCGCCTGCAGCAG	0.662																																					p.A3601S		.											.	OBSCN	403	0			c.G10801T						.						10.0	12.0	12.0					1																	228474710		2006	4171	6177	SO:0001583	missense	84033	exon40			GGGGGCGCCTGCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9514G>T	1.37:g.228474710G>T	ENSP00000409493:p.Ala3172Ser	71.0	0.0		62.0	48.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462369	0.43736	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45	5.09	1.06	0.20224	Immunoglobulin subtype 2 (1);	0.367653	0.26467	N	0.024211	T	0.08447	0.0210	L	0.39147	1.195	0.09310	N	1	B;D	0.64830	0.13;0.994	B;P	0.58172	0.173;0.834	T	0.21415	-1.0246	10	0.09590	T	0.72	.	5.6767	0.17753	0.1333:0.0:0.4468:0.4199	.	3172;3172	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	3172;3172;291;291;2019	ENSP00000284548:A3172S;ENSP00000409493:A3172S;ENSP00000355668:A291S;ENSP00000355670:A291S;ENSP00000352613:A2019S	ENSP00000284548:A3172S	A	+	1	0	OBSCN	226541333	0.000000	0.05858	0.224000	0.23877	0.043000	0.13939	-0.225000	0.09151	0.034000	0.15491	0.561000	0.74099	GCC	.		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2G2	81470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247751752	247751752	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:247751752T>G	ENST00000320065.1	+	1	91	c.91T>G	c.(91-93)Ttt>Gtt	p.F31V	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GAAGGTTCTATTTGTGCTCAT	0.393																																					p.F31V		.											.	OR2G2	68	0			c.T91G						.						214.0	205.0	208.0					1																	247751752		2203	4300	6503	SO:0001583	missense	81470	exon1			GTTCTATTTGTGC	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.91T>G	1.37:g.247751752T>G	ENSP00000326349:p.Phe31Val	632.0	0.0		474.0	141.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306108	0.60305	.	.	ENSG00000177489	ENST00000320065	T	0.04551	3.6	3.73	3.73	0.42828	.	0.000000	0.34338	U	0.004054	T	0.26048	0.0635	M	0.92833	3.35	0.09310	N	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.10636	-1.0621	10	0.87932	D	0	.	10.4648	0.44600	0.0:0.0:0.0:1.0	.	31	Q8NGZ5	OR2G2_HUMAN	V	31	ENSP00000326349:F31V	ENSP00000326349:F31V	F	+	1	0	OR2G2	245818375	0.975000	0.34042	0.048000	0.18961	0.888000	0.51559	3.914000	0.56401	1.535000	0.49220	0.481000	0.45027	TTT	.		0.393	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
PACSIN3	29763	ucsc.edu;bcgsc.ca	37	11	47200816	47200816	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:47200816T>C	ENST00000539589.1	-	8	1136	c.794A>G	c.(793-795)cAc>cGc	p.H265R	PACSIN3_ENST00000298838.6_Missense_Mutation_p.H265R|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000319543.6_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|ARFGAP2_ENST00000419701.2_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	265	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CAAGTCACGGTGGAGTTCATG	0.622																																					p.H265R		.											.	PACSIN3	68	0			c.A794G						.						94.0	89.0	91.0					11																	47200816		2201	4298	6499	SO:0001583	missense	29763	exon8			TCACGGTGGAGTT	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.794A>G	11.37:g.47200816T>C	ENSP00000440945:p.His265Arg	62.0	0.0		47.0	4.0	NM_016223	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	37	CCDS31481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.29|11.29	1.596327|1.596327	0.28445|0.28445	.|.	.|.	ENSG00000165912|ENSG00000165912	ENST00000298838;ENST00000539589;ENST00000528462;ENST00000530513|ENST00000415232	T;T;T;T|.	0.39406|.	1.08;1.08;1.08;2.52|.	5.24|5.24	4.09|4.09	0.47781|0.47781	.|.	0.323582|.	0.39274|.	N|.	0.001414|.	T|T	0.61451|0.61451	0.2348|0.2348	L|L	0.46157|0.46157	1.445|1.445	0.44098|0.44098	D|D	0.996869|0.996869	P|.	0.38617|.	0.64|.	B|.	0.32022|.	0.139|.	T|T	0.63690|0.63690	-0.6580|-0.6580	10|6	0.51188|0.87932	T|D	0.08|0	-25.6972|-25.6972	12.193|12.193	0.54282|0.54282	0.0:0.0:0.1431:0.8569|0.0:0.0:0.1431:0.8569	.|.	265|.	Q9UKS6|.	PACN3_HUMAN|.	R|A	265;265;265;45|264	ENSP00000298838:H265R;ENSP00000440945:H265R;ENSP00000437252:H265R;ENSP00000431924:H45R|.	ENSP00000298838:H265R|ENSP00000405352:T264A	H|T	-|-	2|1	0|0	PACSIN3|PACSIN3	47157392|47157392	1.000000|1.000000	0.71417|0.71417	0.847000|0.847000	0.33407|0.33407	0.068000|0.068000	0.16541|0.16541	4.939000|4.939000	0.63526|0.63526	0.917000|0.917000	0.36895|0.36895	-0.313000|-0.313000	0.08912|0.08912	CAC|ACC	.		0.622	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391632.1	NM_016223	
PCDH17	27253	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	58240890	58240890	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr13:58240890G>A	ENST00000377918.3	+	3	2746	c.2720G>A	c.(2719-2721)gGc>gAc	p.G907D		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	907					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ACTAACAAAGGCTCCTGCTGT	0.488																																					p.G907D	Melanoma(72;952 1291 1619 12849 33676)	.											.	PCDH17	97	0			c.G2720A						.						103.0	94.0	97.0					13																	58240890		2203	4300	6503	SO:0001583	missense	27253	exon3			ACAAAGGCTCCTG	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2720G>A	13.37:g.58240890G>A	ENSP00000367151:p.Gly907Asp	167.0	1.0		65.0	25.0	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097593	0.76870	.	.	ENSG00000118946	ENST00000377918	T	0.52754	0.65	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.62332	0.2419	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.55704	-0.8099	9	.	.	.	.	20.115	0.97926	0.0:0.0:1.0:0.0	.	907	O14917	PCD17_HUMAN	D	907	ENSP00000367151:G907D	.	G	+	2	0	PCDH17	57138891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.761000	0.94854	0.650000	0.86243	GGC	.		0.488	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PCDHGB7	56099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140798829	140798829	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:140798829G>A	ENST00000398594.2	+	1	1403	c.1403G>A	c.(1402-1404)gGt>gAt	p.G468D	PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	468	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACCAGCCGGGTGCCTCCATA	0.572																																					p.G468D		.											.	PCDHGB7	29	0			c.G1403A						.						79.0	92.0	88.0					5																	140798829		2123	4244	6367	SO:0001583	missense	56099	exon1			AGCCGGGTGCCTC	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1403G>A	5.37:g.140798829G>A	ENSP00000381594:p.Gly468Asp	147.0	0.0		129.0	29.0	NM_018927	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	19.66	3.869744	0.72065	.	.	ENSG00000254122	ENST00000398594	T	0.68624	-0.34	5.19	5.19	0.71726	Cadherin (3);Cadherin-like (1);	0.000000	0.32836	U	0.005596	D	0.83681	0.5307	M	0.82323	2.585	0.44123	D	0.9969	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86331	0.1698	10	0.87932	D	0	.	18.3236	0.90246	0.0:0.0:1.0:0.0	.	468;468	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	D	468	ENSP00000381594:G468D	ENSP00000381594:G468D	G	+	2	0	PCDHGB7	140779013	1.000000	0.71417	0.083000	0.20561	0.903000	0.53119	5.657000	0.67996	2.410000	0.81850	0.491000	0.48974	GGT	.		0.572	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
PCGF2	7703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	36891702	36891702	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:36891702G>A	ENST00000580830.1	-	12	1510	c.809C>T	c.(808-810)cCa>cTa	p.P270L	PCGF2_ENST00000578109.1_3'UTR|PCGF2_ENST00000360797.2_Missense_Mutation_p.P270L|PCGF2_ENST00000581345.1_Missense_Mutation_p.P270L|PCGF2_ENST00000579882.1_3'UTR|PCGF2_ENST00000585100.1_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2	270	Pro/Ser-rich.				anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GGAGGTGGCTGGCAGGGTGGC	0.701											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P270L		.											.	PCGF2	658	0			c.C809T						.						19.0	16.0	17.0					17																	36891702		2189	4288	6477	SO:0001583	missense	7703	exon11			GTGGCTGGCAGGG	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.809C>T	17.37:g.36891702G>A	ENSP00000461961:p.Pro270Leu	148.0	0.0	866	111.0	52.0	NM_007144	A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965701	0.74131	.	.	ENSG00000056661	ENST00000360797	T	0.37411	1.2	4.92	3.95	0.45737	.	0.214785	0.40554	N	0.001080	T	0.30916	0.0780	L	0.46157	1.445	0.54753	D	0.999989	B	0.06786	0.001	B	0.08055	0.003	T	0.09058	-1.0692	10	0.40728	T	0.16	-15.7345	11.2214	0.48857	0.0894:0.0:0.9106:0.0	.	270	P35227	PCGF2_HUMAN	L	270	ENSP00000354033:P270L	ENSP00000354033:P270L	P	-	2	0	PCGF2	34145228	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	7.211000	0.77933	1.304000	0.44892	0.561000	0.74099	CCA	.		0.701	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	
PCYT2	5833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79864760	79864760	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:79864760C>A	ENST00000538936.2	-	7	660	c.552G>T	c.(550-552)cgG>cgT	p.R184R	PCYT2_ENST00000331285.3_Silent_p.R106R|PCYT2_ENST00000570391.1_Silent_p.R152R|PCYT2_ENST00000571105.1_Silent_p.R184R|PCYT2_ENST00000570388.1_Silent_p.R106R|PCYT2_ENST00000538721.2_Silent_p.R202R	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	184					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	TCCAGGGGTTCCGCCCACCAG	0.617																																					p.R202R		.											.	PCYT2	68	0			c.G606T						.						48.0	50.0	49.0					17																	79864760		2203	4298	6501	SO:0001819	synonymous_variant	5833	exon8			GGGGTTCCGCCCA	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.552G>T	17.37:g.79864760C>A		53.0	0.0		69.0	31.0	NM_001184917	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Silent	SNP	ENST00000538936.2	37	CCDS11791.1																																																																																			.		0.617	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	
PER3	8863	ucsc.edu;bcgsc.ca	37	1	7887221	7887221	+	Silent	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:7887221A>G	ENST00000361923.2	+	17	2383	c.2208A>G	c.(2206-2208)aaA>aaG	p.K736K	PER3_ENST00000377532.3_Silent_p.K744K|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	736	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGCAGGAAAGGGAAGCACA	0.562																																					p.K736K		.											.	PER3	93	0			c.A2208G						.						18.0	22.0	21.0					1																	7887221		2141	4238	6379	SO:0001819	synonymous_variant	8863	exon17			CAGGAAAGGGAAG	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2208A>G	1.37:g.7887221A>G		54.0	0.0		37.0	4.0	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	ENST00000361923.2	37	CCDS89.1																																																																																			.		0.562	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
PHACTR4	65979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	28800595	28800595	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:28800595C>G	ENST00000373839.3	+	7	1614	c.1353C>G	c.(1351-1353)agC>agG	p.S451R	PHACTR4_ENST00000373836.3_Missense_Mutation_p.S461R|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	451					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGTGACAGCTTTTCTGAGG	0.468																																					p.S461R		.											.	PHACTR4	90	0			c.C1383G						.						120.0	121.0	121.0					1																	28800595		1970	4162	6132	SO:0001583	missense	65979	exon6			TGACAGCTTTTCT	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1353C>G	1.37:g.28800595C>G	ENSP00000362945:p.Ser451Arg	149.0	0.0		134.0	59.0	NM_023923	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	37	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	C	1.196	-0.633920	0.03584	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.23348	1.91;1.91	5.75	4.83	0.62350	.	1.347100	0.04068	N	0.307570	T	0.20659	0.0497	N	0.25647	0.755	0.19575	N	0.999967	B;B	0.31383	0.321;0.112	B;B	0.32465	0.146;0.068	T	0.29243	-1.0018	10	0.16420	T	0.52	-0.0126	7.5436	0.27753	0.0:0.7135:0.1374:0.1491	.	461;451	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	R	451;461;450	ENSP00000362945:S451R;ENSP00000362942:S461R	ENSP00000362942:S461R	S	+	3	2	PHACTR4	28673182	0.332000	0.24722	0.921000	0.36526	0.059000	0.15707	0.877000	0.28106	1.424000	0.47217	0.655000	0.94253	AGC	.		0.468	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923	
PHF8	23133	ucsc.edu;bcgsc.ca	37	X	54022184	54022184	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:54022184T>C	ENST00000357988.5	-	12	1731	c.1373A>G	c.(1372-1374)gAg>gGg	p.E458G	PHF8_ENST00000338946.6_Missense_Mutation_p.E422G|PHF8_ENST00000322659.8_Missense_Mutation_p.E422G|PHF8_ENST00000338154.6_Missense_Mutation_p.E422G	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	458					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						TCGCACTGTCTCCGGGATCTC	0.498																																					p.E458G		.											.	PHF8	133	0			c.A1373G						.						103.0	73.0	83.0					X																	54022184		2203	4300	6503	SO:0001583	missense	23133	exon12			ACTGTCTCCGGGA	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1373A>G	X.37:g.54022184T>C	ENSP00000350676:p.Glu458Gly	43.0	0.0		40.0	5.0	NM_001184896	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	ENST00000357988.5	37	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.46|16.46	3.128382|3.128382	0.56721|0.56721	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659|ENST00000396282;ENST00000448003	T;T;T;T|.	0.44881|.	0.91;0.91;0.91;0.91|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.045965|.	0.85682|.	D|.	0.000000|.	T|T	0.60196|0.60196	0.2250|0.2250	L|L	0.54323|0.54323	1.7|1.7	0.44079|0.44079	D|D	0.99683|0.99683	B;B;B;B|.	0.18461|.	0.018;0.028;0.009;0.0|.	B;B;B;B|.	0.14578|.	0.007;0.008;0.011;0.001|.	T|T	0.59873|0.59873	-0.7372|-0.7372	10|5	0.56958|.	D|.	0.05|.	-12.7565|-12.7565	8.8893|8.8893	0.35423|0.35423	0.0:0.0885:0.0:0.9115|0.0:0.0885:0.0:0.9115	.|.	422;422;458;458|.	Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1|.	.;.;.;PHF8_HUMAN|.	G|G	458;422;422;452;422|326;103	ENSP00000350676:E458G;ENSP00000338868:E422G;ENSP00000340051:E422G;ENSP00000319473:E422G|.	ENSP00000319473:E422G|.	E|R	-|-	2|1	0|2	PHF8|PHF8	54038909|54038909	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.626000|3.626000	0.54245|0.54245	1.890000|1.890000	0.54733|0.54733	0.381000|0.381000	0.24937|0.24937	GAG|AGA	.		0.498	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
PLEC	5339	ucsc.edu;bcgsc.ca	37	8	144994696	144994696	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr8:144994696G>T	ENST00000322810.4	-	32	9873	c.9704C>A	c.(9703-9705)gCc>gAc	p.A3235D	PLEC_ENST00000356346.3_Missense_Mutation_p.A3084D|PLEC_ENST00000436759.2_Missense_Mutation_p.A3125D|PLEC_ENST00000345136.3_Missense_Mutation_p.A3098D|PLEC_ENST00000398774.2_Missense_Mutation_p.A3066D|PLEC_ENST00000527096.1_Missense_Mutation_p.A3121D|PLEC_ENST00000357649.2_Missense_Mutation_p.A3102D|PLEC_ENST00000354589.3_Missense_Mutation_p.A3098D|PLEC_ENST00000354958.2_Missense_Mutation_p.A3076D	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3235	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						AGCCTTCTCGGCTGATAGCAG	0.662																																					p.A3235D		.											.	PLEC	141	0			c.C9704A						.						23.0	27.0	26.0					8																	144994696		2001	4185	6186	SO:0001583	missense	5339	exon32			TTCTCGGCTGATA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9704C>A	8.37:g.144994696G>T	ENSP00000323856:p.Ala3235Asp	32.0	0.0		38.0	4.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443109	0.25987	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	3.86	3.86	0.44501	.	0.000000	0.64402	U	0.000015	D	0.90501	0.7024	M	0.93854	3.465	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.999;0.998;0.998;0.998;0.998	D	0.93155	0.6553	10	0.87932	D	0	.	15.0808	0.72113	0.0:0.0:1.0:0.0	.	3125;3084;3076;3235;3066;3098;3102;3098	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	D	3098;3102;3098;3066;3235;3076;3084;3125;3121	ENSP00000344848:A3098D;ENSP00000350277:A3102D;ENSP00000346602:A3098D;ENSP00000381756:A3066D;ENSP00000323856:A3235D;ENSP00000347044:A3076D;ENSP00000348702:A3084D;ENSP00000388180:A3125D;ENSP00000434583:A3121D	ENSP00000323856:A3235D	A	-	2	0	PLEC	145066684	1.000000	0.71417	0.781000	0.31783	0.477000	0.33069	9.435000	0.97529	2.141000	0.66446	0.448000	0.29417	GCC	.		0.662	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEKHO2	80301	ucsc.edu;bcgsc.ca	37	15	65157960	65157960	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:65157960A>G	ENST00000323544.4	+	6	1474	c.1346A>G	c.(1345-1347)gAg>gGg	p.E449G	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	449										NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						CAGGCTGTGGAGCAGCTGAGG	0.597																																					p.E449G		.											.	PLEKHO2	92	0			c.A1346G						.						37.0	39.0	39.0					15																	65157960		2202	4299	6501	SO:0001583	missense	80301	exon6			CTGTGGAGCAGCT	AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1346A>G	15.37:g.65157960A>G	ENSP00000326706:p.Glu449Gly	74.0	0.0		40.0	4.0	NM_025201	Q7L4H4|Q8WYS8	Missense_Mutation	SNP	ENST00000323544.4	37	CCDS10196.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.104026	0.76983	.	.	ENSG00000241839	ENST00000323544	T	0.40225	1.04	5.13	5.13	0.70059	.	0.052788	0.85682	D	0.000000	T	0.51568	0.1682	L	0.32530	0.975	0.38208	D	0.940391	D;D	0.71674	0.998;0.996	D;D	0.70227	0.968;0.951	T	0.58020	-0.7710	10	0.59425	D	0.04	.	12.7028	0.57043	1.0:0.0:0.0:0.0	.	399;449	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	G	449	ENSP00000326706:E449G	ENSP00000326706:E449G	E	+	2	0	PLEKHO2	62945013	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.321000	0.51999	1.930000	0.55929	0.448000	0.29417	GAG	.		0.597	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256659.1	NM_025201	
PLXND1	23129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129279234	129279234	+	Missense_Mutation	SNP	C	C	T	rs201100072		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:129279234C>T	ENST00000324093.4	-	31	5250	c.5072G>A	c.(5071-5073)cGg>cAg	p.R1691Q	PLXND1_ENST00000393239.1_Missense_Mutation_p.R1691Q	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1691					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						ATGGCTCTGCCGGTGAGACTT	0.662																																					p.R1691Q	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1	90	0			c.G5072A						.						80.0	66.0	71.0					3																	129279234		2203	4299	6502	SO:0001583	missense	23129	exon31			CTCTGCCGGTGAG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5072G>A	3.37:g.129279234C>T	ENSP00000317128:p.Arg1691Gln	158.0	0.0		152.0	62.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695342	0.68386	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.15139	2.45;2.45	5.0	3.99	0.46301	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.066671	0.56097	D	0.000029	T	0.21590	0.0520	L	0.52126	1.63	0.48236	D	0.999611	P;D	0.64830	0.826;0.994	B;P	0.47864	0.185;0.559	T	0.01382	-1.1369	10	0.72032	D	0.01	.	11.9499	0.52948	0.0:0.8809:0.0:0.1191	.	286;1691	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	Q	1691	ENSP00000317128:R1691Q;ENSP00000376931:R1691Q	ENSP00000317128:R1691Q	R	-	2	0	PLXND1	130761924	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	3.723000	0.54955	2.326000	0.78906	0.462000	0.41574	CGG	C|0.999;G|0.000		0.662	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81746949	81746949	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:81746949G>T	ENST00000549396.1	-	17	2103	c.1943C>A	c.(1942-1944)aCg>aAg	p.T648K	PPFIA2_ENST00000550359.2_Missense_Mutation_p.T495K|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000552948.1_Missense_Mutation_p.T648K|PPFIA2_ENST00000548586.1_Missense_Mutation_p.T648K|PPFIA2_ENST00000407050.4_Missense_Mutation_p.T574K|PPFIA2_ENST00000541570.2_Missense_Mutation_p.T215K|PPFIA2_ENST00000443686.3_Missense_Mutation_p.T549K|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000550584.2_Missense_Mutation_p.T648K|PPFIA2_ENST00000333447.7_Missense_Mutation_p.T630K|PPFIA2_ENST00000549325.1_Missense_Mutation_p.T630K	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	648					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CATGGCTAGCGTCTGGGCATC	0.383																																					p.T648K		.											.	PPFIA2	231	0			c.C1943A						.						148.0	142.0	144.0					12																	81746949		1952	4174	6126	SO:0001583	missense	8499	exon16			GCTAGCGTCTGGG	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1943C>A	12.37:g.81746949G>T	ENSP00000450337:p.Thr648Lys	198.0	0.0		116.0	52.0	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043873	0.93685	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058	T;T;T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.56863	0.2014	M	0.83312	2.635	0.80722	D	1	D	0.63880	0.993	D	0.74023	0.982	T	0.61811	-0.6986	10	0.66056	D	0.02	-17.3587	19.2605	0.93966	0.0:0.0:1.0:0.0	.	648	O75334	LIPA2_HUMAN	K	648;630;215;574;659;630;648;549;648;229	ENSP00000450337:T648K;ENSP00000450298:T630K;ENSP00000438337:T215K;ENSP00000385093:T574K;ENSP00000327416:T630K;ENSP00000449338:T648K;ENSP00000388373:T549K;ENSP00000447868:T648K;ENSP00000448941:T229K	ENSP00000327416:T630K	T	-	2	0	PPFIA2	80271080	1.000000	0.71417	0.958000	0.39756	0.960000	0.62799	9.799000	0.99117	2.534000	0.85438	0.585000	0.79938	ACG	.		0.383	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
ARL6IP6	151188	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	153573934	153573934	+	5'Flank	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:153573934C>A	ENST00000326446.5	+	0	0				PRPF40A_ENST00000410080.1_Missense_Mutation_p.R7L|PRPF40A_ENST00000486100.1_5'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						GCTCCGCCGGCGGCCACTGCC	0.647																																					p.R7L		.											.	PRPF40A	68	0			c.G20T						.						30.0	37.0	35.0					2																	153573934		1934	4137	6071	SO:0001631	upstream_gene_variant	55660	exon1			CGCCGGCGGCCAC	AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153573934C>A	Exception_encountered	87.0	0.0		84.0	30.0	NM_017892	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	37	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344018	0.61073	.	.	ENSG00000196504	ENST00000410080;ENST00000359961;ENST00000448428	T	0.34859	1.34	4.87	4.87	0.63330	.	.	.	.	.	T	0.19846	0.0477	N	0.08118	0	0.25132	N	0.990568	B	0.11235	0.004	B	0.06405	0.002	T	0.07731	-1.0757	9	0.14656	T	0.56	.	13.3945	0.60843	0.0:1.0:0.0:0.0	.	7	E9PFS0	.	L	7;7;13	ENSP00000386458:R7L	ENSP00000353046:R7L	R	-	2	0	PRPF40A	153282180	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.309000	0.51903	2.518000	0.84900	0.655000	0.94253	CGC	.		0.647	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
PRR19	284338	ucsc.edu;bcgsc.ca	37	19	42814120	42814120	+	Silent	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:42814120T>C	ENST00000499536.2	+	1	1195	c.384T>C	c.(382-384)ccT>ccC	p.P128P	PRR19_ENST00000341747.3_Silent_p.P128P|PRR19_ENST00000598490.1_Silent_p.P128P			A6NJB7	PRR19_HUMAN	proline rich 19	128										NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	10		Prostate(69;0.00682)				ACCAGGTGCCTGGAGGTTCGG	0.677																																					p.P128P		.											.	PRR19	68	0			c.T384C						.						33.0	41.0	39.0					19																	42814120		2203	4299	6502	SO:0001819	synonymous_variant	284338	exon2			GGTGCCTGGAGGT	AK124116	CCDS33036.1	19q13.2	2007-12-17				ENSG00000188368			33728	protein-coding gene	gene with protein product							Standard	NM_199285		Approved	MGC70924	uc002oti.3	A6NJB7		ENST00000499536.2:c.384T>C	19.37:g.42814120T>C		46.0	1.0		35.0	4.0	NM_199285	A8K663|B3KW48|Q6P584	Silent	SNP	ENST00000499536.2	37	CCDS33036.1																																																																																			.		0.677	PRR19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463735.1	NM_199285	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	109380318	109380318	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:109380318G>T	ENST00000283195.6	+	20	3449	c.3323G>T	c.(3322-3324)gGa>gTa	p.G1108V		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1108					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AATGTGTCTGGAATTTCATTT	0.423																																					p.G1108V		.											.	RANBP2	675	0			c.G3323T						.						53.0	57.0	56.0					2																	109380318		2202	4299	6501	SO:0001583	missense	5903	exon20			TGTCTGGAATTTC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3323G>T	2.37:g.109380318G>T	ENSP00000283195:p.Gly1108Val	214.0	0.0		118.0	45.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	6.438	0.448940	0.12223	.	.	ENSG00000153201	ENST00000283195	T	0.28069	1.63	5.52	-0.104	0.13605	.	.	.	.	.	T	0.26048	0.0635	M	0.62723	1.935	0.09310	N	0.999999	B	0.15473	0.013	B	0.14023	0.01	T	0.36383	-0.9750	9	0.66056	D	0.02	-5.9935	2.5502	0.04747	0.2776:0.1974:0.4212:0.1038	.	1108	P49792	RBP2_HUMAN	V	1108	ENSP00000283195:G1108V	ENSP00000283195:G1108V	G	+	2	0	RANBP2	108746750	0.999000	0.42202	0.928000	0.36995	0.018000	0.09664	1.335000	0.33839	0.034000	0.15491	0.557000	0.71058	GGA	.		0.423	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
REEP5	7905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112238112	112238112	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:112238112A>G	ENST00000379638.4	-	3	664	c.316T>C	c.(316-318)Ttc>Ctc	p.F106L	REEP5_ENST00000545426.1_Missense_Mutation_p.F106L|REEP5_ENST00000513339.1_Missense_Mutation_p.F106L|REEP5_ENST00000504247.1_Intron|REEP5_ENST00000474542.2_5'UTR	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	106						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		CATGACAGGAAGATATCAGAG	0.418																																					p.F106L		.											.	REEP5	280	0			c.T316C						.						162.0	141.0	148.0					5																	112238112		2202	4300	6502	SO:0001583	missense	7905	exon3			ACAGGAAGATATC	BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.316T>C	5.37:g.112238112A>G	ENSP00000368959:p.Phe106Leu	142.0	0.0		128.0	60.0	NM_005669	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	ENST00000379638.4	37	CCDS4109.2	.	.	.	.	.	.	.	.	.	.	A	9.689	1.151291	0.21371	.	.	ENSG00000129625	ENST00000379638;ENST00000513339;ENST00000545426;ENST00000261482	D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89	5.73	5.73	0.89815	.	0.043741	0.85682	D	0.000000	T	0.80270	0.4592	N	0.03948	-0.315	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.13407	0.009;0.009;0.006	T	0.76206	-0.3044	10	0.02654	T	1	-14.5387	16.0233	0.80516	1.0:0.0:0.0:0.0	.	106;79;106	B7Z510;B7Z2A3;Q00765	.;.;REEP5_HUMAN	L	106;106;106;97	ENSP00000368959:F106L;ENSP00000425901:F106L;ENSP00000442940:F106L;ENSP00000261482:F97L	ENSP00000261482:F97L	F	-	1	0	REEP5	112266011	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.401000	0.79962	2.186000	0.69663	0.533000	0.62120	TTC	.		0.418	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250739.2	NM_005669	
RNASEH2C	84153	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65488115	65488115	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:65488115C>G	ENST00000308418.4	-	1	303	c.115G>C	c.(115-117)Gac>Cac	p.D39H	RNASEH2C_ENST00000527610.1_Missense_Mutation_p.D39H|RNASEH2C_ENST00000528220.1_5'UTR	NM_032193.3	NP_115569.2	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C	39			D -> Y (in AGS3). {ECO:0000269|PubMed:20131292}.		RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)				cervix(1)	1						GCGGGCCCGTCCACCGCAACC	0.751																																					p.D39H		.											.	RNASEH2C	90	0			c.G115C						.						10.0	13.0	12.0					11																	65488115		2170	4248	6418	SO:0001583	missense	84153	exon1			GCCCGTCCACCGC	AF312034	CCDS8111.1	11q13.1	2014-09-17							24116	protein-coding gene	gene with protein product	"""Aicardi-Goutieres syndrome 3"""	610330				8244390, 16845400	Standard	NM_032193		Approved	AYP1, AGS3	uc001ofn.3	Q8TDP1		ENST00000308418.4:c.115G>C	11.37:g.65488115C>G	ENSP00000308193:p.Asp39His	24.0	0.0		19.0	9.0	NM_032193	Q9H7F5	Missense_Mutation	SNP	ENST00000308418.4	37	CCDS8111.1	.	.	.	.	.	.	.	.	.	.	C	8.819	0.937041	0.18206	.	.	ENSG00000172922	ENST00000308418;ENST00000527610	D;D	0.93189	-3.18;-3.18	4.36	1.98	0.26296	.	0.572975	0.15750	N	0.246470	D	0.89054	0.6606	L	0.61387	1.9	0.09310	N	1	P	0.43392	0.805	B	0.36504	0.226	T	0.81773	-0.0779	10	0.52906	T	0.07	-15.8151	6.0387	0.19722	0.0:0.3271:0.0:0.6729	.	39	Q8TDP1	RNH2C_HUMAN	H	39	ENSP00000308193:D39H;ENSP00000432897:D39H	ENSP00000308193:D39H	D	-	1	0	RNASEH2C	65244691	0.000000	0.05858	0.109000	0.21407	0.001000	0.01503	0.612000	0.24283	0.745000	0.32763	-0.389000	0.06534	GAC	.		0.751	RNASEH2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390693.2	NM_032193	
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	77651546	77651546	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:77651546G>A	ENST00000461745.1	+	20	3940	c.3040G>A	c.(3040-3042)Gat>Aat	p.D1014N	ROBO2_ENST00000332191.8_Missense_Mutation_p.D1014N|ROBO2_ENST00000487694.3_Missense_Mutation_p.D1030N	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1014					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ATTGGCTGTCGATCTGCCTGA	0.423																																					p.D1014N		.											.	ROBO2	328	0			c.G3040A						.						116.0	108.0	110.0					3																	77651546		1964	4162	6126	SO:0001583	missense	6092	exon20			GCTGTCGATCTGC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3040G>A	3.37:g.77651546G>A	ENSP00000417164:p.Asp1014Asn	238.0	0.0		282.0	115.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.8|29.8	5.040614|5.040614	0.93630|0.93630	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191|ENST00000471893	T;T;T|.	0.64991|.	-0.13;-0.09;-0.08|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.47455|.	D|.	0.000232|.	T|T	0.69178|0.69178	0.3082|0.3082	L|L	0.42245|0.42245	1.32|1.32	0.29415|.	N|.	0.860951|.	D;D;D|.	0.76494|.	0.998;0.999;0.997|.	P;P;P|.	0.62184|.	0.825;0.899;0.649|.	T|T	0.62756|0.62756	-0.6787|-0.6787	9|4	0.48119|.	T|.	0.1|.	.|.	20.1432|20.1432	0.98067|0.98067	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1030;1014;1014|.	Q19AB5;F8W703;Q9HCK4|.	.;.;ROBO2_HUMAN|.	N|Q	1030;1030;1034;1014;1014|88	ENSP00000417335:D1030N;ENSP00000417164:D1014N;ENSP00000327536:D1014N|.	ENSP00000327536:D1014N|.	D|R	+|+	1|2	0|0	ROBO2|ROBO2	77734236|77734236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.476000|9.476000	0.97823|0.97823	2.769000|2.769000	0.95229|0.95229	0.561000|0.561000	0.74099|0.74099	GAT|CGA	.		0.423	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
ROBO1	6091	ucsc.edu;bcgsc.ca	37	3	79639053	79639053	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:79639053C>A	ENST00000464233.1	-	2	122	c.9G>T	c.(7-9)tgG>tgT	p.W3C		NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	3					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GAACATGTTTCCATTTCATCT	0.388																																					p.W3C		.											.	ROBO1	67	0			c.G9T						.						157.0	153.0	154.0					3																	79639053		1894	4123	6017	SO:0001583	missense	6091	exon2			ATGTTTCCATTTC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.9G>T	3.37:g.79639053C>A	ENSP00000420321:p.Trp3Cys	162.0	0.0		44.0	4.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	5.908	0.351673	0.11182	.	.	ENSG00000169855	ENST00000464233;ENST00000398414	T	0.60040	0.22	5.24	5.24	0.73138	.	0.000000	0.35772	N	0.002993	T	0.56891	0.2016	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.72338	0.977	T	0.59343	-0.7472	9	.	.	.	.	16.6141	0.84902	0.0:1.0:0.0:0.0	.	3	Q9Y6N7	ROBO1_HUMAN	C	3	ENSP00000420321:W3C	.	W	-	3	0	ROBO1	79721743	1.000000	0.71417	1.000000	0.80357	0.236000	0.25371	5.010000	0.64004	2.449000	0.82847	0.460000	0.39030	TGG	.		0.388	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RPS4Y1	6192	broad.mit.edu;bcgsc.ca	37	Y	2722744	2722744	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrY:2722744A>G	ENST00000250784.8	+	5	603	c.464A>G	c.(463-465)aAg>aGg	p.K155R	RPS4Y1_ENST00000477725.1_3'UTR	NM_001008.3	NP_000999.1	P22090	RS4Y1_HUMAN	ribosomal protein S4, Y-linked 1	155					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|lung(2)	3						CCTGTCATCAAGGTGAACGAT	0.433																																					p.K155R	Melanoma(193;1927 2965 17170 18413)	.											.	RPS4Y1	424	0			c.A464G						.						137.0	124.0	127.0					Y																	2722744		632	2008	2640	SO:0001583	missense	6192	exon5			TCATCAAGGTGAA		CCDS14773.1	Yp11.3	2011-04-05	2004-05-21	2004-05-26	ENSG00000129824	ENSG00000129824		"""S ribosomal proteins"""	10425	protein-coding gene	gene with protein product	"""ribosomal protein S4Y"", ""40S ribosomal protein S4, Y"""	470000	"""ribosomal protein S4, Y-linked"""	RPS4Y			Standard	NM_001008		Approved	MGC5070, MGC119100, S4	uc004fqi.3	P22090	OTTHUMG00000036152	ENST00000250784.8:c.464A>G	Y.37:g.2722744A>G	ENSP00000250784:p.Lys155Arg	376.0	0.0		49.0	6.0	NM_001008	A8K9V4	Missense_Mutation	SNP	ENST00000250784.8	37	CCDS14773.1																																																																																			.		0.433	RPS4Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088052.2	NM_001008	
RUNDC1	146923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41143400	41143400	+	Silent	SNP	T	T	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:41143400T>A	ENST00000361677.1	+	5	1521	c.1509T>A	c.(1507-1509)ccT>ccA	p.P503P		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	503	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TCGCCCTTCCTGTTACGGGAG	0.557																																					p.P503P		.											.	RUNDC1	90	0			c.T1509A						.						67.0	66.0	66.0					17																	41143400		2203	4300	6503	SO:0001819	synonymous_variant	146923	exon5			CCTTCCTGTTACG	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1509T>A	17.37:g.41143400T>A		122.0	0.0		106.0	36.0	NM_173079	Q6Y2K8|Q8IXT9|Q8N3W1	Silent	SNP	ENST00000361677.1	37	CCDS11448.1																																																																																			.		0.557	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452464.1	NM_173079	
SASH3	54440	ucsc.edu;bcgsc.ca	37	X	128926328	128926328	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:128926328C>A	ENST00000356892.3	+	5	581	c.467C>A	c.(466-468)cCa>cAa	p.P156Q	RP4-753P9.3_ENST00000432513.1_RNA	NM_018990.3	NP_061863.1	O75995	SASH3_HUMAN	SAM and SH3 domain containing 3	156					homeostasis of number of cells within a tissue (GO:0048873)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tumor necrosis factor production (GO:0032760)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	12						AGCCCCAGCCCAGGTTCTGGC	0.632																																					p.P156Q		.											.	SASH3	133	0			c.C467A						.						73.0	70.0	71.0					X																	128926328		2203	4300	6503	SO:0001583	missense	54440	exon5			CCAGCCCAGGTTC	BC051881	CCDS14614.1	Xq26	2013-01-10	2008-02-18	2008-02-18	ENSG00000122122	ENSG00000122122		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	15975	protein-coding gene	gene with protein product		300441	"""chromosome X open reading frame 9"""	CXorf9		11470164	Standard	NM_018990		Approved	SLY, 753P9, SH3D6C, HACS2	uc004euu.3	O75995	OTTHUMG00000022372	ENST00000356892.3:c.467C>A	X.37:g.128926328C>A	ENSP00000349359:p.Pro156Gln	41.0	0.0		42.0	4.0	NM_018990	A6NCH1|A8K7K8|Q5JZ38	Missense_Mutation	SNP	ENST00000356892.3	37	CCDS14614.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774766	0.31411	.	.	ENSG00000122122	ENST00000443760;ENST00000356892	T	0.18338	2.22	4.84	3.91	0.45181	.	0.806524	0.12214	N	0.488980	T	0.17023	0.0409	L	0.27053	0.805	0.29142	N	0.878959	P;B	0.46142	0.873;0.013	P;B	0.49192	0.602;0.012	T	0.03840	-1.0999	10	0.39692	T	0.17	-21.9619	8.0241	0.30427	0.177:0.6536:0.1693:0.0	.	124;156	B4DKQ0;O75995	.;SASH3_HUMAN	Q	124;156	ENSP00000349359:P156Q	ENSP00000349359:P156Q	P	+	2	0	SASH3	128754009	0.259000	0.24043	0.882000	0.34594	0.503000	0.33858	0.813000	0.27225	1.995000	0.58328	0.436000	0.28706	CCA	.		0.632	SASH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058208.1	NM_018990	
SEMA3D	223117	ucsc.edu;bcgsc.ca	37	7	84671523	84671523	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:84671523C>T	ENST00000284136.6	-	8	983	c.940G>A	c.(940-942)Gga>Aga	p.G314R	SEMA3D_ENST00000484038.1_5'Flank	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	314	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CCATCACTTCCAGGAATTGAG	0.393																																					p.G314R	Ovarian(63;442 1191 17318 29975 31528)	.											.	SEMA3D	138	0			c.G940A						.						275.0	252.0	260.0					7																	84671523		2203	4300	6503	SO:0001583	missense	223117	exon8			CACTTCCAGGAAT	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.940G>A	7.37:g.84671523C>T	ENSP00000284136:p.Gly314Arg	173.0	0.0		41.0	5.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	C	34	5.367381	0.95900	.	.	ENSG00000153993	ENST00000284136	T	0.28666	1.6	5.7	5.7	0.88788	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.101452	0.64402	D	0.000002	T	0.70613	0.3244	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.80415	-0.1392	10	0.87932	D	0	.	19.8309	0.96634	0.0:1.0:0.0:0.0	.	314	O95025	SEM3D_HUMAN	R	314	ENSP00000284136:G314R	ENSP00000284136:G314R	G	-	1	0	SEMA3D	84509459	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.684000	0.91462	0.650000	0.86243	GGA	.		0.393	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
CCDC152	100129792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	42804757	42804757	+	IGR	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:42804757C>A	ENST00000361970.5	+	0	3431				SEPP1_ENST00000509276.1_Splice_Site|SEPP1_ENST00000511224.1_Splice_Site|SEPP1_ENST00000514985.1_Splice_Site|SEPP1_ENST00000507920.1_Intron|SEPP1_ENST00000506577.1_Splice_Site|CTD-2325A15.5_ENST00000606056.1_RNA	NM_001134848.1	NP_001128320.1	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152											endometrium(1)	1						CAGAAAAATACCGTGAGAGAG	0.343																																					.		.											.	SEPP1	68	0			c.534+1G>T						.						86.0	82.0	83.0					5																	42804757		1800	4072	5872	SO:0001628	intergenic_variant	6414	exon5			AAAATACCGTGAG		CCDS47203.1	5p12	2008-07-14			ENSG00000198865	ENSG00000198865			34438	protein-coding gene	gene with protein product							Standard	NM_001134848		Approved	LOC100129792	uc003jmx.3	Q4G0S7	OTTHUMG00000162141		5.37:g.42804757C>A		304.0	1.0		314.0	106.0	NM_005410	B3KXI4|B4E0P7|Q5BLP6	Splice_Site	SNP	ENST00000361970.5	37	CCDS47203.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572417	0.65765	.	.	ENSG00000250722	ENST00000514985;ENST00000511224;ENST00000506577;ENST00000514218;ENST00000510965	.	.	.	5.53	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2261	0.82293	0.0:0.8668:0.1332:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEPP1	42840514	1.000000	0.71417	0.696000	0.30242	0.986000	0.74619	6.174000	0.71943	1.276000	0.44395	0.557000	0.71058	.	.		0.343	CCDC152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367497.1	XM_001717416	
SHMT2	6472	ucsc.edu;bcgsc.ca	37	12	57626600	57626600	+	Silent	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:57626600T>C	ENST00000328923.3	+	7	1283	c.831T>C	c.(829-831)acT>acC	p.T277T	SHMT2_ENST00000414700.3_Silent_p.T256T|SHMT2_ENST00000393827.4_Silent_p.T181T|SHMT2_ENST00000553474.1_Silent_p.T256T|SHMT2_ENST00000449049.3_Silent_p.T256T|SHMT2_ENST00000557487.1_Silent_p.T267T	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	277					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TCACCACCACTACTCACAAGA	0.612																																					p.T277T	Esophageal Squamous(150;1369 2416 49071 49364)	.											.	SHMT2	91	0			c.T831C						.						82.0	69.0	73.0					12																	57626600		2203	4300	6503	SO:0001819	synonymous_variant	6472	exon7			CACCACTACTCAC	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.831T>C	12.37:g.57626600T>C		53.0	0.0		42.0	4.0	NM_005412	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Silent	SNP	ENST00000328923.3	37	CCDS8934.1	.	.	.	.	.	.	.	.	.	.	T	1.017	-0.686054	0.03328	.	.	ENSG00000182199	ENST00000557529	.	.	.	4.97	3.96	0.45880	.	.	.	.	.	T	0.46946	0.1419	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43114	-0.9411	4	.	.	.	-0.5821	3.0248	0.06087	0.1685:0.5592:0.164:0.1084	.	.	.	.	H	77	.	.	Y	+	1	0	SHMT2	55912867	0.998000	0.40836	1.000000	0.80357	0.009000	0.06853	0.604000	0.24164	1.260000	0.44134	-0.376000	0.06991	TAC	.		0.612	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
SIGLEC7	27036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51645632	51645632	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:51645632G>A	ENST00000317643.6	+	1	75	c.6G>A	c.(4-6)ctG>ctA	p.L2L	SIGLEC7_ENST00000305628.7_Silent_p.L2L|SIGLEC7_ENST00000600577.1_Silent_p.L2L	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	2					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CAGATAtgctgctgctgctgc	0.597																																					p.L2L		.											.	SIGLEC7	153	0			c.G6A						.						34.0	28.0	30.0					19																	51645632		2203	4300	6503	SO:0001819	synonymous_variant	27036	exon1			TATGCTGCTGCTG	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.6G>A	19.37:g.51645632G>A		43.0	0.0		31.0	14.0	NM_016543	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	37	CCDS12826.1																																																																																			.		0.597	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
SLC12A1	6557	ucsc.edu;bcgsc.ca	37	15	48593511	48593511	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:48593511G>T	ENST00000558405.1	+	25	3110		c.e25-1		SLC12A1_ENST00000380993.3_Splice_Site|SLC12A1_ENST00000396577.3_Splice_Site			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1						cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GTTGCCCACAGAGTTACCGCC	0.363																																					.		.											.	SLC12A1	24	0			c.3097-1G>T						.						83.0	66.0	72.0					15																	48593511		2198	4297	6495	SO:0001630	splice_region_variant	6557	exon26			CCCACAGAGTTAC		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.3097-1G>T	15.37:g.48593511G>T		80.0	0.0		58.0	5.0	NM_001184832	A8JYA2|E9PDW4	Splice_Site	SNP	ENST00000558405.1	37	CCDS10129.2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299475	0.81136	.	.	ENSG00000074803	ENST00000380993;ENST00000396577	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.588	0.91197	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC12A1	46380803	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.408000	0.97327	2.385000	0.81259	0.650000	0.86243	.	.		0.363	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		Intron
SLC17A4	10050	ucsc.edu;bcgsc.ca	37	6	25762253	25762253	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:25762253C>T	ENST00000377905.4	+	2	182	c.63C>T	c.(61-63)aaC>aaT	p.N21N	SLC17A4_ENST00000439485.2_Silent_p.N21N|SLC17A4_ENST00000397076.2_5'UTR	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	21					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GCAATTTAAACGTGGCTCAAG	0.428																																					p.N21N		.											.	SLC17A4	91	0			c.C63T						.						82.0	75.0	78.0					6																	25762253		2203	4300	6503	SO:0001819	synonymous_variant	10050	exon2			TTTAAACGTGGCT	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.63C>T	6.37:g.25762253C>T		53.0	0.0		49.0	4.0	NM_005495	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Silent	SNP	ENST00000377905.4	37	CCDS4564.1																																																																																			.		0.428	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040068.1		
SLC2A13	114134	ucsc.edu;bcgsc.ca	37	12	40158661	40158661	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:40158661C>A	ENST00000280871.4	-	8	1496		c.e8-1			NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				ATTTTCACACCTGAAAAATAA	0.313										HNSCC(50;0.14)																											.		.											.	SLC2A13	515	0			c.1446-1G>T						.						84.0	96.0	92.0					12																	40158661		2202	4300	6502	SO:0001630	splice_region_variant	114134	exon9			TCACACCTGAAAA	AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1446-1G>T	12.37:g.40158661C>A		126.0	0.0		32.0	4.0	NM_052885	Q17S07	Splice_Site	SNP	ENST00000280871.4	37	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311269	0.81358	.	.	ENSG00000151229	ENST00000280871	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5639	0.91111	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC2A13	38444928	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.072000	0.76777	2.387000	0.81309	0.644000	0.83932	.	.		0.313	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		Intron
SLC37A1	54020	ucsc.edu;bcgsc.ca	37	21	43954849	43954849	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr21:43954849C>T	ENST00000352133.2	+	4	1162	c.180C>T	c.(178-180)gaC>gaT	p.D60D	SLC37A1_ENST00000398341.3_Silent_p.D60D			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	60					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						ATGAAGCTGACGTCAGGTTCA	0.602																																					p.D60D		.											.	SLC37A1	90	0			c.C180T						.						101.0	92.0	95.0					21																	43954849		2203	4300	6503	SO:0001819	synonymous_variant	54020	exon5			AGCTGACGTCAGG	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.180C>T	21.37:g.43954849C>T		74.0	0.0		47.0	4.0	NM_018964	D3DSJ7|Q9HAQ1	Silent	SNP	ENST00000352133.2	37	CCDS13689.1																																																																																			.		0.602	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		
SMC2	10592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	106894408	106894408	+	Splice_Site	SNP	T	T	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:106894408T>G	ENST00000286398.7	+	22	3396		c.e22+2		SMC2_ENST00000374793.3_Splice_Site|SMC2_ENST00000303219.8_Splice_Site|SMC2_ENST00000374787.3_Splice_Site	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2						kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TGGCAAAAGGTACTTTTTATG	0.303																																					.		.											.	SMC2	210	0			c.3108+2T>G						.						67.0	72.0	70.0					9																	106894408		2203	4294	6497	SO:0001630	splice_region_variant	10592	exon22			AAAAGGTACTTTT	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.3108+2T>G	9.37:g.106894408T>G		503.0	0.0		287.0	123.0	NM_001042551	Q6IEE0|Q9P1P2	Splice_Site	SNP	ENST00000286398.7	37	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106937	0.77096	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1896	0.65630	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMC2	105934229	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.971000	0.88012	2.222000	0.72286	0.533000	0.62120	.	.		0.303	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		Intron
SNRPA1	6627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	101827889	101827889	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:101827889C>A	ENST00000254193.6	-	4	400	c.328G>T	c.(328-330)Gca>Tca	p.A110S	SNRPA1_ENST00000560856.1_5'UTR	NM_003090.2	NP_003081.2	P09661	RU2A_HUMAN	small nuclear ribonucleoprotein polypeptide A'	110					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	Lung NSC(78;0.00156)|all_lung(78;0.00195)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00113)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTGAGAGATGCCAGAGGGTCC	0.408																																					p.A110S		.											.	SNRPA1	226	0			c.G328T						.						113.0	102.0	106.0					15																	101827889		2203	4300	6503	SO:0001583	missense	6627	exon4			GAGATGCCAGAGG	AJ130971	CCDS10391.1	15q26.3	2011-10-11			ENSG00000131876	ENSG00000131876			11152	protein-coding gene	gene with protein product		603521				2928112	Standard	NM_003090		Approved	Lea1	uc002bww.3	P09661	OTTHUMG00000149871	ENST00000254193.6:c.328G>T	15.37:g.101827889C>A	ENSP00000254193:p.Ala110Ser	196.0	1.0		99.0	66.0	NM_003090	B2R5I6|Q8TBD2	Missense_Mutation	SNP	ENST00000254193.6	37	CCDS10391.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396426	0.42512	.	.	ENSG00000131876	ENST00000254193	T	0.61274	0.12	5.82	4.89	0.63831	.	0.236329	0.43919	D	0.000519	T	0.45196	0.1330	L	0.38175	1.15	0.51767	D	0.999939	B	0.02656	0.0	B	0.06405	0.002	T	0.31833	-0.9929	10	0.15066	T	0.55	-11.4739	12.6983	0.57016	0.4164:0.5836:0.0:0.0	.	110	P09661	RU2A_HUMAN	S	110	ENSP00000254193:A110S	ENSP00000254193:A110S	A	-	1	0	SNRPA1	99645412	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	1.724000	0.38064	1.433000	0.47394	-0.181000	0.13052	GCA	.		0.408	SNRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313621.2	NM_003090	
SNX7	51375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	99203828	99203828	+	Silent	SNP	G	G	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:99203828G>C	ENST00000306121.3	+	8	1170	c.1161G>C	c.(1159-1161)gtG>gtC	p.V387V	SNX7_ENST00000529992.1_Silent_p.V332V|SNX7_ENST00000370189.5_Intron	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	323					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		AAGATAAAGTGGAATGTGCTA	0.353																																					p.V387V		.											.	SNX7	229	0			c.G1161C						.						124.0	125.0	125.0					1																	99203828		2203	4299	6502	SO:0001819	synonymous_variant	51375	exon8			TAAAGTGGAATGT	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.1161G>C	1.37:g.99203828G>C		114.0	0.0		84.0	32.0	NM_015976	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Silent	SNP	ENST00000306121.3	37	CCDS755.2																																																																																			.		0.353	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
SP6	80320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45925714	45925714	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:45925714G>T	ENST00000536300.1	-	2	413	c.82C>A	c.(82-84)Cct>Act	p.P28T	SP6_ENST00000342234.2_Missense_Mutation_p.P28T	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	28					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						GTTTGGAGAGGCTGCAGGTCG	0.716																																					p.P28T		.											.	SP6	91	0			c.C82A						.						8.0	10.0	9.0					17																	45925714		2174	4232	6406	SO:0001583	missense	80320	exon2			GGAGAGGCTGCAG		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.82C>A	17.37:g.45925714G>T	ENSP00000438209:p.Pro28Thr	42.0	0.0		52.0	21.0	NM_001258248	B3KXS4	Missense_Mutation	SNP	ENST00000536300.1	37	CCDS11520.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195352	0.58126	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.12774	2.65;2.65	4.44	4.44	0.53790	.	0.000000	0.43260	D	0.000581	T	0.07007	0.0178	N	0.08118	0	0.33950	D	0.644355	P	0.37233	0.588	B	0.36244	0.22	T	0.23261	-1.0193	10	0.37606	T	0.19	.	9.725	0.40326	0.0971:0.0:0.9029:0.0	.	28	Q3SY56	SP6_HUMAN	T	28	ENSP00000340799:P28T;ENSP00000438209:P28T	ENSP00000340799:P28T	P	-	1	0	SP6	43280713	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.972000	0.49256	2.288000	0.76882	0.462000	0.41574	CCT	.		0.716	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441395.1	NM_199262	
SPATA31D1	389763	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	84609195	84609195	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:84609195G>T	ENST00000344803.2	+	4	3857	c.3810G>T	c.(3808-3810)caG>caT	p.Q1270H		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1270					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CACAGAAGCAGGAGCCCAGGG	0.542																																					p.Q1270H		.											.	.	.	0			c.G3810T						.						87.0	87.0	87.0					9																	84609195		2003	4171	6174	SO:0001583	missense	389763	exon4			GAAGCAGGAGCCC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3810G>T	9.37:g.84609195G>T	ENSP00000341988:p.Gln1270His	106.0	1.0		64.0	22.0	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006785	0.35415	.	.	ENSG00000214929	ENST00000344803	T	0.10288	2.89	3.26	1.37	0.22104	.	.	.	.	.	T	0.15392	0.0371	N	0.24115	0.695	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.14783	-1.0460	9	0.54805	T	0.06	-9.9373	5.2702	0.15620	0.276:0.0:0.724:0.0	.	1270	Q6ZQQ2	F75D1_HUMAN	H	1270	ENSP00000341988:Q1270H	ENSP00000341988:Q1270H	Q	+	3	2	FAM75D1	83799015	0.004000	0.15560	0.008000	0.14137	0.003000	0.03518	0.077000	0.14738	0.386000	0.24997	0.655000	0.94253	CAG	.		0.542	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
SPTBN5	51332	ucsc.edu;bcgsc.ca	37	15	42152870	42152870	+	Silent	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:42152870A>G	ENST00000320955.6	-	47	8129	c.7902T>C	c.(7900-7902)gcT>gcC	p.A2634A		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2634					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TGGCCTCCAGAGCACTGATCT	0.677																																					p.A2599A		.											.	SPTBN5	91	0			c.T7797C						.						13.0	18.0	16.0					15																	42152870		1985	4129	6114	SO:0001819	synonymous_variant	51332	exon47			CTCCAGAGCACTG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.7902T>C	15.37:g.42152870A>G		67.0	0.0		40.0	4.0	NM_016642		Silent	SNP	ENST00000320955.6	37																																																																																				.		0.677	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
ST3GAL2	6483	ucsc.edu;bcgsc.ca	37	16	70432284	70432284	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr16:70432284C>T	ENST00000393640.4	-	1	2257	c.150G>A	c.(148-150)ctG>ctA	p.L50L	ST3GAL2_ENST00000566097.1_5'Flank|ST3GAL2_ENST00000342907.2_Silent_p.L50L|RP11-529K1.4_ENST00000566960.1_RNA			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	50					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				AGCCGGGCACCAGCTTCACCC	0.662																																					p.L50L		.											.	ST3GAL2	91	0			c.G150A						.						53.0	52.0	52.0					16																	70432284		2198	4300	6498	SO:0001819	synonymous_variant	6483	exon2			GGGCACCAGCTTC	U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.150G>A	16.37:g.70432284C>T		43.0	0.0		39.0	4.0	NM_006927	O00654	Silent	SNP	ENST00000393640.4	37	CCDS10890.1																																																																																			.		0.662	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268968.1	NM_006927	
STOML1	9399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74277722	74277722	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:74277722C>A	ENST00000316900.5	-	5	851	c.727G>T	c.(727-729)Gcc>Tcc	p.A243S	STOML1_ENST00000359750.4_Missense_Mutation_p.A243S|STOML1_ENST00000541638.1_Missense_Mutation_p.A201S|STOML1_ENST00000316911.6_Missense_Mutation_p.A193S|STOML1_ENST00000564777.1_Missense_Mutation_p.A193S|STOML1_ENST00000561656.1_Missense_Mutation_p.A156S	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	243						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						AAGTGCAGGGCCAGCTGCTGG	0.692																																					p.A243S		.											.	STOML1	91	0			c.G727T						.						21.0	19.0	20.0					15																	74277722		2198	4297	6495	SO:0001583	missense	9399	exon5			GCAGGGCCAGCTG	Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.727G>T	15.37:g.74277722C>A	ENSP00000319323:p.Ala243Ser	94.0	0.0		38.0	10.0	NM_001256672	B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Missense_Mutation	SNP	ENST00000316900.5	37	CCDS10254.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455809	0.63401	.	.	ENSG00000067221	ENST00000316900;ENST00000316911;ENST00000541638;ENST00000359750	D;D;D;D	0.98221	-3.13;-2.71;-3.1;-4.8	5.22	4.31	0.51392	.	0.107947	0.64402	D	0.000006	D	0.96433	0.8836	L	0.29908	0.895	0.51482	D	0.999928	P;P;P;P;P;P	0.45827	0.791;0.666;0.867;0.666;0.578;0.791	P;B;P;B;B;B	0.50314	0.535;0.194;0.637;0.194;0.272;0.389	D	0.94849	0.8012	10	0.34782	T	0.22	-14.6048	10.6367	0.45569	0.0:0.9109:0.0:0.0891	.	201;243;193;243;243;243	B4DUU5;E7ESC0;Q9UBI4-2;Q4PNR4;Q53HB6;Q9UBI4	.;.;.;.;.;STML1_HUMAN	S	243;193;201;243	ENSP00000319323:A243S;ENSP00000319384:A193S;ENSP00000442478:A201S;ENSP00000352788:A243S	ENSP00000319323:A243S	A	-	1	0	STOML1	72064775	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.057000	0.49931	1.201000	0.43203	0.655000	0.94253	GCC	.		0.692	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269022.1	NM_004809	
SYCN	342898	ucsc.edu;bcgsc.ca	37	19	39694627	39694627	+	Missense_Mutation	SNP	C	C	T	rs201454210		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:39694627C>T	ENST00000318438.6	-	1	279	c.268G>A	c.(268-270)Gtg>Atg	p.V90M		NM_001080468.2	NP_001073937.1	Q0VAF6	SYCN_HUMAN	syncollin	90					exocytosis (GO:0006887)	secretory granule membrane (GO:0030667)				endometrium(1)|kidney(1)	2	all_cancers(60;7.32e-07)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|all_epithelial(25;8.97e-07)|Ovarian(47;0.0454)		Epithelial(26;1.34e-25)|all cancers(26;9.31e-23)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CGGGACCACACGGTGAGCTCG	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		13766	0.001		0.0	False		,,,				2504	0.0				p.V90M		.											.	SYCN	68	0			c.G268A						.	C	MET/VAL	0,4134		0,0,2067	14.0	18.0	17.0		268	3.9	1.0	19		17	1,8353		0,1,4176	yes	missense	SYCN	NM_001080468.2	21	0,1,6243	TT,TC,CC		0.012,0.0,0.0080	probably-damaging	90/135	39694627	1,12487	2067	4177	6244	SO:0001583	missense	342898	exon1			ACCACACGGTGAG	BC039541	CCDS46070.1	19q13.2	2008-02-05	2005-05-26			ENSG00000179751			18442	protein-coding gene	gene with protein product			"""insulin synthesis associated 1"""	INSSA1		11839820	Standard	NM_001080468		Approved	SYL, FLJ27441	uc002okr.2	Q0VAF6		ENST00000318438.6:c.268G>A	19.37:g.39694627C>T	ENSP00000325564:p.Val90Met	52.0	0.0		46.0	4.0	NM_001080468		Missense_Mutation	SNP	ENST00000318438.6	37	CCDS46070.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.627022	0.46840	0.0	1.2E-4	ENSG00000179751	ENST00000318438	T	0.58060	0.36	3.87	3.87	0.44632	.	0.000000	0.53938	D	0.000042	T	0.65974	0.2743	M	0.68952	2.095	0.43021	D	0.994573	D	0.89917	1.0	P	0.60886	0.88	T	0.71803	-0.4482	10	0.87932	D	0	2.1849	13.3539	0.60617	0.0:1.0:0.0:0.0	.	90	Q0VAF6	SYCN_HUMAN	M	90	ENSP00000325564:V90M	ENSP00000325564:V90M	V	-	1	0	SYCN	44386467	0.999000	0.42202	0.994000	0.49952	0.092000	0.18411	2.385000	0.44371	1.995000	0.58328	0.491000	0.48974	GTG	.		0.682	SYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463830.1		
SYF2	25949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	25558651	25558651	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:25558651C>A	ENST00000236273.4	-	2	101	c.76G>T	c.(76-78)Gcc>Tcc	p.A26S	SYF2_ENST00000476231.1_5'UTR|SYF2_ENST00000354361.3_Missense_Mutation_p.A26S	NM_015484.4	NP_056299.1	O95926	SYF2_HUMAN	SYF2 pre-mRNA-splicing factor	26					embryonic organ development (GO:0048568)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|mitotic G2 DNA damage checkpoint (GO:0007095)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(4)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		TTCTGAGCGGCCAGCTCCGCC	0.647																																					p.A26S		.											.	SYF2	90	0			c.G76T						.						21.0	25.0	24.0					1																	25558651		2203	4300	6503	SO:0001583	missense	25949	exon2			GAGCGGCCAGCTC	AF273089	CCDS258.1, CCDS259.1	1p36.11	2013-08-21	2013-08-21	2005-09-14	ENSG00000117614	ENSG00000117614			19824	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 29"""	607090	"""CCNDBP1 interactor"", ""SYF2 homolog, RNA splicing factor (S. cerevisiae)"""	CBPIN		11118353	Standard	NM_207170		Approved	p29, DKFZp564O2082, NTC31, fSAP29	uc001bjt.1	O95926	OTTHUMG00000043610	ENST00000236273.4:c.76G>T	1.37:g.25558651C>A	ENSP00000236273:p.Ala26Ser	80.0	0.0		90.0	41.0	NM_015484	Q5TH73	Missense_Mutation	SNP	ENST00000236273.4	37	CCDS259.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204648	0.79127	.	.	ENSG00000117614	ENST00000236273;ENST00000354361	T;T	0.47869	0.88;0.83	5.42	3.54	0.40534	.	0.104346	0.64402	N	0.000002	T	0.33847	0.0877	L	0.41236	1.265	0.54753	D	0.99998	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.001	T	0.08330	-1.0727	10	0.13470	T	0.59	-11.5655	9.2119	0.37324	0.146:0.7773:0.0:0.0768	.	26;26;26	B4E0Y8;B2RBX8;O95926	.;.;SYF2_HUMAN	S	26	ENSP00000236273:A26S;ENSP00000346330:A26S	ENSP00000236273:A26S	A	-	1	0	SYF2	25431238	1.000000	0.71417	0.992000	0.48379	0.806000	0.45545	2.272000	0.43373	0.651000	0.30788	0.561000	0.74099	GCC	.		0.647	SYF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101962.1	NM_015484	
TAF4	6874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60578221	60578221	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:60578221C>A	ENST00000252996.4	-	9	2480	c.2481G>T	c.(2479-2481)tcG>tcT	p.S827S		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	827					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CTTACCGAAACGAACCTCCCC	0.572																																					p.S827S		.											.	TAF4	93	0			c.G2481T						.						103.0	89.0	94.0					20																	60578221		2203	4300	6503	SO:0001819	synonymous_variant	6874	exon9			CCGAAACGAACCT	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2481G>T	20.37:g.60578221C>A		105.0	0.0		103.0	46.0	NM_003185	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	ENST00000252996.4	37	CCDS33500.1																																																																																			.		0.572	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
TENC1	23371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53446269	53446269	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:53446269A>T	ENST00000314250.6	+	3	505	c.215A>T	c.(214-216)gAa>gTa	p.E72V	TENC1_ENST00000552570.1_Missense_Mutation_p.E72V|TENC1_ENST00000451358.1_Missense_Mutation_p.E72V|RP11-983P16.4_ENST00000551890.1_RNA|RP11-983P16.4_ENST00000550601.1_RNA|TENC1_ENST00000379902.3_De_novo_Start_OutOfFrame|RP11-983P16.4_ENST00000546793.1_RNA|TENC1_ENST00000546602.1_Missense_Mutation_p.E72V|TENC1_ENST00000314276.3_Missense_Mutation_p.E82V|TENC1_ENST00000549700.1_Missense_Mutation_p.E72V	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	72					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						AGAAAATGTGAAGCAAAGGTG	0.567																																					p.E82V		.											.	TENC1	92	0			c.A245T						.						227.0	213.0	218.0					12																	53446269		2203	4300	6503	SO:0001583	missense	23371	exon3			AATGTGAAGCAAA	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.215A>T	12.37:g.53446269A>T	ENSP00000319684:p.Glu72Val	100.0	0.0		111.0	43.0	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	ENST00000314250.6	37	CCDS8843.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503466	0.85176	.	.	ENSG00000111077	ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.55	4.41	0.53225	Protein kinase C-like, phorbol ester/diacylglycerol binding (3);	0.000000	0.64402	D	0.000003	D	0.87966	0.6311	L	0.61218	1.895	0.40401	D	0.979645	D;D;D;D	0.89917	1.0;0.975;1.0;0.997	D;P;D;D	0.80764	0.963;0.668;0.983;0.994	D	0.88702	0.3216	10	0.87932	D	0	-3.8027	9.2442	0.37515	0.9148:0.0:0.0852:0.0	.	72;72;82;49	Q63HR2;F8W661;Q63HR2-4;Q6ZMJ1	TENC1_HUMAN;.;.;.	V	82;72;72;72;72;72;72	ENSP00000319756:E82V;ENSP00000319684:E72V;ENSP00000393362:E72V;ENSP00000449363:E72V;ENSP00000447021:E72V;ENSP00000449361:E72V	ENSP00000319684:E72V	E	+	2	0	TENC1	51732536	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.667000	0.54547	2.251000	0.74343	0.482000	0.46254	GAA	.		0.567	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
TET1	80312	broad.mit.edu;bcgsc.ca	37	10	70332547	70332547	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:70332547A>G	ENST00000373644.4	+	2	661	c.452A>G	c.(451-453)aAg>aGg	p.K151R		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	151					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TTGGGAGTAAAGCACTCAGAA	0.408																																					p.K151R		.											.	TET1	663	0			c.A452G						.						69.0	67.0	68.0					10																	70332547		2203	4300	6503	SO:0001583	missense	80312	exon2			GAGTAAAGCACTC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.452A>G	10.37:g.70332547A>G	ENSP00000362748:p.Lys151Arg	108.0	0.0		83.0	6.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	6.473	0.455457	0.12283	.	.	ENSG00000138336	ENST00000373644	T	0.08807	3.05	5.02	0.985	0.19779	.	3.275280	0.01050	N	0.004458	T	0.07324	0.0185	L	0.29908	0.895	0.09310	N	1	B	0.14805	0.011	B	0.14023	0.01	T	0.35674	-0.9779	10	0.49607	T	0.09	.	1.7511	0.02972	0.5711:0.167:0.1017:0.1602	.	151	Q8NFU7	TET1_HUMAN	R	151	ENSP00000362748:K151R	ENSP00000362748:K151R	K	+	2	0	TET1	70002553	0.014000	0.17966	0.022000	0.16811	0.500000	0.33767	1.501000	0.35693	-0.095000	0.12351	0.460000	0.39030	AAG	.		0.408	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
TGFBRAP1	9392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	105924415	105924415	+	Missense_Mutation	SNP	C	C	A	rs369840873		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:105924415C>A	ENST00000393359.2	-	2	770	c.344G>T	c.(343-345)cGc>cTc	p.R115L	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.R115L			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	115	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						CCCCTTGATGCGGGCCCCCGA	0.582																																					p.R115L	Esophageal Squamous(183;794 2019 9730 21801 48859)	.											.	TGFBRAP1	91	0			c.G344T						.						57.0	63.0	61.0					2																	105924415		2203	4300	6503	SO:0001583	missense	9392	exon2			TTGATGCGGGCCC	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.344G>T	2.37:g.105924415C>A	ENSP00000377027:p.Arg115Leu	48.0	0.0		45.0	23.0	NM_004257	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	37	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168629	0.78339	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.04706	3.57;3.57	5.02	5.02	0.67125	Citron-like (2);	0.055423	0.64402	D	0.000001	T	0.05456	0.0144	L	0.44542	1.39	0.45930	D	0.998766	B	0.34214	0.442	B	0.31614	0.133	T	0.40813	-0.9543	10	0.36615	T	0.2	-30.6776	12.2513	0.54599	0.0:0.9224:0.0:0.0776	.	115	Q8WUH2	TGFA1_HUMAN	L	115	ENSP00000377027:R115L;ENSP00000258449:R115L	ENSP00000258449:R115L	R	-	2	0	TGFBRAP1	105290847	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.578000	0.60929	2.760000	0.94817	0.655000	0.94253	CGC	.		0.582	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
TNS1	7145	ucsc.edu;bcgsc.ca	37	2	218745712	218745712	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:218745712C>A	ENST00000171887.4	-	16	1415	c.963G>T	c.(961-963)ccG>ccT	p.P321P	TNS1_ENST00000310858.6_Silent_p.P352P|TNS1_ENST00000430930.1_Silent_p.P321P|TNS1_ENST00000419504.1_Silent_p.P321P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	321					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CAGACACGCTCGGCCCGTTCT	0.587																																					p.P321P		.											.	TNS1	156	0			c.G963T						.						96.0	78.0	84.0					2																	218745712		2203	4300	6503	SO:0001819	synonymous_variant	7145	exon16			CACGCTCGGCCCG	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.963G>T	2.37:g.218745712C>A		57.0	0.0		42.0	5.0	NM_022648	Q4ZG71|Q6IPI5	Silent	SNP	ENST00000171887.4	37	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	C	4.013	-0.000246	0.07819	.	.	ENSG00000079308	ENST00000453356	.	.	.	4.98	-9.96	0.00443	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.2381	0.06771	0.1159:0.3213:0.2384:0.3243	.	.	.	.	X	97	.	.	E	-	1	0	TNS1	218453957	0.000000	0.05858	0.001000	0.08648	0.626000	0.37791	-5.016000	0.00159	-2.673000	0.00413	-2.291000	0.00267	GAG	.		0.587	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578449	7578449	+	Missense_Mutation	SNP	C	C	A	rs193920817		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:7578449C>A	ENST00000269305.4	-	5	670	c.481G>T	c.(481-483)Gcc>Tcc	p.A161S	TP53_ENST00000455263.2_Missense_Mutation_p.A161S|TP53_ENST00000413465.2_Missense_Mutation_p.A161S|TP53_ENST00000445888.2_Missense_Mutation_p.A161S|TP53_ENST00000359597.4_Missense_Mutation_p.A161S|TP53_ENST00000420246.2_Missense_Mutation_p.A161S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	161	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|MA -> IP (in a sporadic cancer; somatic mutation).|MA -> IS (in sporadic cancers; somatic mutation).|MA -> IT (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A161T(54)|p.0?(8)|p.A68T(3)|p.A29T(3)|p.A161fs*9(3)|p.R156_I162delRVRAMAI(2)|p.M160fs*10(2)|p.V157_C176del20(1)|p.A161fs*19(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.A161fs*10(1)|p.R156_A161del(1)|p.V157fs*9(1)|p.A161fs*20(1)|p.M160_A161>IS(1)|p.A161fs*8(1)|p.S149fs*72(1)|p.A161fs*7(1)|p.T155_A161delTRVRAMA(1)|p.R156fs*20(1)|p.A161S(1)|p.A161P(1)|p.V157_I162delVRAMAI(1)|p.A161F(1)|p.A159_Q167delAMAIYKQSQ(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGTAGATGGCCATGGCGCGG	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A161S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	96	Substitution - Missense(63)|Deletion - Frameshift(10)|Deletion - In frame(9)|Whole gene deletion(8)|Complex - frameshift(3)|Insertion - Frameshift(2)|Complex - compound substitution(1)	lung(15)|large_intestine(13)|urinary_tract(8)|stomach(7)|central_nervous_system(7)|upper_aerodigestive_tract(6)|oesophagus(6)|pancreas(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|bone(4)|liver(4)|breast(3)|ovary(3)|thyroid(1)|meninges(1)|peritoneum(1)|skin(1)	c.G481T						.						52.0	53.0	53.0					17																	7578449		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGATGGCCATGGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.481G>T	17.37:g.7578449C>A	ENSP00000269305:p.Ala161Ser	98.0	0.0		56.0	36.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832703	0.50845	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99811	-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87	5.59	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	M	0.79805	2.47	0.48696	D	0.999696	D;P;D;D;D;D;D	0.89917	0.998;0.951;0.976;0.998;0.961;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.989;0.981;0.998;0.994;1.0;1.0	D	0.97397	0.9993	10	0.59425	D	0.04	-25.6622	14.7187	0.69289	0.0:0.8543:0.1457:0.0	.	122;161;161;68;161;161;161	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	161;161;161;161;161;161;150;68;29;68;29;161	ENSP00000410739:A161S;ENSP00000352610:A161S;ENSP00000269305:A161S;ENSP00000398846:A161S;ENSP00000391127:A161S;ENSP00000391478:A161S;ENSP00000425104:A29S;ENSP00000423862:A68S;ENSP00000424104:A161S	ENSP00000269305:A161S	A	-	1	0	TP53	7519174	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	1.014000	0.29950	1.498000	0.48600	0.655000	0.94253	GCC	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAK2	66008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202251196	202251196	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:202251196G>A	ENST00000332624.3	-	14	2136	c.1708C>T	c.(1708-1710)Ctg>Ttg	p.L570L		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	570					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)	p.L570M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						CAGTGATACAGAGTTTGTGAT	0.423																																					p.L570L		.											.	TRAK2	90	1	Substitution - Missense(1)	lung(1)	c.C1708T						.						91.0	97.0	95.0					2																	202251196		2203	4300	6503	SO:0001819	synonymous_variant	66008	exon14			GATACAGAGTTTG	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.1708C>T	2.37:g.202251196G>A		121.0	0.0		54.0	19.0	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Silent	SNP	ENST00000332624.3	37	CCDS2347.1																																																																																			.		0.423	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230667054	230667054	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:230667054G>A	ENST00000283943.5	-	20	3073	c.2895C>T	c.(2893-2895)gcC>gcT	p.A965A	TRIP12_ENST00000389045.3_Silent_p.A695A|TRIP12_ENST00000389044.4_Silent_p.A1013A|TRIP12_ENST00000543084.1_Intron	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	965					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGGCAGCTGTGGCTGTCCCAC	0.502																																					p.A965A		.											.	TRIP12	572	0			c.C2895T						.						66.0	57.0	60.0					2																	230667054		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon20			AGCTGTGGCTGTC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2895C>T	2.37:g.230667054G>A		111.0	0.0		73.0	18.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	37	CCDS33391.1																																																																																			.		0.502	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
TTC23	64927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	99759189	99759189	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:99759189C>A	ENST00000394132.2	-	7	1186	c.369G>T	c.(367-369)gtG>gtT	p.V123V	TTC23_ENST00000394130.1_Silent_p.V123V|TTC23_ENST00000394135.3_Silent_p.V123V|TTC23_ENST00000558613.1_Silent_p.V123V|TTC23_ENST00000394136.1_Silent_p.V123V|TTC23_ENST00000394129.2_Silent_p.V123V|TTC23_ENST00000558663.1_Silent_p.V123V|TTC23_ENST00000262074.4_Silent_p.V123V			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	123										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TATAGGGAGGCACAATGGAGT	0.423																																					p.V123V		.											.	TTC23	90	0			c.G369T						.						220.0	212.0	215.0					15																	99759189		2197	4297	6494	SO:0001819	synonymous_variant	64927	exon5			GGGAGGCACAATG		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.369G>T	15.37:g.99759189C>A		382.0	0.0		166.0	98.0	NM_001040657	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Silent	SNP	ENST00000394132.2	37	CCDS10379.2																																																																																			.		0.423	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905	
TTN	7273	ucsc.edu;bcgsc.ca	37	2	179583632	179583632	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:179583632T>C	ENST00000591111.1	-	82	23568	c.23344A>G	c.(23344-23346)Agt>Ggt	p.S7782G	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.S8099G|TTN_ENST00000342992.6_Missense_Mutation_p.S6855G|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13316	Ig-like 60.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGATGACACTGGTGAATGTG	0.483																																					p.S8099G		.											.	TTN	636	0			c.A24295G						.						69.0	65.0	67.0					2																	179583632		1917	4147	6064	SO:0001583	missense	7273	exon84			TGACACTGGTGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23344A>G	2.37:g.179583632T>C	ENSP00000465570:p.Ser7782Gly	54.0	0.0		27.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	10.53	1.376872	0.24857	.	.	ENSG00000155657	ENST00000342992	T	0.40476	1.03	6.01	-3.67	0.04476	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28234	0.0697	L	0.39085	1.19	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.02526	-1.1146	9	0.87932	D	0	.	8.0681	0.30672	0.5755:0.063:0.0:0.3615	.	7782	Q8WZ42	TITIN_HUMAN	G	6855	ENSP00000343764:S6855G	ENSP00000343764:S6855G	S	-	1	0	TTN	179291877	0.001000	0.12720	0.952000	0.39060	0.900000	0.52787	0.635000	0.24629	-0.887000	0.03961	-0.341000	0.08007	AGT	.		0.483	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBTF	7343	ucsc.edu;bcgsc.ca	37	17	42287773	42287773	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:42287773C>A	ENST00000302904.4	-	14	1920	c.1428G>T	c.(1426-1428)gaG>gaT	p.E476D	UBTF_ENST00000533177.1_Missense_Mutation_p.E439D|UBTF_ENST00000436088.1_Missense_Mutation_p.E476D|UBTF_ENST00000529383.1_Missense_Mutation_p.E476D|UBTF_ENST00000343638.5_Missense_Mutation_p.E439D|UBTF_ENST00000393606.3_Missense_Mutation_p.E439D|UBTF_ENST00000527034.1_Missense_Mutation_p.E439D|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Missense_Mutation_p.E439D			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	476					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TGCCCCGTTCCTCGCGCTCCC	0.672											OREG0024456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E476D		.											.	UBTF	90	0			c.G1428T						.						40.0	37.0	38.0					17																	42287773		2203	4300	6503	SO:0001583	missense	7343	exon14			CCGTTCCTCGCGC	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1428G>T	17.37:g.42287773C>A	ENSP00000302640:p.Glu476Asp	69.0	0.0	907	48.0	4.0	NM_014233	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	37	CCDS11480.1	.	.	.	.	.	.	.	.	.	.	c	13.38	2.220649	0.39201	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383;ENST00000529373	D;D;D;D;D;D;D;D;T	0.98280	-4.81;-4.08;-4.84;-4.81;-4.08;-4.81;-4.81;-4.08;1.84	4.36	0.871	0.19107	High mobility group, HMG1/HMG2 (1);	0.056481	0.64402	D	0.000002	D	0.92355	0.7574	N	0.12182	0.205	0.37417	D	0.913497	B;B;B	0.24186	0.034;0.099;0.053	B;B;B	0.22753	0.01;0.041;0.021	D	0.86045	0.1522	10	0.46703	T	0.11	-22.6621	4.104	0.10028	0.1564:0.4014:0.0:0.4423	.	439;439;476	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	D	439;476;439;439;476;439;439;476;63	ENSP00000345297:E439D;ENSP00000302640:E476D;ENSP00000431539:E439D;ENSP00000437180:E439D;ENSP00000390669:E476D;ENSP00000377231:E439D;ENSP00000432925:E439D;ENSP00000435708:E476D;ENSP00000431295:E63D	ENSP00000302640:E476D	E	-	3	2	UBTF	39643299	0.993000	0.37304	0.989000	0.46669	0.723000	0.41478	0.332000	0.19751	0.343000	0.23821	0.467000	0.42956	GAG	.		0.672	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	
UNC93A	54346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167708073	167708073	+	Silent	SNP	G	G	A	rs558415122		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:167708073G>A	ENST00000230256.3	+	2	331	c.156G>A	c.(154-156)ctG>ctA	p.L52L	UNC93A_ENST00000366829.2_Silent_p.L52L|UNC93A_ENST00000366830.2_3'UTR	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCATGCTCCTGTCCTCCATGT	0.617																																					p.L52L		.											.	UNC93A	90	0			c.G156A						.						253.0	210.0	224.0					6																	167708073		2203	4300	6503	SO:0001819	synonymous_variant	54346	exon2			GCTCCTGTCCTCC	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.156G>A	6.37:g.167708073G>A		101.0	0.0		115.0	43.0	NM_018974	B3KRP5|Q4QQJ4|Q5JZD6	Silent	SNP	ENST00000230256.3	37	CCDS5300.1																																																																																			.		0.617	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
USF1	7391	ucsc.edu;bcgsc.ca	37	1	161011115	161011115	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:161011115G>T	ENST00000368021.3	-	7	763	c.559C>A	c.(559-561)Ccg>Acg	p.P187T	USF1_ENST00000435396.1_Splice_Site_p.P128T|USF1_ENST00000368020.1_Splice_Site_p.P187T|TSTD1_ENST00000368023.3_5'Flank|TSTD1_ENST00000423014.2_5'Flank|TSTD1_ENST00000318289.10_5'Flank|USF1_ENST00000368019.1_Splice_Site_p.P159T|TSTD1_ENST00000466967.1_5'Flank|F11R_ENST00000289779.3_5'Flank|TSTD1_ENST00000368024.1_5'Flank	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	187					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GTCACTCACGGGGAATAAGGG	0.458																																					p.P187T		.											.	USF1	516	0			c.C559A						.						78.0	79.0	79.0					1																	161011115		2203	4300	6503	SO:0001630	splice_region_variant	7391	exon7			CTCACGGGGAATA	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.560+1C>A	1.37:g.161011115G>T		92.0	0.0		69.0	6.0	NM_001276373	B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	ENST00000368021.3	37	CCDS1214.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.18|11.18	1.561706|1.561706	0.27915|0.27915	.|.	.|.	ENSG00000158773|ENSG00000158773	ENST00000528768|ENST00000368020;ENST00000368021;ENST00000435396;ENST00000368019;ENST00000531842	.|D;D;D;D;D	.|0.92965	.|-3.12;-3.12;-3.14;-3.12;-2.68	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.108122|0.108122	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.80586|0.80586	0.4651|0.4651	N|N	0.25647|0.25647	0.755|0.755	0.38156|0.38156	D|D	0.938896|0.938896	.|B	.|0.15141	.|0.012	.|B	.|0.12837	.|0.008	T|T	0.75309|0.75309	-0.3363|-0.3363	6|10	.|0.22706	.|T	.|0.39	-13.6838|-13.6838	15.8355|15.8355	0.78793|0.78793	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|187	.|P22415	.|USF1_HUMAN	H|T	53|187;187;128;159;126	.|ENSP00000356999:P187T;ENSP00000357000:P187T;ENSP00000390109:P128T;ENSP00000356998:P159T;ENSP00000435005:P126T	.|ENSP00000356998:P159T	P|P	-|-	2|1	0|0	USF1|USF1	159277739|159277739	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.329000|3.329000	0.52060|0.52060	2.600000|2.600000	0.87896|0.87896	0.491000|0.491000	0.48974|0.48974	CCC|CCG	.		0.458	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	Missense_Mutation
VWCE	220001	broad.mit.edu;bcgsc.ca	37	11	61040788	61040788	+	Splice_Site	SNP	T	T	C	rs369402659		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:61040788T>C	ENST00000335613.5	-	13	1968	c.1582A>G	c.(1582-1584)Aat>Gat	p.N528D	VWCE_ENST00000535710.1_5'UTR	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	528	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ACCTCCCCATTCTGGAAGAGA	0.667																																					p.N528D		.											.	VWCE	91	0			c.A1582G						.	T	ASP/ASN	0,4406		0,0,2203	38.0	36.0	37.0		1582	2.3	0.9	11		37	1,8597		0,1,4298	no	missense-near-splice	VWCE	NM_152718.2	23	0,1,6501	CC,CT,TT		0.0116,0.0,0.0077	benign	528/956	61040788	1,13003	2203	4299	6502	SO:0001630	splice_region_variant	220001	exon13			CCCCATTCTGGAA	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1582-1A>G	11.37:g.61040788T>C		170.0	0.0		126.0	7.0	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	ENST00000335613.5	37	CCDS8002.1	.	.	.	.	.	.	.	.	.	.	T	10.84	1.462668	0.26248	0.0	1.16E-4	ENSG00000167992	ENST00000335613	T	0.64618	-0.11	4.67	2.26	0.28386	von Willebrand factor, type C (4);	0.653585	0.13386	N	0.391771	T	0.38665	0.1049	N	0.11724	0.165	0.80722	D	1	B	0.31413	0.322	B	0.29077	0.098	T	0.09618	-1.0666	10	0.42905	T	0.14	.	5.2409	0.15471	0.0:0.0954:0.3507:0.5539	.	528	Q96DN2	VWCE_HUMAN	D	528	ENSP00000334186:N528D	ENSP00000334186:N528D	N	-	1	0	VWCE	60797364	1.000000	0.71417	0.925000	0.36789	0.640000	0.38277	0.766000	0.26560	0.169000	0.19679	0.467000	0.42956	AAT	.		0.667	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	Missense_Mutation
XIRP2	129446	broad.mit.edu;bcgsc.ca	37	2	168105731	168105731	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:168105731C>T	ENST00000409195.1	+	9	7918	c.7829C>T	c.(7828-7830)cCc>cTc	p.P2610L	XIRP2_ENST00000295237.9_Missense_Mutation_p.P2610L|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.P2388L|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2435					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GTGGTTCAACCCAGCCCAGGC	0.458																																					p.P2610L		.											.	XIRP2	104	0			c.C7829T						.						93.0	89.0	91.0					2																	168105731		1891	4113	6004	SO:0001583	missense	129446	exon9			TTCAACCCAGCCC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.7829C>T	2.37:g.168105731C>T	ENSP00000386840:p.Pro2610Leu	169.0	1.0		87.0	4.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.465553	0.26335	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02656	4.22;4.22;4.21	6.07	3.31	0.37934	.	0.998167	0.08111	N	0.996187	T	0.03959	0.0111	L	0.46157	1.445	0.09310	N	0.999998	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.09377	0.001;0.002;0.004	T	0.44345	-0.9334	10	0.27082	T	0.32	0.6382	9.3298	0.38014	0.0:0.7166:0.0:0.2834	.	2435;2435;2388	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	L	2610;2610;2388;24	ENSP00000386840:P2610L;ENSP00000295237:P2610L;ENSP00000387255:P2388L	ENSP00000295237:P2610L	P	+	2	0	XIRP2	167813977	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.288000	0.18939	0.902000	0.36520	0.655000	0.94253	CCC	.		0.458	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZBTB18	10472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	244218434	244218434	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:244218434G>T	ENST00000358704.4	+	2	1507	c.1358G>T	c.(1357-1359)gGc>gTc	p.G453V		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	444					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACCCAGTGCGGCAAGAGCTTC	0.622																																					p.G453V		.											.	.	.	0			c.G1358T						.						56.0	58.0	58.0					1																	244218434		2203	4300	6503	SO:0001583	missense	10472	exon2			AGTGCGGCAAGAG	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1358G>T	1.37:g.244218434G>T	ENSP00000351539:p.Gly453Val	83.0	0.0		105.0	86.0	NM_205768	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	37	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201224	0.58234	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.07444	3.19	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.40645	0.1125	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	T	0.48091	-0.9065	10	0.72032	D	0.01	.	19.7964	0.96487	0.0:0.0:1.0:0.0	.	444;453	Q99592;Q99592-2	ZN238_HUMAN;.	V	453	ENSP00000351539:G453V	ENSP00000351539:G453V	G	+	2	0	ZNF238	242285057	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.702000	0.92279	0.655000	0.94253	GGC	.		0.622	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
ZNF234	10780	ucsc.edu;bcgsc.ca	37	19	44661487	44661487	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:44661487A>G	ENST00000426739.2	+	6	1576	c.1318A>G	c.(1318-1320)Agt>Ggt	p.S440G	ZNF234_ENST00000592437.1_Missense_Mutation_p.S440G	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				CTTCCGTCAGAGTTCATATCT	0.408																																					p.S440G		.											.	.	.	0			c.A1318G						.						62.0	64.0	63.0					19																	44661487		2064	4238	6302	SO:0001583	missense	10780	exon6			CGTCAGAGTTCAT	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1318A>G	19.37:g.44661487A>G	ENSP00000400878:p.Ser440Gly	73.0	0.0		41.0	4.0	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	A	11.60	1.687594	0.29962	.	.	ENSG00000167380	ENST00000426739	T	0.36520	1.25	3.94	1.74	0.24563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25195	0.0612	L	0.60455	1.87	0.09310	N	1	P	0.36483	0.555	B	0.21708	0.036	T	0.11867	-1.0570	9	0.30078	T	0.28	.	5.3616	0.16091	0.5624:0.3412:0.0963:0.0	.	440	Q14588	ZN234_HUMAN	G	440	ENSP00000400878:S440G	ENSP00000400878:S440G	S	+	1	0	ZNF226	49353327	0.000000	0.05858	0.194000	0.23346	0.996000	0.88848	0.209000	0.17435	0.175000	0.19841	0.482000	0.46254	AGT	.		0.408	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
ZNF423	23090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	49671299	49671299	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr16:49671299G>T	ENST00000561648.1	-	4	1817	c.1764C>A	c.(1762-1764)caC>caA	p.H588Q	ZNF423_ENST00000535559.1_Missense_Mutation_p.H471Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.H471Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.H528Q|ZNF423_ENST00000562520.1_Missense_Mutation_p.H528Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.H588Q|ZNF423_ENST00000562871.1_Missense_Mutation_p.H528Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	588					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GAATGTTCTTGTGGTTCTCCT	0.577																																					p.H588Q		.											.	ZNF423	228	0			c.C1764A						.						136.0	111.0	119.0					16																	49671299		2198	4300	6498	SO:0001583	missense	23090	exon4			GTTCTTGTGGTTC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1764C>A	16.37:g.49671299G>T	ENSP00000455426:p.His588Gln	517.0	0.0		447.0	160.0	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102786	0.56183	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.13420	2.59;2.7	4.99	4.99	0.66335	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.01834	-1.1264	9	.	.	.	-29.4823	18.2967	0.90148	0.0:0.0:1.0:0.0	.	588	Q2M1K9	ZN423_HUMAN	Q	588;471	ENSP00000262383:H588Q;ENSP00000442321:H471Q	.	H	-	3	2	ZNF423	48228800	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.379000	0.73154	2.320000	0.78422	0.561000	0.74099	CAC	.		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
ZNF512B	57473	ucsc.edu;bcgsc.ca	37	20	62592677	62592677	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:62592677C>A	ENST00000450537.1	-	16	2472	c.2412G>T	c.(2410-2412)ctG>ctT	p.L804L	ZNF512B_ENST00000217130.3_Silent_p.L804L|ZNF512B_ENST00000369888.1_Silent_p.L804L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	804					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CGTGGGTCTTCAGGATGTGGT	0.637																																					p.L804L		.											.	ZNF512B	90	0			c.G2412T						.						89.0	77.0	81.0					20																	62592677		2203	4300	6503	SO:0001819	synonymous_variant	57473	exon16			GGTCTTCAGGATG	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2412G>T	20.37:g.62592677C>A		46.0	0.0		33.0	4.0	NM_020713	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																			.		0.637	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
ZNF521	25925	ucsc.edu;bcgsc.ca	37	18	22775197	22775197	+	Silent	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr18:22775197A>G	ENST00000361524.3	-	5	3733	c.3585T>C	c.(3583-3585)taT>taC	p.Y1195Y	ZNF521_ENST00000584787.1_Silent_p.Y975Y|ZNF521_ENST00000538137.2_Silent_p.Y1195Y	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1195					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGATGCATTGATAGGTCTTCT	0.333			T	PAX5	ALL																																p.Y1195Y		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	275	0			c.T3585C						.						132.0	117.0	122.0					18																	22775197		2203	4299	6502	SO:0001819	synonymous_variant	25925	exon5			GCATTGATAGGTC	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3585T>C	18.37:g.22775197A>G		121.0	0.0		33.0	4.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	ENST00000361524.3	37	CCDS32806.1																																																																																			.		0.333	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
OR5D14	219436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55563794	55563795	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:55563794_55563795GG>TT	ENST00000335605.1	+	1	763_764	c.763_764GG>TT	c.(763-765)GGg>TTg	p.G255L		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CATCTTCCATGGGACCATCCTT	0.465																																					p.G255L		.											.	.	.	0			.						.																																			SO:0001583	missense	219436	.			TTCCATGGGACCA	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	Exception_encountered	11.37:g.55563794_55563795delinsTT	ENSP00000334456:p.Gly255Leu	289.0	0.0		123.0	53.0	.	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	DNP	ENST00000335605.1	37	CCDS31508.1																																																																																			.		0.465	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
