#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AADAC	13	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151545468	151545468	+	Silent	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr3:151545468A>G	ENST00000232892.7	+	5	834	c.708A>G	c.(706-708)tcA>tcG	p.S236S	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	236					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AAGAAAATTCAAATTTTCTAT	0.363																																					p.S236S	Ovarian(30;839 841 2699 32801 46334)	.											.	AADAC	280	0			c.A708G						.						66.0	68.0	67.0					3																	151545468		2203	4299	6502	SO:0001819	synonymous_variant	13	exon5			AAATTCAAATTTT	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.708A>G	3.37:g.151545468A>G		111.0	0.0		122.0	21.0	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Silent	SNP	ENST00000232892.7	37	CCDS33877.1																																																																																			.		0.363	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
AATK	9625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79100253	79100253	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr17:79100253G>T	ENST00000326724.4	-	7	753	c.729C>A	c.(727-729)caC>caA	p.H243Q	AATK_ENST00000417379.1_Missense_Mutation_p.H140Q|MIR657_ENST00000385003.1_RNA|AATK_ENST00000572339.1_5'UTR|MIR338_ENST00000390137.2_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	243	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TGCGATGAAGGTGCAGGACGC	0.701																																					p.H243Q		.											.	AATK	933	0			c.C729A						.						8.0	10.0	9.0					17																	79100253		1996	4136	6132	SO:0001583	missense	9625	exon7			ATGAAGGTGCAGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.729C>A	17.37:g.79100253G>T	ENSP00000324196:p.His243Gln	68.0	0.0		90.0	14.0	NM_001080395	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.33|10.33	1.321035|1.321035	0.23994|0.23994	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000326724;ENST00000374792|ENST00000417379	D;D|.	0.82893|.	-1.66;-1.66|.	4.07|4.07	-0.25|-0.25	0.13007|0.13007	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.060881|.	0.64402|.	D|.	0.000006|.	T|T	0.60143|0.60143	0.2246|0.2246	M|M	0.74389|0.74389	2.26|2.26	0.41250|0.41250	D|D	0.986704|0.986704	P|.	0.45240|.	0.854|.	P|.	0.51866|.	0.682|.	T|T	0.55276|0.55276	-0.8166|-0.8166	10|5	0.72032|.	D|.	0.01|.	.|.	4.6142|4.6142	0.12417|0.12417	0.4434:0.0:0.4113:0.1453|0.4434:0.0:0.4113:0.1453	.|.	243|.	Q6ZMQ8|.	LMTK1_HUMAN|.	Q|N	243|196	ENSP00000324196:H243Q;ENSP00000363924:H243Q|.	ENSP00000324196:H243Q|.	H|T	-|-	3|2	2|0	AATK|AATK	76714848|76714848	1.000000|1.000000	0.71417|0.71417	0.806000|0.806000	0.32338|0.32338	0.035000|0.035000	0.12851|0.12851	1.533000|1.533000	0.36040|0.36040	-0.180000|-0.180000	0.10637|0.10637	-0.363000|-0.363000	0.07495|0.07495	CAC|ACC	.		0.701	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ACVR2B	93	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38519668	38519668	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr3:38519668T>C	ENST00000352511.4	+	4	879	c.407T>C	c.(406-408)cTc>cCc	p.L136P		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	136					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		CCCACCCTGCTCACGGTGCTG	0.632																																					p.L136P		.											.	ACVR2B	942	0			c.T407C						.						49.0	49.0	49.0					3																	38519668		2203	4300	6503	SO:0001583	missense	93	exon4			CCCTGCTCACGGT	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.407T>C	3.37:g.38519668T>C	ENSP00000340361:p.Leu136Pro	28.0	0.0		42.0	8.0	NM_001106	Q4VAV0	Missense_Mutation	SNP	ENST00000352511.4	37	CCDS2679.1	.	.	.	.	.	.	.	.	.	.	T	19.87	3.906625	0.72868	.	.	ENSG00000114739	ENST00000352511	D	0.84873	-1.91	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.83667	0.5304	M	0.76574	2.34	0.80722	D	1	B	0.28552	0.215	B	0.22601	0.04	T	0.81953	-0.0697	10	0.36615	T	0.2	.	14.2824	0.66221	0.0:0.0:0.0:1.0	.	136	Q13705	AVR2B_HUMAN	P	136	ENSP00000340361:L136P	ENSP00000340361:L136P	L	+	2	0	ACVR2B	38494672	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.096000	0.71446	1.788000	0.52465	0.379000	0.24179	CTC	.		0.632	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
ADCY10	55811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167849404	167849404	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:167849404C>T	ENST00000367851.4	-	11	1349	c.1165G>A	c.(1165-1167)Ggg>Agg	p.G389R	ADCY10_ENST00000367848.1_Missense_Mutation_p.G297R|ADCY10_ENST00000545172.1_Missense_Mutation_p.G236R	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	389	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAGACAATCCCACTGGCAACA	0.498																																					p.G389R		.											.	ADCY10	493	0			c.G1165A						.						72.0	63.0	66.0					1																	167849404		2203	4299	6502	SO:0001583	missense	55811	exon11			CAATCCCACTGGC	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1165G>A	1.37:g.167849404C>T	ENSP00000356825:p.Gly389Arg	103.0	0.0		144.0	18.0	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	37	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559390	0.45590	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	D;D;D	0.97831	-4.56;-4.56;-4.56	5.25	4.34	0.51931	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000010	D	0.98792	0.9593	H	0.95780	3.72	0.32132	N	0.5866290000000001	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99917	1.1230	9	0.87932	D	0	-19.6578	9.8299	0.40934	0.0:0.9049:0.0:0.0951	.	236;297;389	F5GWS5;Q96PN6-2;Q96PN6	.;.;ADCYA_HUMAN	R	236;389;297	ENSP00000441992:G236R;ENSP00000356825:G389R;ENSP00000356822:G297R	ENSP00000356822:G297R	G	-	1	0	ADCY10	166116028	0.993000	0.37304	0.939000	0.37840	0.054000	0.15201	4.672000	0.61597	1.214000	0.43395	0.655000	0.94253	GGG	.		0.498	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
ADSL	158	hgsc.bcm.edu;mdanderson.org	37	22	40742563	40742563	+	Start_Codon_SNP	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr22:40742563A>G	ENST00000216194.7	+	1	57	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	ADSL_ENST00000454266.2_Start_Codon_SNP_p.M1V|ADSL_ENST00000342312.6_Start_Codon_SNP_p.M1V	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	1					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						CAGGGTTGGGATGGCGGCTGG	0.662																																					p.M1V	Colon(4;65 130 1097 1516)	.											.	ADSL	652	0			c.A1G	GRCh37	CM021059	ADSL	M		.						18.0	16.0	17.0					22																	40742563		2197	4291	6488	SO:0001582	initiator_codon_variant	158	exon1			GTTGGGATGGCGG	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.1A>G	22.37:g.40742563A>G	ENSP00000216194:p.Met1Val	9.0	0.0		27.0	7.0	NM_001123378	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046668	0.55110	.	.	ENSG00000239900	ENST00000216194;ENST00000544206;ENST00000425605;ENST00000454266;ENST00000342312	D;D;D	0.95588	-3.75;-3.75;-3.4	4.8	3.77	0.43336	.	0.295715	0.32175	N	0.006465	D	0.94515	0.8234	.	.	.	0.80722	D	1	P;B;B;B	0.36392	0.551;0.021;0.028;0.007	P;B;B;B	0.44394	0.448;0.011;0.017;0.005	D	0.93236	0.6622	9	0.87932	D	0	-11.8893	8.0531	0.30589	0.9068:0.0:0.0931:0.0	.	1;1;1;1	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	V	1	ENSP00000216194:M1V;ENSP00000390107:M1V;ENSP00000341429:M1V	ENSP00000216194:M1V	M	+	1	0	ADSL	39072509	0.004000	0.15560	0.732000	0.30844	0.012000	0.07955	0.000000	0.12993	0.986000	0.38683	0.524000	0.50904	ATG	.		0.662	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	Missense_Mutation
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27101142	27101142	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:27101142A>C	ENST00000324856.7	+	18	4795	c.4424A>C	c.(4423-4425)aAc>aCc	p.N1475T	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000374152.2_Missense_Mutation_p.N1092T	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1475					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCCAGCAAAACATGCCACCA	0.572			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.N1475T		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	0			c.A4424C						.						63.0	66.0	65.0					1																	27101142		2203	4300	6503	SO:0001583	missense	8289	exon18			AGCAAAACATGCC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4424A>C	1.37:g.27101142A>C	ENSP00000320485:p.Asn1475Thr	38.0	0.0		57.0	11.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.640|8.640	0.895675|0.895675	0.17686|0.17686	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000374152	.|T;T	.|0.02369	.|4.49;4.32	5.54|5.54	3.18|3.18	0.36537|0.36537	.|.	.|0.405053	.|0.30528	.|N	.|0.009435	T|T	0.01800|0.01800	0.0057|0.0057	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.25904	.|0.137;0.0;0.001	.|B;B;B	.|0.28011	.|0.085;0.001;0.002	T|T	0.58216|0.58216	-0.7675|-0.7675	5|10	.|0.39692	.|T	.|0.17	-6.5561|-6.5561	7.475|7.475	0.27371|0.27371	0.6555:0.2689:0.0756:0.0|0.6555:0.2689:0.0756:0.0	.|.	.|1092;1475;1128	.|O14497-3;O14497;Q4LE49	.|.;ARI1A_HUMAN;.	N|T	371|1475;1092	.|ENSP00000320485:N1475T;ENSP00000363267:N1092T	.|ENSP00000320485:N1475T	K|N	+|+	3|2	2|0	ARID1A|ARID1A	26973729|26973729	0.935000|0.935000	0.31712|0.31712	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.698000|1.698000	0.37794|0.37794	1.104000|1.104000	0.41587|0.41587	0.528000|0.528000	0.53228|0.53228	AAA|AAC	.		0.572	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ATP1A1	476	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	116948480	116948480	+	IGR	SNP	A	A	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:116948480A>C	ENST00000295598.5	+	0	3654				ATP1A1OS_ENST00000369491.1_RNA|ATP1A1OS_ENST00000369492.4_RNA	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide						ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TGATCTCTACATTTGTCTGCA	0.488																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	84852	.			CTCTACATTTGTC	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109		1.37:g.116948480A>C		55.0	0.0		69.0	9.0	.	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	RNA	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	A	6.549	0.469637	0.12461	.	.	ENSG00000203865	ENST00000369491;ENST00000369492	.	.	.	3.51	-5.94	0.02247	.	.	.	.	.	T	0.31949	0.0813	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.52335	-0.8589	5	0.87932	D	0	.	13.8156	0.63290	0.1874:0.0:0.8126:0.0	.	.	.	.	K	11	.	ENSP00000358503:N11K	N	-	3	2	ATP1A1OS	116750003	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.371000	0.07513	-1.437000	0.01967	-0.924000	0.02725	AAT	.		0.488	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
ASTN1	460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	176999968	176999968	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:176999968C>T	ENST00000367654.3	-	4	1197	c.986G>A	c.(985-987)aGa>aAa	p.R329K	ASTN1_ENST00000281881.3_5'UTR|MIR488_ENST00000365739.2_RNA|ASTN1_ENST00000424564.2_Missense_Mutation_p.R329K|ASTN1_ENST00000367657.3_Missense_Mutation_p.R329K|ASTN1_ENST00000361833.2_Missense_Mutation_p.R329K	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	329					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GATCCGCTTTCTCTGGCTGCT	0.468																																					p.R329K		.											.	ASTN1	319	0			c.G986A						.						162.0	154.0	157.0					1																	176999968		2203	4300	6503	SO:0001583	missense	460	exon4			CGCTTTCTCTGGC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.986G>A	1.37:g.176999968C>T	ENSP00000356626:p.Arg329Lys	79.0	0.0		84.0	15.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	18.15	3.560504	0.65538	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.16457	2.34;2.75;2.75;2.34	5.76	5.76	0.90799	.	0.107611	0.64402	D	0.000016	T	0.10637	0.0260	N	0.19112	0.55	0.44603	D	0.997574	P;B;B	0.36837	0.571;0.218;0.218	B;B;B	0.33620	0.167;0.12;0.12	T	0.26430	-1.0103	10	0.17832	T	0.49	-24.8203	12.8744	0.57982	0.0:0.9253:0.0:0.0747	.	329;329;329	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	K	329	ENSP00000356629:R329K;ENSP00000354536:R329K;ENSP00000356626:R329K;ENSP00000395041:R329K	ENSP00000354536:R329K	R	-	2	0	ASTN1	175266591	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.651000	0.67951	2.706000	0.92434	0.655000	0.94253	AGA	.		0.468	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
BMPER	168667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34014331	34014331	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr7:34014331G>A	ENST00000297161.2	+	7	885	c.511G>A	c.(511-513)Gtg>Atg	p.V171M	BMPER_ENST00000426693.1_Missense_Mutation_p.V171M	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	171	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GTTTGAGGGTGTGCAGTATCA	0.478																																					p.V171M		.											.	BMPER	92	0			c.G511A						.						292.0	257.0	269.0					7																	34014331		2203	4300	6503	SO:0001583	missense	168667	exon7			GAGGGTGTGCAGT		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.511G>A	7.37:g.34014331G>A	ENSP00000297161:p.Val171Met	127.0	0.0		129.0	14.0	NM_133468	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673789	0.29693	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.72835	-0.69;-0.69	5.33	3.52	0.40303	von Willebrand factor, type C (3);	0.416166	0.23928	N	0.043176	T	0.52354	0.1729	L	0.28504	0.86	0.25377	N	0.988647	B	0.12013	0.005	B	0.13407	0.009	T	0.43814	-0.9368	10	0.48119	T	0.1	.	2.7243	0.05209	0.1587:0.1467:0.5429:0.1517	.	171	Q8N8U9	BMPER_HUMAN	M	171	ENSP00000297161:V171M;ENSP00000393950:V171M	ENSP00000297161:V171M	V	+	1	0	BMPER	33980856	0.997000	0.39634	1.000000	0.80357	0.632000	0.37999	1.595000	0.36708	0.725000	0.32318	0.655000	0.94253	GTG	.		0.478	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
CDS1	1040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	85540553	85540553	+	Silent	SNP	T	T	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr4:85540553T>C	ENST00000295887.5	+	5	870	c.447T>C	c.(445-447)ttT>ttC	p.F149F		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		ATAGGTACTTTCTATTGTGTG	0.318																																					p.F149F		.											.	CDS1	155	0			c.T447C						.						71.0	75.0	74.0					4																	85540553		2201	4294	6495	SO:0001819	synonymous_variant	1040	exon5			GTACTTTCTATTG	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.447T>C	4.37:g.85540553T>C		93.0	0.0		106.0	13.0	NM_001263	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Silent	SNP	ENST00000295887.5	37	CCDS3608.1																																																																																			.		0.318	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2		
CHD4	1108	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6690892	6690892	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr12:6690892G>A	ENST00000357008.2	-	31	4767	c.4604C>T	c.(4603-4605)tCa>tTa	p.S1535L	SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000309577.6_Missense_Mutation_p.S1563L|CHD4_ENST00000540960.1_5'Flank|CHD4_ENST00000544040.1_Missense_Mutation_p.S1528L|CHD4_ENST00000544484.1_Missense_Mutation_p.S1560L|RP5-940J5.6_ENST00000501075.2_RNA	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1535					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TGGGGAGGGTGACCCTGGCTG	0.552																																					p.S1535L	Colon(32;586 792 4568 16848 45314)	.											.	CHD4	228	0			c.C4604T						.						202.0	191.0	195.0					12																	6690892		2203	4300	6503	SO:0001583	missense	1108	exon31			GAGGGTGACCCTG	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.4604C>T	12.37:g.6690892G>A	ENSP00000349508:p.Ser1535Leu	71.0	1.0		116.0	23.0	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103123	0.56183	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.91351	-2.83;-2.78;-2.82;-2.76	5.76	5.76	0.90799	.	0.349226	0.26453	N	0.024290	D	0.90452	0.7010	M	0.68952	2.095	0.50467	D	0.999872	B;B;B	0.34399	0.452;0.179;0.002	B;B;B	0.33454	0.164;0.057;0.004	D	0.89795	0.3971	10	0.62326	D	0.03	-4.333	19.9813	0.97326	0.0:0.0:1.0:0.0	.	1563;1535;1528	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	L	1560;1528;1563;1535;1509	ENSP00000440392:S1560L;ENSP00000440542:S1528L;ENSP00000312419:S1563L;ENSP00000349508:S1535L	ENSP00000312419:S1563L	S	-	2	0	CHD4	6561153	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.481000	0.66826	2.726000	0.93360	0.655000	0.94253	TCA	.		0.552	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
CLCN5	1184	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	49853423	49853444	+	Frame_Shift_Del	DEL	AATGGAACAGCTGGCTTATTAC	AATGGAACAGCTGGCTTATTAC	-	rs148124447		TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	AATGGAACAGCTGGCTTATTAC	AATGGAACAGCTGGCTTATTAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chrX:49853423_49853444delAATGGAACAGCTGGCTTATTAC	ENST00000307367.2	+	9	1707_1728	c.1416_1437delAATGGAACAGCTGGCTTATTAC	c.(1414-1437)ggaatggaacagctggcttattacfs	p.GMEQLAYY472fs	CLCN5_ENST00000376108.3_Frame_Shift_Del_p.GMEQLAYY472fs|CLCN5_ENST00000376091.3_Frame_Shift_Del_p.GMEQLAYY542fs|CLCN5_ENST00000376088.3_Frame_Shift_Del_p.GMEQLAYY542fs			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	472					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					TAGGAGTAGGAATGGAACAGCTGGCTTATTACCACCAGGAAT	0.509																																					p.542_549del		.											.	CLCN5	132	0			c.1626_1647del						.																																			SO:0001589	frameshift_variant	1184	exon12			AGTAGGAATGGAA	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1416_1437delAATGGAACAGCTGGCTTATTAC	X.37:g.49853423_49853444delAATGGAACAGCTGGCTTATTAC	ENSP00000304257:p.Gly472fs	123.0	0.0		93.0	10.0	NM_001127898	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Frame_Shift_Del	DEL	ENST00000307367.2	37	CCDS14328.1																																																																																			.		0.509	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	114031312	114031312	+	Silent	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr8:114031312A>G	ENST00000297405.5	-	6	1258	c.1014T>C	c.(1012-1014)ttT>ttC	p.F338F	CSMD3_ENST00000343508.3_Silent_p.F298F|CSMD3_ENST00000352409.3_Silent_p.F338F|CSMD3_ENST00000455883.2_Silent_p.F338F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	338	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F338fs*11(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGGGAGCACTAAATCCACGGT	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.F338F		.											.	CSMD3	1132	1	Deletion - Frameshift(1)	liver(1)	c.T1014C						.						204.0	181.0	189.0					8																	114031312		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon6			AGCACTAAATCCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.1014T>C	8.37:g.114031312A>G		63.0	0.0		97.0	6.0	NM_052900	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTTNBP2	83992	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	117398014	117398014	+	Silent	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr7:117398014C>T	ENST00000160373.3	-	11	3274	c.3183G>A	c.(3181-3183)ccG>ccA	p.P1061P		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1061					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCACTGACCACGGCACATTTC	0.448																																					p.P1061P		.											.	CTTNBP2	94	0			c.G3183A						.						62.0	51.0	54.0					7																	117398014		2203	4300	6503	SO:0001819	synonymous_variant	83992	exon11			TGACCACGGCACA		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3183G>A	7.37:g.117398014C>T		39.0	0.0		44.0	5.0	NM_033427	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.967|1.967	-0.437427|-0.437427	0.04636|0.04636	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000435233;ENST00000416239|ENST00000446636	.|.	.|.	.|.	5.73|5.73	-11.5|-11.5	0.00074|0.00074	.|.	.|.	.|.	.|.	.|.	T|T	0.47838|0.47838	0.1467|0.1467	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.63033|0.63033	-0.6727|-0.6727	4|4	.|.	.|.	.|.	-4.8781|-4.8781	10.2075|10.2075	0.43122|0.43122	0.1456:0.5724:0.0739:0.2081|0.1456:0.5724:0.0739:0.2081	.|.	.|.	.|.	.|.	H|M	75;57|549	.|.	.|.	R|V	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117185250|117185250	0.000000|0.000000	0.05858|0.05858	0.030000|0.030000	0.17652|0.17652	0.309000|0.309000	0.27889|0.27889	-5.485000|-5.485000	0.00118|0.00118	-3.051000|-3.051000	0.00260|0.00260	-0.238000|-0.238000	0.12139|0.12139	CGT|GTG	.		0.448	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
DEPDC1	55635	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	68954709	68954709	+	Silent	SNP	G	G	A	rs561724598		TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:68954709G>A	ENST00000456315.2	-	4	594	c.480C>T	c.(478-480)ggC>ggT	p.G160G	DEPDC1_ENST00000370966.5_Silent_p.G160G	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	160					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		TTATTTTCTCGCCATTTTCCT	0.284													G|||	1	0.000199681	0.0	0.0	5008	,	,		16046	0.0		0.001	False		,,,				2504	0.0				p.G160G		.											.	DEPDC1	90	0			c.C480T						.						84.0	77.0	79.0					1																	68954709		2200	4291	6491	SO:0001819	synonymous_variant	55635	exon4			TTTCTCGCCATTT	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.480C>T	1.37:g.68954709G>A		218.0	2.0		277.0	39.0	NM_017779	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Silent	SNP	ENST00000456315.2	37	CCDS44159.1																																																																																			.		0.284	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779	
DIEXF	27042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	210015748	210015748	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:210015748A>G	ENST00000491415.2	+	9	1681	c.1624A>G	c.(1624-1626)Atc>Gtc	p.I542V		NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)	542					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						GGATGCCCAGATCAACTCAGT	0.478																																					p.I542V		.											.	DIEXF	91	0			c.A1624G						.						138.0	138.0	138.0					1																	210015748		2203	4300	6503	SO:0001583	missense	27042	exon9			GCCCAGATCAACT	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.1624A>G	1.37:g.210015748A>G	ENSP00000419005:p.Ile542Val	53.0	0.0		115.0	15.0	NM_014388	O75992|Q4VY00|Q63HL9	Missense_Mutation	SNP	ENST00000491415.2	37	CCDS1493.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.583532	0.46006	.	.	ENSG00000117597	ENST00000491415	T	0.50001	0.76	6.17	2.68	0.31781	.	0.084250	0.85682	N	0.000000	T	0.48187	0.1486	M	0.80422	2.495	0.49798	D	0.999822	B	0.25105	0.118	B	0.27796	0.083	T	0.43750	-0.9372	10	0.39692	T	0.17	-23.2262	9.5562	0.39339	0.804:0.0:0.196:0.0	.	542	Q68CQ4	DIEXF_HUMAN	V	542	ENSP00000419005:I542V	ENSP00000419005:I542V	I	+	1	0	DIEXF	208082371	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.491000	0.53252	0.566000	0.29273	-0.290000	0.09829	ATC	.		0.478	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089127.2	NM_014388	
EPS15L1	58513	broad.mit.edu;mdanderson.org	37	19	16545246	16545246	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr19:16545246C>A	ENST00000248070.6	-	7	567	c.428G>T	c.(427-429)gGt>gTt	p.G143V	EPS15L1_ENST00000597937.1_Missense_Mutation_p.G143V|EPS15L1_ENST00000455140.2_Missense_Mutation_p.G143V|EPS15L1_ENST00000602009.1_5'UTR|EPS15L1_ENST00000535753.2_Missense_Mutation_p.G143V|EPS15L1_ENST00000594975.1_Missense_Mutation_p.G143V	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	143	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						AGAGAGCAAACCATTGATGGG	0.493																																					p.G143V		.											.	EPS15L1	95	0			c.G428T						.						157.0	155.0	155.0					19																	16545246		2203	4300	6503	SO:0001583	missense	58513	exon7			AGCAAACCATTGA	AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.428G>T	19.37:g.16545246C>A	ENSP00000248070:p.Gly143Val	56.0	1.0		73.0	9.0	NM_021235	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	ENST00000248070.6	37	CCDS32944.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511254	0.85389	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.56103	0.48;0.48;0.48	4.87	4.87	0.63330	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.82038	0.4950	H	0.96889	3.9	0.80722	D	1	D;P;D;P;P	0.89917	1.0;0.873;0.976;0.931;0.915	D;P;P;P;P	0.97110	1.0;0.803;0.71;0.831;0.74	D	0.88744	0.3245	10	0.87932	D	0	.	17.0247	0.86442	0.0:1.0:0.0:0.0	.	143;143;143;143;143	A8K5P4;A5PL29;A2RRF3;Q9UBC2;G3V0H2	.;.;.;EP15R_HUMAN;.	V	143	ENSP00000393313:G143V;ENSP00000248070:G143V;ENSP00000440103:G143V	ENSP00000248070:G143V	G	-	2	0	EPS15L1	16406246	1.000000	0.71417	0.165000	0.22776	0.965000	0.64279	5.918000	0.69996	2.272000	0.75746	0.467000	0.42956	GGT	.		0.493	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461040.1	NM_021235	
DPF1	8193	broad.mit.edu;mdanderson.org	37	19	38713010	38713010	+	Silent	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr19:38713010G>A	ENST00000420980.2	-	3	392	c.366C>T	c.(364-366)tgC>tgT	p.C122C	DPF1_ENST00000414789.1_Silent_p.C40C|DPF1_ENST00000456296.1_Silent_p.C96C|DPF1_ENST00000355526.4_Silent_p.C122C|DPF1_ENST00000416611.1_Silent_p.C96C|DPF1_ENST00000412732.1_Silent_p.C40C	NM_004647.2	NP_004638.2	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1	122					apoptotic process (GO:0006915)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TCTTGTACTCGCAGGGCCTGA	0.617																																					p.C122C		.											.	DPF1	90	0			c.C366T						.						124.0	123.0	123.0					19																	38713010		2203	4300	6503	SO:0001819	synonymous_variant	8193	exon3			GTACTCGCAGGGC	U43843	CCDS33008.2, CCDS46064.1, CCDS46065.1	19q13.12	2013-01-28			ENSG00000011332	ENSG00000011332		"""Zinc fingers, PHD-type"""	20225	protein-coding gene	gene with protein product		601670				8812431	Standard	XM_005259288		Approved	neuro-d4, NEUD4, BAF45b	uc002ohm.3	Q92782	OTTHUMG00000157164	ENST00000420980.2:c.366C>T	19.37:g.38713010G>A		45.0	1.0		77.0	13.0	NM_001135155	B3KSY8|Q08AJ0	Silent	SNP	ENST00000420980.2	37	CCDS33008.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949902	0.92660	.	.	ENSG00000011332	ENST00000355526	.	.	.	3.44	2.36	0.29203	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.5046	3.6245	0.08108	0.2182:0.2255:0.5562:0.0	.	.	.	.	X	115	.	.	R	-	1	2	DPF1	43404850	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.266000	0.43320	0.757000	0.33036	0.455000	0.32223	CGA	.		0.617	DPF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347721.1		
EYA4	2070	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	133846297	133846297	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr6:133846297G>A	ENST00000367895.5	+	19	2208	c.1744G>A	c.(1744-1746)Gaa>Aaa	p.E582K	EYA4_ENST00000452339.2_Intron|EYA4_ENST00000431403.2_Intron|EYA4_ENST00000355167.3_Intron|EYA4_ENST00000355286.6_Missense_Mutation_p.E559K|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000430974.2_Intron|EYA4_ENST00000531901.1_Missense_Mutation_p.E588K|EYA4_ENST00000525849.1_Intron	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	582					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TCCAGGAAAAGAAAGTTGCTT	0.398																																					p.E582K	Melanoma(57;398 1237 3528 4702 7415)	.											.	EYA4	578	0			c.G1744A						.						135.0	130.0	131.0					6																	133846297		2203	4300	6503	SO:0001583	missense	2070	exon19			GGAAAAGAAAGTT	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1744G>A	6.37:g.133846297G>A	ENSP00000356870:p.Glu582Lys	175.0	1.0		254.0	45.0	NM_004100	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	G	34	5.300612	0.95601	.	.	ENSG00000112319	ENST00000367895;ENST00000355286;ENST00000531901	D;D;D	0.93307	-3.2;-3.2;-3.2	5.57	5.57	0.84162	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.000000	0.85682	D	0.000000	D	0.96981	0.9014	M	0.85373	2.75	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.999;0.984;0.999	D	0.97099	0.9796	10	0.72032	D	0.01	-21.6238	19.6104	0.95604	0.0:0.0:1.0:0.0	.	588;559;582	F2Z2Y1;O95677-2;O95677	.;.;EYA4_HUMAN	K	582;559;588	ENSP00000356870:E582K;ENSP00000347434:E559K;ENSP00000432770:E588K	ENSP00000347434:E559K	E	+	1	0	EYA4	133887990	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.865000	0.99609	2.634000	0.89283	0.650000	0.86243	GAA	.		0.398	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
FBXO15	201456	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	71749184	71749184	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr18:71749184T>A	ENST00000419743.2	-	9	1320	c.1241A>T	c.(1240-1242)gAt>gTt	p.D414V	FBXO15_ENST00000269500.5_Missense_Mutation_p.D338V|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	414						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		ATCAAAAATATCAGTTTTCCA	0.279																																					p.D414V		.											.	FBXO15	229	0			c.A1241T						.						80.0	76.0	77.0					18																	71749184		2202	4299	6501	SO:0001583	missense	201456	exon9			AAAATATCAGTTT	AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1241A>T	18.37:g.71749184T>A	ENSP00000393154:p.Asp414Val	194.0	1.0		236.0	31.0	NM_001142958	B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	T	6.335	0.429964	0.11987	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.50001	0.76;0.76	4.78	4.78	0.61160	.	0.854134	0.10588	N	0.657081	T	0.45836	0.1362	L	0.53249	1.67	0.19300	N	0.999978	P;P	0.38582	0.483;0.638	B;B	0.36719	0.113;0.231	T	0.44528	-0.9322	10	0.87932	D	0	-16.2624	11.8801	0.52571	0.0:0.0:0.1454:0.8546	.	414;338	B3KST3;Q8NCQ5	.;FBX15_HUMAN	V	338;414	ENSP00000269500:D338V;ENSP00000393154:D414V	ENSP00000269500:D338V	D	-	2	0	FBXO15	69900164	0.023000	0.18921	0.010000	0.14722	0.105000	0.19272	2.099000	0.41767	1.907000	0.55213	0.533000	0.62120	GAT	.		0.279	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676	
GEMIN5	25929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	154311018	154311018	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr5:154311018C>T	ENST00000285873.7	-	5	856	c.781G>A	c.(781-783)Ggg>Agg	p.G261R		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	261					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCAATCTTACCTCGGCCTCTA	0.433																																					p.G261R		.											.	GEMIN5	228	0			c.G781A						.						162.0	142.0	149.0					5																	154311018		2203	4300	6503	SO:0001630	splice_region_variant	25929	exon5			TCTTACCTCGGCC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.781+1G>A	5.37:g.154311018C>T		53.0	0.0		91.0	27.0	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103299	0.76983	.	.	ENSG00000082516	ENST00000285873	T	0.48201	0.82	5.28	5.28	0.74379	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.190178	0.45126	D	0.000383	T	0.51193	0.1660	L	0.44542	1.39	0.53005	D	0.999965	D;D	0.60575	0.988;0.988	P;P	0.54026	0.74;0.74	T	0.45687	-0.9244	9	.	.	.	-9.4696	12.7256	0.57168	0.0:0.9148:0.0:0.0852	.	260;261	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	R	261	ENSP00000285873:G261R	.	G	-	1	0	GEMIN5	154291211	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.939000	0.56591	2.469000	0.83416	0.655000	0.94253	GGG	.		0.433	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		Missense_Mutation
IL23A	51561	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56733526	56733526	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr12:56733526G>C	ENST00000228534.4	+	3	479	c.313G>C	c.(313-315)Gga>Cga	p.G105R	STAT2_ENST00000556539.1_5'Flank	NM_016584.2	NP_057668.1	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19	105					defense response to Gram-negative bacterium (GO:0050829)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|T cell proliferation (GO:0042098)|tissue remodeling (GO:0048771)	interleukin-23 complex (GO:0070743)				kidney(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	5						GAAGCTGCTAGGATCGGATAT	0.512																																					p.G105R		.											.	IL23A	90	0			c.G313C						.						100.0	100.0	100.0					12																	56733526		2203	4300	6503	SO:0001583	missense	51561	exon3			CTGCTAGGATCGG	AB030000	CCDS8916.1	12q13.13	2011-07-15				ENSG00000110944		"""Interleukins and interleukin receptors"""	15488	protein-coding gene	gene with protein product	"""interleukin-six, G-CSF related factor"""	605580				11114383	Standard	NM_016584		Approved	SGRF, IL23P19, IL-23, IL-23A, P19	uc001sla.3	Q9NPF7		ENST00000228534.4:c.313G>C	12.37:g.56733526G>C	ENSP00000228534:p.Gly105Arg	57.0	1.0		56.0	18.0	NM_016584	Q6NZ80|Q6NZ82|Q9H2A5	Missense_Mutation	SNP	ENST00000228534.4	37	CCDS8916.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092249	0.55968	.	.	ENSG00000110944	ENST00000228534	T	0.32023	1.47	5.14	5.14	0.70334	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.196339	0.35936	N	0.002899	T	0.42040	0.1185	L	0.29908	0.895	0.33757	D	0.621387	D	0.67145	0.996	D	0.66602	0.945	T	0.53121	-0.8483	10	0.72032	D	0.01	-8.2099	14.8223	0.70082	0.0:0.0:1.0:0.0	.	105	Q9NPF7	IL23A_HUMAN	R	105	ENSP00000228534:G105R	ENSP00000228534:G105R	G	+	1	0	IL23A	55019793	1.000000	0.71417	0.998000	0.56505	0.550000	0.35303	2.989000	0.49393	2.779000	0.95612	0.563000	0.77884	GGA	.		0.512	IL23A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_016584	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	15452356	15452356	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr6:15452356C>G	ENST00000341776.2	+	4	687	c.443C>G	c.(442-444)tCt>tGt	p.S148C	JARID2_ENST00000541660.1_Missense_Mutation_p.S110C|JARID2_ENST00000397311.3_5'UTR	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	148					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				TCAGACCTCTCTAAAAGGAAG	0.473																																					p.S148C		.											.	JARID2	228	0			c.C443G						.						99.0	94.0	96.0					6																	15452356		2203	4300	6503	SO:0001583	missense	3720	exon4			ACCTCTCTAAAAG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.443C>G	6.37:g.15452356C>G	ENSP00000341280:p.Ser148Cys	55.0	0.0		71.0	21.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.773059	0.90108	.	.	ENSG00000008083	ENST00000341776;ENST00000541660	T;T	0.38240	1.15;1.15	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.47021	0.1423	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	T	0.41963	-0.9479	10	0.52906	T	0.07	-7.0486	19.1821	0.93628	0.0:1.0:0.0:0.0	.	110;148	F5H590;Q92833	.;JARD2_HUMAN	C	148;110	ENSP00000341280:S148C;ENSP00000444623:S110C	ENSP00000341280:S148C	S	+	2	0	JARID2	15560335	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.294000	0.78760	2.513000	0.84729	0.655000	0.94253	TCT	.		0.473	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
KCTD21	283219	broad.mit.edu;mdanderson.org	37	11	77885144	77885144	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr11:77885144A>C	ENST00000340067.3	-	2	735	c.457T>G	c.(457-459)Tgc>Ggc	p.C153G	KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000530261.1_RNA|KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000528468.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	153					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			AGGAAGAGGCAGGAGGTGCTG	0.562																																					p.C153G		.											.	KCTD21	69	0			c.T457G						.						137.0	121.0	127.0					11																	77885144		2200	4292	6492	SO:0001583	missense	283219	exon2			AGAGGCAGGAGGT	AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.457T>G	11.37:g.77885144A>C	ENSP00000339340:p.Cys153Gly	44.0	2.0		37.0	8.0	NM_001029859	B4DTR0	Missense_Mutation	SNP	ENST00000340067.3	37	CCDS31645.1	.	.	.	.	.	.	.	.	.	.	A	4.505	0.093758	0.08632	.	.	ENSG00000188997	ENST00000340067;ENST00000526208	T;T	0.52983	0.64;0.73	5.78	3.36	0.38483	.	0.095822	0.46442	D	0.000285	T	0.22589	0.0545	N	0.08118	0	0.29953	N	0.820071	B	0.02656	0.0	B	0.01281	0.0	T	0.10428	-1.0630	10	0.18276	T	0.48	.	7.657	0.28381	0.6703:0.119:0.0:0.2107	.	153	Q4G0X4	KCD21_HUMAN	G	153	ENSP00000339340:C153G;ENSP00000431789:C153G	ENSP00000339340:C153G	C	-	1	0	KCTD21	77562792	0.281000	0.24258	0.994000	0.49952	0.990000	0.78478	0.804000	0.27098	2.214000	0.71695	0.528000	0.53228	TGC	.		0.562	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390057.1	NM_001029859	
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10610300	10610300	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr19:10610300A>G	ENST00000171111.5	-	2	957	c.410T>C	c.(409-411)aTt>aCt	p.I137T	KEAP1_ENST00000393623.2_Missense_Mutation_p.I137T|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	137	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GGCGAATTCAATGAGGCGCTC	0.587																																					p.I137T		.											.	KEAP1	637	0			c.T410C						.						144.0	117.0	126.0					19																	10610300		2203	4300	6503	SO:0001583	missense	9817	exon2			AATTCAATGAGGC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.410T>C	19.37:g.10610300A>G	ENSP00000171111:p.Ile137Thr	41.0	0.0		53.0	5.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.161918	0.78226	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.69685	-0.42;-0.42	4.68	4.68	0.58851	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.060634	0.64402	D	0.000002	T	0.78648	0.4316	M	0.89534	3.04	0.50632	D	0.999886	P	0.51537	0.946	P	0.51550	0.673	D	0.83575	0.0114	10	0.87932	D	0	.	12.0934	0.53739	1.0:0.0:0.0:0.0	.	137	Q14145	KEAP1_HUMAN	T	137	ENSP00000171111:I137T;ENSP00000377245:I137T	ENSP00000171111:I137T	I	-	2	0	KEAP1	10471300	1.000000	0.71417	0.950000	0.38849	0.931000	0.56810	9.135000	0.94478	1.756000	0.51951	0.379000	0.24179	ATT	.		0.587	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
KIAA2022	340533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	73960186	73960186	+	Silent	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chrX:73960186A>G	ENST00000055682.6	-	3	4817	c.4206T>C	c.(4204-4206)aaT>aaC	p.N1402N		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1402					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTGTTTTCCCATTGCTTTTGC	0.448																																					p.N1402N		.											.	KIAA2022	183	0			c.T4206C						.						197.0	161.0	173.0					X																	73960186		2203	4300	6503	SO:0001819	synonymous_variant	340533	exon3			TTTCCCATTGCTT		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4206T>C	X.37:g.73960186A>G		39.0	0.0		76.0	14.0	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	A	0.827	-0.746596	0.03065	.	.	ENSG00000050030	ENST00000424929	.	.	.	5.36	0.149	0.14863	.	.	.	.	.	T	0.55097	0.1899	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46233	-0.9206	4	.	.	.	-8.4146	8.451	0.32871	0.4603:0.0:0.5397:0.0	.	.	.	.	R	4	.	.	W	-	1	0	KIAA2022	73876911	0.951000	0.32395	0.989000	0.46669	0.591000	0.36615	0.438000	0.21559	-0.076000	0.12775	0.441000	0.28932	TGG	.		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
MED23	9439	broad.mit.edu;ucsc.edu	37	6	131924170	131924170	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr6:131924170C>T	ENST00000368068.3	-	16	2110	c.1931G>A	c.(1930-1932)tGt>tAt	p.C644Y	MED23_ENST00000540546.1_Splice_Site_p.C650Y|MED23_ENST00000354577.4_Splice_Site_p.C650Y|MED23_ENST00000368060.3_Splice_Site_p.C644Y|MED23_ENST00000403834.3_Splice_Site_p.C650Y|MED23_ENST00000545957.1_Splice_Site_p.C285Y|MED23_ENST00000368053.4_Splice_Site_p.C650Y|MED23_ENST00000539158.1_3'UTR|MED23_ENST00000368058.1_Splice_Site_p.C650Y	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	644					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		ATGAGCTCACCAAAGATGGAG	0.378																																					p.C650Y		.											.	MED23	24	0			c.G1949A						.						99.0	101.0	100.0					6																	131924170		2203	4299	6502	SO:0001630	splice_region_variant	9439	exon17			GCTCACCAAAGAT	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.1931+1G>A	6.37:g.131924170C>T		71.0	1.0		89.0	16.0	NM_015979	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.755027	0.89843	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000540350;ENST00000368058;ENST00000545957;ENST00000368053;ENST00000540546	T;T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.84037	0.5384	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.89917	1.0;0.988;1.0;0.999	D;D;D;D	0.79108	0.992;0.983;0.992;0.987	T	0.82008	-0.0670	9	.	.	.	0.5958	19.592	0.95518	0.0:1.0:0.0:0.0	.	285;650;644;650	B4E3G4;Q9ULK4-2;Q9ULK4;Q9ULK4-3	.;.;MED23_HUMAN;.	Y	650;644;650;644;33;650;285;650;650	ENSP00000346588:C650Y;ENSP00000357047:C644Y;ENSP00000384536:C650Y;ENSP00000357039:C644Y;ENSP00000357037:C650Y;ENSP00000439977:C285Y;ENSP00000357032:C650Y;ENSP00000437818:C650Y	.	C	-	2	0	MED23	131965863	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.784000	0.85713	2.626000	0.88956	0.557000	0.71058	TGT	.		0.378	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		Missense_Mutation
MRGBP	55257	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61429990	61429990	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr20:61429990C>A	ENST00000370487.3	+	3	393	c.322C>A	c.(322-324)Cca>Aca	p.P108T	OGFR-AS1_ENST00000431361.1_RNA	NM_018270.4	NP_060740.1	Q9NV56	MRGBP_HUMAN	MRG/MORF4L binding protein	108					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	H4/H2A histone acetyltransferase complex (GO:0043189)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CTTCGTCCTTCCAGAAGAGAT	0.498																																					p.P108T		.											.	.	.	0			c.C322A						.						135.0	134.0	134.0					20																	61429990		2203	4300	6503	SO:0001583	missense	55257	exon3			GTCCTTCCAGAAG	AK001776	CCDS13503.1	20q13.33	2012-10-29	2012-10-29	2012-10-29	ENSG00000101189	ENSG00000101189			15866	protein-coding gene	gene with protein product		611157	"""chromosome 20 open reading frame 20"""	C20orf20		12963728	Standard	NM_018270		Approved	FLJ10914, MRG15BP, Eaf7	uc002ydi.3	Q9NV56	OTTHUMG00000032940	ENST00000370487.3:c.322C>A	20.37:g.61429990C>A	ENSP00000359518:p.Pro108Thr	82.0	1.0		109.0	20.0	NM_018270	A8C4L5	Missense_Mutation	SNP	ENST00000370487.3	37	CCDS13503.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706703	0.89018	.	.	ENSG00000101189	ENST00000370487	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.84723	0.5535	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87646	0.2525	9	0.87932	D	0	-9.8017	18.6276	0.91347	0.0:1.0:0.0:0.0	.	108	Q9NV56	MRGBP_HUMAN	T	108	.	ENSP00000359518:P108T	P	+	1	0	C20orf20	60900435	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.429000	0.73387	2.380000	0.81148	0.561000	0.74099	CCA	.		0.498	MRGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080080.1	NM_018270	
MYBPC1	4604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	102076403	102076403	+	Intron	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr12:102076403C>T	ENST00000550270.1	+	29	3412				MYBPC1_ENST00000549145.1_Intron|MYBPC1_ENST00000441232.1_Missense_Mutation_p.T1145I|MYBPC1_ENST00000545503.2_Missense_Mutation_p.T1127I|MYBPC1_ENST00000550501.1_3'UTR|MYBPC1_ENST00000360610.2_Intron|MYBPC1_ENST00000361685.2_Intron|MYBPC1_ENST00000536007.1_Missense_Mutation_p.T1108I|MYBPC1_ENST00000547405.1_Missense_Mutation_p.T1101I|MYBPC1_ENST00000541119.1_Missense_Mutation_p.T1115I|MYBPC1_ENST00000361466.2_Missense_Mutation_p.T1152I|MYBPC1_ENST00000551300.1_Intron|MYBPC1_ENST00000553190.1_Intron|MYBPC1_ENST00000392934.3_Intron|MYBPC1_ENST00000547509.1_Missense_Mutation_p.T1113I|MYBPC1_ENST00000452455.2_Missense_Mutation_p.T1145I			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type						cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GGAGTAAATACCCCTGGACAA	0.363																																					p.T1152I		.											.	MYBPC1	94	0			c.C3455T						.						72.0	74.0	73.0					12																	102076403		2203	4300	6503	SO:0001627	intron_variant	4604	exon30			TAAATACCCCTGG		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.3413-1757C>T	12.37:g.102076403C>T		99.0	0.0		144.0	31.0	NM_002465	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	ENST00000550270.1	37	CCDS9085.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575572	0.45902	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000547509;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466	T;T;T;T;T;T;T;T	0.59224	0.3;0.31;0.29;0.29;0.28;0.32;0.29;0.3	5.92	5.92	0.95590	.	0.363133	0.19907	N	0.103391	T	0.41050	0.1142	N	0.08118	0	0.80722	D	1	B;B;B;B;B;P	0.36909	0.002;0.437;0.294;0.437;0.0;0.573	B;B;B;B;B;B	0.37833	0.002;0.132;0.084;0.132;0.001;0.259	T	0.45804	-0.9236	10	0.52906	T	0.07	.	14.3366	0.66595	0.1568:0.8432:0.0:0.0	.	1108;1115;1145;1127;1101;1152	B7ZL02;B7ZL10;E7EWS6;B7ZL09;Q17RR7;G3XAE8	.;.;.;.;.;.	I	1101;1145;1145;1113;1127;1108;1115;1152	ENSP00000448175:T1101I;ENSP00000400908:T1145I;ENSP00000388989:T1145I;ENSP00000447362:T1113I;ENSP00000440034:T1127I;ENSP00000446128:T1108I;ENSP00000442847:T1115I;ENSP00000354849:T1152I	ENSP00000354849:T1152I	T	+	2	0	MYBPC1	100600534	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.228000	0.51270	2.809000	0.96659	0.655000	0.94253	ACC	.		0.363	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
MYH1	4619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10395803	10395803	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr17:10395803G>A	ENST00000226207.5	-	40	5844	c.5750C>T	c.(5749-5751)gCt>gTt	p.A1917V	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1917					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTGGGACTCAGCAATGTCAGC	0.488																																					p.A1917V		.											.	MYH1	171	0			c.C5750T						.						190.0	173.0	179.0					17																	10395803		2203	4300	6503	SO:0001583	missense	4619	exon40			GACTCAGCAATGT		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5750C>T	17.37:g.10395803G>A	ENSP00000226207:p.Ala1917Val	75.0	0.0		124.0	20.0	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	G	34	5.317651	0.95682	.	.	ENSG00000109061	ENST00000226207	T	0.81247	-1.47	4.63	4.63	0.57726	Myosin tail (1);	0.000000	0.39909	U	0.001232	D	0.92967	0.7762	H	0.96175	3.78	0.58432	D	0.999999	D	0.71674	0.998	D	0.73708	0.981	D	0.95159	0.8280	10	0.87932	D	0	.	18.0186	0.89249	0.0:0.0:1.0:0.0	.	1917	P12882	MYH1_HUMAN	V	1917	ENSP00000226207:A1917V	ENSP00000226207:A1917V	A	-	2	0	MYH1	10336528	1.000000	0.71417	0.787000	0.31911	0.976000	0.68499	9.548000	0.98103	2.546000	0.85860	0.655000	0.94253	GCT	.		0.488	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
OR2AG2	338755	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	6789560	6789560	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr11:6789560G>A	ENST00000338569.2	-	1	726	c.629C>T	c.(628-630)cCc>cTc	p.P210L		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GGCAGAAATGGGGAGCAAGAG	0.502																																					p.P210L		.											.	OR2AG2	71	0			c.C629T						.						89.0	81.0	84.0					11																	6789560		2201	4296	6497	SO:0001583	missense	338755	exon1			GAAATGGGGAGCA	AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.629C>T	11.37:g.6789560G>A	ENSP00000342697:p.Pro210Leu	65.0	1.0		59.0	7.0	NM_001004490		Missense_Mutation	SNP	ENST00000338569.2	37	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276333	0.59649	.	.	ENSG00000188124	ENST00000338569	T	0.56103	0.48	4.47	4.47	0.54385	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000115	T	0.70962	0.3284	M	0.86573	2.825	0.25423	N	0.988253	D	0.53885	0.963	P	0.56216	0.794	T	0.67526	-0.5648	10	0.87932	D	0	.	15.4428	0.75200	0.0:0.0:1.0:0.0	.	210	A6NM03	O2AG2_HUMAN	L	210	ENSP00000342697:P210L	ENSP00000342697:P210L	P	-	2	0	OR2AG2	6746136	0.414000	0.25408	0.380000	0.26093	0.797000	0.45037	3.515000	0.53429	2.777000	0.95525	0.655000	0.94253	CCC	.		0.502	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
OVCH1	341350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	29598311	29598311	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr12:29598311G>T	ENST00000318184.5	-	23	2780	c.2781C>A	c.(2779-2781)taC>taA	p.Y927*	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	927	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AAGTCATTGAGTAAAGTCTTC	0.398																																					p.Y927X		.											.	OVCH1	210	0			c.C2781A						.						89.0	84.0	86.0					12																	29598311		1854	4098	5952	SO:0001587	stop_gained	341350	exon23			CATTGAGTAAAGT	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2781C>A	12.37:g.29598311G>T	ENSP00000326708:p.Tyr927*	55.0	0.0		91.0	14.0	NM_183378		Nonsense_Mutation	SNP	ENST00000318184.5	37		.	.	.	.	.	.	.	.	.	.	G	16.50	3.140303	0.56936	.	.	ENSG00000187950	ENST00000318184	.	.	.	2.2	-0.713	0.11223	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.0496	0.14501	0.4856:0.0:0.5144:0.0	.	.	.	.	X	927	.	ENSP00000326708:Y927X	Y	-	3	2	OVCH1	29489578	0.015000	0.18098	0.001000	0.08648	0.002000	0.02628	-0.048000	0.11944	-0.186000	0.10533	-0.251000	0.11542	TAC	.		0.398	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
PCDHGA10	56106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140792839	140792839	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr5:140792839C>T	ENST00000398610.2	+	1	97	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W	PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	33	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTGGAGCCCGGCAGATCTC	0.567											OREG0016862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R33W		.											.	.	.	0			c.C97T						.						45.0	51.0	49.0					5																	140792839		1897	4149	6046	SO:0001583	missense	56106	exon1			GGAGCCCGGCAGA		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.97C>T	5.37:g.140792839C>T	ENSP00000381611:p.Arg33Trp	64.0	0.0	1659	81.0	17.0	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	37	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	c	8.061	0.768209	0.15983	.	.	ENSG00000253846	ENST00000398610	T	0.49139	0.79	5.49	1.19	0.21007	.	.	.	.	.	T	0.40322	0.1112	L	0.54323	1.7	0.09310	N	1	B;B	0.18741	0.016;0.03	B;B	0.20955	0.013;0.032	T	0.41822	-0.9487	9	0.72032	D	0.01	.	6.0171	0.19608	0.1108:0.3842:0.426:0.079	.	33;33	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	W	33	ENSP00000381611:R33W	ENSP00000381611:R33W	R	+	1	2	PCDHGA10	140773023	0.636000	0.27207	0.876000	0.34364	0.324000	0.28378	0.851000	0.27751	0.640000	0.30582	0.460000	0.39030	CGG	.		0.567	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
PITPNM1	9600	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	11	67261260	67261260	+	Silent	SNP	G	G	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr11:67261260G>T	ENST00000534749.1	-	20	3245	c.3057C>A	c.(3055-3057)ggC>ggA	p.G1019G	PITPNM1_ENST00000356404.3_Silent_p.G1019G|PITPNM1_ENST00000526450.1_5'UTR|PITPNM1_ENST00000436757.2_Silent_p.G1018G			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	1019					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CAGCCTCCGTGCCGCGGGCCA	0.716																																					p.G1019G	GBM(28;144 709 4607 5525)	.											.	PITPNM1	227	0			c.C3057A						.						15.0	15.0	15.0					11																	67261260		2089	4084	6173	SO:0001819	synonymous_variant	9600	exon21			CTCCGTGCCGCGG	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.3057C>A	11.37:g.67261260G>T		58.0	0.0		59.0	9.0	NM_004910	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	37	CCDS31620.1																																																																																			.		0.716	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
PUS7	54517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	105121549	105121549	+	Silent	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr7:105121549A>G	ENST00000356362.2	-	9	1339	c.1125T>C	c.(1123-1125)taT>taC	p.Y375Y	PUS7_ENST00000469408.1_Silent_p.Y375Y	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	375	TRUD. {ECO:0000255|PROSITE- ProRule:PRU00342}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						TTTGCATTCCATAGTAGTTAA	0.363																																					p.Y375Y	Colon(138;2387 3051 17860)	.											.	PUS7	90	0			c.T1125C						.						139.0	132.0	134.0					7																	105121549		2203	4300	6503	SO:0001819	synonymous_variant	54517	exon9			CATTCCATAGTAG	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1125T>C	7.37:g.105121549A>G		98.0	0.0		122.0	24.0	NM_019042	Q75MG4|Q9NX19	Silent	SNP	ENST00000356362.2	37	CCDS34725.1																																																																																			.		0.363	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348681.1	NM_019042	
RPAP1	26015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41816168	41816168	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr15:41816168T>C	ENST00000304330.4	-	17	2353	c.2237A>G	c.(2236-2238)gAt>gGt	p.D746G	RPAP1_ENST00000561603.1_Missense_Mutation_p.D746G	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	746						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCAGCAGAATCACTACAAAA	0.597																																					p.D746G		.											.	RPAP1	153	0			c.A2237G						.						33.0	32.0	33.0					15																	41816168		2203	4300	6503	SO:0001583	missense	26015	exon17			GCAGAATCACTAC	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.2237A>G	15.37:g.41816168T>C	ENSP00000306123:p.Asp746Gly	44.0	0.0		59.0	8.0	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	T	6.315	0.426283	0.11987	.	.	ENSG00000103932	ENST00000304330	T	0.11930	2.73	4.47	3.35	0.38373	.	0.937786	0.09133	N	0.844107	T	0.07773	0.0195	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33624	-0.9861	10	0.87932	D	0	-17.8935	3.3007	0.06982	0.2026:0.1116:0.0:0.6857	.	746	Q9BWH6	RPAP1_HUMAN	G	746	ENSP00000306123:D746G	ENSP00000306123:D746G	D	-	2	0	RPAP1	39603460	0.415000	0.25416	0.255000	0.24374	0.204000	0.24138	0.785000	0.26830	0.762000	0.33152	0.460000	0.39030	GAT	.		0.597	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
RUNX1T1	862	ucsc.edu;mdanderson.org	37	8	92998419	92998419	+	Silent	SNP	T	T	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr8:92998419T>C	ENST00000523629.1	-	9	1666	c.1212A>G	c.(1210-1212)aaA>aaG	p.K404K	RUNX1T1_ENST00000360348.2_Silent_p.K367K|RUNX1T1_ENST00000436581.2_Silent_p.K415K|RUNX1T1_ENST00000422361.2_Silent_p.K367K|RUNX1T1_ENST00000396218.1_Silent_p.K377K|RUNX1T1_ENST00000518844.1_Silent_p.K377K|RUNX1T1_ENST00000520724.1_Silent_p.K367K|RUNX1T1_ENST00000265814.3_Silent_p.K404K	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	404					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TGCCGCCACCTTTTTTTAAGT	0.517																																					p.K463K		.											.	RUNX1T1	1196	0			c.A1389G						.						96.0	103.0	101.0					8																	92998419		2203	4300	6503	SO:0001819	synonymous_variant	862	exon9			GCCACCTTTTTTT	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1212A>G	8.37:g.92998419T>C		93.0	2.0		82.0	11.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	ENST00000523629.1	37	CCDS6256.1																																																																																			.		0.517	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
RUNX2	860	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	45390432	45390432	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr6:45390432A>C	ENST00000371438.1	+	2	519	c.161A>C	c.(160-162)cAg>cCg	p.Q54P	RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q122P|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q40P|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q54P|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q54P|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q122P|RUNX2_ENST00000576263.1_Missense_Mutation_p.Q54P|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q40P	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	54	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						cagcagcaacagcagcagcag	0.731																																					p.Q54P		.											.	RUNX2	417	0			c.A161C						.						20.0	28.0	25.0					6																	45390432		1745	3566	5311	SO:0001583	missense	860	exon3			AGCAACAGCAGCA	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.161A>C	6.37:g.45390432A>C	ENSP00000360493:p.Gln54Pro	58.0	0.0		73.0	11.0	NM_001024630	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	A	6.074	0.382044	0.11524	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.50277	0.86;1.08;1.08;0.86;0.75;0.75;0.75	1.8	1.8	0.24995	.	0.397823	0.18432	N	0.141408	T	0.11922	0.0290	N	0.19112	0.55	0.37120	D	0.900762	B;B;B	0.29909	0.027;0.046;0.261	B;B;B	0.17979	0.02;0.009;0.009	T	0.05370	-1.0889	10	0.27082	T	0.32	.	7.3175	0.26509	1.0:0.0:0.0:0.0	.	122;54;40	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	P	54;122;122;54;54;40;40	ENSP00000420707:Q54P;ENSP00000319087:Q122P;ENSP00000446290:Q122P;ENSP00000360493:Q54P;ENSP00000360491:Q54P;ENSP00000352514:Q40P;ENSP00000360486:Q40P	ENSP00000319087:Q122P	Q	+	2	0	RUNX2	45498410	0.814000	0.29104	1.000000	0.80357	0.899000	0.52679	0.000000	0.12993	1.094000	0.41399	0.334000	0.21626	CAG	.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
SALL1	6299	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	51173574	51173574	+	Silent	SNP	A	A	C			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr16:51173574A>C	ENST00000251020.4	-	2	2592	c.2559T>G	c.(2557-2559)tcT>tcG	p.S853S	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.S756S|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	853					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GCAAAGGCGAAGAGGATAAGC	0.517																																					p.S853S	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1	98	0			c.T2559G						.						108.0	106.0	107.0					16																	51173574		2198	4300	6498	SO:0001819	synonymous_variant	6299	exon2			AGGCGAAGAGGAT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2559T>G	16.37:g.51173574A>C		76.0	1.0		69.0	10.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	CCDS10747.1																																																																																			.		0.517	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SEC24A	10802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	133997208	133997208	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr5:133997208G>T	ENST00000398844.2	+	2	785	c.497G>T	c.(496-498)aGt>aTt	p.S166I	SEC24A_ENST00000322887.4_Missense_Mutation_p.S166I	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	166	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGAAATACAAGTTTAACCACA	0.368																																					p.S166I		.											.	SEC24A	68	0			c.G497T						.						96.0	92.0	93.0					5																	133997208		1938	4141	6079	SO:0001583	missense	10802	exon2			ATACAAGTTTAAC	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.497G>T	5.37:g.133997208G>T	ENSP00000381823:p.Ser166Ile	93.0	0.0		113.0	15.0	NM_001252231	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	7.939	0.742462	0.15642	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	D;D	0.97232	-4.3;-4.3	5.55	0.504	0.16946	.	1.193380	0.05767	N	0.605952	D	0.91851	0.7421	N	0.22421	0.69	0.09310	N	1	B	0.15473	0.013	B	0.13407	0.009	T	0.82147	-0.0601	10	0.37606	T	0.19	-0.1978	1.1954	0.01874	0.475:0.143:0.2437:0.1383	.	166	O95486	SC24A_HUMAN	I	166	ENSP00000381823:S166I;ENSP00000321749:S166I	ENSP00000321749:S166I	S	+	2	0	SEC24A	134025107	0.995000	0.38212	0.258000	0.24420	0.328000	0.28507	1.315000	0.33608	0.062000	0.16340	0.655000	0.94253	AGT	.		0.368	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
SHCBP1L	81626	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	182922155	182922155	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr1:182922155delG	ENST00000367547.3	-	1	350	c.114delC	c.(112-114)accfs	p.T39fs	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_5'Flank	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	111										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						CCTTCAGGGTGGTCGCGGCCG	0.736																																					p.T38fs		.											.	SHCBP1L	91	0			c.114delC						.						3.0	3.0	3.0					1																	182922155		1775	3719	5494	SO:0001589	frameshift_variant	81626	exon1			CAGGGTGGTCGCG	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.114delC	1.37:g.182922155delG	ENSP00000356518:p.Thr39fs	45.0	0.0		64.0	14.0	NM_030933	Q4G195|Q9BZQ3|Q9H2B6	Frame_Shift_Del	DEL	ENST00000367547.3	37	CCDS30955.1																																																																																			.		0.736	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
SLC22A8	9376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62782428	62782428	+	Start_Codon_SNP	SNP	C	C	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr11:62782428C>T	ENST00000336232.2	-	2	138	c.3G>A	c.(1-3)atG>atA	p.M1I	SLC22A8_ENST00000545207.1_Intron|SLC22A8_ENST00000311438.8_Start_Codon_SNP_p.M1I|SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000430500.2_Start_Codon_SNP_p.M1I	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	1					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)	p.M1I(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCGAGAAGGTCATGGCACTGG	0.572																																					p.M1I		.											.	SLC22A8	93	1	Substitution - Missense(1)	lung(1)	c.G3A						.						85.0	74.0	78.0					11																	62782428		2201	4298	6499	SO:0001582	initiator_codon_variant	9376	exon2			GAAGGTCATGGCA	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.3G>A	11.37:g.62782428C>T	ENSP00000337335:p.Met1Ile	28.0	0.0		39.0	11.0	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	37	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647807	0.87958	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000311438;ENST00000430500	T;T;T	0.70399	-0.48;-0.48;-0.48	4.76	4.76	0.60689	.	0.089661	0.64402	D	0.000001	D	0.83510	0.5270	.	.	.	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.75020	0.985;0.967	D	0.85886	0.1425	9	0.87932	D	0	.	15.3286	0.74186	0.0:1.0:0.0:0.0	.	1;1	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	I	1	ENSP00000337335:M1I;ENSP00000311463:M1I;ENSP00000398548:M1I	ENSP00000311463:M1I	M	-	3	0	SLC22A8	62539004	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.652000	0.74377	2.460000	0.83146	0.655000	0.94253	ATG	.		0.572	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	Missense_Mutation
SLC4A5	57835	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	74482906	74482906	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr2:74482906T>A	ENST00000377634.4	-	13	1420	c.1021A>T	c.(1021-1023)Acc>Tcc	p.T341S	SLC4A5_ENST00000358683.4_Missense_Mutation_p.T277S|SLC4A5_ENST00000377632.1_Missense_Mutation_p.T341S|SLC4A5_ENST00000359484.4_Missense_Mutation_p.T277S|SLC4A5_ENST00000394019.2_Missense_Mutation_p.T341S|SLC4A5_ENST00000357822.5_Missense_Mutation_p.T341S|SLC4A5_ENST00000346834.4_Missense_Mutation_p.T341S|SLC4A5_ENST00000483195.1_5'UTR|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000423644.1_Missense_Mutation_p.T341S					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TCTCACCTGGTGGGGACAGGC	0.592																																					p.T341S		.											.	SLC4A5	98	0			c.A1021T						.						100.0	86.0	91.0					2																	74482906		2203	4300	6503	SO:0001583	missense	57835	exon8			ACCTGGTGGGGAC	AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1021A>T	2.37:g.74482906T>A	ENSP00000366861:p.Thr341Ser	32.0	0.0		38.0	9.0	NM_021196		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.583538	0.65992	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	5.1	5.1	0.69264	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	T	0.78817	0.4343	L	0.52126	1.63	0.58432	D	0.999997	B;B;B;B;B	0.26445	0.126;0.149;0.022;0.073;0.105	B;B;B;B;B	0.37144	0.052;0.21;0.119;0.242;0.199	T	0.75263	-0.3379	10	0.33141	T	0.24	.	12.8856	0.58042	0.0:0.0:0.0:1.0	.	341;341;277;341;341	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	S	341;341;341;277;341;277;341;341;341;341	ENSP00000377587:T341S;ENSP00000251768:T341S;ENSP00000352461:T277S;ENSP00000395804:T341S;ENSP00000351513:T277S;ENSP00000350475:T341S;ENSP00000366859:T341S;ENSP00000366861:T341S;ENSP00000405678:T341S	ENSP00000251768:T341S	T	-	1	0	SLC4A5	74336414	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	2.144000	0.66660	0.533000	0.62120	ACC	.		0.592	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		
SP7	121340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53722106	53722106	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr12:53722106G>A	ENST00000536324.2	-	3	1403	c.1120C>T	c.(1120-1122)Cgc>Tgc	p.R374C	SP7_ENST00000303846.3_Missense_Mutation_p.R374C|SP7_ENST00000537210.2_Missense_Mutation_p.R356C	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	374					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						CCATGGGTGCGCTGGTGTTTG	0.672											OREG0021867	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R374C		.											.	.	.	0			c.C1120T						.						38.0	45.0	43.0					12																	53722106		2124	4246	6370	SO:0001583	missense	121340	exon2			GGGTGCGCTGGTG	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.1120C>T	12.37:g.53722106G>A	ENSP00000443827:p.Arg374Cys	39.0	0.0	994	45.0	18.0	NM_152860	B3KY26|Q3MJ72|Q7Z718	Missense_Mutation	SNP	ENST00000536324.2	37	CCDS44897.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829160	0.50845	.	.	ENSG00000170374	ENST00000536324;ENST00000303846;ENST00000537210	T;T;T	0.36157	1.27;1.27;1.27	4.66	4.66	0.58398	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.067164	0.56097	D	0.000034	T	0.56645	0.1999	M	0.70842	2.15	0.52501	D	0.999953	D	0.89917	1.0	D	0.69142	0.962	T	0.60439	-0.7263	10	0.87932	D	0	.	12.9159	0.58205	0.0:0.0:0.8366:0.1634	.	374	Q8TDD2	SP7_HUMAN	C	374;374;356	ENSP00000443827:R374C;ENSP00000302812:R374C;ENSP00000441367:R356C	ENSP00000302812:R374C	R	-	1	0	SP7	52008373	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	3.697000	0.54764	2.509000	0.84616	0.561000	0.74099	CGC	.		0.672	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1		
SPG7	6687	hgsc.bcm.edu;mdanderson.org	37	16	89574985	89574985	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr16:89574985G>A	ENST00000268704.2	+	1	175	c.160G>A	c.(160-162)Gag>Aag	p.E54K	SPG7_ENST00000341316.2_Missense_Mutation_p.E54K	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	54					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GGACCTCGCCGAGGCTGGAGG	0.776																																					p.E54K		.											.	SPG7	226	0			c.G160A						.						1.0	2.0	2.0					16																	89574985		1024	2194	3218	SO:0001583	missense	6687	exon1			CTCGCCGAGGCTG	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.160G>A	16.37:g.89574985G>A	ENSP00000268704:p.Glu54Lys	16.0	0.0		34.0	6.0	NM_199367	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119339	0.37436	.	.	ENSG00000197912	ENST00000268704;ENST00000341316	T;T	0.80909	-1.43;-1.43	3.77	-0.85	0.10720	Peptidase M41, FtsH (1);	0.786859	0.11029	N	0.607463	T	0.53899	0.1825	N	0.08118	0	0.09310	N	1	B;B	0.26120	0.011;0.142	B;B	0.14578	0.001;0.011	T	0.37957	-0.9683	10	0.17369	T	0.5	.	4.2676	0.10771	0.226:0.3729:0.4011:0.0	.	54;54	Q9UQ90;Q9UQ90-2	SPG7_HUMAN;.	K	54	ENSP00000268704:E54K;ENSP00000341157:E54K	ENSP00000268704:E54K	E	+	1	0	SPG7	88102486	0.156000	0.22821	0.000000	0.03702	0.055000	0.15305	1.380000	0.34351	-0.087000	0.12528	0.467000	0.42956	GAG	.		0.776	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
SPTB	6710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	65241980	65241980	+	Silent	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr14:65241980G>A	ENST00000389721.5	-	22	4737	c.4705C>T	c.(4705-4707)Ctg>Ttg	p.L1569L	SPTB_ENST00000389720.3_Silent_p.L1569L|SPTB_ENST00000556626.1_Silent_p.L1569L|SPTB_ENST00000389722.3_Silent_p.L1569L|SPTB_ENST00000542895.1_Silent_p.L1569L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1569					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCCTCCCGCAGCCTGTCCCAG	0.677																																					p.L1569L		.											.	SPTB	100	0			c.C4705T						.						38.0	30.0	33.0					14																	65241980		2203	4299	6502	SO:0001819	synonymous_variant	6710	exon22			CCCGCAGCCTGTC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4705C>T	14.37:g.65241980G>A		35.0	0.0		45.0	9.0	NM_001024858	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																			.		0.677	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
TST	7263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	37414605	37414605	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr22:37414605A>G	ENST00000403892.3	-	1	903	c.169T>C	c.(169-171)Tct>Cct	p.S57P	MPST_ENST00000404802.3_5'Flank|TST_ENST00000249042.3_Missense_Mutation_p.S57P|MPST_ENST00000401419.3_5'Flank|MPST_ENST00000341116.3_5'Flank|MPST_ENST00000429360.2_5'Flank|MPST_ENST00000397129.1_5'Flank|MPST_ENST00000404393.1_5'Flank	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	57	Rhodanese 1. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						TCAAAGAAAGAGGCGCCGGGT	0.672																																					p.S57P		.											.	TST	90	0			c.T169C						.						7.0	7.0	7.0					22																	37414605		2158	4235	6393	SO:0001583	missense	7263	exon2			AGAAAGAGGCGCC	Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.169T>C	22.37:g.37414605A>G	ENSP00000385828:p.Ser57Pro	41.0	0.0		40.0	4.0	NM_003312	B3KRM1|Q6IB06	Missense_Mutation	SNP	ENST00000403892.3	37	CCDS13938.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845606	0.71603	.	.	ENSG00000128311	ENST00000403892;ENST00000249042;ENST00000413912;ENST00000438203	T;T;T	0.25250	1.81;1.81;1.81	4.94	4.94	0.65067	Rhodanese-like (5);Thiosulphate sulfurtransferase, conserved site (1);	0.127399	0.64402	D	0.000016	T	0.32010	0.0815	L	0.42245	1.32	0.49798	D	0.999827	P	0.49358	0.923	P	0.56563	0.801	T	0.05517	-1.0880	10	0.35671	T	0.21	-28.9281	6.6314	0.22859	0.7653:0.1554:0.0793:0.0	.	57	Q16762	THTR_HUMAN	P	57	ENSP00000385828:S57P;ENSP00000249042:S57P;ENSP00000400764:S57P	ENSP00000249042:S57P	S	-	1	0	TST	35744551	0.998000	0.40836	1.000000	0.80357	0.949000	0.60115	1.480000	0.35464	1.853000	0.53794	0.459000	0.35465	TCT	.		0.672	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318790.1		
USP40	55230	broad.mit.edu;bcgsc.ca	37	2	234442314	234442314	+	Missense_Mutation	SNP	G	G	T	rs370076373		TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr2:234442314G>T	ENST00000427112.2	-	10	1314	c.1279C>A	c.(1279-1281)Caa>Aaa	p.Q427K	USP40_ENST00000251722.6_Missense_Mutation_p.Q427K|USP40_ENST00000450966.1_Missense_Mutation_p.Q439K			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	427	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TTGAAAATTTGCTGGTCATTC	0.408																																					p.Q439K		.											.	USP40	455	0			c.C1315A						.						112.0	105.0	107.0					2																	234442314		1833	4084	5917	SO:0001583	missense	55230	exon10			AAATTTGCTGGTC	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1279C>A	2.37:g.234442314G>T	ENSP00000387898:p.Gln427Lys	101.0	0.0		79.0	5.0	NM_018218	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	8.985	0.976410	0.18736	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112	T;T;T	0.04758	3.56;3.56;3.56	5.36	2.48	0.30137	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	11.107500	0.00166	N	0.000000	T	0.02533	0.0077	N	0.08118	0	0.09310	N	1	B;B	0.18461	0.028;0.022	B;B	0.18871	0.023;0.014	T	0.40942	-0.9536	10	0.02654	T	1	.	2.4244	0.04455	0.169:0.1479:0.5309:0.1522	.	427;439	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	K	439;427;427	ENSP00000415434:Q439K;ENSP00000251722:Q427K;ENSP00000387898:Q427K	ENSP00000251722:Q427K	Q	-	1	0	USP40	234107053	0.006000	0.16342	0.000000	0.03702	0.095000	0.18619	1.591000	0.36665	0.642000	0.30620	0.655000	0.94253	CAA	.		0.408	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
WEE1	7465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	9597784	9597784	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr11:9597784G>A	ENST00000450114.2	+	3	1043	c.790G>A	c.(790-792)Ggt>Agt	p.G264S	WEE1_ENST00000299613.6_Missense_Mutation_p.G50S|snoU13_ENST00000458785.1_RNA	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	264					blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		tagttcctgtggtgaagacat	0.289																																					p.G264S		.											.	WEE1	1404	0			c.G790A						.						57.0	67.0	63.0					11																	9597784		1327	2308	3635	SO:0001583	missense	7465	exon3			TCCTGTGGTGAAG	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.790G>A	11.37:g.9597784G>A	ENSP00000402084:p.Gly264Ser	143.0	0.0		149.0	21.0	NM_003390	B3KVE1|D3DQV0	Missense_Mutation	SNP	ENST00000450114.2	37	CCDS7800.1	.	.	.	.	.	.	.	.	.	.	G	3.025	-0.200901	0.06219	.	.	ENSG00000166483	ENST00000450114;ENST00000299613	T;T	0.53640	0.74;0.61	3.63	2.67	0.31697	.	0.158692	0.56097	N	0.000031	T	0.34542	0.0901	L	0.46157	1.445	0.80722	D	1	B;B	0.17268	0.0;0.021	B;B	0.17979	0.002;0.02	T	0.08006	-1.0743	10	0.16420	T	0.52	-9.2048	6.8148	0.23824	0.0959:0.0:0.7139:0.1902	.	72;264	Q6MZL0;P30291	.;WEE1_HUMAN	S	264;50	ENSP00000402084:G264S;ENSP00000299613:G50S	ENSP00000299613:G50S	G	+	1	0	WEE1	9554360	1.000000	0.71417	0.992000	0.48379	0.240000	0.25518	2.219000	0.42899	0.442000	0.26555	-0.397000	0.06425	GGT	.		0.289	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
XKR6	286046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	10782237	10782237	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr8:10782237G>T	ENST00000416569.2	-	2	894	c.868C>A	c.(868-870)Ctg>Atg	p.L290M	XKR6_ENST00000304437.2_Missense_Mutation_p.L11M	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	290						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		AGGAGGCGCAGCATGTTGACG	0.577																																					p.L290M		.											.	XKR6	92	0			c.C868A						.						117.0	106.0	110.0					8																	10782237		2203	4300	6503	SO:0001583	missense	286046	exon2			GGCGCAGCATGTT	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.868C>A	8.37:g.10782237G>T	ENSP00000416707:p.Leu290Met	27.0	0.0		44.0	10.0	NM_173683	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	18.26|18.26	3.584910|3.584910	0.65992|0.65992	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000382461|ENST00000304437;ENST00000416569	.|T;T	.|0.72394	.|-0.65;-0.65	4.84|4.84	0.119|0.119	0.14685|0.14685	.|.	.|0.000000	.|0.64402	.|D	.|0.000003	.|D	.|0.84092	.|0.5396	M|M	0.88450|0.88450	2.955|2.955	0.44042|0.44042	D|D	0.996774|0.996774	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|D	.|0.85008	.|0.0904	.|10	.|0.56958	.|D	.|0.05	-13.5137|-13.5137	13.0399|13.0399	0.58893|0.58893	0.2207:0.0:0.7793:0.0|0.2207:0.0:0.7793:0.0	.|.	.|290	.|Q5GH73	.|XKR6_HUMAN	X|M	66|11;290	.|ENSP00000307120:L11M;ENSP00000416707:L290M	.|ENSP00000307120:L11M	C|L	-|-	3|1	2|2	XKR6|XKR6	10819647|10819647	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.919000|1.919000	0.40015|0.40015	0.105000|0.105000	0.17753|0.17753	0.457000|0.457000	0.33378|0.33378	TGC|CTG	.		0.577	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
YIPF7	285525	ucsc.edu;bcgsc.ca	37	4	44626734	44626734	+	Silent	SNP	G	G	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr4:44626734G>A	ENST00000332990.5	-	5	580	c.564C>T	c.(562-564)gcC>gcT	p.A188A	YIPF7_ENST00000415895.4_Silent_p.A164A	NM_182592.2	NP_872398.2	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	188						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(1)	12						GGTTCAGCAAGGCATGAATCA	0.517																																					p.A188A		.											.	.	.	0			c.C564T						.						67.0	72.0	71.0					4																	44626734		2078	4209	6287	SO:0001819	synonymous_variant	285525	exon5			CAGCAAGGCATGA	AK096895	CCDS54766.1	4p13	2008-08-07			ENSG00000177752	ENSG00000177752		"""Yip1 domain family"""	26825	protein-coding gene	gene with protein product							Standard	NM_182592		Approved	FLJ39576, FinGER9	uc021xnx.1	Q8N8F6	OTTHUMG00000160467	ENST00000332990.5:c.564C>T	4.37:g.44626734G>A		166.0	2.0		217.0	48.0	NM_182592	Q3SY21|Q3SY22	Silent	SNP	ENST00000332990.5	37	CCDS54766.1	.	.	.	.	.	.	.	.	.	.	G	0.914	-0.718137	0.03182	.	.	ENSG00000177752	ENST00000415895	.	.	.	5.1	1.04	0.20106	.	.	.	.	.	T	0.55657	0.1934	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47923	-0.9079	4	.	.	.	-9.8822	8.5703	0.33565	0.4452:0.0:0.5548:0.0	.	.	.	.	F	165	.	.	L	-	1	0	YIPF7	44321491	1.000000	0.71417	0.226000	0.23910	0.045000	0.14185	1.089000	0.30890	0.291000	0.22468	0.655000	0.94253	CTT	.		0.517	YIPF7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_182592	
ZNF630	57232	broad.mit.edu;bcgsc.ca	37	X	47919574	47919574	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chrX:47919574T>A	ENST00000409324.3	-	5	483	c.257A>T	c.(256-258)gAa>gTa	p.E86V	ZNF630_ENST00000442455.3_Missense_Mutation_p.E72V|ZNF630_ENST00000276054.4_5'UTR|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						CTGGGAAGATTCAAGGCCTTT	0.393																																					p.E86V		.											.	ZNF630	131	0			c.A257T						.						38.0	26.0	30.0					X																	47919574		690	1587	2277	SO:0001583	missense	57232	exon5			GAAGATTCAAGGC	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.257A>T	X.37:g.47919574T>A	ENSP00000386393:p.Glu86Val	78.0	2.0		78.0	16.0	NM_001037735	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	37	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	11.88	1.771165	0.31320	.	.	ENSG00000221994	ENST00000442455;ENST00000409324;ENST00000428686	T;T;T	0.09538	2.97;3.04;5.11	2.47	-0.341	0.12639	.	.	.	.	.	T	0.05318	0.0141	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38243	-0.9670	9	0.49607	T	0.09	.	2.6615	0.05028	0.2309:0.1622:0.0:0.6069	.	86	Q2M218	ZN630_HUMAN	V	72;86;86	ENSP00000393163:E72V;ENSP00000386393:E86V;ENSP00000407278:E86V	ENSP00000386393:E86V	E	-	2	0	ZNF630	47804518	0.010000	0.17322	0.035000	0.18076	0.725000	0.41563	1.764000	0.38471	0.143000	0.18926	0.345000	0.21793	GAA	.		0.393	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735	
ZNF839	55778	broad.mit.edu;ucsc.edu	37	14	102807765	102807765	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NR-01A-11D-A30V-10	TCGA-DD-A4NR-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	083000f9-e8e4-4d44-a4b3-74a624a24186	ba98edfd-3301-4ba6-8d12-38e87d1f6bfa	g.chr14:102807765T>G	ENST00000558850.1	+	8	2035	c.1685T>G	c.(1684-1686)cTt>cGt	p.L562R	ZNF839_ENST00000559185.1_Missense_Mutation_p.L562R|ZNF839_ENST00000420933.2_3'UTR|ZNF839_ENST00000442396.2_Missense_Mutation_p.L678R|ZNF839_ENST00000262236.5_Missense_Mutation_p.L564R|AL137229.1_ENST00000577622.1_RNA	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	562							metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GGCCCGCAGCTTCAGGCACTG	0.567																																					p.L678R		.											.	ZNF839	91	0			c.T2033G						.						55.0	57.0	56.0					14																	102807765		1965	4165	6130	SO:0001583	missense	55778	exon8			CGCAGCTTCAGGC	AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.1685T>G	14.37:g.102807765T>G	ENSP00000453363:p.Leu562Arg	66.0	1.0		86.0	15.0	NM_018335	B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Missense_Mutation	SNP	ENST00000558850.1	37	CCDS58336.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560134	0.45590	.	.	ENSG00000022976	ENST00000442396;ENST00000262236;ENST00000398436;ENST00000420933	T;T	0.20200	2.09;2.1	4.56	0.662	0.17880	.	0.572500	0.16172	N	0.226240	T	0.13200	0.0320	L	0.43152	1.355	0.09310	N	1	P;P;P	0.41784	0.762;0.762;0.762	B;B;B	0.40199	0.322;0.322;0.322	T	0.10706	-1.0618	10	0.28530	T	0.3	.	0.4928	0.00567	0.2669:0.1708:0.1371:0.4252	.	678;564;562	A8K0R7-5;A8K0R7-2;A8K0R7	.;.;ZN839_HUMAN	R	678;564;230;96	ENSP00000399863:L678R;ENSP00000262236:L564R	ENSP00000262236:L564R	L	+	2	0	ZNF839	101877518	0.021000	0.18746	0.033000	0.17914	0.061000	0.15899	0.187000	0.16998	0.191000	0.20236	0.421000	0.28195	CTT	.		0.567	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000415492.2	NM_018335	
