#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAN	176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89400397	89400397	+	Silent	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr15:89400397G>A	ENST00000561243.1	+	11	4581	c.4581G>A	c.(4579-4581)agG>agA	p.R1527R	ACAN_ENST00000559004.1_Silent_p.R1527R|ACAN_ENST00000439576.2_Silent_p.R1527R|ACAN_ENST00000352105.7_Silent_p.R1527R			P16112	PGCA_HUMAN	aggrecan	1536	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			ACCTCAGCAGGCTCCCTTCTG	0.507																																					p.R1527R		.											.	ACAN	25	0			c.G4581A						.						53.0	54.0	54.0					15																	89400397		1841	4084	5925	SO:0001819	synonymous_variant	176	exon12			CAGCAGGCTCCCT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4581G>A	15.37:g.89400397G>A		64.0	0.0		42.0	38.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	ENST00000561243.1	37	CCDS53970.1																																																																																			.		0.507	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ACSL5	51703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	114168208	114168208	+	Missense_Mutation	SNP	C	C	G	rs140011392		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr10:114168208C>G	ENST00000393081.1	+	6	768	c.461C>G	c.(460-462)aCg>aGg	p.T154R	RP11-324O2.3_ENST00000598447.1_RNA|RP11-324O2.3_ENST00000594870.2_RNA|ACSL5_ENST00000354273.4_Missense_Mutation_p.T154R|ACSL5_ENST00000433418.1_Missense_Mutation_p.T154R|ACSL5_ENST00000356116.1_Missense_Mutation_p.T210R|ACSL5_ENST00000479936.1_3'UTR|RP11-324O2.3_ENST00000449782.2_RNA|ACSL5_ENST00000354655.4_Missense_Mutation_p.T154R|ACSL5_ENST00000369410.3_5'Flank	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	154					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		GCTTGTTACACGTACTCTATG	0.438																																					p.T210R		.											.	ACSL5	154	0			c.C629G						.						298.0	228.0	252.0					10																	114168208		2203	4300	6503	SO:0001583	missense	51703	exon6			GTTACACGTACTC	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.461C>G	10.37:g.114168208C>G	ENSP00000376796:p.Thr154Arg	156.0	0.0		153.0	68.0	NM_016234	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Missense_Mutation	SNP	ENST00000393081.1	37	CCDS7573.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733313	0.69189	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	5.92	5.92	0.95590	AMP-dependent synthetase/ligase (1);	0.046435	0.85682	D	0.000000	T	0.48040	0.1478	L	0.50993	1.605	0.80722	D	1	D;B;B	0.58620	0.983;0.086;0.298	P;B;B	0.54706	0.759;0.095;0.154	T	0.11494	-1.0585	10	0.21014	T	0.42	-12.0121	19.0814	0.93185	0.0:1.0:0.0:0.0	.	154;210;154	A6GV77;Q9ULC5-3;Q9ULC5	.;.;ACSL5_HUMAN	R	154;154;210;154;154	ENSP00000346680:T154R;ENSP00000376796:T154R;ENSP00000348429:T210R;ENSP00000403647:T154R;ENSP00000346223:T154R	ENSP00000346223:T154R	T	+	2	0	ACSL5	114158198	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	7.481000	0.81124	2.798000	0.96311	0.643000	0.83706	ACG	C|1.000;T|0.000		0.438	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234	
ADRBK1	156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67046702	67046702	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:67046702C>A	ENST00000308595.5	+	3	512	c.222C>A	c.(220-222)aaC>aaA	p.N74K	ADRBK1_ENST00000526285.1_Missense_Mutation_p.N74K	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	74	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	TCTGCCTGAACCACCTGGAGG	0.597																																					p.N74K		.											.	ADRBK1	521	0			c.C222A						.						89.0	83.0	85.0					11																	67046702		2200	4295	6495	SO:0001583	missense	156	exon3			CCTGAACCACCTG	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.222C>A	11.37:g.67046702C>A	ENSP00000312262:p.Asn74Lys	100.0	0.0		96.0	37.0	NM_001619	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241494	0.39598	.	.	ENSG00000173020	ENST00000308595;ENST00000526285	T;T	0.02216	4.39;4.39	4.5	1.87	0.25490	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.101746	0.42172	N	0.000744	T	0.02767	0.0083	L	0.45285	1.41	0.48762	D	0.999707	P;P	0.45044	0.849;0.739	B;B	0.43990	0.438;0.371	T	0.62282	-0.6887	10	0.28530	T	0.3	-14.2184	8.3066	0.32047	0.1769:0.5592:0.264:0.0	.	74;74	P25098;E9PRV7	ARBK1_HUMAN;.	K	74	ENSP00000312262:N74K;ENSP00000434126:N74K	ENSP00000312262:N74K	N	+	3	2	ADRBK1	66803278	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.611000	0.24268	0.302000	0.22762	0.655000	0.94253	AAC	.		0.597	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393153.1	NM_001619	
ALMS1	7840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	73676478	73676478	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:73676478G>A	ENST00000264448.6	+	8	2932	c.2821G>A	c.(2821-2823)Gcc>Acc	p.A941T	ALMS1_ENST00000409009.1_Missense_Mutation_p.A899T|ALMS1_ENST00000377715.1_Missense_Mutation_p.A941T	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	941	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TGTATTGGCTGCCCAGAAGAC	0.468																																					p.A941T		.											.	ALMS1	142	0			c.G2821A						.						73.0	72.0	73.0					2																	73676478		1850	4105	5955	SO:0001583	missense	7840	exon8			TTGGCTGCCCAGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.2821G>A	2.37:g.73676478G>A	ENSP00000264448:p.Ala941Thr	185.0	0.0		254.0	93.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	8.670	0.902547	0.17760	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.14766	3.36;3.36;2.48	3.64	0.665	0.17896	.	.	.	.	.	T	0.07773	0.0195	N	0.22421	0.69	0.09310	N	1	B;B;B	0.22003	0.056;0.029;0.063	B;B;B	0.18263	0.021;0.01;0.006	T	0.34950	-0.9808	9	0.49607	T	0.09	.	2.5172	0.04671	0.1093:0.1846:0.5161:0.19	.	941;899;941	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	T	899;941;941	ENSP00000386627:A899T;ENSP00000264448:A941T;ENSP00000366944:A941T	ENSP00000264448:A941T	A	+	1	0	ALMS1	73529986	0.000000	0.05858	0.002000	0.10522	0.030000	0.12068	0.304000	0.19228	0.115000	0.18071	0.591000	0.81541	GCC	.		0.468	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ARID2	196528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	46246151	46246151	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr12:46246151T>G	ENST00000334344.6	+	15	4417	c.4245T>G	c.(4243-4245)atT>atG	p.I1415M	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.I1266M|ARID2_ENST00000457135.1_Missense_Mutation_p.I23M|ARID2_ENST00000444670.1_Missense_Mutation_p.I1025M	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1415					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TAGAAAGAATTTCTAATGGAC	0.408			"""N, S, F"""		hepatocellular carcinoma																																p.I1415M		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	100	0			c.T4245G						.						79.0	80.0	80.0					12																	46246151		2203	4299	6502	SO:0001583	missense	196528	exon15			AAGAATTTCTAAT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4245T>G	12.37:g.46246151T>G	ENSP00000335044:p.Ile1415Met	163.0	0.0		155.0	63.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	37	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	T	9.550	1.115563	0.20795	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T	0.34472	1.36	6.07	6.07	0.98685	.	0.215200	0.49305	D	0.000154	T	0.30792	0.0776	N	0.19112	0.55	0.30985	N	0.722054	B;B;B	0.32526	0.374;0.374;0.087	B;B;B	0.36186	0.219;0.219;0.033	T	0.40384	-0.9566	10	0.72032	D	0.01	-3.99	16.6288	0.85011	0.0:0.0:0.0:1.0	.	1415;1025;1415	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	M	1415;532;532;1266;1025;23	ENSP00000335044:I1415M	ENSP00000335044:I1415M	I	+	3	3	ARID2	44532418	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.569000	0.45973	2.326000	0.78906	0.533000	0.62120	ATT	.		0.408	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ATP2B4	493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	203683382	203683382	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr1:203683382A>C	ENST00000357681.5	+	15	3506	c.2383A>C	c.(2383-2385)Aaa>Caa	p.K795Q	ATP2B4_ENST00000391954.2_Missense_Mutation_p.K795Q|ATP2B4_ENST00000367219.3_Missense_Mutation_p.K783Q|ATP2B4_ENST00000341360.2_Missense_Mutation_p.K795Q|ATP2B4_ENST00000367218.3_Missense_Mutation_p.K795Q	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	795					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGCTCTGAAGAAAGCGGATGT	0.547																																					p.K795Q		.											.	ATP2B4	517	0			c.A2383C						.						211.0	172.0	186.0					1																	203683382		2203	4300	6503	SO:0001583	missense	493	exon15			CTGAAGAAAGCGG	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.2383A>C	1.37:g.203683382A>C	ENSP00000350310:p.Lys795Gln	42.0	0.0		60.0	28.0	NM_001001396	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.029626	0.93518	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82	5.7	5.7	0.88788	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000016	D	0.96476	0.8850	L	0.43646	1.37	0.80722	D	1	D;D;D	0.89917	1.0;0.991;0.997	D;D;D	0.77004	0.989;0.955;0.953	D	0.97130	0.9817	10	0.72032	D	0.01	-24.7161	15.636	0.76953	1.0:0.0:0.0:0.0	.	795;795;795	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	Q	795;795;783;795;795	ENSP00000350310:K795Q;ENSP00000356187:K795Q;ENSP00000356188:K783Q;ENSP00000375816:K795Q;ENSP00000340930:K795Q	ENSP00000340930:K795Q	K	+	1	0	ATP2B4	201950005	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.518000	0.81795	2.168000	0.68352	0.533000	0.62120	AAA	.		0.547	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	
BCL6	604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	187447680	187447680	+	Silent	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr3:187447680G>A	ENST00000406870.2	-	5	879	c.513C>T	c.(511-513)agC>agT	p.S171S	BCL6_ENST00000450123.2_Silent_p.S171S|RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000232014.4_Silent_p.S171S|RP11-211G3.3_ENST00000437407.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	171					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		ACCCAGGGGCGCTCCTCAGTG	0.602			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.S171S		.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	848	0			c.C513T						.						74.0	73.0	73.0					3																	187447680		2203	4300	6503	SO:0001819	synonymous_variant	604	exon4			AGGGGCGCTCCTC		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.513C>T	3.37:g.187447680G>A		72.0	0.0		36.0	34.0	NM_001134738	A7E241|B8PSA7|D3DNV5	Silent	SNP	ENST00000406870.2	37	CCDS3289.1																																																																																			.		0.602	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
C11orf40	143501	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	4592676	4592676	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:4592676T>C	ENST00000307616.1	-	4	630	c.631A>G	c.(631-633)Aac>Gac	p.N211D		NM_144663.1	NP_653264.1	Q8WZ69	CK040_HUMAN	chromosome 11 open reading frame 40	211										large_intestine(3)|lung(1)|ovary(2)|stomach(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;4.28e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		ttcaagtagttcacatccaca	0.403																																					p.N211D		.											.	C11orf40	92	0			c.A631G						.						85.0	75.0	78.0					11																	4592676		2021	3886	5907	SO:0001583	missense	143501	exon4			AGTAGTTCACATC		CCDS31354.1	11p15.5	2005-10-03			ENSG00000171987	ENSG00000171987			23986	protein-coding gene	gene with protein product							Standard	NM_144663		Approved	NOV1	uc010qyg.2	Q8WZ69	OTTHUMG00000165345	ENST00000307616.1:c.631A>G	11.37:g.4592676T>C	ENSP00000302918:p.Asn211Asp	72.0	0.0		73.0	15.0	NM_144663		Missense_Mutation	SNP	ENST00000307616.1	37	CCDS31354.1	.	.	.	.	.	.	.	.	.	.	T	4.332	0.061047	0.08339	.	.	ENSG00000171987	ENST00000307616	T	0.52295	0.67	0.56	-1.09	0.09904	.	.	.	.	.	T	0.22627	0.0546	N	0.08118	0	0.09310	N	1	P	0.49961	0.93	B	0.40444	0.329	T	0.14615	-1.0466	8	0.87932	D	0	.	.	.	.	.	211	Q8WZ69	CK040_HUMAN	D	211	ENSP00000302918:N211D	ENSP00000302918:N211D	N	-	1	0	C11orf40	4549252	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	-0.115000	0.10741	-0.501000	0.06605	0.155000	0.16302	AAC	.		0.403	C11orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383529.1	NM_144663	
C3	718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6714382	6714382	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:6714382C>T	ENST00000245907.6	-	5	672	c.580G>A	c.(580-582)Gac>Aac	p.D194N		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	194					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	TCCGGAATGTCCCAAGACAAG	0.607																																					p.D194N		.											.	C3	95	0			c.G580A						.						73.0	67.0	69.0					19																	6714382		2203	4300	6503	SO:0001583	missense	718	exon5			GAATGTCCCAAGA	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.580G>A	19.37:g.6714382C>T	ENSP00000245907:p.Asp194Asn	79.0	0.0		101.0	56.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	37	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	c	0.011	-1.729245	0.00687	.	.	ENSG00000125730	ENST00000245907	T	0.73469	-0.75	5.04	-0.986	0.10252	Alpha-2-macroglobulin, N-terminal (1);	1.017600	0.07807	N	0.957490	T	0.40423	0.1116	N	0.02192	-0.645	0.09310	N	0.999995	B	0.02656	0.0	B	0.09377	0.004	T	0.21690	-1.0238	10	0.10902	T	0.67	.	1.567	0.02606	0.1595:0.3682:0.1641:0.3082	.	194	P01024	CO3_HUMAN	N	194	ENSP00000245907:D194N	ENSP00000245907:D194N	D	-	1	0	C3	6665382	0.781000	0.28676	0.532000	0.27989	0.082000	0.17680	-0.530000	0.06179	-0.318000	0.08665	-0.482000	0.04802	GAC	.		0.607	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
C4B	721	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	31997490	31997490	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr6:31997490A>C	ENST00000435363.2	+	29	3908	c.3824A>C	c.(3823-3825)cAc>cCc	p.H1275P	C4B_ENST00000425700.2_Missense_Mutation_p.H1275P|C4B-AS1_ENST00000415626.1_RNA	NM_001002029.3	NP_001002029.3	P0C0L5	CO4B_HUMAN	complement component 4B (Chido blood group)	1275					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|detection of molecule of bacterial origin (GO:0032490)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|complement binding (GO:0001848)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	CTCCTGCTTCACGAGGGCAAA	0.672																																					p.H1275P		.											.	C4A	44	0			c.A3824C						.						65.0	63.0	64.0					6																	31997490		1507	2704	4211	SO:0001583	missense	720	exon29			TGCTTCACGAGGG	AF019413	CCDS47405.1	6p21.3	2014-09-17	2009-01-06		ENSG00000224389	ENSG00000224389		"""Blood group antigens"", ""Complement system"""	1324	protein-coding gene	gene with protein product		120820	"""complement component 4B"""				Standard	NM_001002029		Approved	CPAMD3, C4F, CO4, C4B1, C4B3, CH	uc011jpm.2	P0C0L5	OTTHUMG00000031187	ENST00000435363.2:c.3824A>C	6.37:g.31997490A>C	ENSP00000415941:p.His1275Pro	293.0	0.0		283.0	60.0	NM_007293	A2BHY4|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q6U2E9|Q6U2G1|Q6U2I5|Q6U2L1|Q6U2L7|Q6U2L9|Q6U2M5|Q6VCV8|Q96SA7|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	ENST00000435363.2	37	CCDS47405.1	.	.	.	.	.	.	.	.	.	.	A	7.451	0.642632	0.14451	.	.	ENSG00000224389	ENST00000435363;ENST00000425700	T;T	0.14022	2.54;2.54	4.76	1.77	0.24775	.	.	.	.	.	T	0.03053	0.0090	N	0.25426	0.745	0.09310	N	1	P;B	0.36874	0.572;0.371	B;B	0.37480	0.251;0.188	T	0.39440	-0.9614	9	0.51188	T	0.08	.	4.2371	0.10630	0.2186:0.1888:0.5926:0.0	.	1275;1275	F5GXS0;Q6U2E9	.;.	P	1275	ENSP00000415941:H1275P;ENSP00000391933:H1275P	ENSP00000391933:H1275P	H	+	2	0	C4B	32105469	0.118000	0.22208	0.003000	0.11579	0.096000	0.18686	0.947000	0.29082	0.423000	0.26033	-0.515000	0.04445	CAC	.		0.672	C4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076368.5	NM_001002029	
C9	735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	39308341	39308341	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:39308341C>T	ENST00000263408.4	-	8	1326	c.1231G>A	c.(1231-1233)Ggt>Agt	p.G411S		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	411	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			CCAGCTCTACCCTCTCCCCTC	0.428																																					p.G411S		.											.	C9	90	0			c.G1231A						.						148.0	140.0	143.0					5																	39308341		2203	4300	6503	SO:0001583	missense	735	exon8			CTCTACCCTCTCC		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.1231G>A	5.37:g.39308341C>T	ENSP00000263408:p.Gly411Ser	324.0	0.0		287.0	119.0	NM_001737		Missense_Mutation	SNP	ENST00000263408.4	37	CCDS3929.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.763873	0.31228	.	.	ENSG00000113600	ENST00000263408	D	0.83250	-1.7	4.73	-1.48	0.08745	Membrane attack complex component/perforin (MACPF) domain (3);	0.814956	0.11679	N	0.540023	T	0.72510	0.3469	L	0.54323	1.7	0.09310	N	1	B	0.30068	0.267	B	0.30495	0.116	T	0.56074	-0.8039	10	0.12766	T	0.61	-4.6242	5.2386	0.15460	0.0:0.2925:0.1646:0.5429	.	411	P02748	CO9_HUMAN	S	411	ENSP00000263408:G411S	ENSP00000263408:G411S	G	-	1	0	C9	39344098	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.392000	0.07314	-0.204000	0.10235	0.585000	0.79938	GGT	.		0.428	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211576.3		
C5orf34	375444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	43492341	43492341	+	Missense_Mutation	SNP	A	A	G	rs145050535		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:43492341A>G	ENST00000306862.2	-	10	1931	c.1556T>C	c.(1555-1557)aTt>aCt	p.I519T	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	519										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					AGGGTGTTCAATCTGAATTAA	0.289																																					p.I519T		.											.	C5orf34	153	0			c.T1556C						.	A	THR/ILE	0,4406		0,0,2203	91.0	87.0	88.0		1556	2.3	0.9	5	dbSNP_134	88	1,8585	1.2+/-3.3	0,1,4292	no	missense	C5orf34	NM_198566.2	89	0,1,6495	GG,GA,AA		0.0116,0.0,0.0077	benign	519/639	43492341	1,12991	2203	4293	6496	SO:0001583	missense	375444	exon10			TGTTCAATCTGAA	AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.1556T>C	5.37:g.43492341A>G	ENSP00000303490:p.Ile519Thr	414.0	0.0		429.0	181.0	NM_198566		Missense_Mutation	SNP	ENST00000306862.2	37	CCDS3946.1	.	.	.	.	.	.	.	.	.	.	A	7.731	0.699214	0.15106	0.0	1.16E-4	ENSG00000172244	ENST00000306862	T	0.53206	0.63	5.98	2.33	0.28932	.	0.438058	0.24907	N	0.034648	T	0.29158	0.0725	N	0.22421	0.69	0.27320	N	0.95707	B	0.14805	0.011	B	0.13407	0.009	T	0.15694	-1.0428	10	0.26408	T	0.33	-1.963	7.6583	0.28388	0.7445:0.0:0.2555:0.0	.	519	Q96MH7	CE034_HUMAN	T	519	ENSP00000303490:I519T	ENSP00000303490:I519T	I	-	2	0	C5orf34	43528098	0.982000	0.34865	0.931000	0.37212	0.392000	0.30506	2.113000	0.41902	0.167000	0.19631	-0.263000	0.10527	ATT	A|1.000;G|0.000		0.289	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253843.1	NM_198566	
CACNG1	786	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65040955	65040955	+	Missense_Mutation	SNP	G	G	A	rs551549167		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr17:65040955G>A	ENST00000226021.3	+	1	250	c.179G>A	c.(178-180)cGc>cAc	p.R60H		NM_000727.3	NP_000718.1	Q06432	CCG1_HUMAN	calcium channel, voltage-dependent, gamma subunit 1	60					muscle contraction (GO:0006936)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transport (GO:0006810)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	8	all_cancers(12;1.04e-10)|Breast(2;1.45e-16)|all_epithelial(3;4.81e-12)				Diltiazem(DB00343)|Fluspirilene(DB04842)|Ibutilide(DB00308)|Lercanidipine(DB00528)|Magnesium Sulfate(DB00653)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TGTACCAAGCGCATCCCCATG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		16468	0.0		0.0	False		,,,				2504	0.001				p.R60H		.											.	CACNG1	90	0			c.G179A						.						68.0	60.0	63.0					17																	65040955		2203	4300	6503	SO:0001583	missense	786	exon1			CCAAGCGCATCCC	L07738	CCDS11668.1	17q24	2008-05-02				ENSG00000108878		"""Calcium channel subunits"""	1405	protein-coding gene	gene with protein product		114209		CACNLG		8395940	Standard	NM_000727		Approved		uc002jfu.3	Q06432		ENST00000226021.3:c.179G>A	17.37:g.65040955G>A	ENSP00000226021:p.Arg60His	25.0	1.0		31.0	11.0	NM_000727	B2R9N3|Q14D59	Missense_Mutation	SNP	ENST00000226021.3	37	CCDS11668.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830624	0.71258	.	.	ENSG00000108878	ENST00000226021	T	0.69926	-0.44	5.44	4.45	0.53987	.	0.333579	0.25377	N	0.031113	T	0.60196	0.2250	L	0.46614	1.455	0.23391	N	0.997771	B	0.17465	0.022	B	0.15484	0.013	T	0.54689	-0.8256	10	0.49607	T	0.09	.	13.6236	0.62150	0.0:0.0:0.8448:0.1552	.	60	Q06432	CCG1_HUMAN	H	60	ENSP00000226021:R60H	ENSP00000226021:R60H	R	+	2	0	CACNG1	62471417	0.041000	0.20044	0.696000	0.30242	0.993000	0.82548	0.886000	0.28241	1.244000	0.43870	0.591000	0.81541	CGC	.		0.657	CACNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447039.1		
CALCOCO1	57658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	54118936	54118936	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr12:54118936C>A	ENST00000550804.1	-	2	151	c.91G>T	c.(91-93)Gaa>Taa	p.E31*	CALCOCO1_ENST00000547885.1_5'UTR|CALCOCO1_ENST00000262059.4_Nonsense_Mutation_p.E31*|CALCOCO1_ENST00000430117.2_Nonsense_Mutation_p.E31*|CALCOCO1_ENST00000548263.1_Nonsense_Mutation_p.E31*			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	31	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						TAGTGACATTCCACCTTGGTG	0.542																																					p.E31X		.											.	CALCOCO1	91	0			c.G91T						.						208.0	163.0	178.0					12																	54118936		2203	4300	6503	SO:0001587	stop_gained	57658	exon2			GACATTCCACCTT	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.91G>T	12.37:g.54118936C>A	ENSP00000449960:p.Glu31*	117.0	0.0		135.0	58.0	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Nonsense_Mutation	SNP	ENST00000550804.1	37	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	C	39	7.299316	0.98196	.	.	ENSG00000012822	ENST00000430117;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000551900;ENST00000546619;ENST00000547949;ENST00000553154;ENST00000549784;ENST00000549173;ENST00000548177;ENST00000552623;ENST00000549349;ENST00000549688;ENST00000547885;ENST00000548431	.	.	.	4.86	3.97	0.46021	.	0.000000	0.46758	D	0.000280	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-11.3184	12.6432	0.56720	0.0:0.9181:0.0:0.0819	.	.	.	.	X	31	.	ENSP00000262059:E31X	E	-	1	0	CALCOCO1	52405203	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.098000	0.71458	1.428000	0.47296	0.655000	0.94253	GAA	.		0.542	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
CCDC146	57639	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	76796998	76796998	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:76796998A>G	ENST00000285871.4	+	2	140	c.13A>G	c.(13-15)Agc>Ggc	p.S5G	CCDC146_ENST00000431197.1_5'UTR|RP11-467H10.2_ENST00000459742.1_RNA	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	5										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GGAAGACAGTAGCACAGACAC	0.328																																					p.S5G		.											.	CCDC146	70	0			c.A13G						.						36.0	37.0	37.0					7																	76796998		2203	4298	6501	SO:0001583	missense	57639	exon2			GACAGTAGCACAG	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.13A>G	7.37:g.76796998A>G	ENSP00000285871:p.Ser5Gly	492.0	0.0		486.0	155.0	NM_020879	A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	37	CCDS34671.1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.841273	0.32513	.	.	ENSG00000135205	ENST00000415750;ENST00000285871	D;D	0.85411	-1.98;-1.98	4.07	-1.77	0.07982	.	1.474430	0.04140	N	0.319323	T	0.66177	0.2763	N	0.03608	-0.345	0.22639	N	0.998905	B;B	0.21606	0.03;0.058	B;B	0.22601	0.025;0.04	T	0.57201	-0.7852	10	0.56958	D	0.05	0.0615	2.373	0.04335	0.4119:0.0:0.2209:0.3672	.	5;5	Q8IYE0;C9JRR4	CC146_HUMAN;.	G	5	ENSP00000388649:S5G;ENSP00000285871:S5G	ENSP00000285871:S5G	S	+	1	0	AC007000.1	76634934	0.001000	0.12720	0.368000	0.25939	0.963000	0.63663	-0.411000	0.07142	-0.062000	0.13088	0.372000	0.22366	AGC	.		0.328	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
CCR2	729230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46399400	46399400	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr3:46399400A>G	ENST00000400888.2	+	1	421	c.382A>G	c.(382-384)Atc>Gtc	p.I128V	CCR2_ENST00000292301.4_Missense_Mutation_p.I128V|CCR2_ENST00000465202.1_Intron|CCR2_ENST00000445132.2_Missense_Mutation_p.I128V			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	128					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		TTTTGGCGGAATCTTCTTCAT	0.468																																					p.I128V		.											.	CCR2	568	0			c.A382G						.						424.0	381.0	394.0					3																	46399400		1568	3582	5150	SO:0001583	missense	729230	exon2			GGCGGAATCTTCT		CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.382A>G	3.37:g.46399400A>G	ENSP00000383681:p.Ile128Val	178.0	0.0		180.0	82.0	NM_001123041	A0AVQ3|B2RMT0|Q4VBL2	Missense_Mutation	SNP	ENST00000400888.2	37	CCDS43078.1	.	.	.	.	.	.	.	.	.	.	A	12.80	2.045269	0.36085	.	.	ENSG00000121807	ENST00000445132;ENST00000292301;ENST00000400888	T;T;T	0.73789	-0.78;-0.78;-0.78	4.57	2.15	0.27550	GPCR, rhodopsin-like superfamily (1);	0.453694	0.21544	N	0.072851	T	0.68458	0.3003	L	0.51422	1.61	0.40235	D	0.977895	B;B	0.23650	0.078;0.089	B;B	0.31869	0.1;0.137	T	0.66956	-0.5792	10	0.59425	D	0.04	.	9.1994	0.37249	0.8409:0.0:0.1591:0.0	.	128;128	P41597;Q4VBL2	CCR2_HUMAN;.	V	128	ENSP00000399285:I128V;ENSP00000292301:I128V;ENSP00000383681:I128V	ENSP00000292301:I128V	I	+	1	0	CCR2	46374404	0.700000	0.27796	0.323000	0.25347	0.931000	0.56810	3.603000	0.54074	0.726000	0.32339	0.528000	0.53228	ATC	.		0.468	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344292.1	NM_000647	
CD4	920	broad.mit.edu;bcgsc.ca	37	12	6926465	6926465	+	Silent	SNP	G	G	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr12:6926465G>C	ENST00000011653.4	+	7	1383	c.1125G>C	c.(1123-1125)tcG>tcC	p.S375S		NM_000616.4|NM_001195015.2|NM_001195016.2|NM_001195017.2	NP_000607.1|NP_001181944.1|NP_001181945.1|NP_001181946.1	P01730	CD4_HUMAN	CD4 molecule	375					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cytokine production (GO:0001816)|defense response to Gram-negative bacterium (GO:0050829)|entry into host cell (GO:0030260)|enzyme linked receptor protein signaling pathway (GO:0007167)|immune response (GO:0006955)|induction by virus of host cell-cell fusion (GO:0006948)|innate immune response (GO:0045087)|maintenance of protein location in cell (GO:0032507)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase activity (GO:0045860)|protein palmitoleylation (GO:0045234)|regulation of defense response to virus by virus (GO:0050690)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|T cell selection (GO:0045058)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|enzyme binding (GO:0019899)|extracellular matrix structural constituent (GO:0005201)|glycoprotein binding (GO:0001948)|MHC class II protein binding (GO:0042289)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	23		Myeloproliferative disorder(1001;0.0122)			Antithymocyte globulin(DB00098)	TGAGTGACTCGGGACAGGTCC	0.602																																					p.S375S		.											.	CD4	90	0			c.G1125C						.						65.0	54.0	58.0					12																	6926465		2198	4295	6493	SO:0001819	synonymous_variant	920	exon7			TGACTCGGGACAG	M35160	CCDS8562.1	12p13.31	2013-01-11	2006-03-28		ENSG00000010610	ENSG00000010610		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1678	protein-coding gene	gene with protein product		186940	"""CD4 antigen (p55)"", ""T-cell surface glycoprotein CD4"""				Standard	NM_000616		Approved		uc001qqv.2	P01730	OTTHUMG00000168514	ENST00000011653.4:c.1125G>C	12.37:g.6926465G>C		75.0	0.0		69.0	9.0	NM_000616	B2R737|D3DUS5|Q4ZGK2|Q5U066|Q9UDE5	Silent	SNP	ENST00000011653.4	37	CCDS8562.1																																																																																			.		0.602	CD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399978.1	NM_000616	
CD5	921	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	60882526	60882526	+	Splice_Site	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:60882526A>G	ENST00000347785.3	+	2	221		c.e2-1			NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule						apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		TTCTTTCTGCAGTCGCTTCCT	0.607																																					.		.											.	CD5	91	0			c.56-2A>G						.						35.0	33.0	33.0					11																	60882526		2196	4287	6483	SO:0001630	splice_region_variant	921	exon2			TTCTGCAGTCGCT	X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.56-1A>G	11.37:g.60882526A>G		25.0	1.0		23.0	14.0	NM_014207	A0N0P4|A8K9I3	Splice_Site	SNP	ENST00000347785.3	37	CCDS8000.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.471086	0.43942	.	.	ENSG00000110448	ENST00000347785;ENST00000544014	.	.	.	3.1	3.1	0.35709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0475	0.30557	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD5	60639102	0.970000	0.33590	0.614000	0.29051	0.396000	0.30629	2.124000	0.42006	1.688000	0.51068	0.449000	0.29647	.	.		0.607	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396465.2	NM_014207	Intron
CD9	928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6342629	6342629	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr12:6342629T>G	ENST00000382518.1	+	5	761	c.325T>G	c.(325-327)Tgg>Ggg	p.W109G	Y_RNA_ENST00000365448.1_RNA|CD9_ENST00000009180.4_Missense_Mutation_p.W109G|CD9_ENST00000382515.2_Missense_Mutation_p.W40G|CD9_ENST00000481267.1_3'UTR			P21926	CD9_HUMAN	CD9 molecule	109					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						TGCGGCCATCTGGGGATATTC	0.562																																					p.W109G		.											.	CD9	91	0			c.T325G						.						125.0	112.0	117.0					12																	6342629		2203	4300	6503	SO:0001583	missense	928	exon4			GCCATCTGGGGAT	M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.325T>G	12.37:g.6342629T>G	ENSP00000371958:p.Trp109Gly	93.0	0.0		83.0	41.0	NM_001769	D3DUQ9|Q5J7W6|Q96ES4	Missense_Mutation	SNP	ENST00000382518.1	37	CCDS8540.1	.	.	.	.	.	.	.	.	.	.	T	16.24	3.066123	0.55539	.	.	ENSG00000010278	ENST00000382518;ENST00000536586;ENST00000382519;ENST00000425469;ENST00000543424;ENST00000009180;ENST00000382515	T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26	5.87	5.87	0.94306	.	0.049531	0.85682	D	0.000000	D	0.90188	0.6933	M	0.91354	3.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92157	0.5733	10	0.87932	D	0	.	14.2221	0.65833	0.0:0.0:0.0:1.0	.	109;109	B4DK09;P21926	.;CD9_HUMAN	G	109;109;132;109;22;109;40	ENSP00000371958:W109G;ENSP00000440985:W109G;ENSP00000371959:W132G;ENSP00000009180:W109G;ENSP00000371955:W40G	ENSP00000009180:W109G	W	+	1	0	CD9	6212890	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.121000	0.77160	2.248000	0.74166	0.533000	0.62120	TGG	.		0.562	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103348.1		
CHMP6	79643	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	78968447	78968447	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr17:78968447G>T	ENST00000325167.5	+	2	208	c.130G>T	c.(130-132)Gag>Tag	p.E44*		NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	44					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)			lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCTGGAGCGCGAGCGCGCCCT	0.716																																					p.E44X		.											.	CHMP6	91	0			c.G130T						.						16.0	13.0	14.0					17																	78968447		2159	4266	6425	SO:0001587	stop_gained	79643	exon2			GAGCGCGAGCGCG	BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.130G>T	17.37:g.78968447G>T	ENSP00000317468:p.Glu44*	63.0	0.0		79.0	33.0	NM_024591	A8K7U0|Q53FU4|Q9HAE8	Nonsense_Mutation	SNP	ENST00000325167.5	37	CCDS11774.1	.	.	.	.	.	.	.	.	.	.	.	38	6.806771	0.97853	.	.	ENSG00000176108	ENST00000325167	.	.	.	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-1.9258	14.78	0.69760	0.0:0.0:1.0:0.0	.	.	.	.	X	44	.	ENSP00000317468:E44X	E	+	1	0	CHMP6	76583042	1.000000	0.71417	0.951000	0.38953	0.886000	0.51366	7.035000	0.76517	1.987000	0.57996	0.511000	0.50034	GAG	.		0.716	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438215.1	NM_024591	
CHST11	50515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	105151023	105151023	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr12:105151023C>A	ENST00000303694.5	+	3	940	c.501C>A	c.(499-501)taC>taA	p.Y167*	CHST11_ENST00000549260.1_Nonsense_Mutation_p.Y162*	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	167					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						TGAACCAGTACAGCATCCCAG	0.572																																					p.Y167X		.											.	CHST11	90	0			c.C501A						.						73.0	68.0	70.0					12																	105151023		2203	4300	6503	SO:0001587	stop_gained	50515	exon3			CCAGTACAGCATC	AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.501C>A	12.37:g.105151023C>A	ENSP00000305725:p.Tyr167*	65.0	0.0		71.0	31.0	NM_018413	A8K4F8|Q9NXY6|Q9NY36	Nonsense_Mutation	SNP	ENST00000303694.5	37	CCDS9099.1	.	.	.	.	.	.	.	.	.	.	C	37	6.197700	0.97367	.	.	ENSG00000171310	ENST00000549260;ENST00000303694;ENST00000549016	.	.	.	5.42	3.58	0.41010	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9522	12.4791	0.55831	0.0:0.8619:0.0:0.1381	.	.	.	.	X	162;167;127	.	ENSP00000305725:Y167X	Y	+	3	2	CHST11	103675153	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.980000	0.63812	1.312000	0.45043	-0.123000	0.14984	TAC	.		0.572	CHST11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405960.2	NM_018413	
CHURC1	91612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	65398946	65398946	+	Nonstop_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr14:65398946T>C	ENST00000549115.1	+	4	472	c.418T>C	c.(418-420)Taa>Caa	p.*140Q	FNTB_ENST00000542227.1_Intron|CHURC1_ENST00000552002.2_Nonstop_Mutation_p.*113Q|CHURC1-FNTB_ENST00000549987.1_Intron|CHURC1_ENST00000607599.1_Nonstop_Mutation_p.*141Q|CHURC1_ENST00000548752.2_3'UTR|CHURC1_ENST00000359118.2_Nonstop_Mutation_p.*114Q|FNTB_ENST00000447296.2_Intron			Q8WUH1	CHUR_HUMAN	churchill domain containing 1	0					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)		zinc ion binding (GO:0008270)			breast(1)|pancreas(1)	2				all cancers(60;0.00119)|OV - Ovarian serous cystadenocarcinoma(108;0.0056)|BRCA - Breast invasive adenocarcinoma(234;0.00976)		TCTCTTATTCTAAGGATCCTT	0.388																																					p.X141Q		.											.	CHURC1	91	0			c.T421C						.						106.0	99.0	101.0					14																	65398946		2203	4300	6503	SO:0001578	stop_lost	91612	exon4			TTATTCTAAGGAT	AF060510	CCDS32101.1, CCDS32101.2, CCDS55921.1, CCDS55922.1	14q23.3	2011-09-28	2004-05-05	2004-05-07	ENSG00000258289	ENSG00000258289			20099	protein-coding gene	gene with protein product		608577		C14orf52			Standard	NM_145165		Approved	My015, FLJ33064		Q8WUH1	OTTHUMG00000170218	ENST00000549115.1:c.418T>C	14.37:g.65398946T>C	ENSP00000448050:p.*140Glnext*20	109.0	0.0		131.0	31.0	NM_145165	B3KQ81|G3V1X3|G3V214|Q9H3K7	Missense_Mutation	SNP	ENST00000549115.1	37	CCDS55921.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263736	0.80358	.	.	ENSG00000258289	ENST00000552002;ENST00000549115;ENST00000359118	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8268	0.63354	0.0:0.0:0.0:1.0	.	.	.	.	Q	141;140;114	.	.	X	+	1	0	CHURC1	64468699	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	7.215000	0.77966	2.251000	0.74343	0.533000	0.62120	TAA	.		0.388	CHURC1-002	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408062.1	NM_145165	
CYP2R1	120227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	14902228	14902228	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:14902228T>G	ENST00000334636.5	-	3	500	c.454A>C	c.(454-456)Aag>Cag	p.K152Q	CYP2R1_ENST00000532378.1_Intron|CYP2R1_ENST00000526489.1_5'UTR	NM_024514.4	NP_078790.2	Q6VVX0	CP2R1_HUMAN	cytochrome P450, family 2, subfamily R, polypeptide 1	152					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14					Cholecalciferol(DB00169)|Ergocalciferol(DB00153)	TCAAAAGACTTTTGGCCATAT	0.328																																					p.K152Q	NSCLC(173;1584 2058 26117 29365 41534)	.											.	CYP2R1	91	0			c.A454C						.						47.0	49.0	48.0					11																	14902228		2196	4293	6489	SO:0001583	missense	120227	exon3			AAGACTTTTGGCC	AY323817	CCDS7818.1	11p15.2	2008-02-05			ENSG00000186104	ENSG00000186104		"""Cytochrome P450s"""	20580	protein-coding gene	gene with protein product		608713				12464240, 12867411	Standard	XM_005252788		Approved		uc001mlr.3	Q6VVX0	OTTHUMG00000165900	ENST00000334636.5:c.454A>C	11.37:g.14902228T>G	ENSP00000334592:p.Lys152Gln	121.0	0.0		141.0	60.0	NM_024514	Q2M3H3|Q5RT65	Missense_Mutation	SNP	ENST00000334636.5	37	CCDS7818.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.890731	0.52014	.	.	ENSG00000186104	ENST00000334636	T	0.68765	-0.35	5.9	5.9	0.94986	.	0.133325	0.64402	D	0.000003	T	0.61035	0.2315	L	0.42008	1.315	0.40586	D	0.981449	P;B	0.45212	0.853;0.064	B;B	0.39562	0.303;0.059	T	0.67063	-0.5765	10	0.59425	D	0.04	.	16.3196	0.82941	0.0:0.0:0.0:1.0	.	37;152	E9PS56;Q6VVX0	.;CP2R1_HUMAN	Q	152	ENSP00000334592:K152Q	ENSP00000334592:K152Q	K	-	1	0	CYP2R1	14858804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.254000	0.51477	2.248000	0.74166	0.459000	0.35465	AAG	.		0.328	CYP2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386985.1	NM_024514	
DMKN	93099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35992755	35992755	+	Intron	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:35992755G>A	ENST00000339686.3	-	11	1416				DMKN_ENST00000462126.1_Intron|DMKN_ENST00000443640.1_Intron|DMKN_ENST00000480502.1_Intron|DMKN_ENST00000402589.2_Intron|DMKN_ENST00000492341.2_Intron|DMKN_ENST00000419602.1_Intron|DMKN_ENST00000429837.1_Intron|DMKN_ENST00000436012.1_Intron|DMKN_ENST00000602781.1_Intron|DMKN_ENST00000467637.1_Intron|DMKN_ENST00000472252.2_Intron|DMKN_ENST00000414866.2_Intron|DMKN_ENST00000408915.2_Silent_p.G17G	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TCCAGGCCAGGCCCAGCAGGA	0.657																																					p.G17G		.											.	DMKN	155	0			c.C51T						.						22.0	29.0	26.0					19																	35992755		2112	4232	6344	SO:0001627	intron_variant	93099	exon1			GGCCAGGCCCAGC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1239+282C>T	19.37:g.35992755G>A		42.0	0.0		30.0	8.0	NM_001035516	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Silent	SNP	ENST00000339686.3	37	CCDS12463.1																																																																																			.		0.657	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13913898	13913898	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:13913898T>C	ENST00000265104.4	-	11	1594	c.1490A>G	c.(1489-1491)cAa>cGa	p.Q497R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	497	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGTGGAATCTTGCAGGACTGA	0.358									Kartagener syndrome																												p.Q497R		.											.	DNAH5	182	0			c.A1490G						.						121.0	127.0	125.0					5																	13913898		2203	4300	6503	SO:0001583	missense	1767	exon11	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GAATCTTGCAGGA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.1490A>G	5.37:g.13913898T>C	ENSP00000265104:p.Gln497Arg	102.0	0.0		112.0	59.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	10.63	1.404535	0.25378	.	.	ENSG00000039139	ENST00000265104	T	0.55234	0.53	5.67	4.5	0.54988	Dynein heavy chain, domain-1 (1);	0.121891	0.56097	D	0.000026	T	0.48696	0.1514	M	0.68593	2.085	0.41474	D	0.988128	B	0.02656	0.0	B	0.10450	0.005	T	0.40757	-0.9546	10	0.18276	T	0.48	.	11.821	0.52238	0.0:0.0692:0.0:0.9308	.	497	Q8TE73	DYH5_HUMAN	R	497	ENSP00000265104:Q497R	ENSP00000265104:Q497R	Q	-	2	0	DNAH5	13966898	1.000000	0.71417	0.996000	0.52242	0.803000	0.45373	3.486000	0.53215	0.970000	0.38263	0.455000	0.32223	CAA	.		0.358	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	111449457	111449457	+	Splice_Site	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:111449457T>C	ENST00000437633.1	-	29	3263	c.3007A>G	c.(3007-3009)Atc>Gtc	p.I1003V	DOCK4-AS1_ENST00000452714.1_RNA|DOCK4_ENST00000428084.1_Splice_Site_p.I1003V	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1003					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GAATCCCAGATCTAAAACAAG	0.363																																					p.I1003V		.											.	DOCK4	26	0			c.A3007G						.						49.0	44.0	45.0					7																	111449457		1855	4090	5945	SO:0001630	splice_region_variant	9732	exon29			CCCAGATCTAAAA		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.3007-1A>G	7.37:g.111449457T>C		70.0	0.0		50.0	30.0	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	T	7.010	0.556665	0.13436	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.38560	1.13;1.13	5.27	5.27	0.74061	.	0.051771	0.85682	D	0.000000	T	0.13030	0.0316	N	0.00280	-1.71	0.80722	D	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.08055	0.002;0.002;0.003	T	0.21314	-1.0249	10	0.16896	T	0.51	.	15.0222	0.71637	0.0:0.0:0.0:1.0	.	1039;1003;1003	Q149N5;Q8N1I0;Q8N1I0-2	.;DOCK4_HUMAN;.	V	991;1003;1003;991;1002	ENSP00000410746:I1003V;ENSP00000404179:I1003V	ENSP00000345432:I991V	I	-	1	0	DOCK4	111236693	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.072000	0.57563	2.200000	0.70718	0.455000	0.32223	ATC	.		0.363	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	Missense_Mutation
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2217014	2217014	+	Missense_Mutation	SNP	G	G	T	rs562099241		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:2217014G>T	ENST00000398665.3	+	21	2505	c.2469G>T	c.(2467-2469)atG>atT	p.M823I	AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	823					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGCAGCATGAAGCTGAGCC	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		18920	0.001		0.0	False		,,,				2504	0.0				p.M823I		.											.	DOT1L	132	0			c.G2469T						.						36.0	39.0	38.0					19																	2217014		2070	4198	6268	SO:0001583	missense	84444	exon21			CAGCATGAAGCTG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2469G>T	19.37:g.2217014G>T	ENSP00000381657:p.Met823Ile	68.0	0.0		49.0	21.0	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.019|0.019	-1.466184|-1.466184	0.01053|0.01053	.|.	.|.	ENSG00000104885|ENSG00000104885	ENST00000398665;ENST00000221482|ENST00000440640	T|.	0.20598|.	2.06|.	5.15|5.15	1.32|1.32	0.21799|0.21799	.|.	0.858231|.	0.10496|.	N|.	0.667812|.	T|.	0.11580|.	0.0282|.	N|N	0.01352|0.01352	-0.895|-0.895	0.21652|0.21652	N|N	0.999602|0.999602	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.0;0.001|.	T|.	0.27673|.	-1.0067|.	10|.	0.87932|.	D|.	0|.	-11.9448|-11.9448	10.0247|10.0247	0.42063|0.42063	0.1323:0.6922:0.1755:0.0|0.1323:0.6922:0.1755:0.0	.|.	823;823|.	Q8TEK3;Q8TEK3-2|.	DOT1L_HUMAN;.|.	I|L	823|610	ENSP00000381657:M823I|.	ENSP00000221482:M823I|.	M|X	+|+	3|2	0|2	DOT1L|DOT1L	2168014|2168014	0.994000|0.994000	0.37717|0.37717	0.754000|0.754000	0.31244|0.31244	0.251000|0.251000	0.25915|0.25915	0.233000|0.233000	0.17911|0.17911	0.409000|0.409000	0.25649|0.25649	0.655000|0.655000	0.94253|0.94253	ATG|TGA	.		0.672	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
DPP6	1804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	154645526	154645526	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:154645526C>G	ENST00000377770.3	+	17	1844	c.1703C>G	c.(1702-1704)aCa>aGa	p.T568R	RP11-476H24.1_ENST00000448767.1_RNA|DPP6_ENST00000332007.3_Missense_Mutation_p.T506R|DPP6_ENST00000404039.1_Missense_Mutation_p.T504R|DPP6_ENST00000427557.1_Missense_Mutation_p.T461R			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	568					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CACAACACAACAGATAAGAAA	0.433																																					p.T568R	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6	652	0			c.C1703G						.						177.0	157.0	163.0					7																	154645526		1880	4112	5992	SO:0001583	missense	1804	exon17			ACACAACAGATAA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1703C>G	7.37:g.154645526C>G	ENSP00000367001:p.Thr568Arg	113.0	0.0		103.0	35.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	C	0.356	-0.941924	0.02322	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	4.47	3.58	0.41010	.	0.695408	0.14661	N	0.305954	T	0.22282	0.0537	L	0.40543	1.245	0.38510	D	0.948454	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.05750	-1.0866	10	0.11485	T	0.65	-0.0057	9.5442	0.39271	0.0:0.8986:0.0:0.1014	.	461;506;568;504	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	R	504;568;506;461	ENSP00000385578:T504R;ENSP00000367001:T568R;ENSP00000328226:T506R;ENSP00000397303:T461R	ENSP00000328226:T506R	T	+	2	0	DPP6	154276459	0.107000	0.21998	0.711000	0.30485	0.126000	0.20510	1.933000	0.40153	0.968000	0.38212	0.655000	0.94253	ACA	.		0.433	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
E2F3	1871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	20481488	20481488	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr6:20481488T>G	ENST00000346618.3	+	3	623	c.557T>G	c.(556-558)cTc>cGc	p.L186R	E2F3_ENST00000535432.1_Missense_Mutation_p.L55R	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	186					mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			CTTGGTCTGCTCACCAAGAAG	0.458																																					p.L186R		.											.	E2F3	414	0			c.T557G						.						97.0	99.0	98.0					6																	20481488		2203	4300	6503	SO:0001583	missense	1871	exon3			GTCTGCTCACCAA	Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.557T>G	6.37:g.20481488T>G	ENSP00000262904:p.Leu186Arg	69.0	0.0		57.0	25.0	NM_001949	Q15000|Q68DT0|Q9BZ44	Missense_Mutation	SNP	ENST00000346618.3	37	CCDS4545.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.861905	0.91433	.	.	ENSG00000112242	ENST00000378646;ENST00000346618;ENST00000535432	T;T	0.28255	1.62;1.96	5.98	5.98	0.97165	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.65133	0.2662	H	0.96943	3.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78147	-0.2317	10	0.66056	D	0.02	.	16.4622	0.84064	0.0:0.0:0.0:1.0	.	186;55	O00716;Q68DT0	E2F3_HUMAN;.	R	65;186;55	ENSP00000262904:L186R;ENSP00000443418:L55R	ENSP00000262904:L186R	L	+	2	0	E2F3	20589467	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.289000	0.77006	0.533000	0.62120	CTC	.		0.458	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043828.1		
EDEM2	55741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33703635	33703635	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr20:33703635G>C	ENST00000374492.3	-	11	1443	c.1338C>G	c.(1336-1338)ttC>ttG	p.F446L	EDEM2_ENST00000374491.3_Missense_Mutation_p.F409L|SNORD56_ENST00000364281.1_RNA|EDEM2_ENST00000541621.1_Missense_Mutation_p.F225L|EDEM2_ENST00000542871.1_Missense_Mutation_p.F170L	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2	446					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGTTGTGGATGAAGTTGGTTG	0.552																																					p.F446L	Esophageal Squamous(51;906 1021 24535 36410 39145)	.											.	EDEM2	90	0			c.C1338G						.						70.0	63.0	66.0					20																	33703635		2203	4300	6503	SO:0001583	missense	55741	exon11			GTGGATGAAGTTG	AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.1338C>G	20.37:g.33703635G>C	ENSP00000363616:p.Phe446Leu	149.0	0.0		150.0	65.0	NM_018217	B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Missense_Mutation	SNP	ENST00000374492.3	37	CCDS13247.1	.	.	.	.	.	.	.	.	.	.	G	11.22	1.573908	0.28092	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000541621;ENST00000542871	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	5.51	1.49	0.22878	.	0.043308	0.85682	D	0.000000	T	0.44222	0.1283	L	0.32530	0.975	0.80722	D	1	D;P;D	0.65815	0.994;0.909;0.995	D;P;D	0.66847	0.947;0.701;0.942	T	0.16689	-1.0394	10	0.20046	T	0.44	-23.8926	8.6765	0.34183	0.3519:0.0:0.6481:0.0	.	225;409;446	G3V1Q0;Q9BV94-2;Q9BV94	.;.;EDEM2_HUMAN	L	409;446;225;170	ENSP00000363615:F409L;ENSP00000363616:F446L;ENSP00000443528:F225L;ENSP00000441642:F170L	ENSP00000363615:F409L	F	-	3	2	EDEM2	33167296	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	2.880000	0.48530	0.159000	0.19401	0.561000	0.74099	TTC	.		0.552	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078842.2	NM_018217	
EHBP1L1	254102	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65359477	65359477	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:65359477G>T	ENST00000309295.4	+	18	4653	c.4388G>T	c.(4387-4389)cGa>cTa	p.R1463L	EHBP1L1_ENST00000529596.1_Intron|EHBP1L1_ENST00000533364.1_Missense_Mutation_p.R68L|AP001362.1_ENST00000597463.1_Silent_p.R115R	NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	1463						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CAGCAGCACCGAGAGCAGCTC	0.662																																					p.R1463L		.											.	EHBP1L1	69	0			c.G4388T						.						49.0	57.0	54.0					11																	65359477		2043	4177	6220	SO:0001583	missense	254102	exon18			AGCACCGAGAGCA	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.4388G>T	11.37:g.65359477G>T	ENSP00000312671:p.Arg1463Leu	57.0	0.0		56.0	25.0	NM_001099409	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	37	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847694	0.91277	.	.	ENSG00000173442	ENST00000309295;ENST00000533364	T;T	0.48201	0.82;0.82	3.66	3.66	0.41972	Domain of unknown function DUF3585 (1);	0.190274	0.28958	N	0.013589	T	0.69620	0.3131	M	0.87971	2.92	0.46279	D	0.99896	D	0.89917	1.0	D	0.91635	0.999	T	0.74691	-0.3580	10	0.72032	D	0.01	.	10.7148	0.46006	0.0:0.0:1.0:0.0	.	1463	Q8N3D4	EH1L1_HUMAN	L	1463;68	ENSP00000312671:R1463L;ENSP00000435843:R68L	ENSP00000312671:R1463L	R	+	2	0	EHBP1L1	65116053	1.000000	0.71417	0.989000	0.46669	0.820000	0.46376	5.106000	0.64597	1.881000	0.54492	0.313000	0.20887	CGA	.		0.662	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
EMILIN2	84034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2909794	2909794	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr18:2909794G>T	ENST00000254528.3	+	7	2960	c.2801G>T	c.(2800-2802)gGg>gTg	p.G934V	EMILIN2_ENST00000308080.5_3'UTR	NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	934	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GTGAACGACGGGGATGTTTAC	0.587																																					p.G934V		.											.	EMILIN2	93	0			c.G2801T						.						121.0	106.0	111.0					18																	2909794		2203	4300	6503	SO:0001583	missense	84034	exon7			ACGACGGGGATGT	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.2801G>T	18.37:g.2909794G>T	ENSP00000254528:p.Gly934Val	104.0	0.0		104.0	40.0	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	37	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722790	0.68959	.	.	ENSG00000132205	ENST00000254528;ENST00000308080	T	0.04917	3.53	5.8	5.8	0.92144	Tumour necrosis factor-like (2);Complement C1q protein (2);	0.000000	0.85682	D	0.000000	T	0.35248	0.0925	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.28170	-1.0052	10	0.87932	D	0	-35.1375	20.063	0.97692	0.0:0.0:1.0:0.0	.	934	Q9BXX0	EMIL2_HUMAN	V	934;211	ENSP00000254528:G934V	ENSP00000254528:G934V	G	+	2	0	EMILIN2	2899794	1.000000	0.71417	0.629000	0.29254	0.249000	0.25844	8.901000	0.92560	2.735000	0.93741	0.655000	0.94253	GGG	.		0.587	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
ERN2	10595	broad.mit.edu;bcgsc.ca	37	16	23717746	23717746	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr16:23717746G>A	ENST00000457008.2	-	7	532	c.494C>T	c.(493-495)aCg>aTg	p.T165M	ERN2_ENST00000256797.4_Missense_Mutation_p.T213M					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		CATGGTGACCGTATACTCTGG	0.587																																					p.T213M		.											.	ERN2	322	0			c.C638T						.						40.0	41.0	41.0					16																	23717746		2195	4296	6491	SO:0001583	missense	10595	exon7			GTGACCGTATACT	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.494C>T	16.37:g.23717746G>A	ENSP00000413812:p.Thr165Met	53.0	0.0		59.0	4.0	NM_033266		Missense_Mutation	SNP	ENST00000457008.2	37		.	.	.	.	.	.	.	.	.	.	G	13.24	2.178701	0.38511	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.21031	2.03;2.03	5.67	5.67	0.87782	Quinonprotein alcohol dehydrogenase-like (2);	0.086058	0.85682	D	0.000000	T	0.16171	0.0389	L	0.52364	1.645	0.30474	N	0.772986	P;P;P	0.49253	0.812;0.921;0.598	B;B;B	0.33392	0.163;0.153;0.06	T	0.27938	-1.0059	10	0.46703	T	0.11	.	10.6547	0.45667	0.0868:0.0:0.9132:0.0	.	165;165;165	Q76MJ5;E7ETG2;A5YM65	ERN2_HUMAN;.;.	M	213;165	ENSP00000256797:T213M;ENSP00000413812:T165M	ENSP00000256797:T213M	T	-	2	0	ERN2	23625247	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	3.893000	0.56243	2.677000	0.91161	0.462000	0.41574	ACG	.		0.587	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
FAM47B	170062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	34962716	34962716	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chrX:34962716A>T	ENST00000329357.5	+	1	1804	c.1768A>T	c.(1768-1770)Att>Ttt	p.I590F		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	590								p.I590F(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TTATGGACCAATTGCCTTTAA	0.448																																					p.I590F		.											.	FAM47B	196	1	Substitution - Missense(1)	endometrium(1)	c.A1768T						.						146.0	138.0	140.0					X																	34962716		2202	4300	6502	SO:0001583	missense	170062	exon1			GGACCAATTGCCT	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1768A>T	X.37:g.34962716A>T	ENSP00000328307:p.Ile590Phe	186.0	0.0		217.0	49.0	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.023069	0.54683	.	.	ENSG00000189132	ENST00000329357	T	0.16743	2.32	0.843	0.843	0.18935	.	.	.	.	.	T	0.39627	0.1085	M	0.81341	2.54	0.22745	N	0.998784	D	0.89917	1.0	D	0.83275	0.996	T	0.08889	-1.0700	8	0.87932	D	0	.	.	.	.	.	590	Q8NA70	FA47B_HUMAN	F	590	ENSP00000328307:I590F	ENSP00000328307:I590F	I	+	1	0	FAM47B	34872637	0.901000	0.30685	0.464000	0.27143	0.673000	0.39480	0.347000	0.20014	0.575000	0.29434	0.242000	0.17961	ATT	.		0.448	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	80045029	80045029	+	Silent	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr17:80045029C>T	ENST00000306749.2	-	21	3542	c.3324G>A	c.(3322-3324)gaG>gaA	p.E1108E		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1108					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCACCTGCTGCTCCTGCTGCC	0.667																																					p.E1108E	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.G3324A						.						21.0	22.0	22.0					17																	80045029		2187	4287	6474	SO:0001819	synonymous_variant	2194	exon21			CTGCTGCTCCTGC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.3324G>A	17.37:g.80045029C>T		68.0	0.0		58.0	30.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.667	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FCGR2A	2212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161475295	161475295	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr1:161475295C>T	ENST00000271450.6	+	1	76	c.38C>T	c.(37-39)cCc>cTc	p.P13L	FCGR2A_ENST00000367972.4_Missense_Mutation_p.P13L	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	13					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P13L(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AATGTATGTCCCAGAAACCTG	0.483																																					p.P13L		.											.	FCGR2A	91	1	Substitution - Missense(1)	endometrium(1)	c.C38T						.						140.0	123.0	129.0					1																	161475295		2203	4300	6503	SO:0001583	missense	2212	exon1			TATGTCCCAGAAA	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.38C>T	1.37:g.161475295C>T	ENSP00000271450:p.Pro13Leu	60.0	0.0		90.0	33.0	NM_001136219	Q8WUN1|Q8WW64	Missense_Mutation	SNP	ENST00000271450.6	37	CCDS44264.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.563721	0.65651	.	.	ENSG00000143226	ENST00000367972;ENST00000271450	T;T	0.01871	4.64;4.59	2.96	1.01	0.19927	.	2.722680	0.01165	N	0.006739	T	0.00580	0.0019	N	0.08118	0	0.22489	N	0.999059	P;P	0.50819	0.9;0.939	B;B	0.42625	0.22;0.393	T	0.40813	-0.9543	9	0.44086	T	0.13	.	4.3353	0.11083	0.0:0.6295:0.2345:0.136	.	13;13	P12318;P12318-2	FCG2A_HUMAN;.	L	13	ENSP00000356949:P13L;ENSP00000271450:P13L	ENSP00000271450:P13L	P	+	2	0	FCGR2A	159741919	0.000000	0.05858	0.000000	0.03702	0.648000	0.38561	-0.004000	0.12878	0.270000	0.21984	0.655000	0.94253	CCC	.		0.483	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083318.3	NM_021642	
FCGR3A	2214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161595991	161595991	+	Intron	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr1:161595991C>T	ENST00000540048.1	-	2	94				FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.G174E|FCGR3B_ENST00000531221.1_Missense_Mutation_p.G210E|FCGR2B_ENST00000367962.4_Intron|FCGR3B_ENST00000367964.2_Missense_Mutation_p.G174E			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCCAACAAGCCCCCTGCAGAA	0.463																																					p.G210E		.											.	FCGR3B	22	0			c.G629A						.						108.0	116.0	113.0					1																	161595991		2200	4300	6500	SO:0001627	intron_variant	2215	exon4			ACAAGCCCCCTGC	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+4166G>A	1.37:g.161595991C>T		133.0	0.0		183.0	100.0	NM_001244753	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37		.	.	.	.	.	.	.	.	.	.	-	13.54	2.266680	0.40095	.	.	ENSG00000162747	ENST00000367964;ENST00000294800;ENST00000531221	T;T;T	0.13778	2.56;2.56;2.56	2.47	0.106	0.14540	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.248184	0.28279	N	0.015925	T	0.20659	0.0497	M	0.84326	2.69	0.09310	N	0.999994	D	0.89917	1.0	D	0.85130	0.997	T	0.01956	-1.1240	10	0.87932	D	0	.	7.7203	0.28729	0.0:0.4785:0.5215:0.0	.	174	O75015	FCG3B_HUMAN	E	174;174;210	ENSP00000356941:G174E;ENSP00000294800:G174E;ENSP00000433642:G210E	ENSP00000294800:G174E	G	-	2	0	FCGR3B	159862615	0.025000	0.19082	0.376000	0.26042	0.058000	0.15608	0.792000	0.26929	0.352000	0.24053	0.393000	0.25936	GGG	.		0.463	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
GPI	2821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34890537	34890537	+	Splice_Site	SNP	G	G	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:34890537G>T	ENST00000356487.5	+	16	1715		c.e16+1		RP11-618P17.4_ENST00000606020.1_5'Flank|GPI_ENST00000586425.1_Intron|GPI_ENST00000415930.3_Splice_Site	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase						aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					GCCTTGGTCGGTGAGTGAGTA	0.522																																					.		.											.	GPI	228	0			c.1507+1G>T						.						147.0	147.0	147.0					19																	34890537		2203	4300	6503	SO:0001630	splice_region_variant	2821	exon16			TGGTCGGTGAGTG	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.1474+1G>T	19.37:g.34890537G>T		150.0	0.0		156.0	59.0	NM_001184722	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Splice_Site	SNP	ENST00000356487.5	37	CCDS12437.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697727	0.88830	.	.	ENSG00000105220	ENST00000415930;ENST00000356487	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8557	0.96758	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPI	39582377	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	9.780000	0.99024	2.707000	0.92482	0.655000	0.94253	.	.		0.522	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3		Intron
RHOA	387	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	49395602	49395602	+	IGR	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr3:49395602C>T	ENST00000418115.1	-	0	2031				GPX1_ENST00000419349.1_Missense_Mutation_p.G37D|GPX1_ENST00000496791.1_5'UTR|GPX1_ENST00000419783.1_Missense_Mutation_p.G37D	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TAGTACCTTGCCCCGCAGGGA	0.721																																					.		.											.	GPX1	68	0			.						.						9.0	10.0	10.0					3																	49395602		1887	4095	5982	SO:0001628	intergenic_variant	2876	.			ACCTTGCCCCGCA	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395602C>T		100.0	1.0		96.0	41.0	.	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175797	0.94807	.	.	ENSG00000233276	ENST00000419783;ENST00000419349	T;T	0.72942	1.15;-0.7	5.75	5.75	0.90469	Thioredoxin-like fold (2);	0.000000	0.32578	U	0.005911	T	0.75177	0.3814	L	0.59436	1.845	0.58432	D	0.999998	P;B	0.35944	0.529;0.222	B;B	0.43360	0.39;0.417	T	0.76149	-0.3065	10	0.66056	D	0.02	.	18.5306	0.90990	0.0:1.0:0.0:0.0	.	37;37	E9PAS1;P07203	.;GPX1_HUMAN	D	37	ENSP00000407375:G37D;ENSP00000391316:G37D	ENSP00000391316:G37D	G	-	2	0	GPX1	49370606	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	7.727000	0.84838	2.720000	0.93068	0.455000	0.32223	GGC	.		0.721	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
GRIA2	2891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	158256937	158256937	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr4:158256937T>A	ENST00000264426.9	+	10	1660	c.1381T>A	c.(1381-1383)Tac>Aac	p.Y461N	GRIA2_ENST00000507898.1_Missense_Mutation_p.Y414N|GRIA2_ENST00000393815.2_Missense_Mutation_p.Y414N|GRIA2_ENST00000296526.7_Missense_Mutation_p.Y461N|GRIA2_ENST00000449365.1_Missense_Mutation_p.Y414N	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	461					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TGGGTTCAAGTACAAGTTGAC	0.438																																					p.Y461N		.											.	GRIA2	515	0			c.T1381A						.						193.0	166.0	175.0					4																	158256937		2203	4300	6503	SO:0001583	missense	2891	exon10			TTCAAGTACAAGT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1381T>A	4.37:g.158256937T>A	ENSP00000264426:p.Tyr461Asn	140.0	0.0		68.0	59.0	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.355744	0.82243	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38	5.86	5.86	0.93980	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.96932	0.8998	H	0.98351	4.21	0.80722	D	1	D;D;D	0.76494	0.998;0.99;0.999	D;P;D	0.83275	0.943;0.83;0.996	D	0.98498	1.0613	10	0.87932	D	0	.	16.5602	0.84551	0.0:0.0:0.0:1.0	.	461;461;414	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	N	414;414;461;461;414	ENSP00000426845:Y414N;ENSP00000377403:Y414N;ENSP00000296526:Y461N;ENSP00000264426:Y461N;ENSP00000389837:Y414N	ENSP00000264426:Y461N	Y	+	1	0	GRIA2	158476387	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.997000	0.88414	2.367000	0.80283	0.528000	0.53228	TAC	.		0.438	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu	37	6	12120242	12120242	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr6:12120242C>T	ENST00000379388.2	+	4	546	c.214C>T	c.(214-216)Cag>Tag	p.Q72*		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	72					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				AAATCCTCTTCAGGCAAAACA	0.378																																					p.Q72X		.											.	HIVEP1	139	0			c.C214T						.						119.0	113.0	115.0					6																	12120242		1825	4084	5909	SO:0001587	stop_gained	3096	exon4			CCTCTTCAGGCAA	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.214C>T	6.37:g.12120242C>T	ENSP00000368698:p.Gln72*	110.0	0.0		102.0	5.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Nonsense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577809	0.65878	.	.	ENSG00000095951	ENST00000491710;ENST00000487103;ENST00000379388;ENST00000478545	.	.	.	5.79	5.79	0.91817	.	0.000000	0.34245	N	0.004123	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-19.3296	11.5308	0.50610	0.1302:0.728:0.1417:0.0	.	.	.	.	X	72	.	ENSP00000368698:Q72X	Q	+	1	0	HIVEP1	12228228	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	2.851000	0.48302	2.733000	0.93635	0.655000	0.94253	CAG	.		0.378	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
INHBA	3624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	41729922	41729922	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:41729922C>A	ENST00000242208.4	-	3	853	c.607G>T	c.(607-609)Gaa>Taa	p.E203*	INHBA_ENST00000442711.1_Nonsense_Mutation_p.E203*|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	203					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						AGCAACAGTTCACTCCTCTCC	0.582										TSP Lung(11;0.080)																											p.E203X		.											.	INHBA	703	0			c.G607T						.						83.0	74.0	77.0					7																	41729922		2203	4300	6503	SO:0001587	stop_gained	3624	exon3			ACAGTTCACTCCT		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.607G>T	7.37:g.41729922C>A	ENSP00000242208:p.Glu203*	118.0	0.0		104.0	30.0	NM_002192	Q14599	Nonsense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	39	7.379859	0.98248	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	.	.	.	6.06	6.06	0.98353	.	0.319905	0.37348	N	0.002124	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-15.3359	20.6208	0.99490	0.0:1.0:0.0:0.0	.	.	.	.	X	203	.	ENSP00000242208:E203X	E	-	1	0	INHBA	41696447	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.763000	0.62257	2.882000	0.98803	0.655000	0.94253	GAA	.		0.582	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250793.1		
ITGA3	3675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48156884	48156884	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr17:48156884T>C	ENST00000320031.8	+	21	2999	c.2669T>C	c.(2668-2670)cTg>cCg	p.L890P	ITGA3_ENST00000007722.7_Missense_Mutation_p.L890P	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	890					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						CCTGTCACTCTGGCTGCTGCC	0.647																																					p.L890P		.											.	ITGA3	229	0			c.T2669C						.						31.0	32.0	31.0					17																	48156884		2203	4300	6503	SO:0001583	missense	3675	exon21			TCACTCTGGCTGC	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.2669T>C	17.37:g.48156884T>C	ENSP00000315190:p.Leu890Pro	62.0	0.0		68.0	31.0	NM_005501	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.161772	0.78226	.	.	ENSG00000005884	ENST00000007722;ENST00000538917;ENST00000320031	T;T	0.46063	0.88;0.88	4.79	4.79	0.61399	Integrin alpha-2 (1);	0.536026	0.18682	N	0.134128	T	0.64011	0.2560	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.63269	-0.6675	10	0.34782	T	0.22	.	11.9399	0.52894	0.0:0.0:0.0:1.0	.	890;890	P26006-1;P26006	.;ITA3_HUMAN	P	890;876;890	ENSP00000007722:L890P;ENSP00000315190:L890P	ENSP00000007722:L890P	L	+	2	0	ITGA3	45511883	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	4.404000	0.59735	2.012000	0.59069	0.260000	0.18958	CTG	.		0.647	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
KCNK18	338567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118969678	118969678	+	Silent	SNP	C	C	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr10:118969678C>G	ENST00000334549.1	+	3	1023	c.1023C>G	c.(1021-1023)tcC>tcG	p.S341S		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	341					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		TGTTCTTCTCCATTTATATCA	0.383																																					p.S341S		.											.	KCNK18	91	0			c.C1023G						.						278.0	246.0	257.0					10																	118969678		2203	4300	6503	SO:0001819	synonymous_variant	338567	exon3			CTTCTCCATTTAT	AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.1023C>G	10.37:g.118969678C>G		102.0	0.0		94.0	42.0	NM_181840	Q5SQQ8	Silent	SNP	ENST00000334549.1	37	CCDS7598.1																																																																																			.		0.383	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050562.2	NM_181840	
KCNQ2	3785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62076074	62076074	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr20:62076074G>A	ENST00000359125.2	-	4	802	c.628C>T	c.(628-630)Cgc>Tgc	p.R210C	KCNQ2_ENST00000344462.4_Missense_Mutation_p.R210C|KCNQ2_ENST00000344425.5_Missense_Mutation_p.R210C|KCNQ2_ENST00000357249.2_Missense_Mutation_p.R210C|KCNQ2_ENST00000359689.1_Missense_Mutation_p.R210C|KCNQ2_ENST00000360480.3_Missense_Mutation_p.R210C|KCNQ2_ENST00000370224.1_Missense_Mutation_p.R210C|KCNQ2_ENST00000354587.3_Missense_Mutation_p.R210C	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	210					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CGGTCCATGCGGATCATCCGC	0.677																																					p.R210C		.											.	KCNQ2	92	0			c.C628T						.						21.0	22.0	21.0					20																	62076074		2200	4288	6488	SO:0001583	missense	3785	exon4			CCATGCGGATCAT	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.628C>T	20.37:g.62076074G>A	ENSP00000352035:p.Arg210Cys	56.0	0.0		57.0	25.0	NM_172106	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.654063	0.88056	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98;-4.98	4.05	4.05	0.47172	Ion transport (1);	0.082781	0.48767	D	0.000171	D	0.99152	0.9707	M	0.92367	3.3	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.99;0.998;0.997;0.997;0.997;0.998	D	0.99218	1.0878	10	0.87932	D	0	-4.058	16.5766	0.84681	0.0:0.0:1.0:0.0	.	210;210;210;210;210;210	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	C	210	ENSP00000349789:R210C;ENSP00000352035:R210C;ENSP00000359246:R210C;ENSP00000346601:R210C;ENSP00000352718:R210C;ENSP00000399612:R210C;ENSP00000353668:R210C;ENSP00000339611:R210C;ENSP00000359244:R210C;ENSP00000359242:R210C;ENSP00000359241:R210C;ENSP00000345523:R210C	ENSP00000345523:R210C	R	-	1	0	KCNQ2	61546518	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.598000	0.98277	1.978000	0.57642	0.484000	0.47621	CGC	.		0.677	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114124389	114124389	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr9:114124389G>A	ENST00000338205.5	-	49	5660	c.5441C>T	c.(5440-5442)gCt>gTt	p.A1814V	KIAA0368_ENST00000374378.3_Intron|KIAA0368_ENST00000259335.4_Missense_Mutation_p.A1992V			Q5VYK3	ECM29_HUMAN	KIAA0368	1820					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						CTCCATAGTAGCTAAAGACTC	0.358																																					p.A1992V		.											.	KIAA0368	68	0			c.C5975T						.						100.0	102.0	102.0					9																	114124389		1905	4129	6034	SO:0001583	missense	23392	exon51			ATAGTAGCTAAAG	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.5441C>T	9.37:g.114124389G>A	ENSP00000339889:p.Ala1814Val	148.0	0.0		130.0	69.0	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	G	15.32	2.799749	0.50208	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.66638	-0.22	5.93	5.03	0.67393	.	0.352438	0.32970	N	0.005427	T	0.56717	0.2004	L	0.34521	1.04	0.80722	D	1	B	0.28713	0.22	B	0.25140	0.058	T	0.52343	-0.8588	10	0.29301	T	0.29	-7.9857	17.1759	0.86841	0.0:0.1263:0.8737:0.0	.	1289	B3KXF2	.	V	1814;1992;1289	ENSP00000259335:A1992V	ENSP00000259335:A1992V	A	-	2	0	KIAA0368	113164210	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	4.717000	0.61923	1.489000	0.48450	0.655000	0.94253	GCT	.		0.358	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
KIF16B	55614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	16387061	16387061	+	Silent	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr20:16387061A>G	ENST00000354981.2	-	16	1810	c.1653T>C	c.(1651-1653)ttT>ttC	p.F551F	KIF16B_ENST00000408042.1_Silent_p.F551F|KIF16B_ENST00000355755.3_Silent_p.F551F|KIF16B_ENST00000378003.2_5'UTR	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	551					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TTGGATGGTTAAAGCGAAACA	0.473																																					p.F551F		.											.	KIF16B	291	0			c.T1653C						.						221.0	200.0	207.0					20																	16387061		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon16			ATGGTTAAAGCGA	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.1653T>C	20.37:g.16387061A>G		98.0	0.0		122.0	62.0	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																			.		0.473	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
KRT81	3887	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	52680104	52680104	+	Missense_Mutation	SNP	C	C	T	rs115355093	byFrequency	TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr12:52680104C>T	ENST00000327741.5	-	9	1521	c.1453G>A	c.(1453-1455)Gtg>Atg	p.V485M	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	485	Tail.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		CAGGAGCCCACGCCGCAGGAA	0.657													.|||	35	0.00698882	0.0265	0.0	5008	,	,		15073	0.0		0.0	False		,,,				2504	0.0				p.V485M		.											.	KRT81	90	0			c.G1453A						.	C	MET/VAL	56,4254		1,54,2100	31.0	28.0	29.0		1453	3.3	0.8	12	dbSNP_132	29	2,8464		0,2,4231	yes	missense	KRT81	NM_002281.3	21	1,56,6331	TT,TC,CC		0.0236,1.2993,0.454	probably-damaging	485/506	52680104	58,12718	2155	4233	6388	SO:0001583	missense	3887	exon9			AGCCCACGCCGCA	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1453G>A	12.37:g.52680104C>T	ENSP00000369349:p.Val485Met	74.0	0.0		77.0	11.0	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	37	CCDS31805.1	15	0.006868131868131868	15	0.03048780487804878	0	0.0	0	0.0	0	0.0	C	8.506	0.865503	0.17250	0.012993	2.36E-4	ENSG00000205426	ENST00000327741	D	0.81739	-1.53	3.32	3.32	0.38043	.	.	.	.	.	T	0.63651	0.2529	N	0.22421	0.69	0.27329	N	0.956816	D	0.76494	0.999	D	0.76575	0.988	T	0.65335	-0.6193	9	0.44086	T	0.13	.	11.6808	0.51457	0.0:1.0:0.0:0.0	.	485	Q14533	KRT81_HUMAN	M	485	ENSP00000369349:V485M	ENSP00000369349:V485M	V	-	1	0	KRT81	50966371	0.001000	0.12720	0.820000	0.32676	0.073000	0.16967	0.365000	0.20348	1.570000	0.49709	0.462000	0.41574	GTG	C|0.995;T|0.005		0.657	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235915327	235915327	+	Silent	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr1:235915327A>G	ENST00000389794.3	-	27	7779	c.7605T>C	c.(7603-7605)aaT>aaC	p.N2535N	LYST_ENST00000389793.2_Silent_p.N2535N			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2535					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGTTTTTGCTATTTTGAAGAT	0.333																																					p.N2535N		.											.	LYST	143	0			c.T7605C						.						72.0	64.0	67.0					1																	235915327		2202	4297	6499	SO:0001819	synonymous_variant	1130	exon27			TTTGCTATTTTGA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.7605T>C	1.37:g.235915327A>G		86.0	0.0		89.0	50.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	A	9.547	1.115030	0.20795	.	.	ENSG00000143669	ENST00000487530	.	.	.	5.41	-4.15	0.03881	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3753	0.32440	0.2903:0.0:0.5226:0.1871	.	.	.	.	Q	49	.	.	X	-	1	0	LYST	233981950	0.990000	0.36364	0.992000	0.48379	0.997000	0.91878	0.198000	0.17217	-0.357000	0.08175	0.533000	0.62120	TAG	.		0.333	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
MAN2A1	4124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	109178033	109178033	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:109178033A>G	ENST00000261483.4	+	17	3623	c.2571A>G	c.(2569-2571)atA>atG	p.I857M		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	857					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		atttaGGAATAGAAGGACAGT	0.284																																					p.I857M		.											.	MAN2A1	92	0			c.A2571G						.						22.0	23.0	23.0					5																	109178033		2181	4276	6457	SO:0001583	missense	4124	exon17			AGGAATAGAAGGA		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.2571A>G	5.37:g.109178033A>G	ENSP00000261483:p.Ile857Met	302.0	0.0		284.0	128.0	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.842010	0.32513	.	.	ENSG00000112893	ENST00000261483	T	0.78364	-1.17	5.49	5.49	0.81192	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.675464	0.15678	N	0.250069	T	0.75295	0.3830	M	0.72894	2.215	0.37422	D	0.91368	B	0.27264	0.173	B	0.33121	0.158	T	0.74337	-0.3698	10	0.34782	T	0.22	-10.1094	5.9458	0.19217	0.7696:0.0:0.0827:0.1477	.	857	Q16706	MA2A1_HUMAN	M	857	ENSP00000261483:I857M	ENSP00000261483:I857M	I	+	3	3	MAN2A1	109205932	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.210000	0.42816	2.205000	0.71048	0.528000	0.53228	ATA	.		0.284	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
MYCBP2	23077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	77656079	77656079	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr13:77656079T>C	ENST00000544440.2	-	64	10989	c.10972A>G	c.(10972-10974)Agc>Ggc	p.S3658G	MYCBP2_ENST00000407578.2_Missense_Mutation_p.S3696G|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.S3658G|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS2_ENST00000428716.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AAGACGTTGCTCTGATGAAGG	0.363																																					p.S3696G		.											.	MYCBP2	236	0			c.A11086G						.						103.0	95.0	98.0					13																	77656079		2203	4300	6503	SO:0001583	missense	23077	exon64			CGTTGCTCTGATG	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10972A>G	13.37:g.77656079T>C	ENSP00000444596:p.Ser3658Gly	82.0	0.0		124.0	56.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.512218|4.512218	0.85389|0.85389	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000429715|ENST00000357337;ENST00000407578;ENST00000544440	.|T;T;T	.|0.67865	.|-0.29;-0.29;-0.29	5.17|5.17	5.17|5.17	0.71159|0.71159	.|Galactose-binding domain-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79233|0.79233	0.4411|0.4411	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|P	.|0.49447	.|0.924	.|P	.|0.60682	.|0.878	T|T	0.81775|0.81775	-0.0778|-0.0778	5|10	.|0.72032	.|D	.|0.01	.|.	15.2956|15.2956	0.73906|0.73906	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|3658	.|O75592	.|MYCB2_HUMAN	G|G	81|3658;3696;3658	.|ENSP00000349892:S3658G;ENSP00000384288:S3696G;ENSP00000444596:S3658G	.|ENSP00000349892:S3658G	E|S	-|-	2|1	0|0	MYCBP2|MYCBP2	76554080|76554080	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.997000|7.997000	0.88414|0.88414	2.063000|2.063000	0.61619|0.61619	0.533000|0.533000	0.62120|0.62120	GAG|AGC	.		0.363	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
MYO16	23026	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	109793226	109793226	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr13:109793226G>A	ENST00000357550.2	+	31	4641	c.4600G>A	c.(4600-4602)Ggg>Agg	p.G1534R	MYO16_ENST00000356711.2_Missense_Mutation_p.G1534R	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GCAGCCGGAGGGGTCGAGCCC	0.706																																					p.G1556R		.											.	MYO16	142	0			c.G4666A						.						17.0	21.0	20.0					13																	109793226		2193	4286	6479	SO:0001583	missense	23026	exon32			CCGGAGGGGTCGA		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4600G>A	13.37:g.109793226G>A	ENSP00000350160:p.Gly1534Arg	70.0	0.0		150.0	44.0	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	37	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.555911	0.27827	.	.	ENSG00000041515	ENST00000356711;ENST00000357550	T;T	0.46063	0.88;0.88	4.8	3.05	0.35203	.	0.370184	0.19093	U	0.122920	T	0.42494	0.1205	L	0.54323	1.7	0.19575	N	0.999968	P	0.46706	0.883	P	0.47402	0.546	T	0.20009	-1.0288	9	.	.	.	.	8.6125	0.33811	0.2262:0.0:0.7738:0.0	.	1534	Q9Y6X6	MYO16_HUMAN	R	1534	ENSP00000349145:G1534R;ENSP00000350160:G1534R	.	G	+	1	0	MYO16	108591227	0.768000	0.28519	0.002000	0.10522	0.007000	0.05969	1.842000	0.39250	0.452000	0.26830	0.467000	0.42956	GGG	.		0.706	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
MYO9B	4650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17291744	17291744	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:17291744A>T	ENST00000594824.1	+	15	2375	c.2228A>T	c.(2227-2229)cAt>cTt	p.H743L	MYO9B_ENST00000397274.2_Missense_Mutation_p.H743L|MYO9B_ENST00000595618.1_Missense_Mutation_p.H743L|CTD-3032J10.4_ENST00000594678.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	743	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						AGCGATTTGCATAACCAAATG	0.607																																					p.H743L		.											.	MYO9B	67	0			c.A2228T						.						63.0	71.0	69.0					19																	17291744		1949	4128	6077	SO:0001583	missense	4650	exon15			ATTTGCATAACCA		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2228A>T	19.37:g.17291744A>T	ENSP00000471367:p.His743Leu	79.0	0.0		93.0	37.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	A	17.86	3.492678	0.64074	.	.	ENSG00000099331	ENST00000397274	D	0.84589	-1.87	4.77	4.77	0.60923	Myosin head, motor domain (2);	0.143577	0.31134	N	0.008181	D	0.87362	0.6158	L	0.34521	1.04	0.46542	D	0.999092	D;D;D	0.76494	0.987;0.987;0.999	D;D;D	0.77004	0.91;0.91;0.989	D	0.88254	0.2918	10	0.66056	D	0.02	.	11.9558	0.52981	1.0:0.0:0.0:0.0	.	743;743;749	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	L	743	ENSP00000380444:H743L	ENSP00000380444:H743L	H	+	2	0	MYO9B	17152744	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.883000	0.87264	1.922000	0.55676	0.402000	0.26972	CAT	.		0.607	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
NAGS	162417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42083959	42083959	+	Silent	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr17:42083959C>T	ENST00000293404.3	+	4	1096	c.978C>T	c.(976-978)agC>agT	p.S326S	PYY_ENST00000360085.2_5'Flank	NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	326	Amino-acid kinase domain (AAK).				arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AGTGGGTGAGCACAAAAGAAC	0.662																																					p.S326S		.											.	NAGS	90	0			c.C978T						.						39.0	29.0	33.0					17																	42083959		2201	4299	6500	SO:0001819	synonymous_variant	162417	exon4			GGTGAGCACAAAA	AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.978C>T	17.37:g.42083959C>T		60.0	0.0		61.0	25.0	NM_153006	B2RAZ9|Q8IWR4	Silent	SNP	ENST00000293404.3	37	CCDS11473.1																																																																																			.		0.662	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457660.1	NM_153006	
NPFFR1	64106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	72015152	72015152	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr10:72015152G>A	ENST00000277942.6	-	4	853	c.854C>T	c.(853-855)cCg>cTg	p.P285L		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	285					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						CGCCCAGAGCGGCAGCCAGGA	0.706																																					p.P285L		.											.	NPFFR1	22	0			c.C854T						.						6.0	11.0	9.0					10																	72015152		2110	4153	6263	SO:0001583	missense	64106	exon4			CAGAGCGGCAGCC	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.854C>T	10.37:g.72015152G>A	ENSP00000277942:p.Pro285Leu	21.0	0.0		18.0	9.0	NM_022146	A2RRF0|Q8NGR0|Q96RN3	Missense_Mutation	SNP	ENST00000277942.6	37	CCDS53539.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751744	0.89753	.	.	ENSG00000148734	ENST00000449957;ENST00000277942	T;T	0.79845	-1.31;-1.31	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93374	0.7887	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95811	0.8841	10	0.87932	D	0	.	16.2923	0.82757	0.0:0.0:1.0:0.0	.	285	Q9GZQ6	NPFF1_HUMAN	L	283;285	ENSP00000401171:P283L;ENSP00000277942:P285L	ENSP00000277942:P285L	P	-	2	0	NPFFR1	71685158	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.422000	0.97458	2.169000	0.68431	0.462000	0.41574	CCG	.		0.706	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048504.2	NM_022146	
OLFML2A	169611	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	127563878	127563879	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr9:127563878_127563879GG>TT	ENST00000373580.3	+	5	855_856	c.855_856GG>TT	c.(853-858)caGGct>caTTct	p.285_286QA>HS	OLFML2A_ENST00000288815.5_Missense_Mutation_p.71_72QA>HS	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	285					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						CCCAGCAGCAGGCTGTGATCCG	0.644																																					p.Q285H|p.A286S		.											.	OLFML2A	68	0			c.G855T|c.G856T						.																																			SO:0001583	missense	169611	exon5			GCAGCAGGCTGTG|CAGCAGGCTGTGA	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	Exception_encountered	9.37:g.127563878_127563879delinsTT	ENSP00000362682:p.Q285_A286delinsHS	129.0|130.0	2.0|0.0		132.0	59.0	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	37	CCDS6857.2																																																																																			.		0.644	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
OR51F1	256892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4790712	4790712	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:4790712T>C	ENST00000380383.1	-	1	456	c.457A>G	c.(457-459)Atg>Gtg	p.M153V	MMP26_ENST00000380390.1_Intron|OR51F1_ENST00000343430.3_Missense_Mutation_p.M146V|MMP26_ENST00000477339.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	153						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		AGAAGACCCATTTGAATGATT	0.438																																					p.M146V		.											.	OR51F1	70	0			c.A436G						.						93.0	95.0	94.0					11																	4790712		2201	4298	6499	SO:0001583	missense	256892	exon1			GACCCATTTGAAT	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.457A>G	11.37:g.4790712T>C	ENSP00000369744:p.Met153Val	63.0	0.0		76.0	34.0	NM_001004752		Missense_Mutation	SNP	ENST00000380383.1	37		.	.	.	.	.	.	.	.	.	.	T	0.860	-0.735567	0.03111	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.35789	1.29;1.29	5.03	-0.876	0.10624	GPCR, rhodopsin-like superfamily (1);	0.474452	0.19550	N	0.111582	T	0.20414	0.0491	L	0.38531	1.155	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.10109	-1.0644	10	0.39692	T	0.17	.	1.9592	0.03382	0.2756:0.0842:0.1283:0.5118	.	153	A6NGY5	O51F1_HUMAN	V	146;153	ENSP00000345163:M146V;ENSP00000369744:M153V	ENSP00000345163:M146V	M	-	1	0	OR51F1	4747288	0.000000	0.05858	0.008000	0.14137	0.003000	0.03518	-0.027000	0.12371	0.015000	0.14971	0.533000	0.62120	ATG	.		0.438	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752	
OR8I2	120586	broad.mit.edu;mdanderson.org	37	11	55861688	55861688	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:55861688G>A	ENST00000302124.2	+	1	936	c.905G>A	c.(904-906)aGa>aAa	p.R302K		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R302K(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					GCTCTTCTGAGAGTCATACAT	0.383																																					p.R302K		.											.	OR8I2	113	1	Substitution - Missense(1)	skin(1)	c.G905A						.						24.0	24.0	24.0					11																	55861688		2200	4276	6476	SO:0001583	missense	120586	exon1			TTCTGAGAGTCAT	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.905G>A	11.37:g.55861688G>A	ENSP00000303864:p.Arg302Lys	39.0	0.0		29.0	13.0	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	G	0.864	-0.734183	0.03111	.	.	ENSG00000172154	ENST00000302124	T	0.35973	1.28	4.0	3.08	0.35506	.	0.240490	0.21555	U	0.072671	T	0.19846	0.0477	L	0.31845	0.965	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.31971	-0.9924	10	0.02654	T	1	-0.9653	6.2384	0.20776	0.3165:0.0:0.6835:0.0	.	302	Q8N0Y5	OR8I2_HUMAN	K	302	ENSP00000303864:R302K	ENSP00000303864:R302K	R	+	2	0	OR8I2	55618264	0.378000	0.25114	0.002000	0.10522	0.167000	0.22549	1.382000	0.34374	0.798000	0.33994	0.447000	0.29281	AGA	.		0.383	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
PASK	23178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242075390	242075390	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:242075390T>C	ENST00000405260.1	-	8	1900	c.1202A>G	c.(1201-1203)cAg>cGg	p.Q401R	PASK_ENST00000358649.4_Missense_Mutation_p.Q401R|PASK_ENST00000539818.1_Missense_Mutation_p.Q185R|PASK_ENST00000234040.4_Missense_Mutation_p.Q401R|PASK_ENST00000544142.1_Missense_Mutation_p.Q215R|PASK_ENST00000403638.3_Missense_Mutation_p.Q401R	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	401	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GTCTGGGAGCTGTAATGAGCT	0.557																																					p.Q401R		.											.	PASK	536	0			c.A1202G						.						144.0	143.0	143.0					2																	242075390		2203	4300	6503	SO:0001583	missense	23178	exon8			GGGAGCTGTAATG	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.1202A>G	2.37:g.242075390T>C	ENSP00000384016:p.Gln401Arg	84.0	0.0		35.0	30.0	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	T	7.836	0.720824	0.15372	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.69435	-0.4;-0.38;-0.4;-0.35;-0.39;0.61	4.55	0.0993	0.14502	PAS (1);	0.265900	0.26404	N	0.024561	T	0.46908	0.1417	N	0.24115	0.695	0.09310	N	1	P;P;P;P;P	0.45827	0.791;0.867;0.867;0.867;0.791	B;P;B;B;B	0.47346	0.342;0.544;0.359;0.359;0.342	T	0.39251	-0.9623	10	0.21014	T	0.42	.	1.0119	0.01499	0.2122:0.1105:0.2689:0.4083	.	366;215;401;401;401	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	R	401;215;401;401;185;401	ENSP00000234040:Q401R;ENSP00000441374:Q215R;ENSP00000384016:Q401R;ENSP00000351475:Q401R;ENSP00000443083:Q185R;ENSP00000384438:Q401R	ENSP00000234040:Q401R	Q	-	2	0	PASK	241724063	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.063000	0.14410	-0.354000	0.08212	0.460000	0.39030	CAG	.		0.557	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
PIWIL4	143689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94318670	94318670	+	Missense_Mutation	SNP	C	C	A	rs574384867		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr11:94318670C>A	ENST00000299001.6	+	6	906	c.695C>A	c.(694-696)cCa>cAa	p.P232Q	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	232					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCTTCAGAGCCAATGGAAATT	0.313																																					p.P232Q		.											.	PIWIL4	91	0			c.C695A						.						118.0	124.0	122.0					11																	94318670		2201	4298	6499	SO:0001583	missense	143689	exon6			CAGAGCCAATGGA	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.695C>A	11.37:g.94318670C>A	ENSP00000299001:p.Pro232Gln	116.0	0.0		77.0	63.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.745275	0.49151	.	.	ENSG00000134627	ENST00000299001	T	0.09723	2.95	4.87	3.95	0.45737	Argonaute/Dicer protein, PAZ (1);	0.095085	0.44483	N	0.000447	T	0.16685	0.0401	M	0.70595	2.14	0.80722	D	1	P	0.51933	0.949	P	0.44946	0.465	T	0.05468	-1.0883	10	0.30854	T	0.27	-5.4269	13.4329	0.61066	0.1586:0.8414:0.0:0.0	.	232	Q7Z3Z4	PIWL4_HUMAN	Q	232	ENSP00000299001:P232Q	ENSP00000299001:P232Q	P	+	2	0	PIWIL4	93958318	0.985000	0.35326	0.882000	0.34594	0.962000	0.63368	4.516000	0.60496	1.253000	0.44018	0.561000	0.74099	CCA	.		0.313	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
PRKAG3	53632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219688557	219688557	+	Silent	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:219688557G>A	ENST00000529249.1	-	13	1713	c.1398C>T	c.(1396-1398)ggC>ggT	p.G466G	PRKAG3_ENST00000439262.2_Silent_p.G441G|PRKAG3_ENST00000545803.1_Silent_p.G282G			Q9UGI9	AAKG3_HUMAN	protein kinase, AMP-activated, gamma 3 non-catalytic subunit	466	CBS 4. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|protein phosphorylation (GO:0006468)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)	AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			large_intestine(7)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;4.35e-07)|all cancers(144;8.96e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Acetylsalicylic acid(DB00945)	GGGAGACCACGCCCAAGAGAT	0.607																																					p.G466G		.											.	PRKAG3	659	0			c.C1398T						.						131.0	105.0	114.0					2																	219688557		2203	4300	6503	SO:0001819	synonymous_variant	53632	exon13			GACCACGCCCAAG	AF214519	CCDS2424.1	2q35	2012-09-20			ENSG00000115592	ENSG00000115592			9387	protein-coding gene	gene with protein product		604976				10818001	Standard	NM_017431		Approved		uc002vjb.1	Q9UGI9	OTTHUMG00000133078	ENST00000529249.1:c.1398C>T	2.37:g.219688557G>A		34.0	0.0		13.0	8.0	NM_017431	Q4QQG8|Q4V779|Q9NRL1	Silent	SNP	ENST00000529249.1	37	CCDS2424.1																																																																																			.		0.607	PRKAG3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385992.1		
PRLHR	2834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	120354363	120354363	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr10:120354363C>T	ENST00000369169.1	-	1	393	c.394G>A	c.(394-396)Ggc>Agc	p.G132S	PRLHR_ENST00000239032.2_Missense_Mutation_p.G132S			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	132					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		TGGCACAGGCCGCCGCCGAAC	0.657																																					p.G132S		.											.	PRLHR	90	0			c.G394A						.						40.0	36.0	37.0					10																	120354363		2202	4299	6501	SO:0001583	missense	2834	exon2			ACAGGCCGCCGCC	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.394G>A	10.37:g.120354363C>T	ENSP00000358167:p.Gly132Ser	28.0	0.0		36.0	17.0	NM_004248	O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	ENST00000369169.1	37	CCDS7606.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.727068	0.30593	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.71698	-0.59;-0.59	4.66	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.334028	0.30969	N	0.008515	T	0.41050	0.1142	N	0.05414	-0.055	0.31884	N	0.618122	B	0.10296	0.003	B	0.06405	0.002	T	0.23904	-1.0175	10	0.16896	T	0.51	.	2.9845	0.05964	0.3475:0.3804:0.0:0.2721	.	132	P49683	PRLHR_HUMAN	S	132	ENSP00000239032:G132S;ENSP00000358167:G132S	ENSP00000239032:G132S	G	-	1	0	PRLHR	120344353	0.956000	0.32656	0.949000	0.38748	0.968000	0.65278	1.312000	0.33574	1.188000	0.43014	0.655000	0.94253	GGC	.		0.657	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050610.1	NM_004248	
RABEPK	10244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127996064	127996064	+	Silent	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr9:127996064T>C	ENST00000373538.3	+	8	1234	c.924T>C	c.(922-924)gcT>gcC	p.A308A	RABEPK_ENST00000259460.8_Silent_p.A257A|RABEPK_ENST00000394125.4_Silent_p.A308A|RABEPK_ENST00000394124.4_3'UTR	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	308					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						TGACGTGTGCTTCTGAGAAAG	0.458																																					p.A308A		.											.	RABEPK	91	0			c.T924C						.						186.0	158.0	168.0					9																	127996064		2203	4300	6503	SO:0001819	synonymous_variant	10244	exon8			GTGTGCTTCTGAG	BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.924T>C	9.37:g.127996064T>C		122.0	0.0		126.0	56.0	NM_005833	A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Silent	SNP	ENST00000373538.3	37	CCDS6862.1																																																																																			.		0.458	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054064.1	NM_005833	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	109380985	109380985	+	Silent	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:109380985T>C	ENST00000283195.6	+	20	4116	c.3990T>C	c.(3988-3990)gaT>gaC	p.D1330D		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1330					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CAAGTCATGATAACAAGGATA	0.403																																					p.D1330D		.											.	RANBP2	675	0			c.T3990C						.						70.0	73.0	72.0					2																	109380985		2203	4299	6502	SO:0001819	synonymous_variant	5903	exon20			TCATGATAACAAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3990T>C	2.37:g.109380985T>C		99.0	0.0		47.0	43.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Silent	SNP	ENST00000283195.6	37	CCDS2079.1																																																																																			.		0.403	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RBMXL3	139804	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	114426362	114426362	+	Silent	SNP	G	G	A	rs186136686		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chrX:114426362G>A	ENST00000424776.3	+	1	2400	c.2358G>A	c.(2356-2358)tcG>tcA	p.S786S	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	786	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GAGGCCGCTCGCTCGATGCCA	0.682													G|||	3	0.000794702	0.0023	0.0	3775	,	,		13605	0.0		0.0	False		,,,				2504	0.0				p.S786S		.											.	.	.	0			c.G2358A						.	G	,	16,1193		0,13,3,504,172	42.0	41.0	42.0		2358,	0.9	0.0	X		42	0,2391		0,0,0,800,791	no	coding-synonymous,intron	LRCH2,RBMXL3	NM_001145346.1,NM_020871.3	,	0,13,3,1304,963	AA,AG,A,GG,G		0.0,1.3234,0.4444	,	786/1068,	114426362	16,3584	692	1591	2283	SO:0001819	synonymous_variant	139804	exon1			CCGCTCGCTCGAT	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2358G>A	X.37:g.114426362G>A		74.0	1.0		72.0	39.0	NM_001145346	B4DXC0	Silent	SNP	ENST00000424776.3	37	CCDS55478.1																																																																																			G|0.999;A|0.001		0.682	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
RELN	5649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103202066	103202066	+	Silent	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:103202066A>G	ENST00000428762.1	-	36	5601	c.5442T>C	c.(5440-5442)ccT>ccC	p.P1814P	RELN_ENST00000424685.2_Silent_p.P1814P|RELN_ENST00000343529.5_Silent_p.P1814P	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1814					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GCCAAAGGTCAGGATGTAAAT	0.443																																					p.P1814P	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.T5442C						.						108.0	107.0	107.0					7																	103202066		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon36			AAGGTCAGGATGT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5442T>C	7.37:g.103202066A>G		71.0	0.0		81.0	37.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	37	CCDS47680.1																																																																																			.		0.443	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
SCAND1	51282	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	34541998	34541998	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr20:34541998G>A	ENST00000373991.3	-	3	1279	c.209C>T	c.(208-210)gCg>gTg	p.A70V	SCAND1_ENST00000305978.2_Missense_Mutation_p.A70V			P57086	SCND1_HUMAN	SCAN domain containing 1	70					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)					Breast(12;0.00631)|all_lung(11;0.0233)					CTCCAGGGCCGCGGAGGCCGC	0.731																																					p.A133V		.											.	SCAND1	90	0			c.C398T						.						3.0	4.0	4.0					20																	34541998		1880	3657	5537	SO:0001583	missense	51282	exon2			AGGGCCGCGGAGG	AF204271	CCDS13269.1	20q11.1-q11.23	2013-01-08	2002-01-14		ENSG00000171222	ENSG00000171222		"""-"""	10566	protein-coding gene	gene with protein product		610416	"""SCAN domain-containing 1"""			10777584, 10747874, 12444922	Standard	NM_016558		Approved	SDP1, RAZ1	uc002xen.2	P57086	OTTHUMG00000032370	ENST00000373991.3:c.209C>T	20.37:g.34541998G>A	ENSP00000363103:p.Ala70Val	26.0	0.0		23.0	12.0	NM_033630	Q6IAG7	Missense_Mutation	SNP	ENST00000373991.3	37	CCDS13269.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207306	0.79240	.	.	ENSG00000171222	ENST00000305978;ENST00000373991	T;T	0.09163	3.01;3.01	4.39	3.37	0.38596	.	.	.	.	.	T	0.15609	0.0376	N	0.24115	0.695	0.09310	N	1	D	0.89917	1.0	D	0.64506	0.926	T	0.12041	-1.0563	9	0.39692	T	0.17	.	8.1089	0.30903	0.0:0.1683:0.6594:0.1723	.	70	P57086	SCND1_HUMAN	V	70	ENSP00000301995:A70V;ENSP00000363103:A70V	ENSP00000301995:A70V	A	-	2	0	SCAND1	34005412	0.000000	0.05858	0.078000	0.20375	0.003000	0.03518	0.291000	0.18994	2.157000	0.67596	0.655000	0.94253	GCG	.		0.731	SCAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078958.2	NM_016558	
SCN1A	6323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	166897863	166897863	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:166897863C>A	ENST00000303395.4	-	13	2292	c.2293G>T	c.(2293-2295)Gtg>Ttg	p.V765L	SCN1A_ENST00000423058.2_Missense_Mutation_p.V765L|SCN1A_ENST00000375405.3_Missense_Mutation_p.V754L|SCN1A_ENST00000409050.1_Missense_Mutation_p.V737L|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	765					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGGTCCATCACAACCAGGTTG	0.403																																					p.V765L		.											.	SCN1A	147	0			c.G2293T						.						116.0	111.0	112.0					2																	166897863		2203	4300	6503	SO:0001583	missense	6323	exon13			CCATCACAACCAG	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2293G>T	2.37:g.166897863C>A	ENSP00000303540:p.Val765Leu	87.0	0.0		37.0	29.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937153	0.92458	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97505	-4.41;-4.41;-4.37;-4.35	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000014	D	0.99105	0.9692	H	0.96691	3.865	0.80722	D	1	D;D;B	0.61697	0.99;0.984;0.217	D;D;B	0.75484	0.986;0.967;0.171	D	0.99072	1.0834	10	0.87932	D	0	.	19.8328	0.96642	0.0:1.0:0.0:0.0	.	754;737;765	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	L	765;765;754;737	ENSP00000407030:V765L;ENSP00000303540:V765L;ENSP00000364554:V754L;ENSP00000386312:V737L	ENSP00000303540:V765L	V	-	1	0	SCN1A	166606109	1.000000	0.71417	0.992000	0.48379	0.884000	0.51177	7.773000	0.85462	2.758000	0.94735	0.591000	0.81541	GTG	.		0.403	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SEMA3E	9723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83035265	83035265	+	Silent	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:83035265T>C	ENST00000307792.3	-	8	1391	c.924A>G	c.(922-924)gaA>gaG	p.E308E	SEMA3E_ENST00000427262.1_Silent_p.E248E	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	308	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				ATTTACCTAATTCATCAAAAT	0.348																																					p.E308E		.											.	SEMA3E	93	0			c.A924G						.						125.0	115.0	119.0					7																	83035265		2203	4300	6503	SO:0001819	synonymous_variant	9723	exon8			ACCTAATTCATCA	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.924A>G	7.37:g.83035265T>C		71.0	0.0		84.0	37.0	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1																																																																																			.		0.348	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
SEMA6D	80031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48056407	48056407	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr15:48056407T>A	ENST00000316364.5	+	11	1441	c.1002T>A	c.(1000-1002)gaT>gaA	p.D334E	SEMA6D_ENST00000389425.3_Missense_Mutation_p.D334E|SEMA6D_ENST00000536845.2_Missense_Mutation_p.D334E|SEMA6D_ENST00000355997.3_Missense_Mutation_p.D334E|SEMA6D_ENST00000389428.3_Missense_Mutation_p.D334E|SEMA6D_ENST00000537942.1_Missense_Mutation_p.D334E|SEMA6D_ENST00000558014.1_Missense_Mutation_p.D334E|SEMA6D_ENST00000358066.4_Missense_Mutation_p.D334E|SEMA6D_ENST00000354744.4_Missense_Mutation_p.D334E|SEMA6D_ENST00000558816.1_Missense_Mutation_p.D334E|SEMA6D_ENST00000389433.2_Missense_Mutation_p.D334E|SEMA6D_ENST00000389432.2_Missense_Mutation_p.D334E	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	334	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTAGCATGGATGACATTGAAA	0.448																																					p.D334E		.											.	SEMA6D	138	0			c.T1002A						.						121.0	111.0	115.0					15																	48056407		2198	4297	6495	SO:0001583	missense	80031	exon11			CATGGATGACATT	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1002T>A	15.37:g.48056407T>A	ENSP00000324857:p.Asp334Glu	186.0	0.0		104.0	84.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.753056	0.49362	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98	6.08	3.75	0.43078	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.136166	0.64402	D	0.000003	T	0.26521	0.0648	L	0.39020	1.185	0.46749	D	0.999186	D;D;D;B;D	0.59357	0.982;0.985;0.982;0.002;0.982	D;D;P;B;D	0.68765	0.934;0.96;0.88;0.029;0.934	T	0.22382	-1.0218	10	0.18710	T	0.47	.	4.086	0.09947	0.1269:0.0692:0.1327:0.6711	.	334;334;334;334;334	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	E	334	ENSP00000442040:D334E;ENSP00000446152:D334E;ENSP00000324857:D334E;ENSP00000374084:D334E;ENSP00000374083:D334E;ENSP00000346786:D334E;ENSP00000350770:D334E;ENSP00000374079:D334E;ENSP00000348276:D334E;ENSP00000374076:D334E	ENSP00000324857:D334E	D	+	3	2	SEMA6D	45843699	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	0.617000	0.24359	0.527000	0.28560	0.533000	0.62120	GAT	.		0.448	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SMAD5	4090	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	135510151	135510151	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:135510151T>C	ENST00000545279.1	+	7	1444	c.1084T>C	c.(1084-1086)Ttt>Ctt	p.F362L	SMAD5_ENST00000514641.2_3'UTR|SMAD5_ENST00000545620.1_Missense_Mutation_p.F362L	NM_001001419.1|NM_005903.5	NP_001001419.1|NP_005894.3	Q99717	SMAD5_HUMAN	SMAD family member 5	362	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAACTGCAACTTTCATCATGG	0.438																																					.		.											.	SMAD5	278	0			.						.						156.0	151.0	152.0					5																	135510151		2144	4287	6431	SO:0001583	missense	4090	.			TGCAACTTTCATC	U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000545279.1:c.1084T>C	5.37:g.135510151T>C	ENSP00000441954:p.Phe362Leu	121.0	0.0		118.0	50.0	.	O14688|Q15798|Q9UQA1	Missense_Mutation	SNP	ENST00000545279.1	37		.	.	.	.	.	.	.	.	.	.	T	13.14	2.148290	0.37923	.	.	ENSG00000113658	ENST00000545279;ENST00000545620	D;D	0.98602	-5.02;-5.02	6.17	5.0	0.66597	.	0.109437	0.64402	D	0.000005	D	0.93592	0.7954	N	0.08118	0	0.34780	D	0.734638	B	0.02656	0.0	B	0.12156	0.007	D	0.91905	0.5535	10	0.25106	T	0.35	.	12.9711	0.58513	0.1213:0.0:0.0:0.8787	.	362	F5GWU7	.	L	362	ENSP00000441954:F362L;ENSP00000446474:F362L	ENSP00000425018:F362L	F	+	1	0	SMAD5	135538050	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	8.040000	0.89188	1.134000	0.42165	-0.327000	0.08410	TTT	.		0.438	SMAD5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005903	
SOS1	6654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	39278406	39278406	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:39278406C>T	ENST00000426016.1	-	7	829	c.743G>A	c.(742-744)cGc>cAc	p.R248H	SOS1_ENST00000428721.2_Missense_Mutation_p.R191H|SOS1_ENST00000402219.2_Missense_Mutation_p.R248H|SOS1_ENST00000395038.2_Missense_Mutation_p.R248H			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	248	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				ATCTACTATGCGACTAAATAT	0.343									Noonan syndrome																												p.R248H		.											.	SOS1	851	0			c.G743A						.						109.0	112.0	111.0					2																	39278406		2203	4300	6503	SO:0001583	missense	6654	exon6	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ACTATGCGACTAA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.743G>A	2.37:g.39278406C>T	ENSP00000387784:p.Arg248His	99.0	0.0		91.0	85.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	37	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525374	0.64747	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000395038;ENST00000263879;ENST00000428721	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	5.74	5.74	0.90152	Dbl homology (DH) domain (5);	0.300521	0.36628	N	0.002494	D	0.87281	0.6138	N	0.22421	0.69	0.45150	D	0.99816	P	0.45768	0.866	B	0.38106	0.265	D	0.89190	0.3550	10	0.87932	D	0	.	19.544	0.95284	0.0:1.0:0.0:0.0	.	248	Q07889	SOS1_HUMAN	H	248;248;248;248;191	ENSP00000387784:R248H;ENSP00000384675:R248H;ENSP00000378479:R248H;ENSP00000399992:R191H	ENSP00000263879:R248H	R	-	2	0	SOS1	39131910	0.769000	0.28531	1.000000	0.80357	0.994000	0.84299	1.182000	0.32029	2.717000	0.92951	0.563000	0.77884	CGC	.		0.343	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
SPINK6	404203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	147593575	147593575	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:147593575T>C	ENST00000325630.2	+	3	440	c.184T>C	c.(184-186)Tgt>Cgt	p.C62R		NM_001195290.1|NM_205841.3	NP_001182219.1|NP_995313.2	Q6UWN8	ISK6_HUMAN	serine peptidase inhibitor, Kazal type 6	62	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGTGCCTTCTGTAAGGCCAT	0.423																																					p.C62R		.											.	SPINK6	91	0			c.T184C						.						93.0	77.0	82.0					5																	147593575		2203	4300	6503	SO:0001583	missense	404203	exon3			GCCTTCTGTAAGG	AY358716	CCDS34268.1	5q32	2011-08-31	2005-08-17		ENSG00000178172	ENSG00000178172		"""Serine peptidase inhibitors, Kazal type"""	29486	protein-coding gene	gene with protein product	"""protease inhibitor H"""	615868	"""serine protease inhibitor, Kazal type 6"""			15060002	Standard	NM_205841		Approved	MGC21394, UNQ844, BUSI2	uc021yff.1	Q6UWN8	OTTHUMG00000163425	ENST00000325630.2:c.184T>C	5.37:g.147593575T>C	ENSP00000324870:p.Cys62Arg	58.0	0.0		70.0	30.0	NM_205841	E0X656|Q8N5P0	Missense_Mutation	SNP	ENST00000325630.2	37	CCDS34268.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733542	0.69189	.	.	ENSG00000178172	ENST00000325630	D	0.91996	-2.95	5.75	5.75	0.90469	Proteinase inhibitor I1, Kazal (3);	0.000000	0.85682	D	0.000000	D	0.95535	0.8549	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95314	0.8414	8	.	.	.	-19.7628	12.7479	0.57291	0.0:0.0:0.0:1.0	.	62	Q6UWN8	ISK6_HUMAN	R	62	ENSP00000324870:C62R	.	C	+	1	0	SPINK6	147573768	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.529000	0.60588	2.326000	0.78906	0.533000	0.62120	TGT	.		0.423	SPINK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373332.1	NM_205841	
SRRT	51593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	100478943	100478943	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:100478943G>T	ENST00000347433.4	+	3	318	c.160G>T	c.(160-162)Gaa>Taa	p.E54*	SRRT_ENST00000432932.1_Nonsense_Mutation_p.E54*|SRRT_ENST00000388793.4_Nonsense_Mutation_p.E54*|SRRT_ENST00000457580.2_Nonsense_Mutation_p.E54*			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	54	Arg-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TAGTCGGGGTGAATATCGGGA	0.577																																					p.E54X		.											.	SRRT	92	0			c.G160T						.						97.0	87.0	91.0					7																	100478943		2203	4300	6503	SO:0001587	stop_gained	51593	exon3			CGGGGTGAATATC		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.160G>T	7.37:g.100478943G>T	ENSP00000314491:p.Glu54*	46.0	0.0		77.0	29.0	NM_001128853	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Nonsense_Mutation	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	G	36	5.732789	0.96856	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000431645	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	15.9856	0.80151	0.0:0.0:1.0:0.0	.	.	.	.	X	54;54;54;54;61	.	ENSP00000314491:E54X	E	+	1	0	SRRT	100316879	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	8.979000	0.93455	2.360000	0.80028	0.650000	0.86243	GAA	.		0.577	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
TACR1	6869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	75276831	75276831	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr2:75276831G>T	ENST00000305249.5	-	5	1717	c.952C>A	c.(952-954)Cat>Aat	p.H318N		NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	318					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	CGGAAGGCATGCTTGAAGCCC	0.587																																					p.H318N	Pancreas(64;62 1268 3653 14826 43765)	.											.	TACR1	523	0			c.C952A						.						34.0	32.0	33.0					2																	75276831		2203	4300	6503	SO:0001583	missense	6869	exon5			AGGCATGCTTGAA	M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.952C>A	2.37:g.75276831G>T	ENSP00000303522:p.His318Asn	37.0	0.0		47.0	25.0	NM_001058	A8K150	Missense_Mutation	SNP	ENST00000305249.5	37	CCDS1958.1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.827426	0.50845	.	.	ENSG00000115353	ENST00000305249	T	0.36157	1.27	5.25	4.38	0.52667	.	0.047899	0.85682	D	0.000000	T	0.40067	0.1102	L	0.59436	1.845	0.80722	D	1	B	0.34399	0.452	B	0.42214	0.38	T	0.18398	-1.0338	10	0.27785	T	0.31	.	11.7451	0.51815	0.0848:0.0:0.9152:0.0	.	318	P25103	NK1R_HUMAN	N	318	ENSP00000303522:H318N	ENSP00000303522:H318N	H	-	1	0	TACR1	75130339	1.000000	0.71417	0.990000	0.47175	0.973000	0.67179	6.397000	0.73239	1.439000	0.47511	0.563000	0.77884	CAT	.		0.587	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252239.3	NM_001058	
TLR5	7100	hgsc.bcm.edu;broad.mit.edu	37	1	223284253	223284253	+	Silent	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr1:223284253C>A	ENST00000540964.1	-	4	2582	c.2121G>T	c.(2119-2121)gtG>gtT	p.V707V	TLR5_ENST00000342210.6_Silent_p.V707V			O60602	TLR5_HUMAN	toll-like receptor 5	707	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.		Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1). {ECO:0000269|PubMed:14623910}.		cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(131;0.0851)		AAGCATTCTGCACCCATGTGA	0.463																																					p.V707V		.											.	TLR5	525	0			c.G2121T						.						65.0	62.0	63.0					1																	223284253		2203	4300	6503	SO:0001819	synonymous_variant	7100	exon6			ATTCTGCACCCAT		CCDS31033.1	1q32.3-q42	2014-01-29			ENSG00000187554	ENSG00000187554			11851	protein-coding gene	gene with protein product	"""Toll/interleukin-1 receptor-like protein 3"""	603031	"""systemic lupus erythematosus susceptibility 1"""	SLEB1		9435236, 16027372	Standard	NM_003268		Approved	TIL3, FLJ10052, MGC126430, MGC126431	uc001hnw.2	O60602	OTTHUMG00000037937	ENST00000540964.1:c.2121G>T	1.37:g.223284253C>A		123.0	0.0		106.0	5.0	NM_003268	B1AZ05|B3Y633|B9VJ63|D1CS80|D3DTB8|O15456|Q32MI2|Q32MI3	Silent	SNP	ENST00000540964.1	37	CCDS31033.1																																																																																			.		0.463	TLR5-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003268	
TMEM174	134288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	72469597	72469597	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr5:72469597T>A	ENST00000296776.5	+	1	576	c.527T>A	c.(526-528)aTg>aAg	p.M176K	TMEM174_ENST00000511737.1_Intron	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	176						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GCAGCCGCCATGTCAAGTCCT	0.532																																					p.M176K		.											.	TMEM174	91	0			c.T527A						.						84.0	84.0	84.0					5																	72469597		2203	4300	6503	SO:0001583	missense	134288	exon1			CCGCCATGTCAAG	BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.527T>A	5.37:g.72469597T>A	ENSP00000296776:p.Met176Lys	167.0	0.0		142.0	61.0	NM_153217	B2RDA0|Q96N81	Missense_Mutation	SNP	ENST00000296776.5	37	CCDS4018.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.438246	0.25900	.	.	ENSG00000164325	ENST00000296776	.	.	.	5.09	-6.92	0.01644	.	1.617020	0.02858	N	0.129920	T	0.40694	0.1127	L	0.44542	1.39	0.09310	N	1	B	0.22346	0.068	B	0.21546	0.035	T	0.30387	-0.9980	9	0.15952	T	0.53	-23.6664	17.3104	0.87208	0.0:0.746:0.1382:0.1158	.	176	Q8WUU8	TM174_HUMAN	K	176	.	ENSP00000296776:M176K	M	+	2	0	TMEM174	72505353	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.251000	0.02882	-1.255000	0.02481	-0.912000	0.02778	ATG	.		0.532	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254036.1	NM_153217	
TMEM42	131616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44906567	44906567	+	Silent	SNP	G	G	A	rs376440839		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr3:44906567G>A	ENST00000302392.4	+	3	431	c.375G>A	c.(373-375)caG>caA	p.Q125Q		NM_144638.1	NP_653239.1	Q69YG0	TMM42_HUMAN	transmembrane protein 42	125						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		GAGAGTGCCAGGAGGTCTTGT	0.572																																					p.Q125Q		.											.	TMEM42	90	0			c.G375A						.	G		1,4405	2.1+/-5.4	0,1,2202	206.0	160.0	176.0		375	2.6	1.0	3		176	0,8600		0,0,4300	no	coding-synonymous	TMEM42	NM_144638.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		125/160	44906567	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	131616	exon3			GTGCCAGGAGGTC	AL834253	CCDS2722.1	3p21.31	2005-01-19			ENSG00000169964	ENSG00000169964			28444	protein-coding gene	gene with protein product						12477932	Standard	NM_144638		Approved	MGC29956	uc003cnz.3	Q69YG0	OTTHUMG00000133092	ENST00000302392.4:c.375G>A	3.37:g.44906567G>A		155.0	0.0		135.0	64.0	NM_144638	Q8WUQ6	Silent	SNP	ENST00000302392.4	37	CCDS2722.1																																																																																			.		0.572	TMEM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256750.2	NM_144638	
URM1	81605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131152007	131152007	+	Silent	SNP	C	C	T	rs374697837		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr9:131152007C>T	ENST00000372853.4	+	5	362	c.300C>T	c.(298-300)ggC>ggT	p.G100G	URM1_ENST00000483206.1_3'UTR|RP11-339B21.11_ENST00000609303.1_lincRNA|URM1_ENST00000372850.1_3'UTR|URM1_ENST00000452446.1_3'UTR|MIR219-2_ENST00000385220.1_lincRNA	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1											cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						CTCTGCACGGCGGCTGAGGGC	0.647																																					p.G100G		.											.	URM1	90	0			c.C300T						.	C	,	0,4406		0,0,2203	54.0	47.0	49.0		,300	-9.3	0.6	9		49	1,8599	1.2+/-3.3	0,1,4299	no	utr-3,coding-synonymous	URM1	NM_001135947.1,NM_030914.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,100/102	131152007	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	81605	exon5			GCACGGCGGCTGA	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.300C>T	9.37:g.131152007C>T		101.0	0.0		94.0	39.0	NM_030914		Silent	SNP	ENST00000372853.4	37	CCDS6900.1																																																																																			.		0.647	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054422.1	NM_030914	
USP26	83844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	132161219	132161219	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chrX:132161219G>A	ENST00000511190.1	-	6	1499	c.1030C>T	c.(1030-1032)Cgg>Tgg	p.R344W	USP26_ENST00000406273.1_Missense_Mutation_p.R344W|USP26_ENST00000370832.1_Missense_Mutation_p.R344W	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	344	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					AAAAGTAGCCGTGCCAAGCAC	0.378																																					p.R344W	NSCLC(104;342 1621 36940 47097 52632)	.											.	USP26	661	0			c.C1030T						.						34.0	36.0	35.0					X																	132161219		2197	4288	6485	SO:0001583	missense	83844	exon1			GTAGCCGTGCCAA	AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1030C>T	X.37:g.132161219G>A	ENSP00000423390:p.Arg344Trp	268.0	0.0		264.0	133.0	NM_031907	B9WRT6|Q5H9H4	Missense_Mutation	SNP	ENST00000511190.1	37	CCDS14635.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166360	0.38217	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.32023	1.47;1.47;1.47	3.71	2.85	0.33270	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.532585	0.13822	N	0.360341	T	0.37972	0.1023	L	0.38175	1.15	0.09310	N	1	D	0.61697	0.99	P	0.59595	0.86	T	0.09975	-1.0650	10	0.62326	D	0.03	-1.6362	8.7988	0.34896	0.1175:0.0:0.8825:0.0	.	344	Q9BXU7	UBP26_HUMAN	W	344	ENSP00000359869:R344W;ENSP00000423390:R344W;ENSP00000384360:R344W	ENSP00000359869:R344W	R	-	1	2	USP26	131988885	0.719000	0.27986	0.002000	0.10522	0.010000	0.07245	1.903000	0.39858	0.948000	0.37687	-0.381000	0.06696	CGG	.		0.378	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359441.1	NM_031907	
YWHAH	7533	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32352465	32352465	+	Missense_Mutation	SNP	A	A	C	rs145603750		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr22:32352465A>C	ENST00000248975.5	+	2	700	c.427A>C	c.(427-429)Aaa>Caa	p.K143Q	snoU13_ENST00000459049.1_RNA|YWHAH_ENST00000397492.1_3'UTR|YWHAH_ENST00000471374.1_3'UTR	NM_003405.3	NP_003396.1	Q04917	1433F_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta	143					apoptotic process (GO:0006915)|glucocorticoid catabolic process (GO:0006713)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular protein transport (GO:0006886)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane depolarization during action potential (GO:0086010)|membrane organization (GO:0061024)|negative regulation of dendrite morphogenesis (GO:0050774)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of sodium ion transport (GO:0002028)|regulation of synaptic plasticity (GO:0048167)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|glucocorticoid receptor binding (GO:0035259)|insulin-like growth factor receptor binding (GO:0005159)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|large_intestine(1)|upper_aerodigestive_tract(1)	4						TGGGGAGAAGAAAAACAGTGT	0.493																																					p.K143Q	Ovarian(98;460 2060 9263 44007)	.											.	YWHAH	1082	0			c.A427C						.						70.0	66.0	68.0					22																	32352465		2203	4300	6503	SO:0001583	missense	7533	exon2			GAGAAGAAAAACA	X78138	CCDS13901.1	22q12.1-q13.1	2013-12-03	2013-12-03		ENSG00000128245	ENSG00000128245			12853	protein-coding gene	gene with protein product	"""14-3-3 eta"""	113508	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide"""	YWHA1			Standard	NM_003405		Approved		uc003alz.3	Q04917	OTTHUMG00000030833	ENST00000248975.5:c.427A>C	22.37:g.32352465A>C	ENSP00000248975:p.Lys143Gln	74.0	2.0		24.0	19.0	NM_003405		Missense_Mutation	SNP	ENST00000248975.5	37	CCDS13901.1	.	.	.	.	.	.	.	.	.	.	A	12.46	1.944516	0.34283	.	.	ENSG00000128245	ENST00000248975;ENST00000420430	T;T	0.49139	0.79;0.79	5.95	3.85	0.44370	14-3-3 domain (4);	0.112873	0.64402	D	0.000016	T	0.33059	0.0850	N	0.25890	0.77	0.80722	D	1	B;B	0.29136	0.006;0.234	B;B	0.25291	0.008;0.059	T	0.11348	-1.0591	10	0.72032	D	0.01	0.1121	9.5852	0.39512	0.8595:0.0:0.1405:0.0	.	143;143	B2R6N6;Q04917	.;1433F_HUMAN	Q	143;130	ENSP00000248975:K143Q;ENSP00000406747:K130Q	ENSP00000248975:K143Q	K	+	1	0	YWHAH	30682465	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.444000	0.44890	0.514000	0.28300	0.533000	0.62120	AAA	.		0.493	YWHAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075721.2	NM_003405	
ZACN	353174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74075584	74075584	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr17:74075584C>A	ENST00000334586.5	+	2	245	c.162C>A	c.(160-162)aaC>aaA	p.N54K	EXOC7_ENST00000591724.1_5'Flank|ZACN_ENST00000392503.2_Missense_Mutation_p.N54K	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	54					ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						AGATCCCGAACAATGGGAGTG	0.542																																					p.N54K		.											.	ZACN	90	0			c.C162A						.						164.0	140.0	148.0					17																	74075584		2203	4300	6503	SO:0001583	missense	353174	exon2			CCCGAACAATGGG	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.162C>A	17.37:g.74075584C>A	ENSP00000334854:p.Asn54Lys	153.0	0.0		164.0	78.0	NM_180990	Q2TB29|Q6ZWK3|Q86YW4	Missense_Mutation	SNP	ENST00000334586.5	37	CCDS11740.2	.	.	.	.	.	.	.	.	.	.	C	7.967	0.748165	0.15710	.	.	ENSG00000186919	ENST00000334586;ENST00000392503	T	0.77620	-1.11	3.66	-0.0571	0.13803	Neurotransmitter-gated ion-channel ligand-binding (3);	0.810482	0.11207	N	0.588107	T	0.57504	0.2058	L	0.38838	1.175	0.09310	N	1	B	0.14012	0.009	B	0.10450	0.005	T	0.39210	-0.9625	10	0.06365	T	0.9	-6.723	1.8195	0.03107	0.2027:0.3037:0.3649:0.1286	.	54	Q401N2	ZACN_HUMAN	K	54	ENSP00000334854:N54K	ENSP00000334854:N54K	N	+	3	2	ZACN	71587179	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-1.604000	0.02076	0.176000	0.19873	0.462000	0.41574	AAC	.		0.542	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	NM_180990	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100349486	100349486	+	RNA	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr7:100349486C>A	ENST00000348028.3	+	0	1923				ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGCCCACAGTCCCCAAAGAAA	0.468																																					.		.											.	ZAN	142	0			.						.						177.0	200.0	192.0					7																	100349486		1856	4114	5970			7455	.			CACAGTCCCCAAA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349486C>A		136.0	0.0		164.0	93.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37																																																																																				.		0.468	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZFPM2	23414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	106813922	106813922	+	Missense_Mutation	SNP	G	G	A	rs575054307		TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr8:106813922G>A	ENST00000407775.2	+	8	1862	c.1612G>A	c.(1612-1614)Gtc>Atc	p.V538I	RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.V406I|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.V269I|ZFPM2_ENST00000520492.1_Missense_Mutation_p.V406I|RP11-152P17.2_ENST00000520433.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	538					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CTACCCTCCCGTCATTTACAG	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		19209	0.0		0.0	False		,,,				2504	0.001				p.V538I		.											.	ZFPM2	139	0			c.G1612A						.						79.0	83.0	82.0					8																	106813922		1937	4122	6059	SO:0001583	missense	23414	exon8			CCTCCCGTCATTT	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1612G>A	8.37:g.106813922G>A	ENSP00000384179:p.Val538Ile	45.0	0.0		35.0	34.0	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248440	0.39797	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20738	2.05;2.53;2.53;3.73	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.40372	0.1114	L	0.40543	1.245	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.01280	-1.1397	10	0.37606	T	0.19	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	538	Q8WW38	FOG2_HUMAN	I	538;406;406;269	ENSP00000384179:V538I;ENSP00000430757:V406I;ENSP00000428720:V406I;ENSP00000367733:V269I	ENSP00000367733:V269I	V	+	1	0	ZFPM2	106883098	1.000000	0.71417	0.139000	0.22197	0.231000	0.25187	7.863000	0.87023	2.836000	0.97738	0.655000	0.94253	GTC	.		0.438	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
ZNF221	7638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44471018	44471018	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:44471018G>A	ENST00000251269.5	+	6	1692	c.1364G>A	c.(1363-1365)tGt>tAt	p.C455Y	ZNF221_ENST00000592350.1_Missense_Mutation_p.C455Y|ZNF221_ENST00000587682.1_Missense_Mutation_p.C455Y	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TGTGAGGAGTGTGGTAAGGAC	0.438																																					p.C455Y		.											.	ZNF221	91	0			c.G1364A						.						70.0	67.0	68.0					19																	44471018		2203	4300	6503	SO:0001583	missense	7638	exon6			AGGAGTGTGGTAA	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1364G>A	19.37:g.44471018G>A	ENSP00000251269:p.Cys455Tyr	64.0	0.0		71.0	39.0	NM_013359	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	37	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	g	25.1	4.601654	0.87055	.	.	ENSG00000159905	ENST00000251269	D	0.85861	-2.04	2.63	2.63	0.31362	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94108	0.8111	H	0.96175	3.78	0.36439	D	0.865365	D	0.89917	1.0	D	0.97110	1.0	D	0.96344	0.9253	9	0.66056	D	0.02	.	12.3732	0.55265	0.0:0.0:1.0:0.0	.	455	Q9UK13	ZN221_HUMAN	Y	455	ENSP00000251269:C455Y	ENSP00000251269:C455Y	C	+	2	0	ZNF221	49162858	1.000000	0.71417	0.497000	0.27552	0.862000	0.49288	7.342000	0.79310	1.460000	0.47911	0.313000	0.20887	TGT	.		0.438	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
ZNF584	201514	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58928202	58928202	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr19:58928202A>G	ENST00000306910.4	+	4	840	c.317A>G	c.(316-318)gAg>gGg	p.E106G	ZNF584_ENST00000596921.1_3'UTR|ZNF584_ENST00000322834.7_Missense_Mutation_p.R139G|CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000599238.1_3'UTR|ZNF584_ENST00000593920.1_Missense_Mutation_p.E61G	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		GTGGAGGATGAGAGAGCCCAT	0.488																																					p.E106G		.											.	ZNF584	90	0			c.A317G						.						66.0	55.0	59.0					19																	58928202		2203	4300	6503	SO:0001583	missense	201514	exon4			AGGATGAGAGAGC	AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.317A>G	19.37:g.58928202A>G	ENSP00000306756:p.Glu106Gly	48.0	2.0		47.0	24.0	NM_173548	A8K203	Missense_Mutation	SNP	ENST00000306910.4	37	CCDS12979.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.35|10.35	1.326992|1.326992	0.24080|0.24080	.|.	.|.	ENSG00000171574|ENSG00000171574	ENST00000306910|ENST00000322834	T|T	0.07216|0.01438	3.21|4.89	2.91|2.91	0.72|0.72	0.18214|0.18214	.|.	.|.	.|.	.|.	.|.	T|T	0.00906|0.00906	0.0030|0.0030	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|P	0.12013|0.35507	0.005|0.506	B|B	0.08055|0.28011	0.003|0.085	T|T	0.49234|0.49234	-0.8961|-0.8961	9|8	0.27785|.	T|.	0.31|.	.|.	3.2451|3.2451	0.06794|0.06794	0.6195:0.2437:0.1368:0.0|0.6195:0.2437:0.1368:0.0	.|.	106|139	Q8IVC4|F6W0P0	ZN584_HUMAN|.	G|G	106|139	ENSP00000306756:E106G|ENSP00000320731:R139G	ENSP00000306756:E106G|.	E|R	+|+	2|1	0|2	ZNF584|ZNF584	63620014|63620014	0.528000|0.528000	0.26314|0.26314	0.025000|0.025000	0.17156|0.17156	0.036000|0.036000	0.12997|0.12997	1.192000|1.192000	0.32150|0.32150	0.071000|0.071000	0.16664|0.16664	0.460000|0.460000	0.39030|0.39030	GAG|AGA	.		0.488	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467022.1	NM_173548	
ZNF764	92595	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	30569410	30569410	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A73B-01A-12D-A32G-10	TCGA-DD-A73B-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	b4d9df4d-9dd6-46d9-a147-8b26ebd05af3	1669b7ec-5ff8-4578-afe1-3e5d3094b3bf	g.chr16:30569410C>A	ENST00000252797.2	-	1	174	c.94G>T	c.(94-96)Gcc>Tcc	p.A32S	ZNF764_ENST00000395091.2_Missense_Mutation_p.A32S|AC002310.13_ENST00000568114.1_Missense_Mutation_p.A32S	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	32	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						AAGTACACGGCCACGTCCGCG	0.716																																					p.A32S		.											.	ZNF764	91	0			c.G94T						.						18.0	21.0	20.0					16																	30569410		2194	4297	6491	SO:0001583	missense	92595	exon1			ACACGGCCACGTC	BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.94G>T	16.37:g.30569410C>A	ENSP00000252797:p.Ala32Ser	31.0	0.0		18.0	9.0	NM_001172679	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Missense_Mutation	SNP	ENST00000252797.2	37	CCDS10683.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322411	0.81580	.	.	ENSG00000169951	ENST00000252797;ENST00000395091	T;T	0.03181	4.02;4.02	4.27	3.3	0.37823	Krueppel-associated box (4);	0.000000	0.35936	N	0.002896	T	0.14313	0.0346	M	0.76727	2.345	0.28520	N	0.913117	D;D	0.76494	0.999;0.997	D;D	0.85130	0.997;0.994	T	0.01062	-1.1464	10	0.56958	D	0.05	-19.3155	8.5193	0.33266	0.0:0.891:0.0:0.109	.	32;32	B3KSN2;Q96H86	.;ZN764_HUMAN	S	32	ENSP00000252797:A32S;ENSP00000378526:A32S	ENSP00000252797:A32S	A	-	1	0	ZNF764	30476911	0.986000	0.35501	1.000000	0.80357	0.775000	0.43874	2.305000	0.43664	1.128000	0.42052	0.462000	0.41574	GCC	.		0.716	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255541.1	NM_033410	
