#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADSL	158	ucsc.edu;bcgsc.ca	37	22	40742604	40742604	+	Silent	SNP	C	C	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr22:40742604C>A	ENST00000216194.7	+	1	98	c.42C>A	c.(40-42)cgC>cgA	p.R14R	ADSL_ENST00000454266.2_Silent_p.R14R|ADSL_ENST00000342312.6_Silent_p.R14R	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	14					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						ACAGCTACCGCTCACCTCTTG	0.637																																					p.R14R	Colon(4;65 130 1097 1516)	.											.	ADSL	652	0			c.C42A						.						34.0	28.0	30.0					22																	40742604		2202	4299	6501	SO:0001819	synonymous_variant	158	exon1			CTACCGCTCACCT	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.42C>A	22.37:g.40742604C>A		38.0	0.0		34.0	4.0	NM_001123378	B0QY76|O75495|Q5TI34	Silent	SNP	ENST00000216194.7	37	CCDS14001.1																																																																																			.		0.637	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321386.1	NM_000026	
AP2B1	163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33932839	33932839	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr17:33932839G>T	ENST00000262325.7	+	4	812	c.259G>T	c.(259-261)Gct>Tct	p.A87S	AP2B1_ENST00000589344.1_Missense_Mutation_p.A87S|AP2B1_ENST00000592545.1_Missense_Mutation_p.A87S|AP2B1_ENST00000538556.1_Missense_Mutation_p.A30S|AP2B1_ENST00000537622.2_Missense_Mutation_p.A87S|AP2B1_ENST00000312678.8_Missense_Mutation_p.A87S	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	87					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GGCCATCATGGCTGTAAACAG	0.428																																					p.A87S		.											.	AP2B1	91	0			c.G259T						.						101.0	94.0	96.0					17																	33932839		2203	4300	6503	SO:0001583	missense	163	exon4			ATCATGGCTGTAA	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.259G>T	17.37:g.33932839G>T	ENSP00000262325:p.Ala87Ser	79.0	0.0		90.0	34.0	NM_001282	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863089	0.91511	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.54	5.54	0.83059	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	L	0.58428	1.81	0.80722	D	1	P;P;B	0.48911	0.859;0.917;0.252	P;D;P	0.69824	0.888;0.966;0.523	T	0.43925	-0.9361	10	0.66056	D	0.02	-23.47	18.487	0.90833	0.0:0.0:1.0:0.0	.	87;87;87	B4DWG4;P63010;P63010-2	.;AP2B1_HUMAN;.	S	87;87;30;87	ENSP00000262325:A87S;ENSP00000314414:A87S;ENSP00000440563:A30S;ENSP00000437413:A87S	ENSP00000262325:A87S	A	+	1	0	AP2B1	30956952	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	8.011000	0.88624	2.603000	0.88011	0.467000	0.42956	GCT	.		0.428	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32641025	32641025	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr2:32641025T>C	ENST00000421745.2	+	10	2800	c.2666T>C	c.(2665-2667)tTt>tCt	p.F889S		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	889					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AAGAATGGTTTTGAGAGAGAA	0.383																																					p.F889S	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.T2666C						.						70.0	70.0	70.0					2																	32641025		2203	4300	6503	SO:0001583	missense	57448	exon10			ATGGTTTTGAGAG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2666T>C	2.37:g.32641025T>C	ENSP00000393596:p.Phe889Ser	144.0	0.0		184.0	40.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	0.094	-1.162749	0.01673	.	.	ENSG00000115760	ENST00000421745	T	0.61742	0.08	5.65	-1.31	0.09230	.	0.874234	0.10158	N	0.708707	T	0.24275	0.0588	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17868	-1.0355	10	0.15499	T	0.54	.	1.9279	0.03321	0.3148:0.0788:0.3589:0.2475	.	889	Q9NR09	BIRC6_HUMAN	S	889	ENSP00000393596:F889S	ENSP00000393596:F889S	F	+	2	0	BIRC6	32494529	0.043000	0.20138	0.714000	0.30535	0.691000	0.40173	-0.028000	0.12350	0.084000	0.17077	-0.313000	0.08912	TTT	.		0.383	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
CDAN1	146059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43027807	43027807	+	Missense_Mutation	SNP	G	G	A	rs371090455		TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr15:43027807G>A	ENST00000356231.3	-	4	867	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	282					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CTTCCTGTCCGGCTGGGGAGG	0.577																																					p.R282W		.											.	CDAN1	92	0			c.C844T						.	G	TRP/ARG	1,4401		0,1,2200	41.0	44.0	43.0		844	1.6	0.1	15		43	0,8576		0,0,4288	no	missense	CDAN1	NM_138477.2	101	0,1,6488	AA,AG,GG		0.0,0.0227,0.0077	benign	282/1228	43027807	1,12977	2201	4288	6489	SO:0001583	missense	146059	exon4			CTGTCCGGCTGGG	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.844C>T	15.37:g.43027807G>A	ENSP00000348564:p.Arg282Trp	122.0	0.0		95.0	23.0	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	G	8.051	0.765986	0.15983	2.27E-4	0.0	ENSG00000140326	ENST00000356231;ENST00000267892	D	0.88124	-2.34	5.68	1.64	0.23874	.	0.482595	0.23365	N	0.048974	T	0.73845	0.3639	L	0.33485	1.01	0.21256	N	0.999742	B	0.34255	0.445	B	0.25140	0.058	T	0.64635	-0.6361	10	0.52906	T	0.07	-13.3476	3.943	0.09336	0.2631:0.0:0.5654:0.1716	.	282	Q8IWY9	CDAN1_HUMAN	W	282;280	ENSP00000348564:R282W	ENSP00000267892:R280W	R	-	1	2	CDAN1	40815099	0.025000	0.19082	0.149000	0.22428	0.007000	0.05969	0.810000	0.27183	0.306000	0.22856	-0.254000	0.11334	CGG	.		0.577	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
CLDN20	49861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155597357	155597357	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr6:155597357C>A	ENST00000367165.3	+	2	884	c.504C>A	c.(502-504)ttC>ttA	p.F168L	TFB1M_ENST00000367166.4_Intron	NM_001001346.3	NP_001001346.1	P56880	CLD20_HUMAN	claudin 20	168					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|lung(2)	3				OV - Ovarian serous cystadenocarcinoma(155;7.82e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0114)		ATATCGGATTCATTTCTGCAA	0.443																																					p.F168L		.											.	CLDN20	90	0			c.C504A						.						86.0	79.0	81.0					6																	155597357		2203	4300	6503	SO:0001583	missense	49861	exon2			CGGATTCATTTCT	BC020838	CCDS5249.1	6q25	2008-08-01			ENSG00000171217	ENSG00000171217		"""Claudins"""	2042	protein-coding gene	gene with protein product						16836752	Standard	NM_001001346		Approved		uc003qql.2	P56880	OTTHUMG00000015882	ENST00000367165.3:c.504C>A	6.37:g.155597357C>A	ENSP00000356133:p.Phe168Leu	147.0	0.0		141.0	51.0	NM_001001346		Missense_Mutation	SNP	ENST00000367165.3	37	CCDS5249.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500608	0.44455	.	.	ENSG00000171217	ENST00000367165	D	0.88354	-2.37	5.71	2.54	0.30619	.	0.053027	0.85682	D	0.000000	D	0.82788	0.5113	M	0.66439	2.03	0.44175	D	0.996981	P	0.52692	0.955	P	0.45167	0.472	T	0.82602	-0.0376	10	0.66056	D	0.02	.	9.2758	0.37698	0.0:0.6574:0.0:0.3426	.	168	P56880	CLD20_HUMAN	L	168	ENSP00000356133:F168L	ENSP00000356133:F168L	F	+	3	2	CLDN20	155639049	0.998000	0.40836	0.644000	0.29465	0.344000	0.29017	0.542000	0.23222	0.751000	0.32900	-0.251000	0.11542	TTC	.		0.443	CLDN20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042818.1	NM_001001346	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130293202	130293202	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr3:130293202A>G	ENST00000358511.6	+	7	3411	c.3380A>G	c.(3379-3381)cAc>cGc	p.H1127R	COL6A6_ENST00000453409.2_Missense_Mutation_p.H1127R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1127	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GCCCTGAGACACAGAGGTATC	0.562																																					p.H1127R		.											.	COL6A6	76	0			c.A3380G						.						78.0	88.0	85.0					3																	130293202		2022	4179	6201	SO:0001583	missense	131873	exon7			TGAGACACAGAGG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3380A>G	3.37:g.130293202A>G	ENSP00000351310:p.His1127Arg	171.0	0.0		183.0	74.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	A	0.021	-1.429275	0.01117	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.76448	-1.02;-1.02	5.28	-4.49	0.03504	von Willebrand factor, type A (3);	0.824174	0.10883	N	0.623530	T	0.44685	0.1305	N	0.00778	-1.195	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42413	-0.9453	10	0.11182	T	0.66	.	15.5559	0.76192	0.4941:0.0:0.5059:0.0	.	1127	A6NMZ7	CO6A6_HUMAN	R	1127	ENSP00000351310:H1127R;ENSP00000399236:H1127R	ENSP00000351310:H1127R	H	+	2	0	COL6A6	131775892	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.769000	0.04710	-1.147000	0.02851	-1.139000	0.01908	CAC	.		0.562	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
DCLRE1A	9937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	115602174	115602174	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr10:115602174C>A	ENST00000361384.2	-	6	3510	c.2593G>T	c.(2593-2595)Gct>Tct	p.A865S	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.A865S	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	865					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		AGAGTTACAGCCTCAAAGGCA	0.418								Other identified genes with known or suspected DNA repair function																													p.A865S		.											.	DCLRE1A	228	0			c.G2593T						.						236.0	214.0	222.0					10																	115602174		2203	4300	6503	SO:0001583	missense	9937	exon6			TTACAGCCTCAAA		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.2593G>T	10.37:g.115602174C>A	ENSP00000355185:p.Ala865Ser	92.0	0.0		98.0	38.0	NM_014881	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719324	0.30503	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.75477	-0.94;-0.94	5.96	-1.81	0.07882	Beta-lactamase-like (1);	0.836577	0.11199	N	0.588989	T	0.51517	0.1679	N	0.19112	0.55	0.19945	N	0.999946	B	0.15719	0.014	B	0.22152	0.038	T	0.34004	-0.9846	10	0.15952	T	0.53	-4.1529	4.6068	0.12382	0.2502:0.2104:0.0:0.5394	.	865	Q6PJP8	DCR1A_HUMAN	S	865	ENSP00000355185:A865S;ENSP00000358311:A865S	ENSP00000355185:A865S	A	-	1	0	DCLRE1A	115592164	0.917000	0.31117	0.998000	0.56505	0.954000	0.61252	0.244000	0.18124	0.118000	0.18165	-0.136000	0.14681	GCT	.		0.418	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
DYNC2H1	79659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	103029663	103029663	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr11:103029663T>A	ENST00000375735.2	+	28	4429	c.4285T>A	c.(4285-4287)Ttt>Att	p.F1429I	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.F1429I|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1429	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ATTCCCAAGATTTTATTTTAT	0.308																																					p.F1429I		.											.	DYNC2H1	68	0			c.T4285A						.						42.0	39.0	40.0					11																	103029663		1792	4059	5851	SO:0001583	missense	79659	exon28			CCAAGATTTTATT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4285T>A	11.37:g.103029663T>A	ENSP00000364887:p.Phe1429Ile	214.0	0.0		167.0	60.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.978285	0.92982	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.80123	-1.34;-1.34	5.36	5.36	0.76844	Dynein heavy chain, domain-2 (1);	0.000000	0.56097	U	0.000040	D	0.93844	0.8031	H	0.98446	4.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.96197	0.9142	10	0.87932	D	0	.	15.658	0.77158	0.0:0.0:0.0:1.0	.	1429;1429	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	I	1429	ENSP00000364887:F1429I;ENSP00000381167:F1429I	ENSP00000364887:F1429I	F	+	1	0	DYNC2H1	102534873	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.996000	0.70639	2.158000	0.67659	0.460000	0.39030	TTT	.		0.308	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
ENTPD1	953	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	97626110	97626110	+	Silent	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr10:97626110G>A	ENST00000371205.4	+	10	1786	c.1503G>A	c.(1501-1503)aaG>aaA	p.K501K	ENTPD1_ENST00000453258.2_Silent_p.K508K|ENTPD1_ENST00000543964.1_Silent_p.K393K|ENTPD1_ENST00000371207.3_Silent_p.K513K|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1_ENST00000371203.5_Silent_p.K363K|ENTPD1_ENST00000539125.1_Silent_p.K363K|ENTPD1-AS1_ENST00000416301.1_RNA|RP11-248J23.7_ENST00000491114.1_Intron|RP11-429G19.3_ENST00000433113.1_RNA			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	501					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		TCTTTCACAAGCCTTCATATT	0.458																																					p.K513K		.											.	ENTPD1	93	0			c.G1539A						.						138.0	128.0	132.0					10																	97626110		2203	4300	6503	SO:0001819	synonymous_variant	953	exon10			TCACAAGCCTTCA	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.1503G>A	10.37:g.97626110G>A		184.0	1.0		175.0	70.0	NM_001164178	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Silent	SNP	ENST00000371205.4	37	CCDS7444.1																																																																																			.		0.458	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776	
FMN2	56776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	240286619	240286619	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr1:240286619G>A	ENST00000319653.9	+	2	1986	c.1756G>A	c.(1756-1758)Gcc>Acc	p.A586T		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	586					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TAATCAGAATGCCCAGACGAA	0.488																																					p.A586T		.											.	FMN2	145	0			c.G1756A						.						131.0	116.0	121.0					1																	240286619		2203	4300	6503	SO:0001583	missense	56776	exon2			CAGAATGCCCAGA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1756G>A	1.37:g.240286619G>A	ENSP00000318884:p.Ala586Thr	43.0	0.0		95.0	82.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	10.53	1.377302	0.24944	.	.	ENSG00000155816	ENST00000447095;ENST00000319653	T;T	0.80214	-1.35;-1.35	5.69	4.78	0.61160	DEP domain (1);	0.359229	0.25951	N	0.027243	D	0.82912	0.5140	L	0.59436	1.845	0.80722	D	1	D	0.59767	0.986	P	0.50970	0.655	D	0.84909	0.0847	10	0.66056	D	0.02	.	14.7369	0.69422	0.0694:0.0:0.9306:0.0	.	586	Q9NZ56	FMN2_HUMAN	T	19;586	ENSP00000409308:A19T;ENSP00000318884:A586T	ENSP00000318884:A586T	A	+	1	0	FMN2	238353242	0.128000	0.22383	0.099000	0.21106	0.197000	0.23852	1.416000	0.34759	1.549000	0.49425	0.655000	0.94253	GCC	.		0.488	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
HECW2	57520	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197184307	197184307	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr2:197184307C>T	ENST00000260983.3	-	9	1489	c.1307G>A	c.(1306-1308)tGc>tAc	p.C436Y	HECW2_ENST00000409111.1_Missense_Mutation_p.C80Y	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	436					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CCTCTCAGAGCAGGTCGCTGT	0.498																																					p.C436Y		.											.	HECW2	668	0			c.G1307A						.						55.0	56.0	56.0					2																	197184307		2203	4300	6503	SO:0001583	missense	57520	exon9			TCAGAGCAGGTCG	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1307G>A	2.37:g.197184307C>T	ENSP00000260983:p.Cys436Tyr	87.0	0.0		85.0	29.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	1.486	-0.555945	0.03967	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.30981	1.51;1.53	5.64	3.84	0.44239	.	1.089900	0.06720	N	0.774739	T	0.23289	0.0563	N	0.19112	0.55	0.23802	N	0.996804	P	0.34462	0.454	B	0.28784	0.094	T	0.29088	-1.0023	10	0.40728	T	0.16	.	14.3605	0.66768	0.0:0.6543:0.3457:0.0	.	436	Q9P2P5	HECW2_HUMAN	Y	80;436	ENSP00000386775:C80Y;ENSP00000260983:C436Y	ENSP00000260983:C436Y	C	-	2	0	HECW2	196892552	0.032000	0.19561	0.023000	0.16930	0.004000	0.04260	0.190000	0.17057	0.926000	0.37118	-0.181000	0.13052	TGC	.		0.498	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	185897698	185897698	+	Nonsense_Mutation	SNP	T	T	G			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr1:185897698T>G	ENST00000271588.4	+	10	1680	c.1451T>G	c.(1450-1452)tTa>tGa	p.L484*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.L484*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	484	Ig-like C2-type 1.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGTGTGAACTTAGATATTGCA	0.373																																					p.L484X		.											.	HMCN1	113	0			c.T1451G						.						147.0	138.0	141.0					1																	185897698		2203	4300	6503	SO:0001587	stop_gained	83872	exon10			TGAACTTAGATAT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.1451T>G	1.37:g.185897698T>G	ENSP00000271588:p.Leu484*	49.0	0.0		81.0	8.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	38	7.259555	0.98171	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.35	4.43	0.53597	.	0.057434	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.146	0.72653	0.0:0.0:0.8523:0.1477	.	.	.	.	X	484	.	ENSP00000271588:L484X	L	+	2	0	HMCN1	184164321	1.000000	0.71417	0.972000	0.41901	0.419000	0.31324	4.847000	0.62867	1.221000	0.43506	-0.219000	0.12488	TTA	.		0.373	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
IL17RD	54756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57130461	57130461	+	Missense_Mutation	SNP	C	C	T	rs146776354		TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr3:57130461C>T	ENST00000296318.7	-	13	2268	c.2180G>A	c.(2179-2181)cGc>cAc	p.R727H	IL17RD_ENST00000463523.1_Missense_Mutation_p.R583H|IL17RD_ENST00000427856.2_Missense_Mutation_p.R703H|IL17RD_ENST00000320057.5_Missense_Mutation_p.R583H	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	727					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		AGTGTAGCTGCGGCAACCAAG	0.527																																					p.R727H		.											.	IL17RD	500	0			c.G2180A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	183.0	169.0	174.0		2180	-6.5	0.5	3	dbSNP_134	174	0,8600		0,0,4300	no	missense	IL17RD	NM_017563.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	727/740	57130461	1,13005	2203	4300	6503	SO:0001583	missense	54756	exon13			TAGCTGCGGCAAC	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.2180G>A	3.37:g.57130461C>T	ENSP00000296318:p.Arg727His	118.0	0.0		120.0	29.0	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993148	0.35131	2.27E-4	0.0	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.08896	3.06;3.05;3.04;3.05	5.78	-6.46	0.01908	.	0.734007	0.13495	N	0.383729	T	0.02342	0.0072	N	0.01576	-0.805	0.21290	N	0.99974	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45877	-0.9231	10	0.17832	T	0.49	-0.6985	12.3348	0.55060	0.0:0.0903:0.0891:0.8207	.	727;703	Q8NFM7;Q8NFM7-3	I17RD_HUMAN;.	H	727;583;703;583	ENSP00000296318:R727H;ENSP00000322250:R583H;ENSP00000399209:R703H;ENSP00000417516:R583H	ENSP00000296318:R727H	R	-	2	0	IL17RD	57105501	0.998000	0.40836	0.505000	0.27651	0.636000	0.38137	0.249000	0.18216	-1.236000	0.02542	-0.142000	0.14014	CGC	C|1.000;T|0.000		0.527	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
IRF2	3660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	185339323	185339323	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr4:185339323T>A	ENST00000393593.3	-	5	616	c.409A>T	c.(409-411)Aag>Tag	p.K137*	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	137					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K137Q(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		AAGATTACCTTGATGTGCTTA	0.403																																					p.K137X		.											.	IRF2	91	1	Substitution - Missense(1)	liver(1)	c.A409T						.						316.0	259.0	279.0					4																	185339323		2203	4300	6503	SO:0001587	stop_gained	3660	exon5			TTACCTTGATGTG		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.409A>T	4.37:g.185339323T>A	ENSP00000377218:p.Lys137*	183.0	0.0		94.0	65.0	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Nonsense_Mutation	SNP	ENST00000393593.3	37	CCDS3835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.1|26.1	4.703939|4.703939	0.88924|0.88924	.|.	.|.	ENSG00000168310|ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316|ENST00000505067	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.770201|.	0.13187|.	N|.	0.407046|.	.|T	.|0.64594	.|0.2612	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71148	.|-0.4677	.|3	0.02654|.	T|.	1|.	-2.7951|-2.7951	12.6398|12.6398	0.56702|0.56702	0.0:0.0:0.1377:0.8623|0.0:0.0:0.1377:0.8623	.|.	.|.	.|.	.|.	X|L	137|35	.|.	ENSP00000377218:K137X|.	K|Q	-|-	1|2	0|0	IRF2|IRF2	185576317|185576317	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	2.991000|2.991000	0.49409|0.49409	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	AAG|CAA	.		0.403	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
ITPR3	3710	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33644858	33644858	+	Missense_Mutation	SNP	G	G	A	rs147513071	byFrequency	TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr6:33644858G>A	ENST00000374316.5	+	28	4574	c.3514G>A	c.(3514-3516)Gtc>Atc	p.V1172I	ITPR3_ENST00000605930.1_Missense_Mutation_p.V1172I			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1172					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CTACCAGATCGTCAAGGGCGT	0.652													G|||	6	0.00119808	0.0045	0.0	5008	,	,		17174	0.0		0.0	False		,,,				2504	0.0				p.V1172I		.											.	ITPR3	1085	0			c.G3514A						.	G	ILE/VAL	16,4390	24.3+/-50.5	0,16,2187	43.0	45.0	44.0		3514	5.5	1.0	6	dbSNP_134	44	0,8600		0,0,4300	yes	missense	ITPR3	NM_002224.3	29	0,16,6487	AA,AG,GG		0.0,0.3631,0.123	probably-damaging	1172/2672	33644858	16,12990	2203	4300	6503	SO:0001583	missense	3710	exon27			CAGATCGTCAAGG	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.3514G>A	6.37:g.33644858G>A	ENSP00000363435:p.Val1172Ile	234.0	1.0		181.0	28.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039438	0.75617	0.003631	0.0	ENSG00000096433	ENST00000374316	D	0.89050	-2.46	5.52	5.52	0.82312	.	0.064937	0.64402	D	0.000009	T	0.78553	0.4301	N	0.24115	0.695	0.80722	D	1	P	0.51791	0.948	P	0.46659	0.523	T	0.78420	-0.2211	10	0.10377	T	0.69	-52.2799	19.0206	0.92912	0.0:0.0:1.0:0.0	.	1172	Q14573	ITPR3_HUMAN	I	1172	ENSP00000363435:V1172I	ENSP00000363435:V1172I	V	+	1	0	ITPR3	33752836	1.000000	0.71417	0.999000	0.59377	0.832000	0.47134	6.068000	0.71201	2.588000	0.87417	0.655000	0.94253	GTC	G|0.999;A|0.001		0.652	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
KIF20B	9585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	91498042	91498042	+	Silent	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr10:91498042G>A	ENST00000371728.3	+	20	3509	c.3444G>A	c.(3442-3444)gcG>gcA	p.A1148A	KIF20B_ENST00000416354.1_Silent_p.A1178A|KIF20B_ENST00000394289.2_Silent_p.A1148A|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Silent_p.A1108A	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1148					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GAAAGAGAGCGCTTTCAGAAC	0.338																																					p.A1108A		.											.	KIF20B	93	0			c.G3324A						.						71.0	80.0	77.0					10																	91498042		2203	4297	6500	SO:0001819	synonymous_variant	9585	exon20			GAGAGCGCTTTCA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3444G>A	10.37:g.91498042G>A		102.0	0.0		95.0	36.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Silent	SNP	ENST00000371728.3	37																																																																																				.		0.338	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
MED14	9282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	40511063	40511063	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chrX:40511063G>T	ENST00000324817.1	-	31	4478	c.4360C>A	c.(4360-4362)Cca>Aca	p.P1454T		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1454					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTGTCTATGGACGCCCACCA	0.383																																					p.P1454T		.											.	MED14	289	0			c.C4360A						.						45.0	39.0	41.0					X																	40511063		2203	4299	6502	SO:0001583	missense	9282	exon31			TCTATGGACGCCC	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.4360C>A	X.37:g.40511063G>T	ENSP00000323720:p.Pro1454Thr	505.0	1.0		409.0	131.0	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067812	0.55539	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.88	5.88	0.94601	.	0.157371	0.56097	D	0.000024	T	0.47340	0.1440	N	0.22421	0.69	0.51233	D	0.999919	B	0.33694	0.421	B	0.29785	0.107	T	0.51180	-0.8738	9	0.87932	D	0	.	19.1532	0.93499	0.0:0.0:1.0:0.0	.	1454	O60244	MED14_HUMAN	T	1454	.	ENSP00000323720:P1454T	P	-	1	0	MED14	40396007	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.186000	0.72026	2.474000	0.83562	0.600000	0.82982	CCA	.		0.383	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49443599	49443599	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr12:49443599G>A	ENST00000301067.7	-	11	3771	c.3772C>T	c.(3772-3774)Cgg>Tgg	p.R1258W		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1258					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTACAGAGCCGTAGGGAGCCC	0.627																																					p.R1258W		.											.	MLL2	612	0			c.C3772T						.						90.0	94.0	93.0					12																	49443599		1966	4157	6123	SO:0001583	missense	8085	exon11			AGAGCCGTAGGGA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.3772C>T	12.37:g.49443599G>A	ENSP00000301067:p.Arg1258Trp	193.0	0.0		146.0	62.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.685483	0.29872	.	.	ENSG00000167548	ENST00000301067	D	0.82803	-1.65	5.81	3.92	0.45320	.	0.000000	0.35349	N	0.003276	D	0.82852	0.5127	N	0.14661	0.345	0.31778	N	0.631284	D	0.89917	1.0	D	0.77557	0.99	D	0.84859	0.0818	10	0.87932	D	0	.	12.9492	0.58389	0.0:0.0:0.705:0.295	.	1258	O14686	MLL2_HUMAN	W	1258	ENSP00000301067:R1258W	ENSP00000301067:R1258W	R	-	1	2	MLL2	47729866	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.732000	0.47352	0.728000	0.32382	0.655000	0.94253	CGG	.		0.627	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
NRXN1	9378	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	51255367	51255367	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr2:51255367G>T	ENST00000406316.2	-	2	1521	c.45C>A	c.(43-45)tgC>tgA	p.C15*	NRXN1_ENST00000405472.3_Nonsense_Mutation_p.C15*|NRXN1_ENST00000405581.1_Nonsense_Mutation_p.C15*|NRXN1_ENST00000401669.2_Nonsense_Mutation_p.C15*|NRXN1_ENST00000404971.1_Nonsense_Mutation_p.C15*|NRXN1_ENST00000402717.3_Nonsense_Mutation_p.C15*|NRXN1_ENST00000406859.3_Nonsense_Mutation_p.C15*	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	15					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCAGCGAGAGGCACAGAAGAA	0.716																																					p.C15X		.											.	NRXN1	92	0			c.C45A						.						4.0	5.0	5.0					2																	51255367		1825	3976	5801	SO:0001587	stop_gained	9378	exon2			CGAGAGGCACAGA	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.45C>A	2.37:g.51255367G>T	ENSP00000384311:p.Cys15*	16.0	0.0		17.0	9.0	NM_004801	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Nonsense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	47	13.174682	0.99725	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	.	.	.	5.05	4.17	0.49024	.	227.466000	0.01991	U	0.045489	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	7.6862	0.28542	0.0927:0.2201:0.6873:0.0	.	.	.	.	X	15	.	ENSP00000385017:C15X	C	-	3	2	NRXN1	51108871	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.285000	0.43487	1.121000	0.41925	0.514000	0.50259	TGC	.		0.716	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
ONECUT2	9480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	55103728	55103728	+	Silent	SNP	C	C	T			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr18:55103728C>T	ENST00000491143.2	+	1	812	c.780C>T	c.(778-780)ccC>ccT	p.P260P	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	260					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		TGCTCAGCCCCAACTTCGACG	0.687																																					p.P260P		.											.	ONECUT2	494	0			c.C780T						.						52.0	62.0	58.0					18																	55103728		2188	4278	6466	SO:0001819	synonymous_variant	9480	exon1			CAGCCCCAACTTC	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.780C>T	18.37:g.55103728C>T		61.0	0.0		68.0	29.0	NM_004852		Silent	SNP	ENST00000491143.2	37	CCDS42440.1																																																																																			.		0.687	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3		
OR51S1	119692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4869943	4869943	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr11:4869943G>A	ENST00000322101.2	-	1	571	c.496C>T	c.(496-498)Ccc>Tcc	p.P166S	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AATGGCAGGGGCAGATGGAGA	0.557																																					p.P166S		.											.	OR51S1	72	0			c.C496T						.						105.0	106.0	106.0					11																	4869943		2201	4298	6499	SO:0001583	missense	119692	exon1			GCAGGGGCAGATG	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.496C>T	11.37:g.4869943G>A	ENSP00000322754:p.Pro166Ser	82.0	0.0		93.0	46.0	NM_001004758	B9EGZ1|Q6IFI2	Missense_Mutation	SNP	ENST00000322101.2	37	CCDS31362.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.695891	0.68386	.	.	ENSG00000176922	ENST00000322101	T	0.50001	0.76	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.156809	0.30302	N	0.009931	T	0.61135	0.2323	M	0.82193	2.58	0.37096	D	0.899678	P	0.43024	0.798	P	0.46049	0.502	T	0.72786	-0.4188	10	0.87932	D	0	-22.3842	17.5702	0.87933	0.0:0.0:1.0:0.0	.	166	Q8NGJ8	O51S1_HUMAN	S	166	ENSP00000322754:P166S	ENSP00000322754:P166S	P	-	1	0	OR51S1	4826519	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	3.964000	0.56780	2.729000	0.93468	0.655000	0.94253	CCC	.		0.557	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
OR4C15	81309	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	55322154	55322154	+	Silent	SNP	G	G	C			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr11:55322154G>C	ENST00000314644.2	+	1	372	c.372G>C	c.(370-372)gcG>gcC	p.A124A		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TCCTGGATGCGTGCTTCTCAT	0.473										HNSCC(20;0.049)																											p.A124A		.											.	OR4C15	70	0			c.G372C						.						191.0	156.0	168.0					11																	55322154		2201	4296	6497	SO:0001819	synonymous_variant	81309	exon1			GGATGCGTGCTTC	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.372G>C	11.37:g.55322154G>C		41.0	0.0		62.0	5.0	NM_001001920	Q6IFE2	Silent	SNP	ENST00000314644.2	37	CCDS31501.1																																																																																			.		0.473	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
OR9G1	390174	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	56468353	56468353	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr11:56468353T>A	ENST00000312153.1	+	1	490	c.490T>A	c.(490-492)Tcc>Acc	p.S164T		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						GAAAACGTTTTCCTTTAACTT	0.433																																					p.S164T		.											.	.	.	0			c.T490A						.						164.0	158.0	160.0					11																	56468353		2201	4296	6497	SO:0001583	missense	504191	exon1			ACGTTTTCCTTTA	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.490T>A	11.37:g.56468353T>A	ENSP00000309012:p.Ser164Thr	156.0	0.0		138.0	37.0	NM_001013358	Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	ENST00000312153.1	37	CCDS31536.1	.	.	.	.	.	.	.	.	.	.	T	2.727	-0.265243	0.05754	.	.	ENSG00000174914	ENST00000312153	T	0.00216	8.53	4.52	-6.13	0.02118	GPCR, rhodopsin-like superfamily (1);	1.486790	0.03858	N	0.273426	T	0.00109	0.0003	N	0.16016	0.355	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25187	-1.0139	10	0.48119	T	0.1	-2.8801	4.6664	0.12668	0.6557:0.1128:0.1207:0.1108	.	164	Q8NH87	OR9G1_HUMAN	T	164	ENSP00000309012:S164T	ENSP00000309012:S164T	S	+	1	0	OR9G1	56224929	0.000000	0.05858	0.001000	0.08648	0.226000	0.24999	-1.685000	0.01930	-0.722000	0.04922	0.467000	0.42956	TCC	.		0.433	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213	
PCDH17	27253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	58299287	58299287	+	Silent	SNP	G	G	A	rs540534018		TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr13:58299287G>A	ENST00000377918.3	+	4	3365	c.3339G>A	c.(3337-3339)gaG>gaA	p.E1113E		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1113					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ATTCCAGTGAGATGGGTGCTG	0.522																																					p.E1113E	Melanoma(72;952 1291 1619 12849 33676)	.											.	PCDH17	97	0			c.G3339A						.						164.0	168.0	167.0					13																	58299287		2203	4300	6503	SO:0001819	synonymous_variant	27253	exon4			CAGTGAGATGGGT	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3339G>A	13.37:g.58299287G>A		107.0	0.0		141.0	56.0	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	CCDS31986.1																																																																																			.		0.522	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
PLEKHG3	26030	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	65199611	65199611	+	Missense_Mutation	SNP	G	G	T	rs75568560	byFrequency	TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr14:65199611G>T	ENST00000394691.1	+	12	1484	c.1337G>T	c.(1336-1338)cGg>cTg	p.R446L	PLEKHG3_ENST00000247226.7_Missense_Mutation_p.R390L			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	446				QGRRQSEPTKHLLRQLNEKARAAGMK -> KGAGPEPPGSE EEEEEQEESLAVAEQ (in Ref. 2; AAH04298). {ECO:0000305}.			Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CAGGGGCGCCGGCAATCTGGT	0.647																																					p.R390L		.											.	PLEKHG3	91	0			c.G1169T						.						24.0	22.0	23.0					14																	65199611		2203	4299	6502	SO:0001583	missense	26030	exon10			GGCGCCGGCAATC	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.1337G>T	14.37:g.65199611G>T	ENSP00000378183:p.Arg446Leu	234.0	1.0		176.0	68.0	NM_015549	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	37		.	.	.	.	.	.	.	.	.	.	G	26.8	4.776439	0.90195	.	.	ENSG00000126822	ENST00000247226;ENST00000394691	T;T	0.43688	0.94;0.94	5.62	5.62	0.85841	.	0.073020	0.56097	D	0.000039	T	0.68174	0.2972	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;0.967	D;P	0.76575	0.988;0.898	T	0.71836	-0.4472	10	0.87932	D	0	.	18.413	0.90558	0.0:0.0:1.0:0.0	.	446;390	A1L390;A1L390-3	PKHG3_HUMAN;.	L	390;446	ENSP00000247226:R390L;ENSP00000378183:R446L	ENSP00000247226:R390L	R	+	2	0	PLEKHG3	64269364	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	6.691000	0.74573	2.651000	0.90000	0.561000	0.74099	CGG	G|1.000;A|0.000		0.647	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
PPP1R3F	89801	hgsc.bcm.edu;bcgsc.ca	37	X	49138482	49138483	+	Frame_Shift_Ins	INS	-	-	TAGCCCCCACCTGA			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chrX:49138482_49138483insTAGCCCCCACCTGA	ENST00000055335.6	+	3	1115_1116	c.1099_1100insTAGCCCCCACCTGA	c.(1099-1101)gtafs	p.-367fs	PPP1R3F_ENST00000495799.1_Frame_Shift_Ins_p.-21fs|PPP1R3F_ENST00000438316.1_Frame_Shift_Ins_p.-38fs|PPP1R3F_ENST00000376188.1_Frame_Shift_Ins_p.-21fs|PPP1R3F_ENST00000466508.1_Frame_Shift_Ins_p.-21fs	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F						regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					GGGTCCACTGGTAGCCCCCACC	0.545																																					p.V367_A368delinsVAPTX		.											.	PPP1R3F	229	0			c.1099_1100insTAGCCCCCACCTGA						.																																			SO:0001589	frameshift_variant	89801	exon3			CCACTGGTAGCCC		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	Exception_encountered	X.37:g.49138482_49138483insTAGCCCCCACCTGA	ENSP00000055335:p.Val367fs	179.0	0.0		115.0	10.0	NM_033215	A2VDJ8|B3KPW2|E9PCM3	Nonsense_Mutation	INS	ENST00000055335.6	37	CCDS35254.1																																																																																			.		0.545	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215	
RTL1	388015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	101350343	101350343	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr14:101350343G>T	ENST00000534062.1	-	1	841	c.783C>A	c.(781-783)agC>agA	p.S261R	MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	261					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CGATCAGGGGGCTGTTTTCCT	0.532																																					p.S261R		.											.	RTL1	46	0			c.C783A						.						92.0	80.0	84.0					14																	101350343		692	1591	2283	SO:0001583	missense	388015	exon1			CAGGGGGCTGTTT		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.783C>A	14.37:g.101350343G>T	ENSP00000435342:p.Ser261Arg	67.0	0.0		52.0	27.0	NM_001134888	E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794023	0.31777	.	.	ENSG00000254656	ENST00000534062	T	0.24723	1.84	3.42	0.538	0.17150	.	.	.	.	.	T	0.44329	0.1288	M	0.70595	2.14	0.22213	N	0.999287	D	0.76494	0.999	D	0.75020	0.985	T	0.19844	-1.0293	9	0.72032	D	0.01	.	7.3034	0.26434	0.3245:0.0:0.6755:0.0	.	261	E9PKS8	.	R	261	ENSP00000435342:S261R	ENSP00000435342:S261R	S	-	3	2	RTL1	100420096	0.998000	0.40836	0.356000	0.25785	0.249000	0.25844	1.159000	0.31749	0.108000	0.17862	-0.258000	0.10820	AGC	.		0.532	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
SCRT2	85508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	644968	644968	+	Silent	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr20:644968G>A	ENST00000246104.6	-	2	848	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	RP5-850E9.3_ENST00000488788.2_Intron	NM_033129.3	NP_149120.1	Q9NQ03	SCRT2_HUMAN	scratch family zinc finger 2	91					negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			kidney(1)|liver(1)|ovary(1)	3						CGCGCCGACAGGCTCGACTGC	0.746																																					p.L91L		.											.	SCRT2	90	0			c.C271T						.						7.0	7.0	7.0					20																	644968		1630	3722	5352	SO:0001819	synonymous_variant	85508	exon2			CCGACAGGCTCGA		CCDS13006.1	20p13	2013-10-09	2013-10-09		ENSG00000215397	ENSG00000215397		"""Zinc fingers, C2H2-type"""	15952	protein-coding gene	gene with protein product			"""scratch (drosophila homolog) 2, zinc finger protein"", ""scratch homolog 2, zinc finger protein (Drosophila)"""			11274425	Standard	NM_033129		Approved	ZNF898B	uc002wec.3	Q9NQ03	OTTHUMG00000130829	ENST00000246104.6:c.271C>T	20.37:g.644968G>A		39.0	0.0		30.0	16.0	NM_033129		Silent	SNP	ENST00000246104.6	37	CCDS13006.1																																																																																			.		0.746	SCRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253383.2	NM_033129	
SNX14	57231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	86223594	86223594	+	Silent	SNP	G	G	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr6:86223594G>A	ENST00000314673.3	-	26	2753	c.2577C>T	c.(2575-2577)aaC>aaT	p.N859N	SNX14_ENST00000346348.3_Silent_p.N806N|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000369627.2_Silent_p.N850N|SNX14_ENST00000513865.1_Silent_p.N578N|SNX14_ENST00000505648.1_Silent_p.N807N	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	859					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		GAGGTTCAGTGTTTTCACAGA	0.294																																					p.N859N		.											.	SNX14	226	0			c.C2577T						.						76.0	78.0	77.0					6																	86223594		2203	4296	6499	SO:0001819	synonymous_variant	57231	exon26			TTCAGTGTTTTCA	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.2577C>T	6.37:g.86223594G>A		48.0	0.0		39.0	5.0	NM_153816	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Silent	SNP	ENST00000314673.3	37	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	G	6.149	0.395673	0.11638	.	.	ENSG00000135317	ENST00000508658	.	.	.	5.41	1.71	0.24356	.	.	.	.	.	T	0.42585	0.1209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28933	-1.0028	4	.	.	.	-15.0848	8.9203	0.35607	0.4363:0.0:0.5637:0.0	.	.	.	.	I	98	.	.	T	-	2	0	SNX14	86280313	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.496000	0.35638	-0.009000	0.14296	0.555000	0.69702	ACA	.		0.294	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816	
SORL1	6653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121476237	121476237	+	Silent	SNP	A	A	G			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr11:121476237A>G	ENST00000260197.7	+	35	5034	c.4905A>G	c.(4903-4905)gcA>gcG	p.A1635A	SORL1_ENST00000525532.1_Silent_p.A579A|SORL1_ENST00000534286.1_Silent_p.A545A|SORL1_ENST00000532694.1_Silent_p.A481A|SORL1_ENST00000527934.1_Silent_p.A250A	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1635	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TCAGCAAGGCACACAACACCA	0.448																																					p.A1635A		.											.	SORL1	228	0			c.A4905G						.						209.0	194.0	199.0					11																	121476237		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon35			CAAGGCACACAAC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4905A>G	11.37:g.121476237A>G		136.0	0.0		138.0	70.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	37	CCDS8436.1																																																																																			.		0.448	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52551075	52551075	+	Missense_Mutation	SNP	G	G	A	rs144391932	byFrequency	TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr3:52551075G>A	ENST00000321725.6	+	42	4515	c.4439G>A	c.(4438-4440)cGg>cAg	p.R1480Q		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1480	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCTGGGCAGCGGACATGCACC	0.642																																					p.R1480Q		.											.	STAB1	139	0			c.G4439A						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	43.0	47.0	46.0		4439	4.1	1.0	3	dbSNP_134	46	0,8600		0,0,4300	no	missense	STAB1	NM_015136.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1480/2571	52551075	1,13005	2203	4300	6503	SO:0001583	missense	23166	exon42			GGCAGCGGACATG	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.4439G>A	3.37:g.52551075G>A	ENSP00000312946:p.Arg1480Gln	135.0	0.0		130.0	59.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	35	5.561583	0.96527	2.27E-4	0.0	ENSG00000010327	ENST00000321725	D	0.87256	-2.23	4.1	4.1	0.47936	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93910	0.8051	M	0.90650	3.135	0.49051	D	0.999746	D	0.89917	1.0	D	0.85130	0.997	D	0.93421	0.6777	10	0.33141	T	0.24	.	14.654	0.68820	0.0:0.0:1.0:0.0	.	1480	Q9NY15	STAB1_HUMAN	Q	1480	ENSP00000312946:R1480Q	ENSP00000312946:R1480Q	R	+	2	0	STAB1	52526115	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.042000	0.64202	2.284000	0.76573	0.655000	0.94253	CGG	G|1.000;A|0.000		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
ZFC3H1	196441	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	72026111	72026111	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr12:72026111C>A	ENST00000378743.3	-	15	3359	c.3001G>T	c.(3001-3003)Gtg>Ttg	p.V1001L		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1001					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCCTCTTCCACAACTGGAGAG	0.373																																					p.V1001L		.											.	ZFC3H1	138	0			c.G3001T						.						176.0	170.0	172.0					12																	72026111		1842	4087	5929	SO:0001583	missense	196441	exon15			CTTCCACAACTGG	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3001G>T	12.37:g.72026111C>A	ENSP00000368017:p.Val1001Leu	79.0	1.0		82.0	9.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	C	8.542	0.873554	0.17322	.	.	ENSG00000133858	ENST00000378743	T	0.35605	1.3	5.96	1.61	0.23674	.	0.492334	0.19880	N	0.103985	T	0.12774	0.0310	N	0.03608	-0.345	0.21290	N	0.999735	B	0.02656	0.0	B	0.06405	0.002	T	0.15549	-1.0433	10	0.27785	T	0.31	.	3.1986	0.06641	0.1208:0.5155:0.1059:0.2578	.	1001	O60293	ZC3H1_HUMAN	L	1001	ENSP00000368017:V1001L	ENSP00000368017:V1001L	V	-	1	0	ZFC3H1	70312378	0.073000	0.21202	0.990000	0.47175	0.803000	0.45373	0.036000	0.13819	0.412000	0.25729	-0.482000	0.04802	GTG	.		0.373	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
ZNF69	7620	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	12015547	12015547	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A7PY-01A-11D-A33Q-10	TCGA-ED-A7PY-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0e067207-764e-452a-9e8b-5cf53b052abc	f017e474-7862-4fff-8064-742a7c3c8e52	g.chr19:12015547T>C	ENST00000429654.2	+	4	475	c.335T>C	c.(334-336)cTg>cCg	p.L112P	ZNF69_ENST00000340180.5_Missense_Mutation_p.L98P			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	112					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		GATGACAGGCTGAACTTCCAG	0.383																																					p.L98P		.											.	ZNF69	91	0			c.T293C						.						119.0	124.0	123.0					19																	12015547		2203	4300	6503	SO:0001583	missense	7620	exon4			ACAGGCTGAACTT	X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.335T>C	19.37:g.12015547T>C	ENSP00000402985:p.Leu112Pro	149.0	0.0		121.0	11.0	NM_021915	Q86VA7	Missense_Mutation	SNP	ENST00000429654.2	37		.	.	.	.	.	.	.	.	.	.	t	9.329	1.060060	0.19987	.	.	ENSG00000198429	ENST00000429654;ENST00000445911;ENST00000340180	T;T;T	0.09163	3.01;4.09;4.16	0.118	0.118	0.14667	.	.	.	.	.	T	0.20577	0.0495	L	0.49571	1.57	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.10847	-1.0612	9	0.54805	T	0.06	.	4.4137	0.11445	0.0:1.0E-4:0.0:0.9999	.	98	C9JR48	.	P	112;98;98	ENSP00000402985:L112P;ENSP00000388784:L98P;ENSP00000345333:L98P	ENSP00000345333:L98P	L	+	2	0	ZNF69	11876547	0.004000	0.15560	0.006000	0.13384	0.069000	0.16628	-0.834000	0.04391	0.165000	0.19558	0.163000	0.16589	CTG	.		0.383	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000344082.1	NM_021915	
