#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2M	2	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	9221388	9221388	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:9221388T>C	ENST00000318602.7	-	34	4621	c.4314A>G	c.(4312-4314)ccA>ccG	p.P1438P	A2M-AS1_ENST00000499762.1_RNA	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1438					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GATCTCTTACTGGGACATCTT	0.408																																					p.P1438P		.											.	A2M	515	0			c.A4314G						.						70.0	68.0	68.0					12																	9221388		1878	4119	5997	SO:0001819	synonymous_variant	2	exon34			TCTTACTGGGACA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.4314A>G	12.37:g.9221388T>C		178.0	0.0		163.0	33.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	ENST00000318602.7	37	CCDS44827.1																																																																																			.		0.408	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
ABCB1	5243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	87148681	87148681	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:87148681A>C	ENST00000265724.3	-	24	3305	c.2888T>G	c.(2887-2889)tTg>tGg	p.L963W	ABCB1_ENST00000488737.2_5'UTR|ABCB1_ENST00000543898.1_Missense_Mutation_p.L899W	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	963	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ATGTGCCACCAAGTAGGCTCC	0.388																																					p.L963W		.											.	ABCB1	582	0			c.T2888G						.						97.0	88.0	91.0					7																	87148681		2203	4300	6503	SO:0001583	missense	5243	exon24			GCCACCAAGTAGG	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2888T>G	7.37:g.87148681A>C	ENSP00000265724:p.Leu963Trp	95.0	0.0		122.0	13.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	ENST00000265724.3	37	CCDS5608.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225297	0.79576	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.94000	-3.33;-3.33	5.79	4.61	0.57282	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.064892	0.64402	D	0.000008	D	0.97396	0.9148	H	0.94847	3.59	0.54753	D	0.999981	D;D	0.89917	0.999;1.0	D;D	0.91635	0.979;0.999	D	0.97515	1.0069	10	0.87932	D	0	-15.5609	12.1771	0.54192	0.8719:0.0:0.0:0.1281	.	899;963	B5AK60;P08183	.;MDR1_HUMAN	W	744;963;899	ENSP00000265724:L963W;ENSP00000444095:L899W	ENSP00000265724:L963W	L	-	2	0	ABCB1	86986617	0.998000	0.40836	1.000000	0.80357	0.938000	0.57974	9.146000	0.94640	0.971000	0.38288	0.459000	0.35465	TTG	.		0.388	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
ACACA	31	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	35631111	35631111	+	Silent	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:35631111A>G	ENST00000394406.2	-	9	1060	c.870T>C	c.(868-870)taT>taC	p.Y290Y	ACACA_ENST00000353139.5_Silent_p.Y327Y|ACACA_ENST00000335166.5_Silent_p.Y212Y|ACACA_ENST00000360679.3_Silent_p.Y232Y	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	290	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CATCTTTCACATAACCTTTTT	0.428																																					p.Y327Y	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	.											.	ACACA	154	0			c.T981C						.						185.0	153.0	164.0					17																	35631111		2203	4300	6503	SO:0001819	synonymous_variant	31	exon9			TTTCACATAACCT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.870T>C	17.37:g.35631111A>G		165.0	0.0		163.0	52.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	ENST00000394406.2	37	CCDS11317.1																																																																																			.		0.428	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
ACTL9	284382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8807893	8807893	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:8807893G>A	ENST00000324436.3	-	1	1279	c.1159C>T	c.(1159-1161)Ctg>Ttg	p.L387L		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	387						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						AGGGAGGCCAGGATGGAGCCC	0.647																																					p.L387L		.											.	ACTL9	154	0			c.C1159T						.						35.0	38.0	37.0					19																	8807893		2203	4299	6502	SO:0001819	synonymous_variant	284382	exon1			AGGCCAGGATGGA		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1159C>T	19.37:g.8807893G>A		107.0	0.0		102.0	29.0	NM_178525	A8K893|Q6X960	Silent	SNP	ENST00000324436.3	37	CCDS12207.1																																																																																			.		0.647	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	NM_178525	
ADCY2	108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	7773106	7773106	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:7773106A>G	ENST00000338316.4	+	18	2365	c.2276A>G	c.(2275-2277)tAt>tGt	p.Y759C	ADCY2_ENST00000537121.1_Missense_Mutation_p.Y579C	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	759					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CGGGTAAACTATGAGCTGAAG	0.507																																					p.Y759C		.											.	ADCY2	97	0			c.A2276G						.						258.0	222.0	235.0					5																	7773106		2203	4300	6503	SO:0001583	missense	108	exon18			TAAACTATGAGCT	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2276A>G	5.37:g.7773106A>G	ENSP00000342952:p.Tyr759Cys	344.0	0.0		358.0	128.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	A	15.32	2.798226	0.50208	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;D	0.81659	-1.05;-1.52	4.87	4.87	0.63330	.	0.135744	0.51477	D	0.000084	D	0.82273	0.5001	L	0.53249	1.67	0.54753	D	0.999989	D;P	0.63046	0.992;0.709	P;P	0.54965	0.765;0.571	T	0.79500	-0.1778	10	0.22109	T	0.4	.	12.7275	0.57178	1.0:0.0:0.0:0.0	.	579;759	B7Z2C1;Q08462	.;ADCY2_HUMAN	C	759;592;579	ENSP00000342952:Y759C;ENSP00000444803:Y579C	ENSP00000342952:Y759C	Y	+	2	0	ADCY2	7826106	1.000000	0.71417	0.751000	0.31187	0.915000	0.54546	6.605000	0.74155	1.835000	0.53391	0.383000	0.25322	TAT	.		0.507	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADRBK2	157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26117279	26117279	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr22:26117279T>C	ENST00000324198.6	+	20	2012	c.1820T>C	c.(1819-1821)cTc>cCc	p.L607P		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	607	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	GAACAGATTCTCTCTGTGGAA	0.279																																					p.L607P		.											.	ADRBK2	955	0			c.T1820C						.						62.0	71.0	68.0					22																	26117279		2203	4296	6499	SO:0001583	missense	157	exon20			AGATTCTCTCTGT	X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.1820T>C	22.37:g.26117279T>C	ENSP00000317578:p.Leu607Pro	266.0	0.0		336.0	113.0	NM_005160	Q9UGW9	Missense_Mutation	SNP	ENST00000324198.6	37	CCDS13832.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.096840	0.37048	.	.	ENSG00000100077	ENST00000324198	T	0.58358	0.34	5.68	5.68	0.88126	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.672824	0.14072	N	0.343311	T	0.44286	0.1286	N	0.22421	0.69	0.50632	D	0.999885	B	0.24132	0.098	B	0.30855	0.121	T	0.28808	-1.0032	10	0.33940	T	0.23	-1.2072	15.1109	0.72355	0.0:0.0:0.0:1.0	.	607	P35626	ARBK2_HUMAN	P	607	ENSP00000317578:L607P	ENSP00000317578:L607P	L	+	2	0	ADRBK2	24447279	0.836000	0.29430	0.214000	0.23707	0.981000	0.71138	5.504000	0.66968	2.165000	0.68154	0.533000	0.62120	CTC	.		0.279	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317296.4	NM_005160	
AFF3	3899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	100210640	100210640	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:100210640G>T	ENST00000409236.2	-	13	1595	c.1483C>A	c.(1483-1485)Cag>Aag	p.Q495K	AFF3_ENST00000317233.4_Missense_Mutation_p.Q495K|AFF3_ENST00000409579.1_Missense_Mutation_p.Q520K|AFF3_ENST00000356421.2_Missense_Mutation_p.Q520K			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	495					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TTGTAGTACTGATTGCTCTCT	0.498																																					p.Q520K		.											.	AFF3	230	0			c.C1558A						.						144.0	161.0	156.0					2																	100210640		2203	4300	6503	SO:0001583	missense	3899	exon14			AGTACTGATTGCT	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1483C>A	2.37:g.100210640G>T	ENSP00000387207:p.Gln495Lys	279.0	0.0		244.0	72.0	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	37	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040639	0.35989	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	5.87	5.87	0.94306	.	0.162135	0.30383	N	0.009758	T	0.66167	0.2762	L	0.43152	1.355	0.38657	D	0.951992	P;D;B	0.53885	0.828;0.963;0.426	P;P;B	0.54401	0.621;0.751;0.085	T	0.60347	-0.7281	10	0.14656	T	0.56	.	17.9961	0.89184	0.0:0.0:1.0:0.0	.	648;495;520	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	K	495;520;520;495;495;648;520	ENSP00000317421:Q495K;ENSP00000348793:Q520K;ENSP00000386834:Q520K;ENSP00000387207:Q495K	ENSP00000317421:Q495K	Q	-	1	0	AFF3	99577072	0.999000	0.42202	0.705000	0.30386	0.881000	0.50899	4.067000	0.57527	2.781000	0.95711	0.655000	0.94253	CAG	.		0.498	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
ALG10B	144245	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	38714457	38714457	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:38714457T>C	ENST00000308742.4	+	3	1180	c.864T>C	c.(862-864)ttT>ttC	p.F288F	AC117372.1_ENST00000401168.2_RNA|ALG10B_ENST00000551464.1_Intron	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	288					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				GTCTTCATTTTCCTCAACTAT	0.368																																					p.F288F		.											.	ALG10B	93	0			c.T864C						.						136.0	140.0	139.0					12																	38714457		2203	4297	6500	SO:0001819	synonymous_variant	144245	exon3			TCATTTTCCTCAA	AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.864T>C	12.37:g.38714457T>C		343.0	0.0		382.0	137.0	NM_001013620	B2RPF4	Silent	SNP	ENST00000308742.4	37	CCDS31772.1																																																																																			.		0.368	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
ALOX5	240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	45891384	45891384	+	Splice_Site	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr10:45891384G>T	ENST00000374391.2	+	3	484	c.431G>T	c.(430-432)cGa>cTa	p.R144L	ALOX5_ENST00000542434.1_Splice_Site_p.R144L	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	144	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	AAACAATATCGGTGAGTTATG	0.443																																					p.R144L		.											.	ALOX5	228	0			c.G431T						.						129.0	107.0	115.0					10																	45891384		2203	4300	6503	SO:0001630	splice_region_variant	240	exon3			AATATCGGTGAGT	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.431+1G>T	10.37:g.45891384G>T		150.0	0.0		132.0	42.0	NM_001256153	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	ENST00000374391.2	37	CCDS7212.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863720	0.91511	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.90504	-2.68;-2.68	5.96	5.96	0.96718	Lipoxygenase, C-terminal (2);	0.173444	0.47852	D	0.000202	D	0.95252	0.8460	M	0.87381	2.88	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.997	P;P;P	0.62184	0.8;0.899;0.696	D	0.94819	0.7985	10	0.48119	T	0.1	-12.7091	15.9221	0.79583	0.0:0.0:1.0:0.0	.	144;144;144	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	L	144	ENSP00000437634:R144L;ENSP00000363512:R144L	ENSP00000363512:R144L	R	+	2	0	ALOX5	45211390	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.095000	0.64529	2.832000	0.97577	0.655000	0.94253	CGA	.		0.443	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047780.1		Missense_Mutation
AMFR	267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	56443342	56443342	+	Silent	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:56443342A>G	ENST00000290649.5	-	3	717	c.507T>C	c.(505-507)ttT>ttC	p.F169F	RP11-413H22.2_ENST00000563090.1_RNA	NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	169					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						TCACATATTCAAATCGATCCT	0.473																																					p.F169F	Pancreas(2;144 323 39528)	.											.	AMFR	1009	0			c.T507C						.						116.0	108.0	111.0					16																	56443342		2198	4300	6498	SO:0001819	synonymous_variant	267	exon3			ATATTCAAATCGA	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.507T>C	16.37:g.56443342A>G		71.0	0.0		66.0	19.0	NM_001144	P26442|Q8IZ70	Silent	SNP	ENST00000290649.5	37	CCDS10758.1																																																																																			.		0.473	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2		
ANGPTL3	27329	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	63070352	63070352	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:63070352A>C	ENST00000371129.3	+	7	1327	c.1247A>C	c.(1246-1248)aAa>aCa	p.K416T	DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000251157.5_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3	416	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						CTAAATGGTAAATATAACAAA	0.373																																					p.A416A		.											.	ANGPTL3	130	0			c.C1247C						.						100.0	99.0	99.0					1																	63070352		2203	4300	6503	SO:0001583	missense	27329	exon7			ATGGTAAATATAA	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1247A>C	1.37:g.63070352A>C	ENSP00000360170:p.Lys416Thr	259.0	0.0		269.0	81.0	NM_014495	A0JLS0|B1ALJ0|B2RCW1	Silent	SNP	ENST00000371129.3	37	CCDS622.1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893670	0.72639	.	.	ENSG00000132855	ENST00000371129	T	0.78126	-1.15	5.4	5.4	0.78164	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.277044	0.46442	D	0.000290	T	0.80053	0.4553	M	0.69523	2.12	0.45427	D	0.998401	P	0.51147	0.942	P	0.54759	0.76	T	0.80329	-0.1428	10	0.40728	T	0.16	.	15.7054	0.77577	1.0:0.0:0.0:0.0	.	416	Q9Y5C1	ANGL3_HUMAN	T	416	ENSP00000360170:K416T	ENSP00000360170:K416T	K	+	2	0	ANGPTL3	62842940	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	3.514000	0.53422	2.164000	0.68074	0.477000	0.44152	AAA	.		0.373	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025344.1	NM_014495	
ANKRD26	22852	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27337837	27337837	+	Silent	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr10:27337837A>C	ENST00000376087.4	-	17	1872	c.1707T>G	c.(1705-1707)acT>acG	p.T569T	ANKRD26_ENST00000376070.3_Silent_p.T126T|ANKRD26_ENST00000436985.2_Silent_p.T585T	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	569					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						cagcatcatcagtagcaccat	0.328																																					p.T569T		.											.	ANKRD26	138	0			c.T1707G						.						156.0	146.0	149.0					10																	27337837		1951	4155	6106	SO:0001819	synonymous_variant	22852	exon17			ATCATCAGTAGCA	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1707T>G	10.37:g.27337837A>C		190.0	1.0		249.0	75.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Silent	SNP	ENST00000376087.4	37	CCDS41499.1																																																																																			.		0.328	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
AP1G2	8906	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24031766	24031766	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:24031766delC	ENST00000308724.5	-	14	2202	c.1447delG	c.(1447-1449)gagfs	p.E483fs	AP1G2_ENST00000397120.3_Frame_Shift_Del_p.E483fs|RP11-66N24.4_ENST00000553985.1_RNA|AP1G2_ENST00000556277.1_5'Flank|RP11-66N24.3_ENST00000555968.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	483					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TCCCCATACTCCCCAATGCAC	0.602											OREG0022605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E483fs		.											.	AP1G2	45	0			c.1447delG						.						71.0	60.0	64.0					14																	24031766		2203	4300	6503	SO:0001589	frameshift_variant	8906	exon15			CATACTCCCCAAT	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1447delG	14.37:g.24031766delC	ENSP00000312442:p.Glu483fs	116.0	0.0	768	120.0	37.0	NM_003917	D3DS51|O75504	Frame_Shift_Del	DEL	ENST00000308724.5	37	CCDS9602.1																																																																																			.		0.602	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
ARFGEF1	10565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68130369	68130369	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:68130369G>A	ENST00000262215.3	-	31	4732	c.4343C>T	c.(4342-4344)gCt>gTt	p.A1448V	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.A902V|ARFGEF1_ENST00000518230.1_Missense_Mutation_p.A286V	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1448					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CATCCATTCAGCTTTCTGGGG	0.274																																					p.A1448V		.											.	ARFGEF1	294	0			c.C4343T						.						85.0	74.0	78.0					8																	68130369		2203	4300	6503	SO:0001583	missense	10565	exon31			CATTCAGCTTTCT	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4343C>T	8.37:g.68130369G>A	ENSP00000262215:p.Ala1448Val	196.0	0.0		138.0	46.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286513	0.80803	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230	T;T;T	0.65549	0.74;0.74;-0.16	5.48	5.48	0.80851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	M	0.72479	2.2	0.58432	D	0.999999	P;B;B	0.41748	0.761;0.446;0.446	B;B;B	0.38106	0.265;0.15;0.15	T	0.71080	-0.4696	10	0.66056	D	0.02	.	19.7024	0.96060	0.0:0.0:1.0:0.0	.	1448;926;902	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	V	902;1448;286	ENSP00000428429:A902V;ENSP00000262215:A1448V;ENSP00000430891:A286V	ENSP00000262215:A1448V	A	-	2	0	ARFGEF1	68292923	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.724000	0.93272	0.655000	0.94253	GCT	.		0.274	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ARPP21	10777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	35763321	35763321	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:35763321A>C	ENST00000187397.4	+	14	1676	c.1220A>C	c.(1219-1221)aAa>aCa	p.K407T	ARPP21_ENST00000337271.5_Missense_Mutation_p.K353T|ARPP21_ENST00000444190.1_Missense_Mutation_p.K353T|ARPP21_ENST00000417925.1_Missense_Mutation_p.K373T|ARPP21_ENST00000458225.1_Missense_Mutation_p.K373T	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	407	Ser-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						AAGCTGTCCAAAGCAGGTAGT	0.498																																					p.K407T		.											.	ARPP21	93	0			c.A1220C						.						26.0	23.0	24.0					3																	35763321		2203	4300	6503	SO:0001583	missense	10777	exon14			TGTCCAAAGCAGG	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1220A>C	3.37:g.35763321A>C	ENSP00000187397:p.Lys407Thr	255.0	0.0		206.0	47.0	NM_016300	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.5|28.5	4.924566|4.924566	0.92319|0.92319	.|.	.|.	ENSG00000172995|ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925|ENST00000425289	T;T;T;T;T|.	0.52983|.	0.64;0.64;0.64;0.64;0.64|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.312522|.	0.31797|.	N|.	0.007041|.	T|T	0.76285|0.76285	0.3966|0.3966	M|M	0.77486|0.77486	2.375|2.375	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.997;0.996;1.0|.	D;D;D|.	0.73380|.	0.962;0.918;0.98|.	T|T	0.77189|0.77189	-0.2679|-0.2679	10|5	0.18710|.	T|.	0.47|.	-22.9268|-22.9268	16.0663|16.0663	0.80878|0.80878	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	373;407;353|.	Q9UBL0-3;Q9UBL0;Q9UBL0-4|.	.;ARP21_HUMAN;.|.	T|H	373;353;353;407;373|179	ENSP00000414351:K373T;ENSP00000337792:K353T;ENSP00000405276:K353T;ENSP00000187397:K407T;ENSP00000412326:K373T|.	ENSP00000187397:K407T|.	K|Q	+|+	2|3	0|2	ARPP21|ARPP21	35738325|35738325	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.287000|9.287000	0.95975|0.95975	2.201000|2.201000	0.70794|0.70794	0.533000|0.533000	0.62120|0.62120	AAA|CAA	.		0.498	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
AXIN2	8313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	63534326	63534326	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:63534326G>A	ENST00000375702.5	-	4	1303	c.1195C>T	c.(1195-1197)Cga>Tga	p.R399*	AXIN2_ENST00000307078.5_Nonsense_Mutation_p.R399*|CTD-2535L24.2_ENST00000577662.1_3'UTR			Q9Y2T1	AXIN2_HUMAN	axin 2	399	Interaction with GSK3B. {ECO:0000250}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						ATTACCTCTCGGATCTGCTGC	0.612									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.R399X		.											.	AXIN2	658	0			c.C1195T						.						68.0	55.0	59.0					17																	63534326		2203	4300	6503	SO:0001587	stop_gained	8313	exon5	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	CCTCTCGGATCTG	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1195C>T	17.37:g.63534326G>A	ENSP00000364854:p.Arg399*	173.0	0.0		204.0	55.0	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Nonsense_Mutation	SNP	ENST00000375702.5	37		.	.	.	.	.	.	.	.	.	.	G	36	5.646295	0.96704	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	.	.	.	4.68	2.51	0.30379	.	0.291643	0.34652	N	0.003788	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.4675	11.9475	0.52936	0.0:0.0:0.491:0.509	.	.	.	.	X	399	.	ENSP00000302625:R399X	R	-	1	2	AXIN2	60964788	1.000000	0.71417	0.986000	0.45419	0.907000	0.53573	1.912000	0.39946	0.540000	0.28808	0.555000	0.69702	CGA	.		0.612	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
B4GALT3	8703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161141842	161141842	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:161141842G>T	ENST00000319769.5	-	8	1168	c.946C>A	c.(946-948)Caa>Aaa	p.Q316K	B4GALT3_ENST00000367998.1_Missense_Mutation_p.Q316K|PPOX_ENST00000432542.2_Intron|B4GALT3_ENST00000470882.1_5'UTR|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	316					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	ATCCCATCTTGCGTCCAGGAA	0.522																																					p.Q316K		.											.	B4GALT3	90	0			c.C946A						.						75.0	78.0	77.0					1																	161141842		2203	4300	6503	SO:0001583	missense	8703	exon8			CATCTTGCGTCCA	BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.946C>A	1.37:g.161141842G>T	ENSP00000320965:p.Gln316Lys	114.0	0.0		143.0	40.0	NM_003779	D3DVG3|O60910|Q9BPZ4|Q9H8T2	Missense_Mutation	SNP	ENST00000319769.5	37	CCDS1222.1	.	.	.	.	.	.	.	.	.	.	G	5.768	0.326161	0.10900	.	.	ENSG00000158850	ENST00000319769;ENST00000407555;ENST00000367998;ENST00000367997	T;T	0.28255	1.62;1.62	5.28	5.28	0.74379	.	0.260915	0.40385	N	0.001105	T	0.04861	0.0131	N	0.03238	-0.38	0.34035	D	0.654243	B	0.10296	0.003	B	0.12837	0.008	T	0.16012	-1.0417	10	0.06625	T	0.88	.	13.5604	0.61786	0.0:0.1563:0.8437:0.0	.	316	O60512	B4GT3_HUMAN	K	316;293;316;316	ENSP00000320965:Q316K;ENSP00000356977:Q316K	ENSP00000320965:Q316K	Q	-	1	0	B4GALT3	159408466	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	4.881000	0.63114	2.746000	0.94184	0.655000	0.94253	CAA	.		0.522	B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083054.1	NM_003779	
BCL6	604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	187449531	187449531	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:187449531C>A	ENST00000406870.2	-	4	715	c.349G>T	c.(349-351)Gtt>Ttt	p.V117F	RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.V117F|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.V117F	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	117					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GTGTCCACAACATGCTCCATC	0.527			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																p.V117F		.		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	.	BCL6	848	0			c.G349T						.						78.0	72.0	74.0					3																	187449531		2203	4300	6503	SO:0001583	missense	604	exon3			CCACAACATGCTC		CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.349G>T	3.37:g.187449531C>A	ENSP00000384371:p.Val117Phe	155.0	0.0		179.0	65.0	NM_001134738	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	ENST00000406870.2	37	CCDS3289.1	.	.	.	.	.	.	.	.	.	.	C	34	5.327875	0.95733	.	.	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123;ENST00000430339	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	5.76	5.76	0.90799	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.91202	0.7228	H	0.96015	3.755	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	D	0.93134	0.6535	10	0.87932	D	0	.	19.3276	0.94268	0.0:1.0:0.0:0.0	.	117;117	B8PSA7;P41182	.;BCL6_HUMAN	F	117	ENSP00000384371:V117F;ENSP00000232014:V117F;ENSP00000413122:V117F;ENSP00000415574:V117F	ENSP00000232014:V117F	V	-	1	0	BCL6	188932225	1.000000	0.71417	0.965000	0.40720	0.994000	0.84299	7.487000	0.81328	2.894000	0.99253	0.591000	0.81541	GTT	.		0.527	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344202.1	NM_138931	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32654298	32654298	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:32654298A>C	ENST00000421745.2	+	11	3091	c.2957A>C	c.(2956-2958)aAa>aCa	p.K986T		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	986					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCTCTTTCTAAAGGAATAGAA	0.333																																					p.K986T	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.A2957C						.						54.0	52.0	53.0					2																	32654298		2202	4296	6498	SO:0001583	missense	57448	exon11			TTTCTAAAGGAAT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2957A>C	2.37:g.32654298A>C	ENSP00000393596:p.Lys986Thr	37.0	0.0		37.0	17.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	13.60	2.285916	0.40394	.	.	ENSG00000115760	ENST00000421745	T	0.75050	-0.9	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	L	0.29908	0.895	0.47698	D	0.999499	P	0.37781	0.608	B	0.24701	0.055	T	0.62501	-0.6841	10	0.38643	T	0.18	.	14.8359	0.70183	1.0:0.0:0.0:0.0	.	986	Q9NR09	BIRC6_HUMAN	T	986	ENSP00000393596:K986T	ENSP00000393596:K986T	K	+	2	0	BIRC6	32507802	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.038000	0.93771	1.957000	0.56846	0.460000	0.39030	AAA	.		0.333	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
C11orf42	160298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6231167	6231167	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:6231167A>C	ENST00000316375.2	+	2	210	c.160A>C	c.(160-162)Aaa>Caa	p.K54Q	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	54										endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTGCTGGTAAAACAGTCCCG	0.617																																					p.K54Q		.											.	C11orf42	91	0			c.A160C						.						131.0	106.0	115.0					11																	6231167		2201	4296	6497	SO:0001583	missense	160298	exon2			CTGGTAAAACAGT	BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.160A>C	11.37:g.6231167A>C	ENSP00000321021:p.Lys54Gln	105.0	0.0		105.0	34.0	NM_173525		Missense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.961200	0.34565	.	.	ENSG00000180878	ENST00000316375	T	0.62232	0.04	5.17	5.17	0.71159	.	0.000000	0.56097	D	0.000021	T	0.65873	0.2733	N	0.24115	0.695	0.31772	N	0.631935	D	0.76494	0.999	D	0.80764	0.994	T	0.71724	-0.4506	10	0.87932	D	0	-10.4063	11.314	0.49381	1.0:0.0:0.0:0.0	.	54	Q8N5U0	CK042_HUMAN	Q	54	ENSP00000321021:K54Q	ENSP00000321021:K54Q	K	+	1	0	C11orf42	6187743	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.583000	0.60964	2.168000	0.68352	0.477000	0.44152	AAA	.		0.617	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257227.2	NM_173525	
C19orf24	55009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	1275790	1275792	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	GCG	GCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:1275790_1275792delGCG	ENST00000409293.4	+	1	765_767	c.242_244delGCG	c.(241-246)tgcggc>tgc	p.G82del	C19orf24_ENST00000469144.1_5'Flank	NM_017914.3	NP_060384.3	Q9BVV8	CS024_HUMAN	chromosome 19 open reading frame 24	82						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)							Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGGCTTCTGCGGCCTGACCGC	0.7																																					p.81_82del		.											.	C19orf24	90	0			c.242_244del						.																																			SO:0001651	inframe_deletion	55009	exon1			GCTTCTGCGGCCT	BC000890	CCDS12060.2	19p13.3	2012-10-24			ENSG00000228300	ENSG00000228300			26073	protein-coding gene	gene with protein product						16847563	Standard	NM_017914		Approved	FLJ20640	uc002lrw.4	Q9BVV8	OTTHUMG00000153928	ENST00000409293.4:c.242_244delGCG	19.37:g.1275790_1275792delGCG	ENSP00000386557:p.Gly82del	32.0	0.0		70.0	50.0	NM_017914	Q9NWS2	In_Frame_Del	DEL	ENST00000409293.4	37	CCDS12060.2																																																																																			.		0.700	C19orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333049.2	NM_017914	
C21orf91	54149	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	19168929	19168942	+	Frame_Shift_Del	DEL	TCTGGACATTAGCC	TCTGGACATTAGCC	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	TCTGGACATTAGCC	TCTGGACATTAGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr21:19168929_19168942delTCTGGACATTAGCC	ENST00000400558.3	-	3	711_724	c.621_634delGGCTAATGTCCAGA	c.(619-636)gaggctaatgtccagaccfs	p.EANVQT207fs	AL109761.5_ENST00000428689.1_RNA|C21orf91_ENST00000284881.4_Frame_Shift_Del_p.EANVQT207fs|C21orf91_ENST00000493464.1_5'Flank|C21orf91_ENST00000400559.3_Frame_Shift_Del_p.EANVQT207fs	NM_001100421.1	NP_001093891.1			chromosome 21 open reading frame 91											endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		GGATGCTGGGTCTGGACATTAGCCTCTGGACTAG	0.407																																					p.207_212del		.											.	C21orf91	91	0			c.621_634del						.																																			SO:0001589	frameshift_variant	54149	exon3			GCTGGGTCTGGAC	AF239726	CCDS42907.1, CCDS42908.1, CCDS42909.1	21q21.1	2011-12-12	2003-07-22		ENSG00000154642	ENSG00000154642			16459	protein-coding gene	gene with protein product	"""cold sore susceptibility gene 1"", ""early undifferentiated retina and lens"""		"""chromosome 21 open reading frame 38"""	C21orf38, C21orf14		22039568	Standard	NM_001100421		Approved	YG81, EURL, CSSG1	uc002yko.4	Q9NYK6	OTTHUMG00000074509	ENST00000400558.3:c.621_634delGGCTAATGTCCAGA	21.37:g.19168929_19168942delTCTGGACATTAGCC	ENSP00000383403:p.Glu207fs	261.0	0.0		254.0	50.0	NM_017447		Frame_Shift_Del	DEL	ENST00000400558.3	37	CCDS42909.1																																																																																			.		0.407	C21orf91-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000158214.1	NM_017447	
C3orf79	152118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	153202472	153202472	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:153202472T>C	ENST00000446603.2	+	1	189	c.127T>C	c.(127-129)Tac>Cac	p.Y43H	RP11-23D24.2_ENST00000493214.2_RNA	NM_001101337.1	NP_001094807.1	P0CE67	CC079_HUMAN	chromosome 3 open reading frame 79	43										endometrium(1)|large_intestine(3)	4						GTGTTTGCTTTACAAGGTAAA	0.413																																					p.Y43H		.											.	.	.	0			c.T127C						.						274.0	259.0	264.0					3																	153202472		1904	4133	6037	SO:0001583	missense	152118	exon1			TTGCTTTACAAGG	AF086445	CCDS46937.1	3q25.2	2009-09-30			ENSG00000237787	ENSG00000237787			37259	protein-coding gene	gene with protein product							Standard	NM_001101337		Approved		uc003ezt.3	P0CE67	OTTHUMG00000159629	ENST00000446603.2:c.127T>C	3.37:g.153202472T>C	ENSP00000389475:p.Tyr43His	152.0	0.0		138.0	45.0	NM_001101337		Missense_Mutation	SNP	ENST00000446603.2	37	CCDS46937.1	.	.	.	.	.	.	.	.	.	.	T	4.343	0.063024	0.08388	.	.	ENSG00000237787	ENST00000446603	.	.	.	3.66	-0.246	0.13022	.	.	.	.	.	T	0.16557	0.0398	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.21552	-1.0242	8	0.87932	D	0	.	3.4367	0.07448	0.0:0.225:0.2029:0.5721	.	43	P0CE67	CC079_HUMAN	H	43	.	ENSP00000389475:Y43H	Y	+	1	0	C3orf79	154685162	0.003000	0.15002	0.001000	0.08648	0.262000	0.26303	0.633000	0.24598	-0.032000	0.13758	-0.256000	0.11100	TAC	.		0.413	C3orf79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356570.1	NM_001101337	
CAPZA2	830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	116544394	116544394	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:116544394T>A	ENST00000361183.3	+	5	522	c.383T>A	c.(382-384)cTg>cAg	p.L128Q	CAPZA2_ENST00000490693.1_Missense_Mutation_p.L128Q|CAPZA2_ENST00000458284.2_Missense_Mutation_p.L128Q	NM_006136.2	NP_006127.1	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line, alpha 2	128					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(2)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	13	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			GAAACTGCTCTGAGAGCTTAC	0.403																																					p.L128Q		.											.	CAPZA2	514	0			c.T383A						.						115.0	103.0	107.0					7																	116544394		2203	4300	6503	SO:0001583	missense	830	exon5			CTGCTCTGAGAGC		CCDS5768.1	7q31.2-q31.3	2008-07-18			ENSG00000198898	ENSG00000198898			1490	protein-coding gene	gene with protein product	"""F-actin capping protein alpha-2 subunit"""	601571					Standard	NM_006136		Approved	CAPZ, CAPPA2	uc003vil.3	P47755	OTTHUMG00000023185	ENST00000361183.3:c.383T>A	7.37:g.116544394T>A	ENSP00000354947:p.Leu128Gln	78.0	0.0		84.0	35.0	NM_006136	B4DG50	Missense_Mutation	SNP	ENST00000361183.3	37	CCDS5768.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.809458	0.90707	.	.	ENSG00000198898	ENST00000361183;ENST00000458284;ENST00000490693	.	.	.	5.42	5.42	0.78866	.	0.129181	0.52532	D	0.000063	T	0.79953	0.4535	M	0.80847	2.515	0.48452	D	0.999654	D	0.59767	0.986	D	0.74348	0.983	T	0.82896	-0.0230	9	0.72032	D	0.01	-4.8687	15.7455	0.77936	0.0:0.0:0.0:1.0	.	128	P47755	CAZA2_HUMAN	Q	128	.	ENSP00000354947:L128Q	L	+	2	0	CAPZA2	116331630	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.993000	0.88291	2.170000	0.68504	0.533000	0.62120	CTG	.		0.403	CAPZA2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059506.4	NM_006136	
CCDC105	126402	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	15121855	15121855	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:15121855T>A	ENST00000292574.3	+	1	300	c.218T>A	c.(217-219)tTc>tAc	p.F73Y	SLC1A6_ENST00000430939.2_5'Flank	NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	73						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CCCTGGCGCTTCCGCGTGGAG	0.697																																					p.F73Y		.											.	CCDC105	91	0			c.T218A						.						10.0	11.0	11.0					19																	15121855		2160	4256	6416	SO:0001583	missense	126402	exon1			GGCGCTTCCGCGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.218T>A	19.37:g.15121855T>A	ENSP00000292574:p.Phe73Tyr	54.0	1.0		51.0	6.0	NM_173482	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.390478	0.82902	.	.	ENSG00000160994	ENST00000292574	T	0.23552	1.9	4.03	4.03	0.46877	.	0.000000	0.42053	D	0.000762	T	0.35711	0.0941	L	0.34521	1.04	0.26099	N	0.980845	D	0.63880	0.993	D	0.72338	0.977	T	0.06041	-1.0849	10	0.59425	D	0.04	-16.6525	9.3667	0.38228	0.0:0.0:0.0:1.0	.	73	Q8IYK2	CC105_HUMAN	Y	73	ENSP00000292574:F73Y	ENSP00000292574:F73Y	F	+	2	0	CCDC105	14982855	1.000000	0.71417	0.996000	0.52242	0.936000	0.57629	4.188000	0.58351	1.449000	0.47699	0.379000	0.24179	TTC	.		0.697	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
CCDC137	339230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79639185	79639185	+	Splice_Site	SNP	G	G	A	rs373550389		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:79639185G>A	ENST00000329214.8	+	5	1063	c.660G>A	c.(658-660)caG>caA	p.Q220Q		NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	220							poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCAAGGACCAGGTAAGTGGGG	0.587																																					p.Q220Q		.											.	CCDC137	69	0			c.G660A						.	G		0,4026		0,0,2013	40.0	44.0	42.0		660	4.8	0.9	17		42	1,8359		0,1,4179	no	coding-synonymous-near-splice	CCDC137	NM_199287.2		0,1,6192	AA,AG,GG		0.012,0.0,0.0081		220/290	79639185	1,12385	2013	4180	6193	SO:0001630	splice_region_variant	339230	exon5			GGACCAGGTAAGT	BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.660+1G>A	17.37:g.79639185G>A		128.0	0.0		140.0	77.0	NM_199287		Silent	SNP	ENST00000329214.8	37	CCDS42400.1																																																																																			.		0.587	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440387.1		Silent
CCNA2	890	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122740571	122740571	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:122740571G>A	ENST00000274026.5	-	5	1261	c.958C>T	c.(958-960)Ctg>Ttg	p.L320L		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	320					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						TGCTGATGCAGAAAGTATTGG	0.373																																					p.L320L		.											.	CCNA2	848	0			c.C958T						.						97.0	96.0	96.0					4																	122740571		2203	4300	6503	SO:0001819	synonymous_variant	890	exon5			GATGCAGAAAGTA		CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.958C>T	4.37:g.122740571G>A		144.0	1.0		162.0	63.0	NM_001237	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Silent	SNP	ENST00000274026.5	37	CCDS3723.1																																																																																			.		0.373	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	
CCNG1	900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	162866370	162866370	+	Silent	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:162866370A>C	ENST00000340828.2	+	2	332	c.108A>C	c.(106-108)ctA>ctC	p.L36L	RP11-541P9.3_ENST00000458002.2_RNA|CCNG1_ENST00000510664.1_Intron|CCNG1_ENST00000393929.1_Silent_p.L36L|CCNG1_ENST00000511683.2_Intron|RP11-541P9.3_ENST00000503504.1_RNA|CCNG1_ENST00000504553.1_5'Flank|CCNG1_ENST00000512163.1_Intron	NM_004060.3	NP_004051.1	P51959	CCNG1_HUMAN	cyclin G1	36					brain development (GO:0007420)|cell growth (GO:0016049)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to organonitrogen compound (GO:0010243)|syncytium formation (GO:0006949)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		GTTTGAGACTAATTGAGTCTG	0.438																																					p.L36L		.											.	CCNG1	725	0			c.A108C						.						136.0	126.0	130.0					5																	162866370		2203	4300	6503	SO:0001819	synonymous_variant	900	exon3			GAGACTAATTGAG	D78341	CCDS4360.1	5q32-q34	2010-11-15			ENSG00000113328	ENSG00000113328			1592	protein-coding gene	gene with protein product		601578		CCNG		8954786, 8806701	Standard	NM_004060		Approved		uc003lzb.3	P51959	OTTHUMG00000130380	ENST00000340828.2:c.108A>C	5.37:g.162866370A>C		171.0	0.0		133.0	47.0	NM_199246	B2R7B2|B4DLW7|D3DQK7|Q15757|Q96L32	Silent	SNP	ENST00000340828.2	37	CCDS4360.1																																																																																			.		0.438	CCNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252750.3	NM_004060	
CD300LB	124599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72518964	72518964	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:72518964C>G	ENST00000392621.1	-	4	634	c.630G>C	c.(628-630)aaG>aaC	p.K210N		NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	173					cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						TCTGAGACCCCTTCAACCAGA	0.532																																					p.K210N		.											.	CD300LB	91	0			c.G630C						.						130.0	112.0	118.0					17																	72518964		2203	4300	6503	SO:0001583	missense	124599	exon4			AGACCCCTTCAAC	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.630G>C	17.37:g.72518964C>G	ENSP00000376397:p.Lys210Asn	229.0	0.0		307.0	86.0	NM_174892	Q1EG73|Q8IX40|Q8N6D1	Missense_Mutation	SNP	ENST00000392621.1	37	CCDS11700.1	.	.	.	.	.	.	.	.	.	.	C	7.214	0.595946	0.13875	.	.	ENSG00000178789	ENST00000392621;ENST00000314401	.	.	.	4.61	1.46	0.22682	.	0.544623	0.16395	N	0.216277	T	0.28433	0.0703	N	0.17345	0.48	0.35571	D	0.805457	B	0.22909	0.077	B	0.20955	0.032	T	0.16719	-1.0393	9	0.12430	T	0.62	-9.0403	5.4382	0.16494	0.0:0.6452:0.1652:0.1896	.	173	A8K4G0	CLM7_HUMAN	N	173;210	.	ENSP00000317337:K210N	K	-	3	2	CD300LB	70030559	0.265000	0.24102	0.204000	0.23530	0.395000	0.30598	0.352000	0.20113	0.244000	0.21351	-0.379000	0.06801	AAG	.		0.532	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145082.2	NM_174892	
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	26881298	26881298	+	Missense_Mutation	SNP	G	G	T	rs568693690		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:26881298G>T	ENST00000231021.4	-	12	2489	c.2317C>A	c.(2317-2319)Cgt>Agt	p.R773S		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	773					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TTTTTGAAACGAGGCCCCCAG	0.408																																					p.R773S	Melanoma(8;187 585 15745 40864 52829)	.											.	CDH9	99	0			c.C2317A						.						128.0	124.0	126.0					5																	26881298		2203	4299	6502	SO:0001583	missense	1007	exon12			TGAAACGAGGCCC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2317C>A	5.37:g.26881298G>T	ENSP00000231021:p.Arg773Ser	128.0	0.0		139.0	44.0	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379404	0.82682	.	.	ENSG00000113100	ENST00000231021	T	0.79653	-1.29	5.26	5.26	0.73747	Cadherin, cytoplasmic domain (1);	0.167045	0.56097	D	0.000037	D	0.92815	0.7715	H	0.96301	3.8	0.47476	D	0.99943	D;D	0.62365	0.991;0.991	D;D	0.66716	0.946;0.946	D	0.94980	0.8125	9	.	.	.	.	17.4441	0.87574	0.0:0.0:1.0:0.0	.	366;773	B4DFP0;Q9ULB4	.;CADH9_HUMAN	S	773	ENSP00000231021:R773S	.	R	-	1	0	CDH9	26917055	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.835000	0.99442	2.456000	0.83038	0.557000	0.71058	CGT	.		0.408	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CDC20B	166979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54442574	54442574	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:54442574T>G	ENST00000381375.2	-	3	382	c.237A>C	c.(235-237)caA>caC	p.Q79H	CDC20B_ENST00000296733.1_Missense_Mutation_p.Q79H|CDC20B_ENST00000331730.3_Missense_Mutation_p.Q58H|CDC20B_ENST00000334206.5_Missense_Mutation_p.Q79H|CDC20B_ENST00000322374.6_Missense_Mutation_p.Q79H			Q86Y33	CD20B_HUMAN	cell division cycle 20B	79										kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			TAGTTTGACTTTGCTGCCACC	0.517											OREG0016610	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q79H		.											.	CDC20B	90	0			c.A237C						.						120.0	112.0	114.0					5																	54442574		2203	4300	6503	SO:0001583	missense	166979	exon3			TTGACTTTGCTGC	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.237A>C	5.37:g.54442574T>G	ENSP00000370781:p.Gln79His	125.0	0.0	1000	114.0	42.0	NM_001170402	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Missense_Mutation	SNP	ENST00000381375.2	37	CCDS54852.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.695414	0.48202	.	.	ENSG00000164287	ENST00000334206;ENST00000296733;ENST00000381375;ENST00000322374;ENST00000331730	T;T;T;T;T	0.27104	3.11;3.11;3.11;3.11;1.69	4.79	-1.36	0.09085	.	0.147317	0.31450	N	0.007638	T	0.39009	0.1062	M	0.61703	1.905	0.09310	N	0.999994	D;D;D;D	0.89917	1.0;1.0;0.999;0.993	D;D;D;P	0.69479	0.964;0.961;0.915;0.891	T	0.17198	-1.0377	10	0.59425	D	0.04	-13.586	8.5261	0.33307	0.0:0.5087:0.0:0.4913	.	79;79;79;79	Q86Y33-4;Q86Y33-3;Q86Y33;Q86Y33-2	.;.;CD20B_HUMAN;.	H	79;79;79;79;58	ENSP00000335664:Q79H;ENSP00000296733:Q79H;ENSP00000370781:Q79H;ENSP00000315720:Q79H;ENSP00000330566:Q58H	ENSP00000296733:Q79H	Q	-	3	2	CDC20B	54478331	0.950000	0.32346	0.936000	0.37596	0.546000	0.35178	0.030000	0.13688	-0.103000	0.12175	0.528000	0.53228	CAA	.		0.517	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	NM_152623	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109795272	109795272	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:109795272C>T	ENST00000271332.3	+	1	2632	c.2571C>T	c.(2569-2571)ggC>ggT	p.G857G		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	857	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TCCAAGGAGGCGACGATGGAG	0.547																																					p.G857G	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.C2571T						.						113.0	104.0	107.0					1																	109795272		2203	4300	6503	SO:0001819	synonymous_variant	1952	exon1			AGGAGGCGACGAT	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.2571C>T	1.37:g.109795272C>T		158.0	0.0		226.0	100.0	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.547	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CHD9	80205	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	53358774	53358774	+	Silent	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:53358774A>C	ENST00000398510.3	+	38	8748	c.8661A>C	c.(8659-8661)tcA>tcC	p.S2887S	CHD9_ENST00000447540.1_Silent_p.S2872S|CHD9_ENST00000566029.1_Silent_p.S2871S|CHD9_ENST00000564845.1_Silent_p.S2871S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2887	Poly-Ser.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CATCGTCGTCATCTGAGGATT	0.363																																					p.S2871S		.											.	CHD9	272	0			c.A8613C						.						21.0	20.0	20.0					16																	53358774		1852	4085	5937	SO:0001819	synonymous_variant	80205	exon39			GTCGTCATCTGAG	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.8661A>C	16.37:g.53358774A>C		284.0	1.0		294.0	97.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	ENST00000398510.3	37																																																																																				.		0.363	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CHPF	79586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220406586	220406586	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:220406586C>T	ENST00000243776.6	-	2	888	c.640G>A	c.(640-642)Ggc>Agc	p.G214S	CHPF_ENST00000535926.1_Missense_Mutation_p.G52S|TMEM198_ENST00000344458.2_5'Flank|TMEM198_ENST00000373883.3_5'Flank|CHPF_ENST00000373891.2_Missense_Mutation_p.G214S	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	214					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CTGAGGTGGCCAGTTAGGCGT	0.697											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G214S		.											.	CHPF	90	0			c.G640A						.						29.0	24.0	26.0					2																	220406586		2201	4299	6500	SO:0001583	missense	79586	exon2			GGTGGCCAGTTAG	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.640G>A	2.37:g.220406586C>T	ENSP00000243776:p.Gly214Ser	68.0	0.0	2266	125.0	39.0	NM_024536	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	37	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769714	0.49680	.	.	ENSG00000123989	ENST00000243776;ENST00000535926;ENST00000373891	T;T	0.10382	2.92;2.88	4.29	3.42	0.39159	.	0.290182	0.33327	N	0.005024	T	0.04092	0.0114	N	0.04820	-0.15	0.39060	D	0.960512	B;B	0.21606	0.046;0.058	B;B	0.21360	0.034;0.032	T	0.33394	-0.9870	10	0.08381	T	0.77	-22.8262	6.797	0.23731	0.294:0.6219:0.0:0.0841	.	214;214	F8W6H2;Q8IZ52	.;CHSS2_HUMAN	S	214;52;214	ENSP00000243776:G214S;ENSP00000445571:G52S	ENSP00000243776:G214S	G	-	1	0	CHPF	220114830	0.981000	0.34729	0.835000	0.33067	0.981000	0.71138	2.407000	0.44565	1.183000	0.42943	0.549000	0.68633	GGC	.		0.697	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
CIB1	10519	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90773726	90773726	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:90773726A>C	ENST00000328649.6	-	7	727	c.566T>G	c.(565-567)aTt>aGt	p.I189S		NM_006384.3	NP_006375.2	Q99828	CIB1_HUMAN	calcium and integrin binding 1 (calmyrin)	189					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to growth factor stimulus (GO:0071363)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to tumor necrosis factor (GO:0071356)|cytoplasmic microtubule organization (GO:0031122)|double-strand break repair (GO:0006302)|endomitotic cell cycle (GO:0007113)|extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|platelet formation (GO:0030220)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of male germ cell proliferation (GO:2000256)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell division (GO:0051302)|regulation of cell proliferation (GO:0042127)|response to ischemia (GO:0002931)|spermatid development (GO:0007286)|thrombopoietin-mediated signaling pathway (GO:0038163)	cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|protein anchor (GO:0043495)|Ras GTPase binding (GO:0017016)			lung(1)|prostate(1)	2	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			TCACAGGACAATCTTAAAGGA	0.557																																					p.I189S		.											.	CIB1	130	0			c.T566G						.						68.0	64.0	66.0					15																	90773726		1819	3413	5232	SO:0001583	missense	10519	exon7			AGGACAATCTTAA	U82226	CCDS10360.1, CCDS73781.1	15q25.3-q26	2013-01-10			ENSG00000185043	ENSG00000185043		"""EF-hand domain containing"""	16920	protein-coding gene	gene with protein product		602293				9030514, 10826701	Standard	NM_006384		Approved	SIP2-28, CALMYRIN, CIB, KIP	uc031qtq.1	Q99828	OTTHUMG00000149808	ENST00000328649.6:c.566T>G	15.37:g.90773726A>C	ENSP00000333873:p.Ile189Ser	178.0	0.0		166.0	56.0	NM_006384	B5BU40|H6WJF3|O00693|O00735|Q6IB49|Q96J54|Q99971	Missense_Mutation	SNP	ENST00000328649.6	37	CCDS10360.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.499885	0.85176	.	.	ENSG00000185043	ENST00000328649	T	0.09911	2.93	5.67	5.67	0.87782	EF-hand-like domain (1);	0.049490	0.85682	D	0.000000	T	0.34221	0.0890	M	0.75615	2.305	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.07046	-1.0793	10	0.87932	D	0	-9.9203	15.1051	0.72315	1.0:0.0:0.0:0.0	.	189	Q99828	CIB1_HUMAN	S	189	ENSP00000333873:I189S	ENSP00000333873:I189S	I	-	2	0	CIB1	88574730	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.762000	0.55250	2.163000	0.67991	0.459000	0.35465	ATT	.		0.557	CIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313419.1		
CLCN6	1185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11896203	11896203	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:11896203A>T	ENST00000346436.6	+	18	2025	c.1973A>T	c.(1972-1974)aAg>aTg	p.K658M	CLCN6_ENST00000376496.3_Missense_Mutation_p.K658M|CLCN6_ENST00000376487.3_Missense_Mutation_p.K636M|CLCN6_ENST00000312413.6_3'UTR	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	658	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AACAACATCAAGTTCAAGGTA	0.567																																					p.K658M		.											.	CLCN6	90	0			c.A1973T						.						77.0	69.0	71.0					1																	11896203		2203	4300	6503	SO:0001583	missense	1185	exon18			ACATCAAGTTCAA	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.1973A>T	1.37:g.11896203A>T	ENSP00000234488:p.Lys658Met	149.0	0.0		138.0	50.0	NM_001286	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	A	13.99	2.400682	0.42613	.	.	ENSG00000011021	ENST00000346436;ENST00000376487;ENST00000376496	D;D;D	0.91996	-2.92;-2.91;-2.95	5.71	1.84	0.25277	Cystathionine beta-synthase, core (1);	0.254796	0.42964	D	0.000630	D	0.82291	0.5005	N	0.14661	0.345	0.80722	D	1	B;B	0.22146	0.065;0.039	B;B	0.21708	0.036;0.016	T	0.70234	-0.4928	10	0.36615	T	0.2	-13.6392	8.2988	0.32001	0.7356:0.0:0.2644:0.0	.	636;658	F8W9R3;P51797	.;CLCN6_HUMAN	M	658;636;658	ENSP00000234488:K658M;ENSP00000365670:K636M;ENSP00000365679:K658M	ENSP00000234488:K658M	K	+	2	0	CLCN6	11818790	0.990000	0.36364	0.910000	0.35882	0.907000	0.53573	2.069000	0.41481	0.051000	0.15978	0.379000	0.24179	AAG	.		0.567	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006639.2	NM_001286	
CMTM8	152189	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	32280486	32280486	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:32280486C>T	ENST00000307526.3	+	1	316	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C	CMTM8_ENST00000458535.2_Missense_Mutation_p.R8C|RP11-384L8.1_ENST00000565519.1_RNA	NM_178868.3	NP_849199.2	Q8IZV2	CKLF8_HUMAN	CKLF-like MARVEL transmembrane domain containing 8	8					chemotaxis (GO:0006935)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|lung(1)	4						GCAGCGCGCCCGCTCGCACAC	0.731																																					p.R8C		.											.	CMTM8	90	0			c.C22T						.						19.0	20.0	20.0					3																	32280486		2126	4173	6299	SO:0001583	missense	152189	exon1			CGCGCCCGCTCGC	AF474370	CCDS2652.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000170293	ENSG00000170293			19179	protein-coding gene	gene with protein product		607891	"""chemokine-like factor super family 8"", ""chemokine-like factor superfamily 8"""	CKLFSF8			Standard	NM_178868		Approved		uc003cex.3	Q8IZV2	OTTHUMG00000130753	ENST00000307526.3:c.22C>T	3.37:g.32280486C>T	ENSP00000307741:p.Arg8Cys	210.0	1.0		225.0	92.0	NM_178868	A5D6I7|Q8IW01	Missense_Mutation	SNP	ENST00000307526.3	37	CCDS2652.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821521	0.50633	.	.	ENSG00000170293	ENST00000458535;ENST00000307526	T	0.31769	1.48	4.37	4.37	0.52481	.	0.111310	0.40640	N	0.001057	T	0.33235	0.0856	N	0.08118	0	0.46823	D	0.999214	D;D	0.89917	1.0;0.998	D;P	0.76575	0.988;0.853	T	0.34950	-0.9808	10	0.52906	T	0.07	-4.8842	12.4117	0.55471	0.0:0.83:0.17:0.0	.	8;8	A5D6I7;Q8IZV2	.;CKLF8_HUMAN	C	8	ENSP00000307741:R8C	ENSP00000307741:R8C	R	+	1	0	CMTM8	32255490	0.966000	0.33281	0.981000	0.43875	0.010000	0.07245	2.807000	0.47955	1.946000	0.56461	0.561000	0.74099	CGC	.		0.731	CMTM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253253.1	NM_178868	
CNPY2	10330	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	56708923	56708923	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:56708923G>A	ENST00000273308.4	-	2	619	c.79C>T	c.(79-81)Cac>Tac	p.H27Y	RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.10_ENST00000549318.1_Missense_Mutation_p.H27Y|RP11-977G19.11_ENST00000549860.1_RNA|CNPY2_ENST00000551720.1_5'UTR|PAN2_ENST00000549090.1_5'Flank	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2	27	Saposin B-type. {ECO:0000255|PROSITE- ProRule:PRU00415}.				negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						CCTCCACAGTGGAGATCCTGG	0.587																																					p.H27Y		.											.	CNPY2	68	0			c.C79T						.						58.0	61.0	60.0					12																	56708923		2203	4300	6503	SO:0001583	missense	10330	exon2			CACAGTGGAGATC	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.79C>T	12.37:g.56708923G>A	ENSP00000273308:p.His27Tyr	125.0	0.0		136.0	53.0	NM_014255	B2R7B9|Q9UHE9	Missense_Mutation	SNP	ENST00000273308.4	37	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322443	0.60634	.	.	ENSG00000144785;ENSG00000144785;ENSG00000144785;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000547423;ENST00000548360;ENST00000273308;ENST00000551475	T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31	5.17	5.17	0.71159	Saposin B (1);	0.107189	0.64402	D	0.000006	T	0.21307	0.0513	N	0.01576	-0.805	0.43300	D	0.995299	P;B	0.46912	0.886;0.002	P;B	0.46659	0.523;0.003	T	0.29579	-1.0007	10	0.30854	T	0.27	-20.3382	17.9755	0.89126	0.0:0.0:1.0:0.0	.	27;27	Q9Y2B0-2;Q9Y2B0	.;CNPY2_HUMAN	Y	27	ENSP00000446743:H27Y;ENSP00000446506:H27Y;ENSP00000447042:H27Y;ENSP00000273308:H27Y;ENSP00000448809:H27Y	ENSP00000273308:H27Y	H	-	1	0	RP11-977G19.10;CNPY2	54995190	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.846000	0.48262	2.865000	0.98341	0.655000	0.94253	CAC	.		0.587	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	
CNTN2	6900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205038645	205038645	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:205038645A>G	ENST00000331830.4	+	17	2436	c.2152A>G	c.(2152-2154)Agc>Ggc	p.S718G		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	718	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CTCAGGACTCAGCGGAGGAGG	0.597																																					p.S718G	Melanoma(183;2548 2817 37099 41192)	.											.	CNTN2	91	0			c.A2152G						.						64.0	68.0	67.0					1																	205038645		2203	4300	6503	SO:0001583	missense	6900	exon17			GGACTCAGCGGAG	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2152A>G	1.37:g.205038645A>G	ENSP00000330633:p.Ser718Gly	124.0	0.0		156.0	36.0	NM_005076	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	37	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	A	9.060	0.994363	0.19043	.	.	ENSG00000184144	ENST00000331830	T	0.59502	0.26	5.57	5.57	0.84162	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.090873	0.47852	D	0.000206	T	0.28764	0.0713	N	0.03281	-0.365	0.32149	N	0.584446	B;B	0.06786	0.0;0.001	B;B	0.09377	0.0;0.004	T	0.33343	-0.9872	10	0.10377	T	0.69	.	8.2247	0.31562	0.8504:0.0:0.1496:0.0	.	718;609	Q02246;Q68DA2	CNTN2_HUMAN;.	G	718	ENSP00000330633:S718G	ENSP00000330633:S718G	S	+	1	0	CNTN2	203305268	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.023000	0.41040	2.114000	0.64651	0.460000	0.39030	AGC	.		0.597	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
CNTRL	11064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123922548	123922548	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:123922548T>C	ENST00000373855.1	+	32	5317	c.5057T>C	c.(5056-5058)gTt>gCt	p.V1686A	CNTRL_ENST00000373844.1_Missense_Mutation_p.V131A|CNTRL_ENST00000238341.5_Missense_Mutation_p.V1686A|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.V1134A			Q7Z7A1	CNTRL_HUMAN	centriolin	1686					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AATCTTCAGGTTGTTTTAAGG	0.313																																					p.V1686A		.											.	CNTRL	661	0			c.T5057C						.						73.0	86.0	82.0					9																	123922548		2203	4290	6493	SO:0001583	missense	11064	exon30			TTCAGGTTGTTTT	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5057T>C	9.37:g.123922548T>C	ENSP00000362962:p.Val1686Ala	234.0	0.0		200.0	56.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.654806	0.29425	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373845;ENST00000373844	T;T;T	0.27402	1.67;1.67;1.67	5.62	2.93	0.34026	.	.	.	.	.	T	0.20780	0.0500	L	0.60455	1.87	0.19300	N	0.99998	B	0.30741	0.293	B	0.22386	0.039	T	0.24548	-1.0157	9	0.07990	T	0.79	.	3.5789	0.07945	0.1242:0.0739:0.2282:0.5736	.	1686	Q7Z7A1	CNTRL_HUMAN	A	1686;1686;1686;442;1134;368;131	ENSP00000362962:V1686A;ENSP00000238341:V1686A;ENSP00000362956:V1134A	ENSP00000238341:V1686A	V	+	2	0	CNTRL	122962369	0.953000	0.32496	0.999000	0.59377	0.952000	0.60782	0.245000	0.18142	0.923000	0.37045	0.482000	0.46254	GTT	.		0.313	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
COBLL1	22837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	165542496	165542496	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:165542496A>C	ENST00000392717.2	-	15	3579	c.3575T>G	c.(3574-3576)cTc>cGc	p.L1192R	SNORA70F_ENST00000384142.1_RNA|COBLL1_ENST00000409184.3_Missense_Mutation_p.L1154R|COBLL1_ENST00000194871.6_Missense_Mutation_p.L1221R|COBLL1_ENST00000342193.4_Missense_Mutation_p.L1154R|COBLL1_ENST00000375458.2_Missense_Mutation_p.L1116R			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1192						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GGAATGGCTGAGTCTTGACCT	0.438																																					p.L1154R		.											.	COBLL1	93	0			c.T3461G						.						150.0	120.0	130.0					2																	165542496		2203	4300	6503	SO:0001583	missense	22837	exon14			TGGCTGAGTCTTG	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3575T>G	2.37:g.165542496A>C	ENSP00000376478:p.Leu1192Arg	96.0	0.0		93.0	34.0	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.	.	.	.	.	.	.	.	.	.	A	19.15	3.772607	0.69992	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.62	5.62	0.85841	.	0.097389	0.45606	D	0.000345	T	0.77164	0.4090	M	0.66939	2.045	0.47374	D	0.999405	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.69142	0.917;0.917;0.962	T	0.79771	-0.1663	9	0.87932	D	0	-1.6258	16.1219	0.81365	1.0:0.0:0.0:0.0	.	1192;1221;1154	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	R	1116;1154;1154;1192;1221	.	ENSP00000194871:L1221R	L	-	2	0	COBLL1	165250742	1.000000	0.71417	0.982000	0.44146	0.909000	0.53808	3.275000	0.51639	2.254000	0.74563	0.528000	0.53228	CTC	.		0.438	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
CSNK1G2	1455	ucsc.edu;mdanderson.org	37	19	1953388	1953388	+	Intron	SNP	C	C	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:1953388C>G	ENST00000255641.8	+	1	230				CSNK1G2-AS1_ENST00000314315.3_RNA|CSNK1G2-AS1_ENST00000586395.1_RNA	NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCTCACTTCCCCCGGAGTCT	0.612																																					.	Ovarian(91;880 1392 21236 36928 37598)	.											.	.	.	0			.						.						87.0	84.0	85.0					19																	1953388		2047	4175	6222	SO:0001627	intron_variant	255193	.			CACTTCCCCCGGA	AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.-266+11971C>G	19.37:g.1953388C>G		176.0	0.0		170.0	56.0	.	B5BU42|O00704|Q8WUB1	RNA	SNP	ENST00000255641.8	37	CCDS12077.1	.	.	.	.	.	.	.	.	.	.	c	6.584	0.476067	0.12521	.	.	ENSG00000180846	ENST00000314315	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	T	0.54240	0.1846	.	.	.	0.09310	N	1	D	0.55605	0.972	P	0.62184	0.899	T	0.42515	-0.9447	6	0.87932	D	0	.	.	.	.	.	104	Q8NCQ2	CS034_HUMAN	A	104	.	ENSP00000315669:G104A	G	-	2	0	C19orf34	1904388	0.005000	0.15991	0.061000	0.19648	0.061000	0.15899	0.959000	0.29240	0.202000	0.20498	0.205000	0.17691	GGG	.		0.612	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449287.1	NM_001319	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	C	rs121913416		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:41266100T>C	ENST00000349496.5	+	3	377	c.97T>C	c.(97-99)Tct>Cct	p.S33P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1	CTNNB1	24361	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)	c.T97C						.						93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGACTCTGGAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>C	3.37:g.41266100T>C	ENSP00000344456:p.Ser33Pro	398.0	0.0		329.0	98.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395782	0.83011	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	P	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26P;ENSP00000385604:S33P;ENSP00000412219:S33P;ENSP00000379486:S33P;ENSP00000344456:S33P;ENSP00000411226:S26P;ENSP00000379488:S33P;ENSP00000409302:S33P;ENSP00000401599:S33P	ENSP00000344456:S33P	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266110	41266110	+	Missense_Mutation	SNP	A	A	C	rs121913416		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:41266110A>C	ENST00000349496.5	+	3	387	c.107A>C	c.(106-108)cAt>cCt	p.H36P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.H36P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.H29P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	36					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.H36P(24)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.H36R(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTGGAATCCATTCTGGTGCC	0.498		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.H36P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0	CTNNB1	24361	159	Deletion - In frame(104)|Substitution - Missense(27)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(119)|large_intestine(20)|stomach(7)|kidney(6)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A107C						.						95.0	80.0	85.0					3																	41266110		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GAATCCATTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.107A>C	3.37:g.41266110A>C	ENSP00000344456:p.His36Pro	382.0	0.0		330.0	96.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824526	0.50739	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.76	5.76	0.90799	.	0.093481	0.85682	D	0.000000	T	0.51210	0.1661	M	0.64170	1.965	0.80722	D	1	P	0.40398	0.716	P	0.45946	0.498	T	0.54807	-0.8238	10	0.72032	D	0.01	-2.3155	16.0676	0.80897	1.0:0.0:0.0:0.0	.	36	P35222	CTNB1_HUMAN	P	29;36;36;36;36;29;36;36;36	ENSP00000400508:H29P;ENSP00000385604:H36P;ENSP00000412219:H36P;ENSP00000379486:H36P;ENSP00000344456:H36P;ENSP00000411226:H29P;ENSP00000379488:H36P;ENSP00000409302:H36P;ENSP00000401599:H36P	ENSP00000344456:H36P	H	+	2	0	CTNNB1	41241114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CUL9	23113	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43174240	43174240	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:43174240A>G	ENST00000252050.4	+	26	5288	c.5204A>G	c.(5203-5205)tAc>tGc	p.Y1735C	CUL9_ENST00000502937.1_3'UTR|CUL9_ENST00000354495.3_Missense_Mutation_p.Y1625C|CUL9_ENST00000372647.2_Missense_Mutation_p.Y1735C	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1735					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TCCAGTTTCTACAGCCAGAGT	0.542																																					p.Y1735C		.											.	CUL9	529	0			c.A5204G						.						82.0	79.0	80.0					6																	43174240		2203	4300	6503	SO:0001583	missense	23113	exon26			GTTTCTACAGCCA	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5204A>G	6.37:g.43174240A>G	ENSP00000252050:p.Tyr1735Cys	210.0	1.0		183.0	70.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551294	0.65311	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	D;D;D	0.91894	-2.93;-2.93;-2.93	5.36	5.36	0.76844	Cullin, N-terminal (1);Cullin homology (2);	0.255835	0.40222	N	0.001145	D	0.89255	0.6663	M	0.69823	2.125	0.49798	D	0.999821	P;P;P	0.37441	0.552;0.595;0.595	B;B;B	0.42495	0.389;0.362;0.362	D	0.90495	0.4470	10	0.62326	D	0.03	-23.8256	10.13	0.42674	0.9153:0.0:0.0847:0.0	.	1625;1735;1735	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	C	1735;1625;1735	ENSP00000252050:Y1735C;ENSP00000346490:Y1625C;ENSP00000361730:Y1735C	ENSP00000252050:Y1735C	Y	+	2	0	CUL9	43282218	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.504000	0.73704	2.029000	0.59856	0.482000	0.46254	TAC	.		0.542	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
DDIT3	1649	broad.mit.edu;bcgsc.ca	37	12	57911095	57911095	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:57911095T>A	ENST00000346473.3	-	3	274	c.95A>T	c.(94-96)gAt>gTt	p.D32V	DDIT3_ENST00000551116.1_Missense_Mutation_p.D55V|MIR616_ENST00000385293.1_RNA|DDIT3_ENST00000547303.1_Missense_Mutation_p.D32V|DDIT3_ENST00000552740.1_Missense_Mutation_p.D55V	NM_001195057.1|NM_004083.5	NP_001181986.1|NP_004074.2	P35638	DDIT3_HUMAN	DNA-damage-inducible transcript 3	32					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|blood vessel maturation (GO:0001955)|cell cycle arrest (GO:0007050)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of determination of dorsal identity (GO:2000016)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of transcription involved in anterior/posterior axis specification (GO:0044324)|regulation of transcription, DNA-templated (GO:0006355)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to starvation (GO:0042594)|response to unfolded protein (GO:0006986)|Wnt signaling pathway (GO:0016055)	late endosome (GO:0005770)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)		EWSR1/DDIT3(45)|FUS/DDIT3(631)	central_nervous_system(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)	16						CCCATTTTCATCTGAAGACAG	0.493			T	FUS	liposarcoma																																p.D55V	GBM(112;1383 1547 7626 23045 28770)	.		Dom	yes		12	12q13.1-q13.2	1649	DNA-damage-inducible transcript 3		M	DDIT3,brain,glioma,-1	DDIT3	1171	0			c.A164T						.						68.0	60.0	63.0					12																	57911095		2203	4300	6503	SO:0001583	missense	1649	exon3			TTTTCATCTGAAG	BC003637	CCDS8943.1, CCDS55838.1	12q13.1-q13.2	2008-02-05				ENSG00000175197			2726	protein-coding gene	gene with protein product	"""C/EBP zeta"""	126337				1990262	Standard	NM_001195053		Approved	CHOP10, GADD153, CHOP	uc021qzk.1	P35638		ENST00000346473.3:c.95A>T	12.37:g.57911095T>A	ENSP00000340671:p.Asp32Val	87.0	0.0		75.0	5.0	NM_001195054	F8VS99	Missense_Mutation	SNP	ENST00000346473.3	37	CCDS8943.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268744	0.80469	.	.	ENSG00000175197	ENST00000547303;ENST00000551116;ENST00000346473;ENST00000552740;ENST00000547526	T;T;T;T	0.63096	0.05;-0.02;0.05;-0.02	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.69223	0.3087	L	0.34521	1.04	0.80722	D	1	D;D	0.67145	0.996;0.982	D;P	0.70016	0.967;0.861	T	0.72890	-0.4155	10	0.87932	D	0	-18.5436	14.1539	0.65405	0.0:0.0:0.0:1.0	.	55;32	F8VS99;P35638	.;DDIT3_HUMAN	V	32;55;32;55;55	ENSP00000447188:D32V;ENSP00000448665:D55V;ENSP00000340671:D32V;ENSP00000447803:D55V	ENSP00000340671:D32V	D	-	2	0	DDIT3	56197362	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.013000	0.76373	2.240000	0.73641	0.533000	0.62120	GAT	.		0.493	DDIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407137.1	NM_004083	
DHX15	1665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	24529578	24529578	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:24529578T>G	ENST00000336812.4	-	14	2513	c.2357A>C	c.(2356-2358)aAa>aCa	p.K786T	DHX15_ENST00000508032.1_5'UTR	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	786				KLQSKEYSQY -> QTSIQGIFTVLNSVLRTEVIERTALKD E (in Ref. 1; BAA23987). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				GGATTGAAGTTTGGCAATGAT	0.393																																					p.K786T		.											.	DHX15	91	0			c.A2357C						.						154.0	138.0	144.0					4																	24529578		2203	4300	6503	SO:0001583	missense	1665	exon14			TGAAGTTTGGCAA	AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.2357A>C	4.37:g.24529578T>G	ENSP00000336741:p.Lys786Thr	141.0	0.0		173.0	65.0	NM_001358	Q9NQT7	Missense_Mutation	SNP	ENST00000336812.4	37	CCDS33966.1	.	.	.	.	.	.	.	.	.	.	T	15.70	2.910808	0.52439	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.03212	4.01	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.04318	0.0119	N	0.24115	0.695	0.80722	D	1	B;B;B	0.12630	0.003;0.003;0.006	B;B;B	0.19148	0.011;0.011;0.024	T	0.48703	-0.9012	10	0.49607	T	0.09	-11.7458	16.4696	0.84102	0.0:0.0:0.0:1.0	.	786;775;775	O43143;B4E0S6;F5H6K0	DHX15_HUMAN;.;.	T	786;775	ENSP00000336741:K786T	ENSP00000336741:K786T	K	-	2	0	DHX15	24138676	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.289000	0.77006	0.482000	0.46254	AAA	.		0.393	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
DLGAP4	22839	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35125206	35125206	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr20:35125206G>C	ENST00000373907.2	+	7	1946	c.1747G>C	c.(1747-1749)Gag>Cag	p.E583Q	DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000401952.2_Missense_Mutation_p.E583Q|DLGAP4_ENST00000339266.5_Missense_Mutation_p.E583Q|DLGAP4_ENST00000340491.4_Missense_Mutation_p.E44Q|DLGAP4_ENST00000373913.3_Missense_Mutation_p.E583Q			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	583					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GAGCAGTACTGAGTCTGCCCA	0.587																																					p.E583Q		.											.	DLGAP4	94	0			c.G1747C						.						118.0	106.0	110.0					20																	35125206		2203	4300	6503	SO:0001583	missense	22839	exon7			AGTACTGAGTCTG	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.1747G>C	20.37:g.35125206G>C	ENSP00000363014:p.Glu583Gln	177.0	1.0		178.0	61.0	NM_014902	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	37		.	.	.	.	.	.	.	.	.	.	G	19.13	3.768649	0.69878	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266;ENST00000340491	T;T;T;T;T	0.32753	1.44;1.44;1.89;1.89;1.44	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.62011	0.2393	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.64850	-0.6310	10	0.87932	D	0	.	19.335	0.94312	0.0:0.0:1.0:0.0	.	44;583	Q9Y2H0-3;Q9Y2H0-1	.;.	Q	583;583;583;583;44	ENSP00000363023:E583Q;ENSP00000384954:E583Q;ENSP00000363014:E583Q;ENSP00000341633:E583Q;ENSP00000345700:E44Q	ENSP00000341633:E583Q	E	+	1	0	DLGAP4	34558620	1.000000	0.71417	0.970000	0.41538	0.178000	0.23041	9.813000	0.99286	2.884000	0.98904	0.655000	0.94253	GAG	.		0.587	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902	
DLX5	1749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	96651649	96651649	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:96651649C>T	ENST00000222598.4	-	2	861	c.388G>A	c.(388-390)Gtg>Atg	p.V130M	DLX5_ENST00000486603.2_Missense_Mutation_p.V130M|DLX5_ENST00000493764.1_Intron	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	130					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.M129_V130>IL(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TTGCCATTCACCATTCTCACC	0.463																																					p.V130M		.											.	DLX5	515	1	Complex - compound substitution(1)	lung(1)	c.G388A						.						130.0	126.0	127.0					7																	96651649		2203	4300	6503	SO:0001583	missense	1749	exon2			CATTCACCATTCT		CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.388G>A	7.37:g.96651649C>T	ENSP00000222598:p.Val130Met	79.0	0.0		67.0	33.0	NM_005221	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	ENST00000222598.4	37	CCDS5647.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984691	0.93044	.	.	ENSG00000105880	ENST00000222598	D	0.89875	-2.58	5.28	5.28	0.74379	Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.93321	0.7871	M	0.66439	2.03	0.80722	D	1	D;P	0.64830	0.994;0.834	D;P	0.62955	0.909;0.701	D	0.93410	0.6768	10	0.62326	D	0.03	-11.1905	18.7072	0.91643	0.0:1.0:0.0:0.0	.	130;130	B7Z4P3;P56178	.;DLX5_HUMAN	M	130	ENSP00000222598:V130M	ENSP00000222598:V130M	V	-	1	0	DLX5	96489585	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.582000	0.82546	2.752000	0.94435	0.467000	0.42956	GTG	.		0.463	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2		
DMBX1	127343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46972704	46972704	+	Missense_Mutation	SNP	G	G	A	rs150745846		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:46972704G>A	ENST00000360032.3	+	1	36	c.22G>A	c.(22-24)Ggc>Agc	p.G8S	DMBX1_ENST00000371956.4_Missense_Mutation_p.G8S	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					CGGGGTGAACGGCTACTCACT	0.632																																					p.G8S		.											.	DMBX1	227	0			c.G22A						.	G	SER/GLY,SER/GLY	0,4406		0,0,2203	98.0	78.0	85.0		22,22	5.2	1.0	1	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DMBX1	NM_147192.2,NM_172225.1	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	8/383,8/378	46972704	1,13005	2203	4300	6503	SO:0001583	missense	127343	exon1			GTGAACGGCTACT	AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.22G>A	1.37:g.46972704G>A	ENSP00000353132:p.Gly8Ser	391.0	0.0		408.0	142.0	NM_147192		Missense_Mutation	SNP	ENST00000360032.3	37	CCDS536.1	.	.	.	.	.	.	.	.	.	.	G	35	5.546657	0.96488	0.0	1.16E-4	ENSG00000197587	ENST00000371956;ENST00000360032	D;D	0.95171	-3.39;-3.63	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.94781	0.8315	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.983;0.993	D	0.95940	0.8946	10	0.72032	D	0.01	.	17.8482	0.88737	0.0:0.0:1.0:0.0	.	8;8	Q8NFW5;Q8NFW5-2	DMBX1_HUMAN;.	S	8	ENSP00000361024:G8S;ENSP00000353132:G8S	ENSP00000353132:G8S	G	+	1	0	DMBX1	46745291	1.000000	0.71417	0.986000	0.45419	0.994000	0.84299	7.408000	0.80041	2.453000	0.82957	0.655000	0.94253	GGC	G|1.000;A|0.000		0.632	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1		
DNAH2	146754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7721651	7721651	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:7721651T>C	ENST00000572933.1	+	69	11869	c.10409T>C	c.(10408-10410)aTt>aCt	p.I3470T	DNAH2_ENST00000389173.2_Missense_Mutation_p.I3470T			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3470	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTGATGCGCATTGGCGATAAG	0.567																																					p.I3470T		.											.	DNAH2	102	0			c.T10409C						.						220.0	196.0	204.0					17																	7721651		2203	4300	6503	SO:0001583	missense	146754	exon68			TGCGCATTGGCGA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.10409T>C	17.37:g.7721651T>C	ENSP00000458355:p.Ile3470Thr	185.0	0.0		236.0	70.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	13.56	2.273274	0.40194	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.31510	1.49	5.0	3.92	0.45320	.	0.150858	0.44483	D	0.000459	T	0.45558	0.1348	M	0.82716	2.605	0.80722	D	1	P;P	0.37824	0.609;0.464	P;P	0.46585	0.521;0.471	T	0.47711	-0.9096	10	0.87932	D	0	.	9.8214	0.40885	0.0:0.0818:0.0:0.9182	.	3431;3470	Q9P225-2;Q9P225	.;DYH2_HUMAN	T	3431;3470	ENSP00000373825:I3470T	ENSP00000353818:I3431T	I	+	2	0	DNAH2	7662376	1.000000	0.71417	0.789000	0.31954	0.116000	0.19942	7.367000	0.79558	0.934000	0.37316	-0.256000	0.11100	ATT	.		0.567	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
EEPD1	80820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	36336620	36336620	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:36336620T>C	ENST00000242108.4	+	7	2052	c.1334T>C	c.(1333-1335)aTc>aCc	p.I445T	EEPD1_ENST00000534978.1_Missense_Mutation_p.I445T	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	445					DNA repair (GO:0006281)		DNA binding (GO:0003677)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						GATGTCATTATCTTAGGGGAT	0.468																																					p.I445T		.											.	EEPD1	68	0			c.T1334C						.						87.0	83.0	85.0					7																	36336620		2203	4300	6503	SO:0001583	missense	80820	exon7			TCATTATCTTAGG	AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.1334T>C	7.37:g.36336620T>C	ENSP00000242108:p.Ile445Thr	91.0	0.0		110.0	42.0	NM_030636	Q96K64|Q9C0F7	Missense_Mutation	SNP	ENST00000242108.4	37	CCDS34619.1	.	.	.	.	.	.	.	.	.	.	T	14.37	2.516577	0.44763	.	.	ENSG00000122547	ENST00000242108;ENST00000534978	D;D	0.95885	-3.84;-3.84	5.1	5.1	0.69264	Endonuclease/exonuclease/phosphatase (2);	0.293466	0.37348	N	0.002140	D	0.92873	0.7733	L	0.36672	1.1	0.24291	N	0.995165	B	0.21905	0.062	B	0.27715	0.082	D	0.87220	0.2253	10	0.87932	D	0	-3.6303	15.6062	0.76672	0.0:0.0:0.0:1.0	.	445	Q7L9B9	EEPD1_HUMAN	T	445	ENSP00000242108:I445T;ENSP00000442692:I445T	ENSP00000242108:I445T	I	+	2	0	EEPD1	36303145	0.994000	0.37717	0.341000	0.25589	0.748000	0.42578	7.788000	0.85771	2.231000	0.72958	0.459000	0.35465	ATC	.		0.468	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337602.1	NM_030636	
EID3	493861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104698075	104698075	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:104698075C>T	ENST00000527879.1	+	1	559	c.363C>T	c.(361-363)gaC>gaT	p.D121D	TXNRD1_ENST00000524698.1_Intron|TXNRD1_ENST00000378070.4_Intron|TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000529546.1_Intron|TXNRD1_ENST00000429002.2_Intron|TXNRD1_ENST00000503506.2_Intron|TXNRD1_ENST00000526691.1_Intron|TXNRD1_ENST00000526390.1_Intron|TXNRD1_ENST00000525566.1_Intron|TXNRD1_ENST00000354940.6_Intron|TXNRD1_ENST00000388854.3_Intron|TXNRD1_ENST00000397736.2_Intron|TXNRD1_ENST00000542918.1_Intron	NM_001008394.2	NP_001008395.1			EP300 interacting inhibitor of differentiation 3											large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						CATTTTGTGACTTTCTGTTTC	0.413																																					p.D121D		.											.	.	.	0			c.C363T						.						212.0	210.0	211.0					12																	104698075		1973	4156	6129	SO:0001819	synonymous_variant	493861	exon1			TTGTGACTTTCTG	BC027612	CCDS53822.1	12q23.3	2006-11-24				ENSG00000255150			32961	protein-coding gene	gene with protein product		612986				15987788, 15752197	Standard	NM_001008394		Approved	FLJ25832, NSMCE4B, NSE4B	uc001tkw.3	Q8N140		ENST00000527879.1:c.363C>T	12.37:g.104698075C>T		218.0	0.0		251.0	80.0	NM_001008394		Silent	SNP	ENST00000527879.1	37	CCDS53822.1																																																																																			.		0.413	EID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387034.1	NM_001008394	
EIF4G1	1981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184040633	184040633	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:184040633A>G	ENST00000346169.2	+	13	2091	c.1820A>G	c.(1819-1821)gAg>gGg	p.E607G	EIF4G1_ENST00000350481.5_Missense_Mutation_p.E443G|EIF4G1_ENST00000424196.1_Missense_Mutation_p.E614G|EIF4G1_ENST00000434061.2_Missense_Mutation_p.E411G|EIF4G1_ENST00000342981.4_Missense_Mutation_p.E607G|EIF4G1_ENST00000382330.3_Missense_Mutation_p.E614G|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000411531.1_Missense_Mutation_p.E567G|EIF4G1_ENST00000427845.1_Missense_Mutation_p.E520G|EIF4G1_ENST00000414031.1_Missense_Mutation_p.E567G|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000441154.1_Missense_Mutation_p.E443G|EIF4G1_ENST00000392537.2_Missense_Mutation_p.E520G|EIF4G1_ENST00000435046.2_Missense_Mutation_p.E411G|EIF4G1_ENST00000352767.3_Missense_Mutation_p.E614G|EIF4G1_ENST00000319274.6_Missense_Mutation_p.E607G	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	607	EIF4E-binding.|MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTAAACCTAGAGGAGAAAAAA	0.463																																					p.E614G		.											.	EIF4G1	344	0			c.A1841G						.						158.0	151.0	154.0					3																	184040633		2203	4300	6503	SO:0001583	missense	1981	exon14			ACCTAGAGGAGAA	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1820A>G	3.37:g.184040633A>G	ENSP00000316879:p.Glu607Gly	95.0	0.0		119.0	33.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184374	0.78677	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.58004	0.2092	L	0.57536	1.79	0.80722	D	1	D;D;D;D	0.60160	0.987;0.972;0.987;0.972	P;P;P;P	0.55455	0.776;0.715;0.776;0.519	T	0.55218	-0.8175	10	0.31617	T	0.26	-19.4364	15.5933	0.76558	1.0:0.0:0.0:0.0	.	614;607;607;614	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	G	607;567;520;607;614;614;548;443;614;520;607;607;614;567;443;443;411;411	ENSP00000316879:E607G;ENSP00000391935:E567G;ENSP00000376320:E520G;ENSP00000391412:E607G;ENSP00000413159:E614G;ENSP00000371767:E614G;ENSP00000403269:E548G;ENSP00000317600:E443G;ENSP00000338020:E614G;ENSP00000407682:E520G;ENSP00000343450:E607G;ENSP00000323737:E607G;ENSP00000416255:E614G;ENSP00000395974:E567G;ENSP00000398145:E443G;ENSP00000399858:E443G;ENSP00000411826:E411G;ENSP00000404754:E411G	ENSP00000323737:E607G	E	+	2	0	EIF4G1	185523327	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.761000	0.91691	2.270000	0.75569	0.460000	0.39030	GAG	.		0.463	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
ELL2	22936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	95236720	95236720	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:95236720T>C	ENST00000237853.4	-	6	1155	c.806A>G	c.(805-807)cAa>cGa	p.Q269R	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	269					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		CCAGTCTCTTTGAAGCTCTTT	0.348																																					p.Q269R		.											.	ELL2	90	0			c.A806G						.						78.0	83.0	82.0					5																	95236720		2202	4299	6501	SO:0001583	missense	22936	exon6			TCTCTTTGAAGCT	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.806A>G	5.37:g.95236720T>C	ENSP00000237853:p.Gln269Arg	190.0	0.0		158.0	47.0	NM_012081	B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	37	CCDS4080.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.765006	0.69878	.	.	ENSG00000118985	ENST00000237853;ENST00000513343	T;T	0.35048	1.33;1.33	5.52	5.52	0.82312	.	0.050304	0.85682	D	0.000000	T	0.59046	0.2165	M	0.81682	2.555	0.80722	D	1	D	0.61697	0.99	P	0.59487	0.858	T	0.65681	-0.6109	10	0.87932	D	0	-10.1971	15.2931	0.73882	0.0:0.0:0.0:1.0	.	269	O00472	ELL2_HUMAN	R	269;87	ENSP00000237853:Q269R;ENSP00000423915:Q87R	ENSP00000237853:Q269R	Q	-	2	0	ELL2	95262476	1.000000	0.71417	0.973000	0.42090	0.832000	0.47134	7.698000	0.84413	2.086000	0.62901	0.459000	0.35465	CAA	.		0.348	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
ELL2	22936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	95236730	95236730	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:95236730T>A	ENST00000237853.4	-	6	1145	c.796A>T	c.(796-798)Aaa>Taa	p.K266*	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	266					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGAAGCTCTTTAAAAACATAA	0.348																																					p.K266X		.											.	ELL2	90	0			c.A796T						.						74.0	79.0	77.0					5																	95236730		2202	4299	6501	SO:0001587	stop_gained	22936	exon6			GCTCTTTAAAAAC	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.796A>T	5.37:g.95236730T>A	ENSP00000237853:p.Lys266*	192.0	0.0		149.0	45.0	NM_012081	B4DNK7	Nonsense_Mutation	SNP	ENST00000237853.4	37	CCDS4080.1	.	.	.	.	.	.	.	.	.	.	T	36	5.930280	0.97116	.	.	ENSG00000118985	ENST00000237853;ENST00000513343	.	.	.	5.52	5.52	0.82312	.	0.047215	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.4723	15.2931	0.73882	0.0:0.0:0.0:1.0	.	.	.	.	X	266;84	.	ENSP00000237853:K266X	K	-	1	0	ELL2	95262486	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.203000	0.42752	2.086000	0.62901	0.459000	0.35465	AAA	.		0.348	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
ELP3	55140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	28013470	28013470	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:28013470T>C	ENST00000256398.8	+	11	1489	c.1112T>C	c.(1111-1113)aTg>aCg	p.M371T	ELP3_ENST00000542181.1_Missense_Mutation_p.M242T|ELP3_ENST00000380353.4_Missense_Mutation_p.M279T|ELP3_ENST00000537665.1_Missense_Mutation_p.M252T|ELP3_ENST00000521015.1_Missense_Mutation_p.M357T|ELP3_ENST00000524103.1_Missense_Mutation_p.M299T	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	371					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		GATATTCCAATGCCTTTAGTT	0.403																																					p.M371T		.											.	ELP3	90	0			c.T1112C						.						74.0	68.0	70.0					8																	28013470		2203	4300	6503	SO:0001583	missense	55140	exon11			TTCCAATGCCTTT		CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.1112T>C	8.37:g.28013470T>C	ENSP00000256398:p.Met371Thr	192.0	0.0		197.0	11.0	NM_018091	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Missense_Mutation	SNP	ENST00000256398.8	37	CCDS6065.1	.	.	.	.	.	.	.	.	.	.	T	16.72	3.202748	0.58234	.	.	ENSG00000134014	ENST00000521015;ENST00000256398;ENST00000542181;ENST00000524103;ENST00000537665;ENST00000380353	.	.	.	5.91	5.91	0.95273	Acyl-CoA N-acyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.74635	0.3742	M	0.88906	2.99	0.80722	D	1	B;B	0.32893	0.029;0.389	B;B	0.40602	0.01;0.334	T	0.72481	-0.4280	9	0.17832	T	0.49	-29.4111	14.3004	0.66346	0.0:0.0:0.0:1.0	.	252;371	B4DE19;Q9H9T3	.;ELP3_HUMAN	T	357;371;242;299;252;279	.	ENSP00000256398:M371T	M	+	2	0	ELP3	28069389	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.705000	0.84606	2.254000	0.74563	0.533000	0.62120	ATG	.		0.403	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219963.2	NM_018091	
ENOSF1	55556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	683313	683313	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr18:683313A>C	ENST00000251101.7	-	11	897	c.809T>G	c.(808-810)tTc>tGc	p.F270C	ENOSF1_ENST00000383578.3_Missense_Mutation_p.F188C|ENOSF1_ENST00000583973.1_5'UTR|ENOSF1_ENST00000340116.7_Missense_Mutation_p.F291C|ENOSF1_ENST00000580982.1_Missense_Mutation_p.F194C|ENOSF1_ENST00000319815.6_Missense_Mutation_p.F40C	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1	270					cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						CAATGGCTTGAACTTGGCCAG	0.562																																					p.F291C		.											.	ENOSF1	91	0			c.T872G						.						125.0	107.0	113.0					18																	683313		2203	4300	6503	SO:0001583	missense	55556	exon11			GGCTTGAACTTGG	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.809T>G	18.37:g.683313A>C	ENSP00000251101:p.Phe270Cys	238.0	0.0		266.0	90.0	NM_202758	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Missense_Mutation	SNP	ENST00000251101.7	37	CCDS11822.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.217209	0.79352	.	.	ENSG00000132199	ENST00000383578;ENST00000319815;ENST00000251101;ENST00000340116	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.54	5.54	0.83059	Mandelate racemase/muconate lactonizing enzyme, conserved site (1);Mandelate racemase/muconate lactonizing enzyme, C-terminal (2);	0.095383	0.64402	D	0.000001	T	0.55497	0.1924	M	0.74258	2.255	0.80722	D	1	P;P;D;P;P	0.57571	0.948;0.837;0.98;0.948;0.647	P;B;P;P;B	0.49999	0.628;0.409;0.628;0.628;0.372	T	0.61028	-0.7145	10	0.56958	D	0.05	.	9.9774	0.41793	0.8486:0.0:0.0:0.1514	.	291;89;315;270;188	A6NMP3;B3KXE4;Q6ZS08;Q7L5Y1;Q7L5Y1-2	.;.;.;ENOF1_HUMAN;.	C	188;40;270;291	ENSP00000373072:F188C;ENSP00000313346:F40C;ENSP00000251101:F270C;ENSP00000345974:F291C	ENSP00000251101:F270C	F	-	2	0	ENOSF1	673313	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.834000	0.75339	2.096000	0.63516	0.477000	0.44152	TTC	A|1.000;T|0.000		0.562	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254312.2	NM_017512	
DMTN	2039	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	21924617	21924617	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:21924617A>G	ENST00000523266.1	+	3	502	c.40A>G	c.(40-42)Agc>Ggc	p.S14G	DMTN_ENST00000523782.2_Intron|DMTN_ENST00000358242.3_Missense_Mutation_p.S14G|DMTN_ENST00000432128.1_Missense_Mutation_p.S14G|DMTN_ENST00000265800.5_Missense_Mutation_p.S14G|DMTN_ENST00000381470.3_Missense_Mutation_p.S14G|DMTN_ENST00000517600.1_Intron|DMTN_ENST00000443491.2_Intron|DMTN_ENST00000415253.1_Missense_Mutation_p.S14G|DMTN_ENST00000519907.1_Missense_Mutation_p.S14G	NM_001978.2	NP_001969.2	Q08495	DEMA_HUMAN	dematin actin binding protein	14					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|actin filament capping (GO:0051693)|actin filament reorganization (GO:0090527)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cytoskeleton organization (GO:0007010)|erythrocyte development (GO:0048821)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of platelet aggregation (GO:1901731)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of wound healing (GO:0090303)|protein complex assembly (GO:0006461)|protein secretion by platelet (GO:0070560)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)|regulation of lamellipodium assembly (GO:0010591)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection membrane (GO:0031253)|cortical cytoskeleton (GO:0030863)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|protein self-association (GO:0043621)|receptor binding (GO:0005102)|spectrin binding (GO:0030507)										CTCCCCCGGGAGCGTGAGCCC	0.721																																					p.S14G		.											.	EPB49	90	0			c.A40G						.						28.0	29.0	28.0					8																	21924617		2200	4298	6498	SO:0001583	missense	2039	exon3			CCCGGGAGCGTGA	U28389	CCDS6020.1, CCDS47820.1, CCDS47821.1	8p21.1	2013-05-03	2013-05-03	2013-05-03	ENSG00000158856	ENSG00000158856			3382	protein-coding gene	gene with protein product		125305	"""erythrocyte membrane protein band 4.9 (dematin)"""	EPB49		8341682, 12011427	Standard	NM_001978		Approved	DMT		Q08495	OTTHUMG00000097087	ENST00000523266.1:c.40A>G	8.37:g.21924617A>G	ENSP00000427866:p.Ser14Gly	227.0	0.0		200.0	62.0	NM_001978	A8K0T5|B3KP70|B3KRH3|E9PEJ0|Q13215|Q9BRE3	Missense_Mutation	SNP	ENST00000523266.1	37	CCDS6020.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702006	0.88924	.	.	ENSG00000158856	ENST00000519850;ENST00000381470;ENST00000432128;ENST00000517804;ENST00000265800;ENST00000517418;ENST00000358242;ENST00000415253;ENST00000523266;ENST00000519907	T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	4.86	4.86	0.63082	.	.	.	.	.	T	0.63721	0.2535	M	0.68952	2.095	0.39049	D	0.960293	P;P	0.52842	0.956;0.954	P;D	0.63597	0.899;0.916	T	0.69847	-0.5034	9	0.87932	D	0	.	12.3993	0.55404	1.0:0.0:0.0:0.0	.	14;14	Q08495;Q08495-2	DEMA_HUMAN;.	G	14	ENSP00000430600:S14G;ENSP00000370879:S14G;ENSP00000416111:S14G;ENSP00000428415:S14G;ENSP00000265800:S14G;ENSP00000429948:S14G;ENSP00000350977:S14G;ENSP00000401291:S14G;ENSP00000427866:S14G;ENSP00000429377:S14G	ENSP00000265800:S14G	S	+	1	0	EPB49	21980563	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.653000	0.74382	1.824000	0.53156	0.379000	0.24179	AGC	.		0.721	DMTN-009	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375178.1	NM_001978	
EPRS	2058	hgsc.bcm.edu;bcgsc.ca	37	1	220146578	220146578	+	Splice_Site	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:220146578A>G	ENST00000366923.3	-	29	4514		c.e29+1			NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase						cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TTAAGAAACTACCTTGTGAAA	0.418																																					.		.											.	EPRS	92	0			c.4244+2T>C						.						156.0	150.0	152.0					1																	220146578		2203	4300	6503	SO:0001630	splice_region_variant	2058	exon30			GAAACTACCTTGT	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.4244+1T>C	1.37:g.220146578A>G		150.0	0.0		135.0	21.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Splice_Site	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.306983	0.81247	.	.	ENSG00000136628	ENST00000366923	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPRS	218213201	1.000000	0.71417	0.453000	0.27007	0.830000	0.47004	8.593000	0.90832	2.254000	0.74563	0.533000	0.62120	.	.		0.418	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	Intron
ERCC2	2068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45860557	45860557	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:45860557T>C	ENST00000391945.4	-	15	1527	c.1450A>G	c.(1450-1452)Acg>Gcg	p.T484A	ERCC2_ENST00000391944.3_Missense_Mutation_p.T406A	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	484	Mediates interaction with MMS19.				7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CGTGCCAGCGTCATGGTGAAG	0.652			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.T484A		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2	848	0			c.A1450G						.						91.0	76.0	82.0					19																	45860557		2203	4300	6503	SO:0001583	missense	2068	exon15	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CCAGCGTCATGGT		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1450A>G	19.37:g.45860557T>C	ENSP00000375809:p.Thr484Ala	179.0	0.0		169.0	66.0	NM_000400	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.606965	0.87157	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	T;D	0.82344	-1.37;-1.6	5.27	5.27	0.74061	.	0.108809	0.64402	D	0.000008	D	0.88897	0.6562	M	0.93939	3.475	0.80722	D	1	B;P;P	0.42518	0.429;0.594;0.782	P;B;P	0.45681	0.49;0.354;0.472	D	0.90966	0.4816	10	0.87932	D	0	-20.816	11.5741	0.50852	0.0:0.0:0.0:1.0	.	406;484;177	E7EVE9;P18074;Q6ZNQ5	.;ERCC2_HUMAN;.	A	434;460;484;406	ENSP00000375809:T484A;ENSP00000375808:T406A	ENSP00000375805:T434A	T	-	1	0	ERCC2	50552397	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	6.731000	0.74785	1.991000	0.58162	0.533000	0.62120	ACG	.		0.652	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
FAM133A	286499	broad.mit.edu;bcgsc.ca	37	X	92964586	92964586	+	Silent	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chrX:92964586A>G	ENST00000355813.5	+	4	694	c.168A>G	c.(166-168)aaA>aaG	p.K56K	FAM133A_ENST00000332647.4_Silent_p.K56K|FAM133A_ENST00000322139.4_Silent_p.K56K|FAM133A_ENST00000538690.1_Silent_p.K56K	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	56	Lys-rich.									breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						CAGGTTCAAAAGCATTAGCTG	0.328																																					p.K56K		.											.	FAM133A	130	0			c.A168G						.						28.0	29.0	29.0					X																	92964586		2183	4272	6455	SO:0001819	synonymous_variant	286499	exon4			TTCAAAAGCATTA	AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.168A>G	X.37:g.92964586A>G		61.0	0.0		55.0	4.0	NM_173698		Silent	SNP	ENST00000355813.5	37	CCDS14466.1																																																																																			.		0.328	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057452.1	NM_173698	
FAM83C	128876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33875240	33875240	+	Missense_Mutation	SNP	G	G	A	rs375816362		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr20:33875240G>A	ENST00000374408.3	-	4	1438	c.1342C>T	c.(1342-1344)Cgc>Tgc	p.R448C	FAM83C-AS1_ENST00000429167.1_RNA|EIF6_ENST00000462894.1_5'Flank|EIF6_ENST00000374450.3_5'Flank|EIF6_ENST00000374443.3_5'Flank|EIF6_ENST00000374436.3_5'Flank	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	448										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GGCCGGGAGCGAGGAAGCAGA	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17573	0.0		0.0	False		,,,				2504	0.001				p.R448C		.											.	FAM83C	92	0			c.C1342T						.						41.0	36.0	38.0					20																	33875240		2203	4300	6503	SO:0001583	missense	128876	exon4			GGGAGCGAGGAAG	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.1342C>T	20.37:g.33875240G>A	ENSP00000363529:p.Arg448Cys	101.0	0.0		86.0	35.0	NM_178468	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	G	9.722	1.159888	0.21454	.	.	ENSG00000125998	ENST00000374408	T	0.07114	3.22	4.81	0.47	0.16747	.	0.888176	0.09695	N	0.767816	T	0.08088	0.0202	L	0.48877	1.53	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.34551	-0.9824	10	0.72032	D	0.01	-17.195	5.4886	0.16763	0.1031:0.0:0.371:0.5259	.	448	Q9BQN1	FA83C_HUMAN	C	448	ENSP00000363529:R448C	ENSP00000363529:R448C	R	-	1	0	FAM83C	33338654	0.000000	0.05858	0.002000	0.10522	0.945000	0.59286	0.150000	0.16263	0.362000	0.24319	0.561000	0.74099	CGC	.		0.652	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078854.3		
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80037282	80037282	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:80037282G>A	ENST00000306749.2	-	42	7567	c.7349C>T	c.(7348-7350)aCg>aTg	p.T2450M	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2450	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGCGCCACCCGTCTTGGCGCG	0.652																																					p.T2450M	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.C7349T						.						82.0	70.0	74.0					17																	80037282		2203	4300	6503	SO:0001583	missense	2194	exon42			CCACCCGTCTTGG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.7349C>T	17.37:g.80037282G>A	ENSP00000304592:p.Thr2450Met	150.0	0.0		185.0	51.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	9.168	1.020442	0.19433	.	.	ENSG00000169710	ENST00000306749	T	0.26810	1.71	4.16	-0.264	0.12950	Thioesterase (1);	0.061993	0.64402	N	0.000005	T	0.20414	0.0491	M	0.73962	2.25	0.43439	D	0.995616	P	0.43024	0.798	B	0.34301	0.179	T	0.03325	-1.1048	10	0.48119	T	0.1	-6.2659	5.3654	0.16111	0.2357:0.0:0.6233:0.141	.	2450	P49327	FAS_HUMAN	M	2450	ENSP00000304592:T2450M	ENSP00000304592:T2450M	T	-	2	0	FASN	77630571	0.999000	0.42202	0.117000	0.21633	0.023000	0.10783	2.872000	0.48467	-0.084000	0.12595	0.561000	0.74099	ACG	.		0.652	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	80039907	80039907	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:80039907T>G	ENST00000306749.2	-	36	6359	c.6141A>C	c.(6139-6141)aaA>aaC	p.K2047N	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2047	Beta-ketoacyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CGTGCCGGCGTTTCTCACAGA	0.647																																					p.K2047N	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.A6141C						.						68.0	69.0	68.0					17																	80039907		2203	4300	6503	SO:0001583	missense	2194	exon36			CCGGCGTTTCTCA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6141A>C	17.37:g.80039907T>G	ENSP00000304592:p.Lys2047Asn	39.0	0.0		76.0	16.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.548985	0.45383	.	.	ENSG00000169710	ENST00000306749	T	0.42513	0.97	4.77	2.73	0.32206	Polyketide synthase/Fatty acid synthase, KR (1);NAD(P)-binding domain (1);	0.349618	0.27433	N	0.019390	T	0.31420	0.0796	N	0.25957	0.775	0.32180	N	0.580527	B	0.20780	0.048	B	0.33254	0.16	T	0.33599	-0.9862	10	0.45353	T	0.12	-14.9167	8.1701	0.31249	0.0:0.7427:0.0:0.2573	.	2047	P49327	FAS_HUMAN	N	2047	ENSP00000304592:K2047N	ENSP00000304592:K2047N	K	-	3	2	FASN	77633196	1.000000	0.71417	0.985000	0.45067	0.570000	0.35934	2.389000	0.44407	0.407000	0.25591	0.260000	0.18958	AAA	.		0.647	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FBN3	84467	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8211044	8211044	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:8211044C>T	ENST00000600128.1	-	4	730	c.316G>A	c.(316-318)Ggg>Agg	p.G106R	FBN3_ENST00000601739.1_Missense_Mutation_p.G106R|FBN3_ENST00000270509.2_Missense_Mutation_p.G106R			Q75N90	FBN3_HUMAN	fibrillin 3	106						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GCCAGCGTCCCATCCGCACAG	0.657																																					p.G106R		.											.	FBN3	100	0			c.G316A						.						28.0	27.0	28.0					19																	8211044		2200	4294	6494	SO:0001583	missense	84467	exon3			GCGTCCCATCCGC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.316G>A	19.37:g.8211044C>T	ENSP00000470498:p.Gly106Arg	274.0	0.0		269.0	15.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270977	0.80469	.	.	ENSG00000142449	ENST00000270509	D	0.91577	-2.87	3.88	3.88	0.44766	.	0.149229	0.43919	U	0.000507	D	0.96140	0.8742	H	0.94462	3.54	0.48135	D	0.999592	D	0.89917	1.0	D	0.91635	0.999	D	0.96562	0.9416	10	0.87932	D	0	.	11.3274	0.49456	0.0:1.0:0.0:0.0	.	106	Q75N90	FBN3_HUMAN	R	106	ENSP00000270509:G106R	ENSP00000270509:G106R	G	-	1	0	FBN3	8117044	0.978000	0.34361	0.129000	0.21949	0.910000	0.53928	2.876000	0.48498	1.725000	0.51514	0.313000	0.20887	GGG	.		0.657	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
FCF1	51077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	75190045	75190045	+	Silent	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:75190045A>C	ENST00000341162.4	+	5	417	c.363A>C	c.(361-363)ctA>ctC	p.L121L	FCF1_ENST00000534938.2_Silent_p.L109L|FCF1_ENST00000553615.1_Silent_p.L106L	NM_015962.4	NP_057046.1	Q9Y324	FCF1_HUMAN	FCF1 rRNA-processing protein	121	PINc.				rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.0037)		GAGTGGCTCTAAGGTAGGAAG	0.378																																					p.L121L		.											.	FCF1	91	0			c.A363C						.						105.0	100.0	102.0					14																	75190045		2203	4300	6503	SO:0001819	synonymous_variant	51077	exon5			GGCTCTAAGGTAG	AF132969	CCDS9832.1	14q24.2	2013-05-03	2013-05-03	2007-01-30	ENSG00000119616	ENSG00000119616			20220	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 111"", ""FCF1 small subunit (SSU) processome component homolog (S. cerevisiae)"""	C14orf111		16762320	Standard	XR_245690		Approved	CGI-35, Bka, UTP24	uc001xqh.3	Q9Y324		ENST00000341162.4:c.363A>C	14.37:g.75190045A>C		198.0	0.0		137.0	48.0	NM_015962	Q86TW8|Q8TBL8	Silent	SNP	ENST00000341162.4	37	CCDS9832.1																																																																																			.		0.378	FCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413622.1	NM_015962	
FCHO2	115548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	72377662	72377662	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:72377662A>C	ENST00000430046.2	+	23	2149	c.2033A>C	c.(2032-2034)aAa>aCa	p.K678T	FCHO2_ENST00000341845.6_Missense_Mutation_p.K678T|FCHO2_ENST00000512348.1_Missense_Mutation_p.K645T	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	678	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with DAB2, EPS15, EPS15R and ITSN1.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		ACATACTGGAAATGTAGTGCT	0.393																																					p.K678T		.											.	FCHO2	23	0			c.A2033C						.						116.0	108.0	110.0					5																	72377662		1868	4109	5977	SO:0001583	missense	115548	exon23			ACTGGAAATGTAG	AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.2033A>C	5.37:g.72377662A>C	ENSP00000393776:p.Lys678Thr	153.0	0.0		151.0	51.0	NM_138782	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	ENST00000430046.2	37	CCDS47230.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.269416	0.80469	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.55588	0.51;0.51;0.51	5.65	4.49	0.54785	Muniscin C-terminal mu homology domain (1);	0.000000	0.85682	D	0.000000	T	0.71921	0.3397	M	0.81942	2.565	0.53005	D	0.999964	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.99	T	0.75286	-0.3371	10	0.87932	D	0	-23.8727	11.517	0.50526	0.9306:0.0:0.0694:0.0	.	645;678	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	T	678;678;645	ENSP00000393776:K678T;ENSP00000344034:K678T;ENSP00000427296:K645T	ENSP00000344034:K678T	K	+	2	0	FCHO2	72413418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.761000	0.91691	1.149000	0.42402	0.533000	0.62120	AAA	.		0.393	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368795.3	XM_291142	
FLNB	2317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	58141694	58141694	+	Nonsense_Mutation	SNP	C	C	G	rs541513836		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:58141694C>G	ENST00000295956.4	+	41	6945	c.6780C>G	c.(6778-6780)taC>taG	p.Y2260*	FLNB_ENST00000429972.2_Nonsense_Mutation_p.Y2249*|FLNB_ENST00000419752.2_Nonsense_Mutation_p.Y2080*|FLNB_ENST00000493452.1_Nonsense_Mutation_p.Y2067*|FLNB_ENST00000357272.4_3'UTR|FLNB_ENST00000358537.3_Nonsense_Mutation_p.Y2236*|FLNB_ENST00000490882.1_Nonsense_Mutation_p.Y2291*|FLNB_ENST00000348383.5_Nonsense_Mutation_p.Y2219*	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2260	Interaction with INPPL1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TAGGTAACTACGAGGTGTCCA	0.542																																					p.Y2291X		.											.	FLNB	593	0			c.C6873G						.						80.0	71.0	74.0					3																	58141694		2203	4300	6503	SO:0001587	stop_gained	2317	exon42			TAACTACGAGGTG	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.6780C>G	3.37:g.58141694C>G	ENSP00000295956:p.Tyr2260*	75.0	0.0		69.0	20.0	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Nonsense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	49	15.163195	0.99824	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000493452;ENST00000419752	.	.	.	5.58	3.43	0.39272	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4487	0.38712	0.0:0.7523:0.0:0.2477	.	.	.	.	X	2260;2291;2236;2249;2219;2067;2080	.	ENSP00000295956:Y2260X	Y	+	3	2	FLNB	58116734	0.995000	0.38212	1.000000	0.80357	0.983000	0.72400	0.362000	0.20284	1.502000	0.48669	0.655000	0.94253	TAC	.		0.542	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	39263846	39263886	+	Frame_Shift_Del	DEL	CCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	CCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	-	rs145526450|rs369187680|rs140101984|rs377001164	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	CCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	CCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr13:39263846_39263886delCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	ENST00000280481.7	+	1	2581_2621	c.2365_2405delCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	c.(2365-2406)ccgggtcaagaactgggcgtggctactcgagtggcccagttcfs	p.PGQELGVATRVAQF789fs		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	789					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q801H(1)|p.G790S(1)|p.P789P(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTTCCAGTTCCAG	0.552																																					p.789_802del		.											.	FREM2	100	3	Substitution - Missense(2)|Substitution - coding silent(1)	skin(2)|endometrium(1)	c.2365_2405del						.																																			SO:0001589	frameshift_variant	341640	exon1			AGACCCCCGGGTC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2365_2405delCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	13.37:g.39263846_39263886delCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTT	ENSP00000280481:p.Pro789fs	95.0	0.0		77.0	14.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Frame_Shift_Del	DEL	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.552	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FSCB	84075	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	44974659	44974659	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:44974659G>A	ENST00000340446.4	-	1	1823	c.1532C>T	c.(1531-1533)cCa>cTa	p.P511L	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	511	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TTCAGCTAATGGAGATTGAAC	0.517																																					p.P511L		.											.	FSCB	587	0			c.C1532T						.						34.0	33.0	33.0					14																	44974659		2203	4299	6502	SO:0001583	missense	84075	exon1			GCTAATGGAGATT	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1532C>T	14.37:g.44974659G>A	ENSP00000344579:p.Pro511Leu	148.0	1.0		100.0	32.0	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357013	0.41801	.	.	ENSG00000189139	ENST00000340446	T	0.46819	0.86	5.55	0.59	0.17458	.	.	.	.	.	T	0.32436	0.0829	N	0.17594	0.5	0.09310	N	1	P	0.50272	0.933	P	0.45406	0.479	T	0.17992	-1.0351	9	0.29301	T	0.29	0.0967	9.3317	0.38025	0.3716:0.0:0.6284:0.0	.	511	Q5H9T9	FSCB_HUMAN	L	511	ENSP00000344579:P511L	ENSP00000344579:P511L	P	-	2	0	FSCB	44044409	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.364000	0.07583	-0.076000	0.12775	0.603000	0.83216	CCA	.		0.517	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
GABRR1	2569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	89899880	89899888	+	Splice_Site	DEL	TCACAGCTT	TCACAGCTT	-	rs374058908		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	TCACAGCTT	TCACAGCTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:89899880_89899888delTCACAGCTT	ENST00000454853.2	-	6	761_766	c.651_656delAAGCTGTGA	c.(649-657)gaaagctgt>gat	p.217_219ESC>D	GABRR1_ENST00000369451.3_Splice_Site_p.130_132ESC>D|GABRR1_ENST00000435811.1_Splice_Site_p.200_202ESC>D	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	217					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	ACAAGTCTACTCACAGCTTTCAATTTCAA	0.455																																					p.217_219del		.											.	GABRR1	91	0			c.651_655del						.																																			SO:0001630	splice_region_variant	2569	exon6			GTCTACTCACAGC		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.655+1AAGCTGTGA>-	6.37:g.89899880_89899888delTCACAGCTT		143.0	0.0		97.0	19.0	NM_002042	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Frame_Shift_Del	DEL	ENST00000454853.2	37	CCDS5019.2																																																																																			.		0.455	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2		In_Frame_Del
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171713607	171713607	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:171713607A>G	ENST00000358196.3	+	15	2043	c.1493A>G	c.(1492-1494)gAa>gGa	p.E498G		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	498					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						AAAAACAGAGAAGAATTTGAG	0.418																																					p.E498G		.											.	GAD1	91	0			c.A1493G						.						122.0	132.0	129.0					2																	171713607		2203	4300	6503	SO:0001583	missense	2571	exon15			ACAGAGAAGAATT		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1493A>G	2.37:g.171713607A>G	ENSP00000350928:p.Glu498Gly	67.0	0.0		87.0	25.0	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.533714	0.64972	.	.	ENSG00000128683	ENST00000358196	T	0.37584	1.19	5.75	5.75	0.90469	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.045953	0.85682	D	0.000000	T	0.39118	0.1066	L	0.46741	1.465	0.80722	D	1	B	0.29671	0.254	B	0.35073	0.195	T	0.29640	-1.0005	10	0.72032	D	0.01	-16.6059	16.0623	0.80847	1.0:0.0:0.0:0.0	.	498	Q99259	DCE1_HUMAN	G	498	ENSP00000350928:E498G	ENSP00000350928:E498G	E	+	2	0	GAD1	171421853	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.074000	0.76791	2.195000	0.70347	0.533000	0.62120	GAA	.		0.418	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
GALNT1	2589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	33267146	33267146	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr18:33267146G>C	ENST00000269195.5	+	5	959	c.856G>C	c.(856-858)Gtc>Ctc	p.V286L	GALNT1_ENST00000537549.1_Missense_Mutation_p.V226L	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	286	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						GACTCTTCCTGTCAGGTAATT	0.403																																					p.V286L		.											.	GALNT1	92	0			c.G856C						.						121.0	121.0	121.0					18																	33267146		2203	4300	6503	SO:0001583	missense	2589	exon5			CTTCCTGTCAGGT		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.856G>C	18.37:g.33267146G>C	ENSP00000269195:p.Val286Leu	135.0	0.0		88.0	21.0	NM_020474	Q86TJ7|Q9UM86	Missense_Mutation	SNP	ENST00000269195.5	37	CCDS11915.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.937040	0.52972	.	.	ENSG00000141429	ENST00000537748;ENST00000269195;ENST00000537549	T;T	0.61510	0.1;0.1	5.5	5.5	0.81552	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.43809	0.1264	N	0.16368	0.405	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.24048	-1.0171	10	0.30854	T	0.27	.	16.8858	0.86075	0.0:0.0:1.0:0.0	.	286	Q10472	GALT1_HUMAN	L	286;286;226	ENSP00000269195:V286L;ENSP00000440910:V226L	ENSP00000269195:V286L	V	+	1	0	GALNT1	31521144	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.595000	0.87683	0.585000	0.79938	GTC	.		0.403	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255771.2	NM_020474	
GBGT1	26301	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	136029633	136029633	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:136029633G>A	ENST00000372040.3	-	7	686	c.375C>T	c.(373-375)atC>atT	p.I125I	GBGT1_ENST00000372038.3_Missense_Mutation_p.P138S|GBGT1_ENST00000372043.3_Intron|GBGT1_ENST00000540636.1_Silent_p.I108I|RALGDS_ENST00000542690.1_Intron|GBGT1_ENST00000472281.1_5'UTR	NM_001282629.1	NP_001269558.1	Q8N5D6	GBGT1_HUMAN	globoside alpha-1,3-N-acetylgalactosaminyltransferase 1	125					glycolipid biosynthetic process (GO:0009247)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	globoside alpha-N-acetylgalactosaminyltransferase activity (GO:0047277)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(4)|lung(2)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		GGAAGGACTGGATGAAATGAG	0.607																																					p.I125I		.											.	GBGT1	90	0			c.C375T						.						41.0	43.0	43.0					9																	136029633		2203	4299	6502	SO:0001819	synonymous_variant	26301	exon7			GGACTGGATGAAA	AY358175	CCDS6960.1, CCDS65175.1, CCDS65176.1	9q34.13-q34.3	2014-07-18			ENSG00000148288	ENSG00000148288		"""Glycosyltransferase family 6 domain containing"""	20460	protein-coding gene	gene with protein product	"""Forssman glycolipid synthetase (FS)"", ""Forssman synthetase"""	606074				10506200, 8855242	Standard	NM_021996		Approved	UDP-GalNAc, A3GALNT, MGC44848, FS		Q8N5D6	OTTHUMG00000020853	ENST00000372040.3:c.375C>T	9.37:g.136029633G>A		26.0	0.0		23.0	11.0	NM_021996	A8K633|B2RA95|B7Z8S5|Q45F07|Q5T7U9|Q5T7V1|Q8N2K4|Q9UKI5	Silent	SNP	ENST00000372040.3	37	CCDS6960.1	.	.	.	.	.	.	.	.	.	.	G	6.527	0.465514	0.12402	.	.	ENSG00000148288	ENST00000372038	T	0.38722	1.12	5.38	2.35	0.29111	.	.	.	.	.	T	0.38799	0.1054	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	T	0.25984	-1.0116	6	0.46703	T	0.11	-2.6927	7.4262	0.27100	0.1532:0.3919:0.4548:0.0	.	.	.	.	S	138	ENSP00000361108:P138S	ENSP00000361108:P138S	P	-	1	0	GBGT1	135019454	0.000000	0.05858	0.719000	0.30619	0.296000	0.27459	-0.499000	0.06413	0.186000	0.20125	0.491000	0.48974	CCA	.		0.607	GBGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054815.1	NM_021996	
GJB5	2709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35223387	35223387	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:35223387C>A	ENST00000338513.1	+	2	629	c.456C>A	c.(454-456)ttC>ttA	p.F152L	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	152					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				TCCACTCATTCTACCCCAAAT	0.522																																					p.F152L		.											.	GJB5	91	0			c.C456A						.						112.0	98.0	103.0					1																	35223387		2203	4300	6503	SO:0001583	missense	2709	exon2			CTCATTCTACCCC	BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.456C>A	1.37:g.35223387C>A	ENSP00000340811:p.Phe152Leu	103.0	0.0		95.0	29.0	NM_005268	Q9UPA3	Missense_Mutation	SNP	ENST00000338513.1	37	CCDS382.1	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.380752	0.01204	.	.	ENSG00000189280	ENST00000338513	D	0.90324	-2.65	5.89	2.81	0.32909	Gap junction protein, cysteine-rich domain (1);	0.287190	0.37348	N	0.002123	T	0.72252	0.3437	N	0.02412	-0.56	0.33889	D	0.637041	B	0.02656	0.0	B	0.06405	0.002	T	0.67273	-0.5712	10	0.02654	T	1	.	11.3043	0.49325	0.0:0.5903:0.3438:0.0658	.	152	O95377	CXB5_HUMAN	L	152	ENSP00000340811:F152L	ENSP00000340811:F152L	F	+	3	2	GJB5	34995974	0.489000	0.26004	0.971000	0.41717	0.036000	0.12997	-0.176000	0.09811	0.801000	0.34066	-0.254000	0.11334	TTC	.		0.522	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011561.1	NM_005268	
GBP3	2635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89480301	89480301	+	Silent	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:89480301G>T	ENST00000370481.4	-	4	577	c.357C>A	c.(355-357)gcC>gcA	p.A119A	GBP3_ENST00000475853.2_5'Flank	NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	167	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		TCAGGAGGACGGCCAGGGTGA	0.512																																					p.A119A		.											.	GBP3	92	0			c.C357A						.						195.0	165.0	175.0					1																	89480301		2203	4300	6503	SO:0001819	synonymous_variant	2635	exon4			GAGGACGGCCAGG	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.357C>A	1.37:g.89480301G>T		229.0	0.0		297.0	138.0	NM_018284	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Silent	SNP	ENST00000370481.4	37	CCDS717.2																																																																																			.		0.512	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284	
GNB5	10681	broad.mit.edu;bcgsc.ca	37	15	52416767	52416767	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:52416767A>G	ENST00000261837.7	-	12	1144	c.1079T>C	c.(1078-1080)gTc>gCc	p.V360A	GNB5_ENST00000358784.7_Missense_Mutation_p.V318A|CTD-2184D3.6_ENST00000559825.1_lincRNA|CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000396335.4_Missense_Mutation_p.V248A|GNB5_ENST00000559348.1_5'UTR	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	360					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		CAGGATGGAGACCCGGGACCC	0.498																																					p.V360A		.											.	GNB5	227	0			c.T1079C						.						121.0	116.0	118.0					15																	52416767		2195	4293	6488	SO:0001583	missense	10681	exon12			ATGGAGACCCGGG	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.1079T>C	15.37:g.52416767A>G	ENSP00000261837:p.Val360Ala	168.0	0.0		188.0	10.0	NM_016194	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	37	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.385697	0.61956	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.61980	0.06	5.88	4.76	0.60689	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51753	0.1693	L	0.39326	1.205	0.80722	D	1	B;B	0.10296	0.003;0.0	B;B	0.15484	0.013;0.002	T	0.42464	-0.9450	10	0.27082	T	0.32	-37.1409	11.9658	0.53033	0.9325:0.0:0.0675:0.0	.	360;248	O14775;O14775-3	GBB5_HUMAN;.	A	360;318;158;248	ENSP00000261837:V360A	ENSP00000261837:V360A	V	-	2	0	GNB5	50204059	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	5.185000	0.65076	1.070000	0.40811	0.524000	0.50904	GTC	.		0.498	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
GPR25	2848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	200843249	200843249	+	Nonstop_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:200843249T>G	ENST00000304244.2	+	1	1167	c.1084T>G	c.(1084-1086)Tag>Gag	p.*362E		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						GGCCTCCTGGTAGCTGCCCCG	0.711																																					p.X362E		.											.	GPR25	91	0			c.T1084G						.						6.0	5.0	5.0					1																	200843249		2051	4008	6059	SO:0001578	stop_lost	2848	exon1			TCCTGGTAGCTGC	U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.1084T>G	1.37:g.200843249T>G	ENSP00000301917:p.*362Gluext*?	37.0	0.0		42.0	19.0	NM_005298	A0AVJ5	Missense_Mutation	SNP	ENST00000304244.2	37	CCDS1405.1	.	.	.	.	.	.	.	.	.	.	T	5.468	0.271420	0.10349	.	.	ENSG00000170128	ENST00000304244	.	.	.	2.79	0.44	0.16572	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.5235	0.16945	0.0:0.424:0.0:0.576	.	.	.	.	E	362	.	.	X	+	1	0	GPR25	199109872	0.000000	0.05858	0.001000	0.08648	0.059000	0.15707	-1.509000	0.02264	0.070000	0.16634	0.260000	0.18958	TAG	.		0.711	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087056.1	NM_005298	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	90079723	90079723	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:90079723T>C	ENST00000405460.2	+	67	13598	c.13502T>C	c.(13501-13503)cTa>cCa	p.L4501P	GPR98_ENST00000425867.2_Missense_Mutation_p.L162P	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4501					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGGCGCCACCTAGTGAGCAGA	0.443																																					p.L4501P		.											.	GPR98	103	0			c.T13502C						.						59.0	57.0	58.0					5																	90079723		1839	4082	5921	SO:0001583	missense	84059	exon67			GCCACCTAGTGAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13502T>C	5.37:g.90079723T>C	ENSP00000384582:p.Leu4501Pro	95.0	0.0		116.0	52.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901167	0.72754	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.26957	1.7;1.7	5.97	5.97	0.96955	.	0.283287	0.34531	N	0.003900	T	0.51584	0.1683	M	0.76838	2.35	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.996;0.999	D;P;D	0.68943	0.915;0.804;0.961	T	0.48768	-0.9006	10	0.33940	T	0.23	.	16.4454	0.83928	0.0:0.0:0.0:1.0	.	162;4501;162	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	P	4501;4501;162	ENSP00000384582:L4501P;ENSP00000392618:L162P	ENSP00000296619:L4501P	L	+	2	0	GPR98	90115479	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.908000	0.69916	2.275000	0.75901	0.533000	0.62120	CTA	.		0.443	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	90079728	90079728	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:90079728A>C	ENST00000405460.2	+	67	13603	c.13507A>C	c.(13507-13509)Agc>Cgc	p.S4503R	GPR98_ENST00000425867.2_Missense_Mutation_p.S164R	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4503					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCACCTAGTGAGCAGAATCAT	0.428																																					p.S4503R		.											.	GPR98	103	0			c.A13507C						.						60.0	58.0	59.0					5																	90079728		1838	4082	5920	SO:0001583	missense	84059	exon67			CTAGTGAGCAGAA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13507A>C	5.37:g.90079728A>C	ENSP00000384582:p.Ser4503Arg	103.0	0.0		119.0	21.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.714648	0.48622	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.27402	1.67;1.67	5.97	4.79	0.61399	.	0.177930	0.64402	D	0.000011	T	0.44973	0.1319	M	0.70595	2.14	0.30855	N	0.73417	P;P;P	0.50617	0.895;0.761;0.937	P;B;P	0.53809	0.548;0.276;0.735	T	0.55611	-0.8114	10	0.72032	D	0.01	.	10.3547	0.43956	0.7168:0.0:0.0:0.2832	.	164;4503;164	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	R	4503;4503;164	ENSP00000384582:S4503R;ENSP00000392618:S164R	ENSP00000296619:S4503R	S	+	1	0	GPR98	90115484	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.854000	0.48325	1.028000	0.39785	0.533000	0.62120	AGC	.		0.428	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GRIA1	2890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	153065884	153065884	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:153065884C>T	ENST00000285900.5	+	8	1472	c.1129C>T	c.(1129-1131)Cga>Tga	p.R377*	GRIA1_ENST00000448073.4_Nonsense_Mutation_p.R387*|GRIA1_ENST00000518783.1_Nonsense_Mutation_p.R387*|GRIA1_ENST00000340592.5_Nonsense_Mutation_p.R377*|GRIA1_ENST00000518142.1_Nonsense_Mutation_p.R297*|GRIA1_ENST00000521843.2_Nonsense_Mutation_p.R308*	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	377					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.R377*(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TGACGGCATCCGAAAGGTAAG	0.512																																					p.R387X		.											.	GRIA1	96	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1159T						.						98.0	89.0	92.0					5																	153065884		2203	4300	6503	SO:0001587	stop_gained	2890	exon8			GGCATCCGAAAGG		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1129C>T	5.37:g.153065884C>T	ENSP00000285900:p.Arg377*	102.0	0.0		101.0	14.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Nonsense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	C	37	6.492604	0.97612	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	.	.	.	5.23	2.32	0.28847	.	0.061429	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7135	0.62682	0.5498:0.4502:0.0:0.0	.	.	.	.	X	377;377;297;331;377;308;308;387;387	.	ENSP00000285900:R377X	R	+	1	2	GRIA1	153046077	0.541000	0.26417	0.999000	0.59377	0.727000	0.41649	0.800000	0.27042	0.159000	0.19401	-0.182000	0.12963	CGA	.		0.512	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
GRIN2A	2903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	10273990	10273990	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:10273990T>C	ENST00000396573.2	-	3	588	c.279A>G	c.(277-279)gcA>gcG	p.A93A	GRIN2A_ENST00000396575.2_Silent_p.A93A|GRIN2A_ENST00000562109.1_Silent_p.A93A|GRIN2A_ENST00000330684.3_Silent_p.A93A|GRIN2A_ENST00000404927.2_Silent_p.A93A	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	93					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGTGGATGCGTGCCCCGGACA	0.637																																					p.A93A		.											.	GRIN2A	349	0			c.A279G						.						98.0	93.0	94.0					16																	10273990		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon3			GATGCGTGCCCCG		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.279A>G	16.37:g.10273990T>C		170.0	0.0		178.0	35.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																			.		0.637	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
GTF3C3	9330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197643775	197643775	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:197643775A>G	ENST00000263956.3	-	10	1324	c.1235T>C	c.(1234-1236)cTa>cCa	p.L412P		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	412				LV -> HL (in Ref. 6; AAH15995). {ECO:0000305}.	5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CTGTTCTACTAGTGTTGTCAA	0.378																																					p.L412P		.											.	GTF3C3	97	0			c.T1235C						.						102.0	105.0	104.0					2																	197643775		2203	4300	6503	SO:0001583	missense	9330	exon10			TCTACTAGTGTTG	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.1235T>C	2.37:g.197643775A>G	ENSP00000263956:p.Leu412Pro	175.0	0.0		149.0	47.0	NM_012086	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.203397	0.79127	.	.	ENSG00000119041	ENST00000263956;ENST00000448087	T	0.58940	0.3	4.66	4.66	0.58398	Tetratricopeptide-like helical (1);	0.000000	0.64402	D	0.000002	T	0.70928	0.3280	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.74262	-0.3722	10	0.72032	D	0.01	-10.0781	14.531	0.67926	1.0:0.0:0.0:0.0	.	412	Q9Y5Q9	TF3C3_HUMAN	P	412;97	ENSP00000263956:L412P	ENSP00000263956:L412P	L	-	2	0	GTF3C3	197352020	1.000000	0.71417	0.983000	0.44433	0.996000	0.88848	8.709000	0.91379	2.076000	0.62316	0.528000	0.53228	CTA	.		0.378	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
GUSB	2990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	65425954	65425954	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:65425954A>T	ENST00000304895.4	-	12	2016	c.1886T>A	c.(1885-1887)aTt>aAt	p.I629N	GUSB_ENST00000421103.1_Missense_Mutation_p.I483N|GUSB_ENST00000345660.6_Missense_Mutation_p.I578N	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	629					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						TTCATTGGCAATCTTCCAGTA	0.488																																					p.I629N		.											.	GUSB	90	0			c.T1886A						.						259.0	234.0	243.0					7																	65425954		2203	4300	6503	SO:0001583	missense	2990	exon12			TTGGCAATCTTCC	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1886T>A	7.37:g.65425954A>T	ENSP00000302728:p.Ile629Asn	308.0	0.0		276.0	85.0	NM_000181	B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	ENST00000304895.4	37	CCDS5530.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.915919	0.73098	.	.	ENSG00000169919	ENST00000304895;ENST00000421103;ENST00000345660	D;D;D	0.95788	-3.81;-3.81;-3.81	5.87	5.87	0.94306	Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.328915	0.32640	N	0.005835	D	0.97309	0.9120	M	0.71871	2.18	0.45962	D	0.998785	D;D	0.76494	0.999;0.997	D;D	0.77004	0.989;0.971	D	0.97929	1.0319	10	0.87932	D	0	.	15.4554	0.75308	1.0:0.0:0.0:0.0	.	483;629	E9PCV0;P08236	.;BGLR_HUMAN	N	629;483;578	ENSP00000302728:I629N;ENSP00000391390:I483N;ENSP00000340734:I578N	ENSP00000302728:I629N	I	-	2	0	GUSB	65063389	1.000000	0.71417	0.267000	0.24556	0.685000	0.39939	9.326000	0.96389	2.253000	0.74438	0.533000	0.62120	ATT	.		0.488	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251637.3	NM_000181	
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63943568	63943568	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:63943568G>A	ENST00000443617.2	-	53	10517	c.10430C>T	c.(10429-10431)gCt>gTt	p.A3477V		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3477					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GCTTTCCTCAGCATCCCCTTC	0.408																																					p.A3477V		.											.	HERC1	666	0			c.C10430T						.						95.0	93.0	93.0					15																	63943568		1827	4083	5910	SO:0001583	missense	8925	exon53			TCCTCAGCATCCC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.10430C>T	15.37:g.63943568G>A	ENSP00000390158:p.Ala3477Val	90.0	0.0		75.0	32.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.298859	0.60195	.	.	ENSG00000103657	ENST00000443617	T	0.24538	1.85	5.43	5.43	0.79202	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.378828	0.24031	N	0.042191	T	0.17874	0.0429	N	0.08118	0	0.31525	N	0.661906	B	0.15141	0.012	B	0.14023	0.01	T	0.12091	-1.0561	10	0.72032	D	0.01	.	19.258	0.93955	0.0:0.0:1.0:0.0	.	3477	Q15751	HERC1_HUMAN	V	3477	ENSP00000390158:A3477V	ENSP00000390158:A3477V	A	-	2	0	HERC1	61730621	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.476000	0.66793	2.554000	0.86153	0.655000	0.94253	GCT	.		0.408	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	28482110	28482110	+	Splice_Site	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:28482110G>A	ENST00000261609.7	-	26	4110	c.4002C>T	c.(4000-4002)gcC>gcT	p.A1334A		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTTCTTACTGGCACATTCAA	0.463																																					p.A1334A		.											.	HERC2	234	0			c.C4002T						.						35.0	35.0	35.0					15																	28482110		2199	4287	6486	SO:0001630	splice_region_variant	8924	exon26			CTTACTGGCACAT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.4003+1C>T	15.37:g.28482110G>A		300.0	0.0		306.0	107.0	NM_004667		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			.		0.463	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	Silent
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63967194	63967194	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:63967194T>A	ENST00000443617.2	-	38	7280	c.7193A>T	c.(7192-7194)tAt>tTt	p.Y2398F	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2398					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GCCAGTGAGATATGTTAGGTC	0.488																																					p.Y2398F		.											.	HERC1	666	0			c.A7193T						.						134.0	127.0	129.0					15																	63967194		2048	4207	6255	SO:0001583	missense	8925	exon38			GTGAGATATGTTA	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.7193A>T	15.37:g.63967194T>A	ENSP00000390158:p.Tyr2398Phe	317.0	0.0		260.0	83.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.637144	0.47049	.	.	ENSG00000103657	ENST00000443617	T	0.24151	1.87	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000001	T	0.19485	0.0468	L	0.29908	0.895	0.38422	D	0.94621	B	0.02656	0.0	B	0.04013	0.001	T	0.05801	-1.0863	10	0.40728	T	0.16	.	11.3945	0.49834	0.1353:0.0:0.0:0.8646	.	2398	Q15751	HERC1_HUMAN	F	2398	ENSP00000390158:Y2398F	ENSP00000390158:Y2398F	Y	-	2	0	HERC1	61754247	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.367000	0.52350	2.092000	0.63282	0.528000	0.53228	TAT	.		0.488	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HNRNPA2B1	3181	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	26237265	26237265	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:26237265A>C	ENST00000354667.4	-	3	298	c.130T>G	c.(130-132)Tgg>Ggg	p.W44G	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.W32G	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	44	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						AGCTTTCCCCATTGTTCGTAG	0.363			T	ETV1	prostate																																p.W44G		.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	HNRNPA2B1	70	0			c.T130G						.						85.0	82.0	83.0					7																	26237265		2203	4300	6503	SO:0001583	missense	3181	exon3			TTCCCCATTGTTC	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.130T>G	7.37:g.26237265A>C	ENSP00000346694:p.Trp44Gly	201.0	1.0		158.0	40.0	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	ENST00000354667.4	37	CCDS43557.1	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833803	0.71258	.	.	ENSG00000122566	ENST00000354667;ENST00000356674;ENST00000409814	T;T	0.05855	3.38;3.38	6.07	6.07	0.98685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000005	T	0.17238	0.0414	L	0.35542	1.07	0.58432	D	0.999993	D;D	0.76494	0.993;0.999	P;D	0.72982	0.852;0.979	T	0.00512	-1.1696	10	0.87932	D	0	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	32;44	P22626-2;P22626	.;ROA2_HUMAN	G	44;32;32	ENSP00000346694:W44G;ENSP00000349101:W32G	ENSP00000346694:W44G	W	-	1	0	HNRNPA2B1	26203790	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	9.253000	0.95501	2.326000	0.78906	0.533000	0.62120	TGG	.		0.363	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
HSPA2	3306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	65008467	65008467	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:65008467C>T	ENST00000394709.1	+	2	976	c.900C>T	c.(898-900)atC>atT	p.I300I	HSPA2_ENST00000247207.6_Silent_p.I300I|RP11-973N13.4_ENST00000554918.1_RNA			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	300					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		ATACGTCCATCACGCGCGCCC	0.667																																					p.I300I	Pancreas(136;1211 1835 24894 31984 38227)	.											.	HSPA2	226	0			c.C900T						.						20.0	21.0	20.0					14																	65008467		2203	4300	6503	SO:0001819	synonymous_variant	3306	exon1			GTCCATCACGCGC	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.900C>T	14.37:g.65008467C>T		65.0	0.0		89.0	34.0	NM_021979	Q15508|Q53XM3|Q9UE78	Silent	SNP	ENST00000394709.1	37	CCDS9766.1																																																																																			.		0.667	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
HSPB2	3316	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	111784419	111784419	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:111784419T>C	ENST00000304298.3	+	2	937	c.349T>C	c.(349-351)Ttc>Ctc	p.F117L	CRYAB_ENST00000526180.1_5'Flank|CRYAB_ENST00000531198.1_5'Flank|CRYAB_ENST00000533280.1_5'Flank|CRYAB_ENST00000527950.1_Intron|CRYAB_ENST00000227251.3_5'Flank|CRYAB_ENST00000533971.1_5'Flank|HSPB2_ENST00000537382.1_Missense_Mutation_p.F117L|CRYAB_ENST00000525823.1_5'Flank|HSPB2-C11orf52_ENST00000534100.1_Intron|CRYAB_ENST00000533475.1_5'UTR	NM_001541.3	NP_001532.1	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	117					positive regulation of catalytic activity (GO:0043085)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		GTCCCGAGAGTTCTGCCGCAC	0.632																																					p.F117L		.											.	HSPB2	659	0			c.T349C						.						76.0	69.0	72.0					11																	111784419		2201	4297	6498	SO:0001583	missense	3316	exon2			CGAGAGTTCTGCC	U75898	CCDS8352.1	11q22-q23	2011-09-02	2002-08-29			ENSG00000170276		"""Heat shock proteins / HSPB"""	5247	protein-coding gene	gene with protein product		602179	"""heat shock 27kD protein 2"""			9344664, 9490724	Standard	NM_001541		Approved	Hs.78846, MKBP	uc001pmg.2	Q16082		ENST00000304298.3:c.349T>C	11.37:g.111784419T>C	ENSP00000302476:p.Phe117Leu	128.0	1.0		145.0	60.0	NM_001541	Q6I9U7	Missense_Mutation	SNP	ENST00000304298.3	37	CCDS8352.1	.	.	.	.	.	.	.	.	.	.	T	18.96	3.733880	0.69189	.	.	ENSG00000170276	ENST00000304298;ENST00000537382	D;D	0.96554	-4.05;-4.05	5.36	4.23	0.50019	Heat shock protein Hsp20 (2);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	D	0.97151	0.9069	M	0.86651	2.83	0.43364	D	0.995445	D	0.55605	0.972	P	0.53224	0.721	D	0.97321	0.9944	10	0.87932	D	0	-22.7516	10.8862	0.46968	0.0:0.0738:0.0:0.9262	.	117	Q16082	HSPB2_HUMAN	L	117	ENSP00000302476:F117L;ENSP00000445585:F117L	ENSP00000302476:F117L	F	+	1	0	HSPB2	111289629	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.697000	0.61782	2.171000	0.68590	0.528000	0.53228	TTC	.		0.632	HSPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391669.1		
IGFBP3	3486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	45956856	45956856	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:45956856C>T	ENST00000275521.6	-	2	719	c.586G>A	c.(586-588)Gat>Aat	p.D196N	IGFBP3_ENST00000381086.5_Missense_Mutation_p.D99N|IGFBP3_ENST00000465642.1_5'UTR|IGFBP3_ENST00000381083.4_Missense_Mutation_p.D202N	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	196	Ser/Thr-rich.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	TTCTGGGTATCTGTGCTCTGA	0.498											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D202N		.											.	IGFBP3	1009	0			c.G604A						.						177.0	160.0	165.0					7																	45956856		2203	4300	6503	SO:0001583	missense	3486	exon2			GGGTATCTGTGCT		CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.586G>A	7.37:g.45956856C>T	ENSP00000275521:p.Asp196Asn	191.0	0.0	935	169.0	60.0	NM_001013398	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	ENST00000275521.6	37	CCDS5505.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.269690|5.269690	0.95429|0.95429	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817|ENST00000417621	T;T;T;T|.	0.26518|.	2.39;1.73;2.39;1.83|.	5.29|5.29	5.29|5.29	0.74685|0.74685	Thyroglobulin type-1 (1);|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.78253|0.78253	0.4254|0.4254	M|M	0.84846|0.84846	2.72|2.72	0.48975|0.48975	D|D	0.999735|0.999735	P;D;P|.	0.67145|.	0.879;0.996;0.879|.	P;D;P|.	0.67900|.	0.496;0.954;0.566|.	T|T	0.80525|0.80525	-0.1344|-0.1344	10|5	0.37606|.	T|.	0.19|.	-53.1404|-53.1404	14.4394|14.4394	0.67306|0.67306	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	99;196;181|.	B3KWK7;P17936;B4DN53|.	.;IBP3_HUMAN;.|.	N|K	173;196;99;182;94;202;168;86|57	ENSP00000275521:D196N;ENSP00000370476:D99N;ENSP00000370473:D202N;ENSP00000389668:D86N|.	ENSP00000275521:D196N|.	D|R	-|-	1|2	0|0	IGFBP3|IGFBP3	45923381|45923381	0.994000|0.994000	0.37717|0.37717	0.978000|0.978000	0.43139|0.43139	0.995000|0.995000	0.86356|0.86356	2.960000|2.960000	0.49161|0.49161	2.463000|2.463000	0.83235|0.83235	0.655000|0.655000	0.94253|0.94253	GAT|AGA	.		0.498	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398	
IGSF5	150084	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	41160116	41160116	+	Splice_Site	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr21:41160116G>A	ENST00000380588.4	+	6	1059		c.e6+1			NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5						single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				AATTTCAAAAGTAAGTTTGAA	0.279																																					.		.											.	IGSF5	68	0			c.956+1G>A						.						69.0	65.0	66.0					21																	41160116		2192	4294	6486	SO:0001630	splice_region_variant	150084	exon6			TCAAAAGTAAGTT		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.956+1G>A	21.37:g.41160116G>A		186.0	0.0		197.0	10.0	NM_001080444		Splice_Site	SNP	ENST00000380588.4	37	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	G	8.937	0.964808	0.18583	.	.	ENSG00000183067	ENST00000380588	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.82	0.52232	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGSF5	40081986	1.000000	0.71417	1.000000	0.80357	0.100000	0.18952	3.694000	0.54742	2.502000	0.84385	0.555000	0.69702	.	.		0.279	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1		Intron
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	55259985	55259985	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:55259985G>T	ENST00000381298.2	-	6	959	c.647C>A	c.(646-648)cCt>cAt	p.P216H	IL6ST_ENST00000522633.2_Missense_Mutation_p.P216H|IL6ST_ENST00000502326.3_Missense_Mutation_p.P216H|IL6ST_ENST00000336909.5_Missense_Mutation_p.P216H|IL6ST_ENST00000577363.1_5'Flank|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000536319.1_Missense_Mutation_p.P216H|IL6ST_ENST00000381287.4_Missense_Mutation_p.P216H|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000381294.3_Missense_Mutation_p.P216H	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	216	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTATATACAGGATCAAAATT	0.299			O		hepatocellular ca																																p.P216H		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	290	0			c.C647A						.						93.0	91.0	92.0					5																	55259985		2203	4300	6503	SO:0001583	missense	3572	exon6			TATACAGGATCAA	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.647C>A	5.37:g.55259985G>T	ENSP00000370698:p.Pro216His	198.0	0.0		225.0	78.0	NM_175767	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140058	0.77775	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000522633;ENST00000542298	T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18	6.17	6.17	0.99709	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.152023	0.64402	D	0.000010	T	0.62913	0.2467	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63699	-0.6578	10	0.51188	T	0.08	.	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	216;216;216	Q5FC04;P40189-2;P40189	.;.;IL6RB_HUMAN	H	216	ENSP00000370698:P216H;ENSP00000338799:P216H;ENSP00000370694:P216H;ENSP00000370687:P216H;ENSP00000444456:P216H;ENSP00000435399:P216H	ENSP00000338799:P216H	P	-	2	0	IL6ST	55295742	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.233000	0.78125	2.941000	0.99782	0.655000	0.94253	CCT	.		0.299	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
INTS8	55656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	95892461	95892461	+	Nonstop_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:95892461A>C	ENST00000523731.1	+	27	3120	c.2987A>C	c.(2986-2988)tAa>tCa	p.*996S	CCNE2_ENST00000308108.4_3'UTR|INTS8_ENST00000447247.1_Nonstop_Mutation_p.*979S|CCNE2_ENST00000520509.1_3'UTR	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	0					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					CTTTACTTTTAAGCAGttaaa	0.303																																					p.X996S		.											.	INTS8	90	0			c.A2987C						.						39.0	40.0	40.0					8																	95892461		2203	4300	6503	SO:0001578	stop_lost	55656	exon27			ACTTTTAAGCAGT	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.2987A>C	8.37:g.95892461A>C	ENSP00000430338:p.*996Serext*6	88.0	0.0		107.0	36.0	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	37	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	a	19.04	3.750597	0.69533	.	.	ENSG00000164941	ENST00000523731;ENST00000447247	.	.	.	5.83	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7867	0.52047	0.9316:0.0:0.0684:0.0	.	.	.	.	S	996;979	.	.	X	+	2	2	INTS8	95961637	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.448000	0.60027	1.037000	0.40024	0.529000	0.55759	TAA	.		0.303	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
ITGA2	3673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	52347345	52347345	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:52347345T>C	ENST00000296585.5	+	7	878	c.735T>C	c.(733-735)taT>taC	p.Y245Y		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	245	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CATCCCAATATGGTGGGGACC	0.348																																					p.Y245Y		.											.	ITGA2	226	0			c.T735C						.						113.0	109.0	111.0					5																	52347345		2203	4300	6503	SO:0001819	synonymous_variant	3673	exon7			CCAATATGGTGGG		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.735T>C	5.37:g.52347345T>C		158.0	0.0		165.0	50.0	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																			.		0.348	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
ITIH1	3697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52823733	52823733	+	Silent	SNP	G	G	C	rs145442481		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:52823733G>C	ENST00000273283.2	+	19	2208	c.2184G>C	c.(2182-2184)acG>acC	p.T728T	ITIH1_ENST00000540715.1_Silent_p.T586T|ITIH1_ENST00000405128.3_Silent_p.T94T|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000537050.1_Silent_p.T440T	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	728	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ATGACGGCACGTACTTCGGGC	0.587																																					p.T728T		.											.	ITIH1	93	0			c.G2184C						.						107.0	101.0	103.0					3																	52823733		2203	4300	6503	SO:0001819	synonymous_variant	3697	exon19			CGGCACGTACTTC		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2184G>C	3.37:g.52823733G>C		112.0	0.0		110.0	40.0	NM_002215	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Silent	SNP	ENST00000273283.2	37	CCDS2864.1																																																																																			G|1.000;A|0.000		0.587	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
ITM2B	9445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	48832330	48832330	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr13:48832330T>C	ENST00000378565.5	+	4	725	c.522T>C	c.(520-522)gtT>gtC	p.V174V	ITM2B_ENST00000378549.5_Intron	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	174	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		CTTCCATTGTTATGCCACCCA	0.378																																					p.V174V		.											.	ITM2B	90	0			c.T522C						.						178.0	164.0	168.0					13																	48832330		2203	4300	6503	SO:0001819	synonymous_variant	9445	exon4			CATTGTTATGCCA	AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.522T>C	13.37:g.48832330T>C		206.0	0.0		231.0	12.0	NM_021999	Q5W0A3|Q96B24|Q9NYH1	Silent	SNP	ENST00000378565.5	37	CCDS9409.1																																																																																			.		0.378	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044870.3	NM_021999	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	4776907	4776907	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:4776907T>C	ENST00000443694.2	+	41	5368	c.5368T>C	c.(5368-5370)Tgt>Cgt	p.C1790R	ITPR1_ENST00000423119.2_Missense_Mutation_p.C1757R|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.C1790R|ITPR1_ENST00000302640.8_Missense_Mutation_p.C1790R|ITPR1_ENST00000357086.4_Missense_Mutation_p.C1757R|ITPR1_ENST00000456211.2_Missense_Mutation_p.C1742R			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1805					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CGAGGTTCAGTGTCACCTTGA	0.493																																					p.C1790R		.											.	ITPR1	710	0			c.T5368C						.						112.0	115.0	114.0					3																	4776907		2031	4182	6213	SO:0001583	missense	3708	exon43			GTTCAGTGTCACC	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.5368T>C	3.37:g.4776907T>C	ENSP00000401671:p.Cys1790Arg	135.0	0.0		101.0	39.0	NM_001168272	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661648	0.88154	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.94897	-3.55;-3.55;-3.55;-3.55;-3.55;-3.55	5.09	5.09	0.68999	.	0.093975	0.85682	D	0.000000	D	0.97028	0.9029	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.97110	0.901;1.0	D	0.96987	0.9719	10	0.45353	T	0.12	.	15.2238	0.73333	0.0:0.0:0.0:1.0	.	1805;1757	Q14643;G5E9P1	ITPR1_HUMAN;.	R	1805;1790;1790;1757;251;1757;1742;1790	ENSP00000306253:C1790R;ENSP00000346595:C1790R;ENSP00000405934:C1757R;ENSP00000349597:C1757R;ENSP00000397885:C1742R;ENSP00000401671:C1790R	ENSP00000306253:C1790R	C	+	1	0	ITPR1	4751907	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.587000	0.82613	2.056000	0.61249	0.477000	0.44152	TGT	.		0.493	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	15468853	15468853	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:15468853A>T	ENST00000341776.2	+	5	818	c.574A>T	c.(574-576)Aca>Tca	p.T192S	JARID2_ENST00000397311.3_Missense_Mutation_p.T20S|JARID2_ENST00000541660.1_Missense_Mutation_p.T154S	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	192					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGATGATGAGACAGAAGACGT	0.488																																					p.T192S		.											.	JARID2	228	0			c.A574T						.						152.0	126.0	135.0					6																	15468853		2203	4300	6503	SO:0001583	missense	3720	exon5			GATGAGACAGAAG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.574A>T	6.37:g.15468853A>T	ENSP00000341280:p.Thr192Ser	175.0	0.0		209.0	90.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.905084	0.33628	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.34859	1.34;1.34;1.34	4.94	4.94	0.65067	.	0.432685	0.22979	N	0.053340	T	0.11793	0.0287	L	0.36672	1.1	0.25820	N	0.984297	P;P;B	0.36837	0.571;0.555;0.255	B;B;B	0.35770	0.21;0.138;0.104	T	0.08513	-1.0718	10	0.19590	T	0.45	-5.9259	9.7093	0.40236	0.8452:0.0:0.0:0.1548	.	154;56;192	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	S	56;192;20;154	ENSP00000341280:T192S;ENSP00000380478:T20S;ENSP00000444623:T154S	ENSP00000341280:T192S	T	+	1	0	JARID2	15576832	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.856000	0.48341	1.858000	0.53909	0.529000	0.55759	ACA	.		0.488	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
KCNJ15	3772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	39671772	39671772	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr21:39671772A>G	ENST00000328656.4	+	4	892	c.589A>G	c.(589-591)Att>Gtt	p.I197V	KCNJ15_ENST00000398934.1_Missense_Mutation_p.I197V|KCNJ15_ENST00000398932.1_Missense_Mutation_p.I197V|KCNJ15_ENST00000398930.1_Missense_Mutation_p.I197V|KCNJ15_ENST00000398938.2_Missense_Mutation_p.I197V	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	197					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GTGCTTGGTGATTCAGGTAGC	0.547																																					p.S197G		.											.	KCNJ15	157	0			c.A589G						.						60.0	60.0	60.0					21																	39671772		2203	4300	6503	SO:0001583	missense	3772	exon3			TTGGTGATTCAGG	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.589A>G	21.37:g.39671772A>G	ENSP00000331698:p.Ile197Val	61.0	0.0		67.0	16.0	NM_170736	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	37	CCDS13656.1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.571641	0.28003	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934	D;D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85;-2.85	5.73	5.73	0.89815	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.062544	0.64402	D	0.000004	D	0.82870	0.5131	N	0.20986	0.625	0.38641	D	0.951609	B	0.16396	0.017	B	0.23275	0.045	T	0.78157	-0.2313	9	.	.	.	.	10.3723	0.44062	0.9272:0.0:0.0728:0.0	.	197	Q99712	IRK15_HUMAN	V	197	ENSP00000331698:I197V;ENSP00000381911:I197V;ENSP00000381905:I197V;ENSP00000414487:I197V;ENSP00000381904:I197V;ENSP00000381907:I197V	.	I	+	1	0	KCNJ15	38593642	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.435000	0.44811	2.190000	0.69967	0.533000	0.62120	ATT	.		0.547	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
KDR	3791	broad.mit.edu;bcgsc.ca	37	4	55948168	55948168	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:55948168T>C	ENST00000263923.4	-	29	4098	c.3803A>G	c.(3802-3804)gAg>gGg	p.E1268G	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1268					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGTTTTCAGCTCTTCTGAGGC	0.363			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.E1268G		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	2298	0			c.A3803G						.						94.0	92.0	93.0					4																	55948168		2203	4300	6503	SO:0001583	missense	3791	exon29			TTCAGCTCTTCTG	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3803A>G	4.37:g.55948168T>C	ENSP00000263923:p.Glu1268Gly	170.0	1.0		135.0	6.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	37	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.931106	0.73327	.	.	ENSG00000128052	ENST00000263923	T	0.79554	-1.28	5.87	5.87	0.94306	.	0.166886	0.52532	D	0.000062	T	0.79845	0.4516	M	0.78049	2.395	0.52501	D	0.999951	P	0.47253	0.892	B	0.35770	0.21	D	0.84048	0.0368	10	0.87932	D	0	.	16.2533	0.82498	0.0:0.0:0.0:1.0	.	1268	P35968	VGFR2_HUMAN	G	1268	ENSP00000263923:E1268G	ENSP00000263923:E1268G	E	-	2	0	KDR	55642925	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	5.566000	0.67372	2.240000	0.73641	0.533000	0.62120	GAG	.		0.363	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	10602811	10602812	+	Frame_Shift_Ins	INS	-	-	CGTA			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:10602811_10602812insCGTA	ENST00000171111.5	-	3	1313_1314	c.766_767insTACG	c.(766-768)gacfs	p.D256fs	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Frame_Shift_Ins_p.D256fs|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	256	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CTGTTCGCAGTCGTACTTGACC	0.634																																					p.D256fs		.											.	KEAP1	637	0			c.767_768insTACG						.																																			SO:0001589	frameshift_variant	9817	exon3			TCGCAGTCGTACT	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.763_766dupTACG	19.37:g.10602812_10602815dupCGTA	ENSP00000171111:p.Asp256fs	84.0	0.0		102.0	18.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Frame_Shift_Ins	INS	ENST00000171111.5	37	CCDS12239.1																																																																																			.		0.634	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10610398	10610398	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:10610398G>T	ENST00000171111.5	-	2	859	c.312C>A	c.(310-312)agC>agA	p.S104R	KEAP1_ENST00000393623.2_Missense_Mutation_p.S104R|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	104	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TGAAGACAGGGCTGGATGAGG	0.617																																					p.S104R		.											.	KEAP1	637	0			c.C312A						.						83.0	67.0	73.0					19																	10610398		2203	4300	6503	SO:0001583	missense	9817	exon2			GACAGGGCTGGAT	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.312C>A	19.37:g.10610398G>T	ENSP00000171111:p.Ser104Arg	145.0	0.0		157.0	55.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171438	0.38315	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.85861	-2.04;-2.04	4.68	3.65	0.41850	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.099963	0.64402	D	0.000004	D	0.95046	0.8396	H	0.98754	4.32	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.95026	0.8165	10	0.87932	D	0	.	10.599	0.45356	0.0958:0.0:0.9042:0.0	.	104	Q14145	KEAP1_HUMAN	R	104	ENSP00000171111:S104R;ENSP00000377245:S104R	ENSP00000171111:S104R	S	-	3	2	KEAP1	10471398	1.000000	0.71417	0.998000	0.56505	0.108000	0.19459	2.606000	0.46291	0.980000	0.38523	-0.379000	0.06801	AGC	.		0.617	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
KIAA0556	23247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27788950	27788950	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:27788950T>G	ENST00000261588.4	+	26	4590	c.4571T>G	c.(4570-4572)cTt>cGt	p.L1524R		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1524						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GACGACCTGCTTGTGTACAAT	0.632																																					p.L1524R		.											.	KIAA0556	141	0			c.T4571G						.						105.0	91.0	96.0					16																	27788950		2197	4300	6497	SO:0001583	missense	23247	exon26			ACCTGCTTGTGTA	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.4571T>G	16.37:g.27788950T>G	ENSP00000261588:p.Leu1524Arg	122.0	0.0		95.0	33.0	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.841006	0.51057	.	.	ENSG00000047578	ENST00000261588	T	0.28454	1.61	4.75	4.75	0.60458	.	0.000000	0.64402	D	0.000011	T	0.60495	0.2273	M	0.87180	2.865	0.49389	D	0.999784	D	0.89917	1.0	D	0.97110	1.0	T	0.68941	-0.5276	10	0.87932	D	0	-39.4665	14.234	0.65913	0.0:0.0:0.0:1.0	.	1524	O60303	K0556_HUMAN	R	1524	ENSP00000261588:L1524R	ENSP00000261588:L1524R	L	+	2	0	KIAA0556	27696451	1.000000	0.71417	0.989000	0.46669	0.045000	0.14185	7.675000	0.84002	1.897000	0.54924	0.459000	0.35465	CTT	.		0.632	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
KIAA0586	9786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	58895077	58895077	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:58895077A>G	ENST00000556134.1	+	2	324	c.50A>G	c.(49-51)cAt>cGt	p.H17R	TIMM9_ENST00000556007.2_5'Flank|TIMM9_ENST00000216463.4_5'Flank|KIAA0586_ENST00000423743.3_Intron|TIMM9_ENST00000555404.1_5'Flank|TIMM9_ENST00000555593.1_5'Flank|KIAA0586_ENST00000261244.5_Missense_Mutation_p.H32R|RP11-517O13.1_ENST00000556734.1_RNA|TIMM9_ENST00000395159.2_5'Flank|KIAA0586_ENST00000354386.6_Missense_Mutation_p.H44R	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	17					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CATGGAGATCATTTGGTTTTG	0.418																																					p.H44R		.											.	KIAA0586	23	0			c.A131G						.						164.0	152.0	156.0					14																	58895077		2008	4187	6195	SO:0001583	missense	9786	exon2			GAGATCATTTGGT	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.50A>G	14.37:g.58895077A>G	ENSP00000452351:p.His17Arg	225.0	0.0		257.0	82.0	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	A	7.070	0.568194	0.13560	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000261244	T;T;T	0.41065	1.01;1.03;1.03	5.08	2.7	0.31948	.	1.027060	0.07711	N	0.942010	T	0.30135	0.0755	.	.	.	0.09310	N	1	B;B;B	0.25667	0.131;0.035;0.035	B;B;B	0.23419	0.046;0.025;0.025	T	0.27839	-1.0062	9	0.41790	T	0.15	.	5.1913	0.15210	0.7271:0.1808:0.0921:0.0	.	44;32;17	E7EWM8;E9PGW8;Q9BVV6	.;.;K0586_HUMAN	R	44;17;32	ENSP00000346359:H44R;ENSP00000452351:H17R;ENSP00000261244:H32R	ENSP00000261244:H32R	H	+	2	0	KIAA0586	57964830	0.000000	0.05858	0.001000	0.08648	0.539000	0.34962	0.052000	0.14163	0.405000	0.25532	0.533000	0.62120	CAT	.		0.418	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
ICE1	23379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	5454677	5454677	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:5454677T>C	ENST00000296564.7	+	11	839	c.617T>C	c.(616-618)cTg>cCg	p.L206P	KIAA0947_ENST00000512608.1_3'UTR	NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		206					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AAAGTGAAACTGCTTCTGAAG	0.458																																					p.L206P		.											.	KIAA0947	48	0			c.T617C						.						57.0	61.0	60.0					5																	5454677		1942	4148	6090	SO:0001583	missense	23379	exon11			TGAAACTGCTTCT																												ENST00000296564.7:c.617T>C	5.37:g.5454677T>C	ENSP00000296564:p.Leu206Pro	87.0	0.0		110.0	39.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.184915	0.78677	.	.	ENSG00000164151	ENST00000296564	T	0.17054	2.3	5.25	5.25	0.73442	.	0.151623	0.42420	D	0.000711	T	0.28665	0.0710	L	0.27053	0.805	0.44880	D	0.997893	D	0.89917	1.0	D	0.75484	0.986	T	0.03898	-1.0994	10	0.72032	D	0.01	-8.8619	13.3984	0.60868	0.0:0.0:0.0:1.0	.	206	Q9Y2F5	K0947_HUMAN	P	206	ENSP00000296564:L206P	ENSP00000296564:L206P	L	+	2	0	KIAA0947	5507677	0.789000	0.28775	0.862000	0.33874	0.989000	0.77384	2.866000	0.48420	2.109000	0.64355	0.528000	0.53228	CTG	.		0.458	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
KIAA1244	57221	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138608320	138608320	+	Splice_Site	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:138608320A>C	ENST00000251691.4	+	17	3061	c.2895A>C	c.(2893-2895)caA>caC	p.Q965H		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CCATCACACAAGGTAACAACT	0.577																																					p.Q965H		.											.	KIAA1244	228	0			c.A2895C						.						63.0	52.0	56.0					6																	138608320		2200	4289	6489	SO:0001630	splice_region_variant	57221	exon17			CACACAAGGTAAC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.2896+1A>C	6.37:g.138608320A>C		29.0	0.0		30.0	13.0	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	A	19.14	3.770065	0.69992	.	.	ENSG00000112379	ENST00000251691	T	0.19394	2.15	4.82	4.82	0.62117	.	0.424918	0.27981	N	0.017069	T	0.12220	0.0297	L	0.57536	1.79	0.54753	D	0.999988	B	0.30824	0.296	B	0.22753	0.041	T	0.03534	-1.1027	10	0.66056	D	0.02	-19.5419	14.5456	0.68027	1.0:0.0:0.0:0.0	.	965	Q5TH69	BIG3_HUMAN	H	965	ENSP00000251691:Q965H	ENSP00000251691:Q965H	Q	+	3	2	KIAA1244	138650013	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	8.761000	0.91691	2.028000	0.59812	0.533000	0.62120	CAA	.		0.577	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	Missense_Mutation
KIAA1456	57604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	12879028	12879028	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:12879028C>A	ENST00000524591.2	+	5	1329	c.840C>A	c.(838-840)agC>agA	p.S280R	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	280							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						GGGCCAGTAGCACTGTAACAG	0.423																																					p.S280R		.											.	KIAA1456	90	0			c.C840A						.						83.0	80.0	81.0					8																	12879028		1885	4106	5991	SO:0001583	missense	57604	exon5			CAGTAGCACTGTA	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.840C>A	8.37:g.12879028C>A	ENSP00000432695:p.Ser280Arg	123.0	0.0		145.0	43.0	NM_020844	Q96AW6	Missense_Mutation	SNP	ENST00000524591.2	37	CCDS47808.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144688	0.37825	.	.	ENSG00000250305	ENST00000524591;ENST00000529978	T	0.11604	2.76	5.18	4.3	0.51218	.	0.501510	0.24298	N	0.039744	T	0.14056	0.0340	M	0.64997	1.995	0.26851	N	0.968151	B	0.11235	0.004	B	0.10450	0.005	T	0.10200	-1.0640	10	0.72032	D	0.01	-5.7566	12.1134	0.53852	0.0:0.8569:0.0:0.1431	.	280	Q9P272	K1456_HUMAN	R	280;193	ENSP00000432695:S280R	ENSP00000432695:S280R	S	+	3	2	AC135352.2	12923399	0.000000	0.05858	0.087000	0.20705	0.013000	0.08279	0.381000	0.20619	1.552000	0.49463	0.655000	0.94253	AGC	.		0.423	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383262.2	NM_001099677	
KIAA1755	85449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36848153	36848153	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr20:36848153G>A	ENST00000279024.4	-	11	2706	c.2435C>T	c.(2434-2436)gCc>gTc	p.A812V		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	812										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CAAGGCAGTGGCTGCAGCCAG	0.632																																					p.A812V		.											.	KIAA1755	95	0			c.C2435T						.						108.0	102.0	104.0					20																	36848153		2203	4300	6503	SO:0001583	missense	85449	exon11			GCAGTGGCTGCAG	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.2435C>T	20.37:g.36848153G>A	ENSP00000279024:p.Ala812Val	86.0	0.0		97.0	25.0	NM_001029864	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141898	0.57044	.	.	ENSG00000149633	ENST00000279024;ENST00000373398;ENST00000435901	T;T	0.22134	3.44;1.97	4.26	4.26	0.50523	.	0.000000	0.42053	D	0.000776	T	0.37839	0.1018	L	0.55017	1.72	0.35351	D	0.787336	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	T	0.33317	-0.9873	10	0.15066	T	0.55	.	14.5425	0.68005	0.0:0.0:1.0:0.0	.	812;320	Q5JYT7;E9PFS1	K1755_HUMAN;.	V	812;320;111	ENSP00000279024:A812V;ENSP00000393503:A111V	ENSP00000279024:A812V	A	-	2	0	KIAA1755	36281567	0.996000	0.38824	0.273000	0.24645	0.660000	0.38997	5.568000	0.67385	2.367000	0.80283	0.561000	0.74099	GCC	.		0.632	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28974375	28974375	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:28974375T>C	ENST00000524189.1	-	31	3848	c.3810A>G	c.(3808-3810)agA>agG	p.R1270R	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1270					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TGACACAGATTCTCTTGCGTA	0.582																																					p.R1270R		.											.	KIF13B	22	0			c.A3810G						.						72.0	77.0	75.0					8																	28974375		2126	4240	6366	SO:0001819	synonymous_variant	23303	exon31			ACAGATTCTCTTG	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3810A>G	8.37:g.28974375T>C		262.0	0.0		234.0	74.0	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	ENST00000524189.1	37	CCDS55217.1																																																																																			.		0.582	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28974384	28974384	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:28974384T>C	ENST00000524189.1	-	31	3839	c.3801A>G	c.(3799-3801)ttA>ttG	p.L1267L	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1267					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TTCTCTTGCGTAACACCAGTT	0.592																																					p.L1267L		.											.	KIF13B	22	0			c.A3801G						.						74.0	79.0	77.0					8																	28974384		2136	4243	6379	SO:0001819	synonymous_variant	23303	exon31			CTTGCGTAACACC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3801A>G	8.37:g.28974384T>C		274.0	0.0		247.0	76.0	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	ENST00000524189.1	37	CCDS55217.1																																																																																			.		0.592	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KLB	152831	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39409343	39409343	+	Silent	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:39409343A>T	ENST00000257408.4	+	1	871	c.774A>T	c.(772-774)ggA>ggT	p.G258G		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	258	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						ATGCCCCTGGAGAGAAGGGAA	0.438																																					p.G258G		.											.	KLB	69	0			c.A774T						.						78.0	83.0	81.0					4																	39409343		2202	4300	6502	SO:0001819	synonymous_variant	152831	exon1			CCCTGGAGAGAAG	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.774A>T	4.37:g.39409343A>T		207.0	1.0		196.0	65.0	NM_175737	Q2M3K8	Silent	SNP	ENST00000257408.4	37	CCDS3451.1																																																																																			.		0.438	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
KPNA1	3836	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	122146558	122146558	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:122146558A>G	ENST00000344337.6	-	13	1432	c.1256T>C	c.(1255-1257)cTa>cCa	p.L419P	RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|KPNA1_ENST00000466923.1_5'UTR|RP11-299J3.8_ENST00000608015.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	419	Binding to RAG1.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		CAGTTCTACTAGGTACCTAAA	0.388																																					p.L419P	Melanoma(12;340 801 11196 19797)	.											.	KPNA1	226	0			c.T1256C						.						63.0	58.0	60.0					3																	122146558		2203	4300	6503	SO:0001583	missense	3836	exon13			TCTACTAGGTACC	S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.1256T>C	3.37:g.122146558A>G	ENSP00000343701:p.Leu419Pro	54.0	0.0		55.0	24.0	NM_002264	D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	ENST00000344337.6	37	CCDS3013.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.618245	0.87359	.	.	ENSG00000114030	ENST00000344337	T	0.73789	-0.78	5.64	5.64	0.86602	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90164	0.6926	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92857	0.6302	10	0.87932	D	0	-7.5972	15.1937	0.73067	1.0:0.0:0.0:0.0	.	419	P52294	IMA1_HUMAN	P	419	ENSP00000343701:L419P	ENSP00000343701:L419P	L	-	2	0	KPNA1	123629248	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.109000	0.94291	2.367000	0.80283	0.528000	0.53228	CTA	.		0.388	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355740.1	NM_002264	
KPNA1	3836	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122186176	122186176	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:122186176A>T	ENST00000344337.6	-	3	406	c.230T>A	c.(229-231)aTg>aAg	p.M77K		NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	77					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		TACTGGTGCCATCTCCATGTT	0.358																																					p.M77K	Melanoma(12;340 801 11196 19797)	.											.	KPNA1	226	0			c.T230A						.						140.0	130.0	134.0					3																	122186176		2202	4300	6502	SO:0001583	missense	3836	exon3			GGTGCCATCTCCA	S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.230T>A	3.37:g.122186176A>T	ENSP00000343701:p.Met77Lys	203.0	1.0		212.0	43.0	NM_002264	D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	ENST00000344337.6	37	CCDS3013.1	.	.	.	.	.	.	.	.	.	.	A	5.076	0.199677	0.09652	.	.	ENSG00000114030	ENST00000344337;ENST00000465882;ENST00000482287;ENST00000476916;ENST00000493510	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	4.56	4.56	0.56223	Importin-alpha, importin-beta-binding domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.396903	0.29846	N	0.011047	T	0.14270	0.0345	N	0.11560	0.145	0.50171	D	0.999854	B	0.06786	0.001	B	0.06405	0.002	T	0.07158	-1.0787	10	0.05721	T	0.95	-0.7455	11.917	0.52771	1.0:0.0:0.0:0.0	.	77	P52294	IMA1_HUMAN	K	77	ENSP00000343701:M77K;ENSP00000419890:M77K;ENSP00000417166:M77K;ENSP00000417319:M77K;ENSP00000419257:M77K	ENSP00000343701:M77K	M	-	2	0	KPNA1	123668866	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.393000	0.73217	1.909000	0.55274	0.383000	0.25322	ATG	.		0.358	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355740.1	NM_002264	
KRT40	125115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39140461	39140461	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:39140461G>A	ENST00000398486.2	-	3	225	c.65C>T	c.(64-66)gCa>gTa	p.A22V	KRT40_ENST00000377755.4_Missense_Mutation_p.A22V	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	22	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				TGAGGCAGGTGCACAACCGGA	0.572																																					p.A22V		.											.	.	.	0			c.C65T						.						33.0	42.0	39.0					17																	39140461		2093	4216	6309	SO:0001583	missense	125115	exon3			GCAGGTGCACAAC	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.65C>T	17.37:g.39140461G>A	ENSP00000381500:p.Ala22Val	109.0	0.0		140.0	59.0	NM_182497	Q6IFU5	Missense_Mutation	SNP	ENST00000398486.2	37	CCDS42320.1	.	.	.	.	.	.	.	.	.	.	G	7.463	0.645080	0.14451	.	.	ENSG00000204889	ENST00000377755;ENST00000398486	D;D	0.81908	-1.55;-1.55	4.79	2.74	0.32292	.	1.160560	0.06757	N	0.781005	T	0.78874	0.4352	L	0.57536	1.79	0.09310	N	1	B	0.23128	0.08	B	0.19946	0.027	T	0.60717	-0.7208	10	0.27785	T	0.31	.	6.747	0.23466	0.0837:0.0:0.6049:0.3113	.	22	Q6A162	K1C40_HUMAN	V	22	ENSP00000366984:A22V;ENSP00000381500:A22V	ENSP00000366984:A22V	A	-	2	0	KRT40	36393987	.	.	0.000000	0.03702	0.025000	0.11179	.	.	0.532000	0.28657	-0.500000	0.04577	GCA	.		0.572	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	
KRT79	338785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53227630	53227630	+	Missense_Mutation	SNP	G	G	A	rs140167313		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:53227630G>A	ENST00000330553.5	-	1	449	c.415C>T	c.(415-417)Cgc>Tgc	p.R139C		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	139	Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCCTGAGTGCGCACTCGCTGG	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		16262	0.0		0.001	False		,,,				2504	0.0				p.R139C		.											.	KRT79	72	0			c.C415T						.	G	CYS/ARG	0,4406		0,0,2203	116.0	115.0	116.0		415	4.3	1.0	12	dbSNP_134	116	2,8598	2.2+/-6.3	0,2,4298	yes	missense	KRT79	NM_175834.2	180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	139/536	53227630	2,13004	2203	4300	6503	SO:0001583	missense	338785	exon1			GAGTGCGCACTCG	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.415C>T	12.37:g.53227630G>A	ENSP00000328358:p.Arg139Cys	190.0	0.0		182.0	65.0	NM_175834	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	22.1	4.245675	0.80024	0.0	2.33E-4	ENSG00000185640	ENST00000330553	T	0.78595	-1.19	4.26	4.26	0.50523	.	0.000000	0.45126	D	0.000400	T	0.72495	0.3467	L	0.52364	1.645	0.58432	D	0.999999	P	0.50528	0.936	B	0.42771	0.397	T	0.76642	-0.2884	10	0.66056	D	0.02	.	12.0376	0.53433	0.0:0.0:0.827:0.173	.	139	Q5XKE5	K2C79_HUMAN	C	139	ENSP00000328358:R139C	ENSP00000328358:R139C	R	-	1	0	KRT79	51513897	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.334000	0.43920	2.643000	0.89663	0.591000	0.81541	CGC	G|0.999;A|0.000		0.607	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
KSR1	8844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	25928943	25928943	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:25928943A>C	ENST00000319524.6	+	12	1535	c.1535A>C	c.(1534-1536)aAa>aCa	p.K512T	KSR1_ENST00000398988.3_Missense_Mutation_p.K375T|KSR1_ENST00000509603.2_Intron|KSR1_ENST00000581975.1_Intron|KSR1_ENST00000268763.6_Missense_Mutation_p.K375T			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	512					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CATTGCTGGAAATGCCTCCTT	0.448											OREG0024261	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K375T	Esophageal Squamous(88;1120 1336 6324 10502 16832)	.											.	KSR1	964	0			c.A1124C						.						58.0	56.0	56.0					17																	25928943		1949	4166	6115	SO:0001583	missense	8844	exon12			GCTGGAAATGCCT	U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1535A>C	17.37:g.25928943A>C	ENSP00000323178:p.Lys512Thr	126.0	0.0	782	143.0	42.0	NM_014238	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	ENST00000319524.6	37		.	.	.	.	.	.	.	.	.	.	A	2.679	-0.275784	0.05679	.	.	ENSG00000141068	ENST00000319524;ENST00000268763;ENST00000398982	T;T	0.79653	-1.29;-1.26	4.74	2.5	0.30297	.	4.906310	0.00166	N	0.000009	T	0.56775	0.2008	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54735	-0.8249	10	0.12430	T	0.62	.	4.9038	0.13788	0.7154:0.1882:0.0964:0.0	.	510	Q8IVT5	KSR1_HUMAN	T	512;375;375	ENSP00000323178:K512T;ENSP00000268763:K375T	ENSP00000268763:K375T	K	+	2	0	KSR1	22953070	0.014000	0.17966	0.001000	0.08648	0.001000	0.01503	0.416000	0.21198	0.399000	0.25367	-0.250000	0.11733	AAA	.		0.448	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_014238	
L1TD1	54596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62676374	62676374	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:62676374T>C	ENST00000498273.1	+	4	2223	c.1928T>C	c.(1927-1929)tTg>tCg	p.L643S	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	643										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						tcaggtgtcttggaaattgaa	0.343																																					p.L643S		.											.	L1TD1	92	0			c.T1928C						.						21.0	20.0	20.0					1																	62676374		2080	4001	6081	SO:0001583	missense	54596	exon5			GTGTCTTGGAAAT	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1928T>C	1.37:g.62676374T>C	ENSP00000419901:p.Leu643Ser	161.0	0.0		155.0	48.0	NM_001164835	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	ENST00000498273.1	37	CCDS619.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.498565	0.26861	.	.	ENSG00000240563	ENST00000498273	T	0.23348	1.91	3.07	1.94	0.25998	.	.	.	.	.	T	0.30324	0.0761	M	0.71920	2.185	0.09310	N	1	P	0.39535	0.677	B	0.43536	0.423	T	0.23762	-1.0179	9	0.87932	D	0	.	4.8405	0.13487	0.0:0.1462:0.0:0.8538	.	643	Q5T7N2	LITD1_HUMAN	S	643	ENSP00000419901:L643S	ENSP00000419901:L643S	L	+	2	0	L1TD1	62448962	0.000000	0.05858	0.004000	0.12327	0.266000	0.26442	0.427000	0.21379	0.600000	0.29862	0.260000	0.18958	TTG	.		0.343	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
LACTB2	51110	hgsc.bcm.edu;broad.mit.edu	37	8	71581340	71581340	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:71581340G>A	ENST00000276590.4	-	1	52	c.16C>T	c.(16-18)Cag>Tag	p.Q6*	XKR9_ENST00000408926.3_5'Flank|XKR9_ENST00000520030.1_5'Flank|LACTB2_ENST00000522447.1_Nonsense_Mutation_p.Q6*	NM_016027.2	NP_057111.1	Q53H82	LACB2_HUMAN	lactamase, beta 2	6						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|prostate(1)	10	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			TCGACGCGCTGCAGTACAGCA	0.652											OREG0018822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q6X		.											.	LACTB2	227	0			c.C16T						.						27.0	25.0	26.0					8																	71581340		2199	4289	6488	SO:0001587	stop_gained	51110	exon1			CGCGCTGCAGTAC	AF151841	CCDS6208.1	8q13.3	2005-10-14			ENSG00000147592	ENSG00000147592			18512	protein-coding gene	gene with protein product							Standard	NM_016027		Approved	CGI-83	uc003xyp.3	Q53H82	OTTHUMG00000164430	ENST00000276590.4:c.16C>T	8.37:g.71581340G>A	ENSP00000276590:p.Gln6*	101.0	0.0	1131	98.0	7.0	NM_016027	A8K2D6|Q9Y392	Nonsense_Mutation	SNP	ENST00000276590.4	37	CCDS6208.1	.	.	.	.	.	.	.	.	.	.	G	36	5.839193	0.97009	.	.	ENSG00000147592	ENST00000522447;ENST00000276590	.	.	.	4.66	3.77	0.43336	.	0.111909	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-2.6738	14.2343	0.65916	0.0:0.0:0.8497:0.1503	.	.	.	.	X	6	.	ENSP00000276590:Q6X	Q	-	1	0	LACTB2	71743894	1.000000	0.71417	0.977000	0.42913	0.037000	0.13140	7.091000	0.76923	1.167000	0.42706	0.650000	0.86243	CAG	.		0.652	LACTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378748.1	NM_016027	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21418835	21418835	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr18:21418835A>G	ENST00000313654.9	+	26	3425	c.3184A>G	c.(3184-3186)Aat>Gat	p.N1062D	LAMA3_ENST00000399516.3_Missense_Mutation_p.N1062D	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1062	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GCGATTTGTCAATCAAAGGTA	0.418																																					p.N1062D		.											.	LAMA3	100	0			c.A3184G						.						184.0	182.0	183.0					18																	21418835		1959	4142	6101	SO:0001583	missense	3909	exon26			TTTGTCAATCAAA	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3184A>G	18.37:g.21418835A>G	ENSP00000324532:p.Asn1062Asp	314.0	0.0		258.0	74.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	2.951	-0.216710	0.06101	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.17691	2.28;2.26	5.52	5.52	0.82312	.	.	.	.	.	T	0.14830	0.0358	L	0.59912	1.85	0.39731	D	0.971619	B;B	0.13145	0.004;0.007	B;B	0.09377	0.004;0.004	T	0.11397	-1.0589	9	0.11485	T	0.65	.	6.9956	0.24780	0.7668:0.1519:0.0813:0.0	.	1062;1062	Q6VU67;Q16787	.;LAMA3_HUMAN	D	1062;1062;1060	ENSP00000324532:N1062D;ENSP00000382432:N1062D	ENSP00000324532:N1062D	N	+	1	0	LAMA3	19672833	0.105000	0.21958	0.907000	0.35723	0.201000	0.24016	0.585000	0.23879	2.234000	0.73211	0.533000	0.62120	AAT	.		0.418	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LBR	3930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225611703	225611703	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:225611703T>C	ENST00000338179.2	-	2	200	c.75A>G	c.(73-75)gtA>gtG	p.V25V	LBR_ENST00000272163.4_Silent_p.V25V	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	25	Tudor.				cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		TCAGAATTTCTACTTCATAAT	0.393																																					p.V25V		.											.	LBR	228	0			c.A75G						.						252.0	270.0	264.0					1																	225611703		2203	4300	6503	SO:0001819	synonymous_variant	3930	exon2			AATTTCTACTTCA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.75A>G	1.37:g.225611703T>C		165.0	0.0		192.0	46.0	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Silent	SNP	ENST00000338179.2	37	CCDS1545.1																																																																																			.		0.393	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
RPL9	6133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39460742	39460742	+	5'Flank	SNP	C	C	A	rs372288500		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:39460742C>A	ENST00000449470.2	-	0	0				LIAS_ENST00000381846.1_Missense_Mutation_p.S2Y|LIAS_ENST00000513731.1_Missense_Mutation_p.S2Y|LIAS_ENST00000340169.2_Missense_Mutation_p.S2Y|LIAS_ENST00000261434.3_Missense_Mutation_p.S2Y|RPL9_ENST00000295955.9_5'Flank|LIAS_ENST00000515061.1_3'UTR	NM_001024921.2	NP_001020092.1	P32969	RL9_HUMAN	ribosomal protein L9						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|skin(1)	8						GAGGAAATGTCTCTACGCTGC	0.622																																					p.S2Y		.											.	LIAS	90	0			c.C5A						.						62.0	61.0	62.0					4																	39460742		2203	4300	6503	SO:0001631	upstream_gene_variant	11019	exon1			AAATGTCTCTACG	D14531	CCDS3452.1	4p13	2011-04-06			ENSG00000163682	ENSG00000163682		"""L ribosomal proteins"""	10369	protein-coding gene	gene with protein product		603686				8597601, 8415001	Standard	XM_005262661		Approved	L9	uc021sso.1	P32969	OTTHUMG00000099367		4.37:g.39460742C>A	Exception_encountered	52.0	0.0		59.0	11.0	NM_194451		Missense_Mutation	SNP	ENST00000449470.2	37	CCDS3452.1	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561934	0.65538	.	.	ENSG00000121897	ENST00000340169;ENST00000261434;ENST00000513731;ENST00000381846	T;T;T;T	0.79141	-1.15;-1.15;-1.24;-1.14	5.21	5.21	0.72293	.	0.421175	0.26574	N	0.023608	T	0.78929	0.4361	N	0.22421	0.69	0.26563	N	0.97371	D;P;P;P;P	0.65815	0.995;0.763;0.651;0.651;0.946	P;P;B;B;P	0.61201	0.885;0.533;0.248;0.248;0.735	T	0.72494	-0.4276	10	0.49607	T	0.09	-6.5397	15.9633	0.79948	0.0:1.0:0.0:0.0	.	2;2;2;2;2	B4E0L7;C9JCF6;D6RCP8;O43766;Q6P5Q6	.;.;.;LIAS_HUMAN;.	Y	2	ENSP00000340676:S2Y;ENSP00000261434:S2Y;ENSP00000425580:S2Y;ENSP00000371270:S2Y	ENSP00000261434:S2Y	S	+	2	0	LIAS	39137137	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.513000	0.53414	2.873000	0.98535	0.561000	0.74099	TCT	.		0.622	RPL9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361018.1		
LEF1	51176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	109000723	109000723	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:109000723C>T	ENST00000265165.1	-	7	1424	c.770G>A	c.(769-771)gGc>gAc	p.G257D	LEF1_ENST00000438313.2_Missense_Mutation_p.G229D|LEF1_ENST00000503879.1_5'Flank|LEF1_ENST00000379951.2_Missense_Mutation_p.G229D|LEF1_ENST00000510624.1_Missense_Mutation_p.G161D	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	257	Pro-rich.				alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		ATGAGGGATGCCAGTTGTGTG	0.498																																					p.G257D		.											.	LEF1	721	0			c.G770A						.						252.0	209.0	224.0					4																	109000723		2203	4300	6503	SO:0001583	missense	51176	exon7			GGGATGCCAGTTG		CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.770G>A	4.37:g.109000723C>T	ENSP00000265165:p.Gly257Asp	174.0	0.0		141.0	58.0	NM_016269	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	ENST00000265165.1	37	CCDS3679.1	.	.	.	.	.	.	.	.	.	.	C	35	5.551944	0.96501	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313;ENST00000510624	D;D;D;D	0.99220	-5.58;-5.57;-5.55;-5.57	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.99492	0.9819	M	0.85373	2.75	0.80722	D	1	D;D;D;P;D	0.89917	1.0;0.994;1.0;0.83;0.998	D;P;D;P;D	0.91635	0.992;0.782;0.999;0.756;0.954	D	0.98951	1.0794	10	0.72032	D	0.01	.	20.1731	0.98165	0.0:1.0:0.0:0.0	.	161;114;229;229;257	E9PDK3;B4DZY5;Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;.;.;LEF1_HUMAN	D	257;229;229;161	ENSP00000265165:G257D;ENSP00000369284:G229D;ENSP00000406176:G229D;ENSP00000422840:G161D	ENSP00000265165:G257D	G	-	2	0	LEF1	109220172	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.768000	0.95171	0.655000	0.94253	GGC	.		0.498	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254749.2		
LITAF	9516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	11647418	11647418	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:11647418C>A	ENST00000571688.1	-	3	578	c.348G>T	c.(346-348)tgG>tgT	p.W116C	LITAF_ENST00000381810.3_Missense_Mutation_p.W116C|LITAF_ENST00000571459.1_Intron|LITAF_ENST00000576036.1_Missense_Mutation_p.W116C|LITAF_ENST00000413364.2_Missense_Mutation_p.W116C|LITAF_ENST00000570904.1_Missense_Mutation_p.W116C|LITAF_ENST00000574763.1_Missense_Mutation_p.W116C|LITAF_ENST00000571976.1_Missense_Mutation_p.W116C|LITAF_ENST00000339430.5_Missense_Mutation_p.W116C|LITAF_ENST00000572255.1_Missense_Mutation_p.W23C	NM_001136472.1	NP_001129944.1	Q99732	LITAF_HUMAN	lipopolysaccharide-induced TNF factor	116			W -> G (in CMT1C). {ECO:0000269|PubMed:12525712}.		aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cytokine production (GO:0001817)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			endometrium(1)|large_intestine(1)|liver(1)|lung(3)|skin(1)	7						CGCAGGACAGCCAGGTCAGAG	0.602																																					p.W116C		.											.	LITAF	227	0			c.G348T						.						60.0	48.0	52.0					16																	11647418		2197	4300	6497	SO:0001583	missense	9516	exon3			GGACAGCCAGGTC	AB034747	CCDS32386.1, CCDS45411.1	16p13.3-p12	2014-09-17							16841	protein-coding gene	gene with protein product		603795				9305847, 10200294	Standard	NM_004862		Approved	PIG7, SIMPLE, FLJ38636, TP53I7	uc002dbb.3	Q99732		ENST00000571688.1:c.348G>T	16.37:g.11647418C>A	ENSP00000459533:p.Trp116Cys	48.0	0.0		50.0	12.0	NM_001136473	D3DUG1|G5E9K0|Q05DW0|Q9C0L6	Missense_Mutation	SNP	ENST00000571688.1	37	CCDS32386.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022741	0.75275	.	.	ENSG00000189067	ENST00000339430;ENST00000413364;ENST00000381810	D;D;D	0.88124	-2.34;-2.34;-2.34	5.48	5.48	0.80851	LPS-induced tumor necrosis factor alpha factor (2);	0.000000	0.85682	D	0.000000	D	0.93838	0.8029	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.94299	0.7535	10	0.66056	D	0.02	-14.2553	16.8808	0.86062	0.0:1.0:0.0:0.0	.	116;116	G5E9K0;Q99732	.;LITAF_HUMAN	C	116	ENSP00000340118:W116C;ENSP00000397958:W116C;ENSP00000371231:W116C	ENSP00000340118:W116C	W	-	3	0	LITAF	11554919	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.373000	0.66162	2.572000	0.86782	0.655000	0.94253	TGG	.		0.602	LITAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436794.2	NM_004862	
LPHN1	22859	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	14261860	14261860	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:14261860G>T	ENST00000340736.6	-	24	4547	c.4250C>A	c.(4249-4251)cCc>cAc	p.P1417H	CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.P1412H	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1417	Poly-Pro.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGGGGGCCGGGGGGTGCGGG	0.726																																					p.P1417H		.											.	LPHN1	523	0			c.C4250A						.						2.0	2.0	2.0					19																	14261860		1153	2788	3941	SO:0001583	missense	22859	exon24			GGGCCGGGGGGTG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.4250C>A	19.37:g.14261860G>T	ENSP00000340688:p.Pro1417His	40.0	0.0		91.0	42.0	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466249	0.26335	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.70164	-0.46;-0.46	3.94	3.94	0.45596	GPCR, family 2, latrophilin, C-terminal (1);	0.241291	0.35179	N	0.003391	T	0.48642	0.1511	N	0.14661	0.345	0.37287	D	0.90808	P;P	0.44521	0.804;0.837	B;B	0.39590	0.202;0.304	T	0.60010	-0.7346	10	0.45353	T	0.12	.	13.4745	0.61301	0.0:0.0:1.0:0.0	.	1412;1417	O94910-2;O94910	.;LPHN1_HUMAN	H	1417;1412	ENSP00000340688:P1417H;ENSP00000355328:P1412H	ENSP00000340688:P1417H	P	-	2	0	LPHN1	14122860	0.991000	0.36638	0.927000	0.36925	0.179000	0.23085	2.178000	0.42519	1.764000	0.52075	0.205000	0.17691	CCC	.		0.726	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57601983	57601983	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:57601983G>A	ENST00000243077.3	+	77	12488	c.12022G>A	c.(12022-12024)Gtg>Atg	p.V4008M		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4008					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CGCCATTGTGGTGGACCCACT	0.667																																					p.V4008M		.											.	LRP1	596	0			c.G12022A						.						39.0	33.0	35.0					12																	57601983		2202	4300	6502	SO:0001583	missense	4035	exon77			ATTGTGGTGGACC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12022G>A	12.37:g.57601983G>A	ENSP00000243077:p.Val4008Met	108.0	0.0		128.0	37.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495477	0.64186	.	.	ENSG00000123384	ENST00000243077	D	0.97959	-4.63	4.19	4.19	0.49359	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	D	0.000019	D	0.98789	0.9592	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99297	1.0900	10	0.62326	D	0.03	.	15.8163	0.78604	0.0:0.0:1.0:0.0	.	4008	Q07954	LRP1_HUMAN	M	4008	ENSP00000243077:V4008M	ENSP00000243077:V4008M	V	+	1	0	LRP1	55888250	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.457000	0.60088	2.325000	0.78763	0.655000	0.94253	GTG	.		0.667	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	170033099	170033110	+	Splice_Site	DEL	CTAGTGGAAAAG	CTAGTGGAAAAG	-	rs574497332		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	CTAGTGGAAAAG	CTAGTGGAAAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:170033099_170033110delCTAGTGGAAAAG	ENST00000263816.3	-	54	10679		c.e54-1		LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2						cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGATTGCTCACTAGTGGAAAAGGAAGAAAATA	0.415																																					.		.											.	LRP2	175	0			.						.																																			SO:0001630	splice_region_variant	4036	.			TGCTCACTAGTGG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10394-1CTTTTCCACTAG>-	2.37:g.170033099_170033110delCTAGTGGAAAAG		95.0	0.0		66.0	10.0	.	O00711|Q16215	Splice_Site	DEL	ENST00000263816.3	37	CCDS2232.1																																																																																			.		0.415	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	Intron
LRRC27	80313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134161592	134161592	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr10:134161592C>T	ENST00000368614.3	+	6	763	c.658C>T	c.(658-660)Cca>Tca	p.P220S	LRRC27_ENST00000432555.2_Missense_Mutation_p.P93S|LRRC27_ENST00000368612.1_Missense_Mutation_p.P158S|LRRC27_ENST00000344079.5_Missense_Mutation_p.P220S|LRRC27_ENST00000356571.4_3'UTR|LRRC27_ENST00000392638.2_Missense_Mutation_p.P220S|LRRC27_ENST00000368615.3_Missense_Mutation_p.P220S|LRRC27_ENST00000368610.3_Missense_Mutation_p.P158S|LRRC27_ENST00000368613.4_Missense_Mutation_p.P220S	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	220										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CGCTCAGGACCCAGAGGGGGC	0.577																																					p.P220S		.											.	LRRC27	91	0			c.C658T						.						61.0	64.0	63.0					10																	134161592		2203	4300	6503	SO:0001583	missense	80313	exon6			CAGGACCCAGAGG	AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.658C>T	10.37:g.134161592C>T	ENSP00000357603:p.Pro220Ser	93.0	0.0		106.0	41.0	NM_001143758	A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Missense_Mutation	SNP	ENST00000368614.3	37	CCDS31316.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.603052	0.46423	.	.	ENSG00000148814	ENST00000368615;ENST00000392638;ENST00000344079;ENST00000368614;ENST00000368613;ENST00000368612;ENST00000368610;ENST00000432555	T;T;T;T;T;T;T;T	0.45668	2.53;2.43;2.43;2.5;2.5;4.27;4.27;0.89	3.81	2.88	0.33553	.	1.545580	0.04074	N	0.308553	T	0.32704	0.0838	L	0.27053	0.805	0.09310	N	1	P;P;P;P;P	0.47910	0.804;0.782;0.902;0.51;0.774	B;B;B;B;B	0.42495	0.194;0.189;0.268;0.066;0.389	T	0.16394	-1.0404	10	0.10636	T	0.68	0.3322	10.0178	0.42024	0.0:0.7935:0.2065:0.0	.	220;93;158;220;220	Q9C0I9-4;B4DW88;Q9C0I9-2;Q9C0I9;Q9C0I9-3	.;.;.;LRC27_HUMAN;.	S	220;220;220;220;220;158;158;93	ENSP00000357604:P220S;ENSP00000376413:P220S;ENSP00000342641:P220S;ENSP00000357603:P220S;ENSP00000357602:P220S;ENSP00000357601:P158S;ENSP00000357599:P158S;ENSP00000407949:P93S	ENSP00000342641:P220S	P	+	1	0	LRRC27	134011582	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.268000	0.18571	0.875000	0.35847	0.655000	0.94253	CCA	.		0.577	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	XM_290462	
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	78130892	78130893	+	Splice_Site	INS	-	-	CT			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:78130892_78130893insCT	ENST00000354212.4	-	5	1219		c.e5+1		MAGI2_ENST00000536571.1_Splice_Site|MAGI2_ENST00000522391.1_Splice_Site|MAGI2_ENST00000419488.1_Splice_Site|MAGI2_ENST00000535697.1_Splice_Site	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2						cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGTGAAACTCACTCAATGAAGT	0.386																																					.		.											.	MAGI2	461	0			c.965+2->AG						.																																			SO:0001630	splice_region_variant	9863	exon6			AAACTCACTCAAT	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.965+1->AG	7.37:g.78130893_78130894dupCT		160.0	0.0		137.0	43.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Splice_Site	INS	ENST00000354212.4	37	CCDS5594.1																																																																																			.		0.386	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	Intron
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	78130909	78130909	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:78130909T>G	ENST00000354212.4	-	5	1203	c.950A>C	c.(949-951)gAa>gCa	p.E317A	MAGI2_ENST00000536571.1_Missense_Mutation_p.E149A|MAGI2_ENST00000522391.1_Missense_Mutation_p.E317A|MAGI2_ENST00000419488.1_Missense_Mutation_p.E317A|MAGI2_ENST00000535697.1_Missense_Mutation_p.E154A	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	317	Interaction with DDN.|WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GAAGTAGACTTCGCCCTTCTC	0.418																																					p.E317A		.											.	MAGI2	461	0			c.A950C						.						233.0	196.0	208.0					7																	78130909		2203	4300	6503	SO:0001583	missense	9863	exon5			TAGACTTCGCCCT	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.950A>C	7.37:g.78130909T>G	ENSP00000346151:p.Glu317Ala	190.0	0.0		171.0	61.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.556539	0.86231	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6	5.96	5.96	0.96718	WW/Rsp5/WWP (5);	0.000000	0.37483	U	0.002063	D	0.89663	0.6780	M	0.64080	1.96	0.80722	D	1	P;D;P;D	0.76494	0.845;0.967;0.917;0.999	P;P;P;D	0.81914	0.712;0.852;0.774;0.995	D	0.90113	0.4193	10	0.59425	D	0.04	.	15.6296	0.76893	0.0:0.0:0.0:1.0	.	154;149;317;317	F5GWH1;F5GWK7;Q86UL8-2;Q86UL8	.;.;.;MAGI2_HUMAN	A	317;317;317;317;149;154	ENSP00000405766:E317A;ENSP00000346151:E317A;ENSP00000428389:E317A;ENSP00000441584:E149A;ENSP00000441603:E154A	ENSP00000346151:E317A	E	-	2	0	MAGI2	77968845	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.698000	0.84413	2.285000	0.76669	0.533000	0.62120	GAA	.		0.418	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
MANF	7873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	51426503	51426503	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:51426503G>A	ENST00000528157.1	+	4	828	c.532G>A	c.(532-534)Gca>Aca	p.A178T	RBM15B_ENST00000323686.4_5'Flank|MANF_ENST00000470900.1_3'UTR	NM_006010.4	NP_006001.3	P55145	MANF_HUMAN	mesencephalic astrocyte-derived neurotrophic factor	178					response to unfolded protein (GO:0006986)|vasoconstriction of artery involved in ischemic response to lowering of systemic arterial blood pressure (GO:0002014)	extracellular space (GO:0005615)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			lung(1)|ovary(1)	2						GGCAGCCAGTGCACGGACCGA	0.458											OREG0015594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A178T		.											.	.	.	0			c.G532A						.						29.0	30.0	30.0					3																	51426503		1909	4126	6035	SO:0001583	missense	7873	exon4			GCCAGTGCACGGA	M83751	CCDS46836.1, CCDS46836.2	3p21.1	2010-12-09	2009-06-04	2009-06-04	ENSG00000145050	ENSG00000145050			15461	protein-coding gene	gene with protein product		601916	"""arginine-rich, mutated in early stage tumors"""	ARMET		12794311	Standard	NM_006010		Approved	ARP	uc003dbc.3	P55145	OTTHUMG00000156897	ENST00000528157.1:c.532G>A	3.37:g.51426503G>A	ENSP00000432799:p.Ala178Thr	94.0	0.0	977	100.0	41.0	NM_006010	Q14CX4|Q86U67|Q96IS4	Missense_Mutation	SNP	ENST00000528157.1	37	CCDS46836.2	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290296	0.59976	.	.	ENSG00000145050	ENST00000528157;ENST00000273628	.	.	.	5.7	4.69	0.59074	.	0.116838	0.56097	D	0.000033	T	0.62319	0.2418	M	0.62723	1.935	0.51482	D	0.999929	B	0.16166	0.016	B	0.28011	0.085	T	0.60505	-0.7250	9	0.49607	T	0.09	.	13.8252	0.63346	0.0:0.0:0.6339:0.3661	.	178	P55145	MANF_HUMAN	T	178;181	.	ENSP00000273628:A181T	A	+	1	0	MANF	51401543	1.000000	0.71417	0.947000	0.38551	0.992000	0.81027	3.461000	0.53035	1.220000	0.43490	0.655000	0.94253	GCA	.		0.458	MANF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346490.3	NM_006010	
MAP10	54627	hgsc.bcm.edu;broad.mit.edu	37	1	232941381	232941381	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:232941381G>A	ENST00000418460.1	+	1	739	c.612G>A	c.(610-612)ctG>ctA	p.L204L		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	62					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										TCCGCCTGCTGGACTTCCCCA	0.716																																					p.L204L		.											.	.	.	0			c.G612A						.						5.0	7.0	6.0					1																	232941381		1949	4080	6029	SO:0001819	synonymous_variant	54627	exon1			CCTGCTGGACTTC	AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.612G>A	1.37:g.232941381G>A		31.0	0.0		50.0	4.0	NM_019090	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Silent	SNP	ENST00000418460.1	37	CCDS44334.1																																																																																			.		0.716	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092317.3	NM_019090	
MBIP	51562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	36785921	36785921	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:36785921T>G	ENST00000416007.4	-	2	314	c.227A>C	c.(226-228)gAa>gCa	p.E76A	MBIP_ENST00000359527.7_Missense_Mutation_p.E76A|MBIP_ENST00000318473.7_Missense_Mutation_p.E76A|MBIP_ENST00000603913.1_5'Flank	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	76					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		AATGTGTTGTTCAAGTGCACT	0.368																																					p.E76A		.											.	MBIP	658	0			c.A227C						.						68.0	68.0	68.0					14																	36785921		2203	4300	6503	SO:0001583	missense	51562	exon2			TGTTGTTCAAGTG	BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.227A>C	14.37:g.36785921T>G	ENSP00000399718:p.Glu76Ala	217.0	0.0		230.0	63.0	NM_016586	Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Missense_Mutation	SNP	ENST00000416007.4	37	CCDS9658.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.51|18.51	3.639703|3.639703	0.67244|0.67244	.|.	.|.	ENSG00000151332|ENSG00000151332	ENST00000416007;ENST00000318473;ENST00000359527;ENST00000396329;ENST00000553549;ENST00000556427|ENST00000553977	T;T;T|.	0.43688|.	0.94;0.94;0.94|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.050616|.	0.85682|.	D|.	0.000000|.	T|.	0.51736|.	0.1692|.	L|L	0.43152|0.43152	1.355|1.355	0.33315|0.33315	D|D	0.566546|0.566546	P;P;P|.	0.52316|.	0.873;0.952;0.873|.	B;B;B|.	0.43413|.	0.225;0.419;0.225|.	T|.	0.62263|.	-0.6891|.	10|.	0.66056|.	D|.	0.02|.	-15.4773|-15.4773	10.5384|10.5384	0.45018|0.45018	0.1443:0.0:0.0:0.8557|0.1443:0.0:0.0:0.8557	.|.	76;76;76|.	Q9NS73-5;Q9NS73-3;Q9NS73|.	.;.;MBIP1_HUMAN|.	A|C	76;76;76;76;55;34|72	ENSP00000399718:E76A;ENSP00000324444:E76A;ENSP00000352517:E76A|.	ENSP00000324444:E76A|.	E|X	-|-	2|3	0|0	MBIP|MBIP	35855672|35855672	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.983000|0.983000	0.72400|0.72400	5.740000|5.740000	0.68629|0.68629	2.092000|2.092000	0.63282|0.63282	0.477000|0.477000	0.44152|0.44152	GAA|TGA	.		0.368	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276685.2	NM_016586	
MEOX2	4223	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	15725601	15725601	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:15725601C>T	ENST00000262041.5	-	1	836	c.427G>A	c.(427-429)Gcg>Acg	p.A143T	AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	143					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		GGCGCGCACGCGGCCCCAGTC	0.706																																					p.A143T	Esophageal Squamous(140;197 1769 16409 18257 29929)	.											MEOX2,NS,carcinoma,+2	MEOX2	515	0			c.G427A						.						25.0	30.0	28.0					7																	15725601		2188	4266	6454	SO:0001583	missense	4223	exon1			CGCACGCGGCCCC		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.427G>A	7.37:g.15725601C>T	ENSP00000262041:p.Ala143Thr	48.0	0.0		82.0	35.0	NM_005924	B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	ENST00000262041.5	37	CCDS34605.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389997	0.25118	.	.	ENSG00000106511	ENST00000262041	D	0.90133	-2.62	5.43	1.28	0.21552	.	0.062950	0.64402	D	0.000005	T	0.77791	0.4183	N	0.19112	0.55	0.42799	D	0.993923	B	0.21147	0.052	B	0.08055	0.003	T	0.62067	-0.6932	10	0.14252	T	0.57	-4.8243	5.6014	0.17355	0.2734:0.572:0.0:0.1547	.	143	P50222	MEOX2_HUMAN	T	143	ENSP00000262041:A143T	ENSP00000262041:A143T	A	-	1	0	MEOX2	15692126	0.679000	0.27596	0.994000	0.49952	0.975000	0.68041	0.966000	0.29331	0.237000	0.21200	-0.824000	0.03097	GCG	.		0.706	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
METTL7A	25840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	51323788	51323788	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:51323788delT	ENST00000548553.1	+	3	1571	c.590delT	c.(589-591)cttfs	p.L198fs	METTL7A_ENST00000332160.4_Frame_Shift_Del_p.L198fs			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	198						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						GCCTGGCACCTTCTGTTTGAT	0.557																																					p.L197fs		.											.	METTL7A	90	0			c.590delT						.						124.0	121.0	122.0					12																	51323788		2203	4300	6503	SO:0001589	frameshift_variant	25840	exon2			GGCACCTTCTGTT		CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.590delT	12.37:g.51323788delT	ENSP00000448785:p.Leu198fs	132.0	0.0		104.0	24.0	NM_014033	Q9H7R3|Q9UHZ7|Q9Y422	Frame_Shift_Del	DEL	ENST00000548553.1	37	CCDS8804.1																																																																																			.		0.557	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	NM_014033	
METTL7A	25840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51323795	51323795	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:51323795T>C	ENST00000548553.1	+	3	1578	c.597T>C	c.(595-597)ttT>ttC	p.F199F	METTL7A_ENST00000332160.4_Silent_p.F199F			Q9H8H3	MET7A_HUMAN	methyltransferase like 7A	199						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	10						ACCTTCTGTTTGATGGGTGCA	0.562																																					p.F199F		.											.	METTL7A	90	0			c.T597C						.						120.0	116.0	118.0					12																	51323795		2203	4300	6503	SO:0001819	synonymous_variant	25840	exon2			TCTGTTTGATGGG		CCDS8804.1	12q13.12	2013-06-20			ENSG00000185432	ENSG00000185432			24550	protein-coding gene	gene with protein product						12975309	Standard	XM_006719332		Approved	DKFZP586A0522	uc001rxb.3	Q9H8H3	OTTHUMG00000169484	ENST00000548553.1:c.597T>C	12.37:g.51323795T>C		112.0	0.0		97.0	26.0	NM_014033	Q9H7R3|Q9UHZ7|Q9Y422	Silent	SNP	ENST00000548553.1	37	CCDS8804.1																																																																																			.		0.562	METTL7A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404294.2	NM_014033	
MON2	23041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	62929480	62929480	+	Missense_Mutation	SNP	T	T	C	rs201313378		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:62929480T>C	ENST00000393632.2	+	14	2282	c.1891T>C	c.(1891-1893)Tcc>Ccc	p.S631P	MON2_ENST00000393629.2_Missense_Mutation_p.S631P|MON2_ENST00000280379.6_Missense_Mutation_p.S631P|MON2_ENST00000552115.1_Missense_Mutation_p.S631P|MON2_ENST00000393630.3_Missense_Mutation_p.S631P|MON2_ENST00000546600.1_Missense_Mutation_p.S631P|MON2_ENST00000552738.1_Intron	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	631					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AGCTACACTTTCCAACAAATG	0.388																																					p.S631P		.											.	MON2	514	0			c.T1891C						.						102.0	98.0	99.0					12																	62929480		2203	4300	6503	SO:0001583	missense	23041	exon14			ACACTTTCCAACA		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.1891T>C	12.37:g.62929480T>C	ENSP00000377252:p.Ser631Pro	206.0	0.0		180.0	61.0	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	T	11.36	1.615635	0.28801	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000393629;ENST00000552115	T;T;T;T;T;T	0.57907	0.38;0.37;0.38;0.38;0.38;0.39	5.35	4.17	0.49024	.	0.059325	0.64402	D	0.000001	T	0.33556	0.0867	N	0.11427	0.14	0.43662	D	0.996082	P;P;P	0.40250	0.586;0.709;0.709	B;B;B	0.39971	0.167;0.315;0.221	T	0.07424	-1.0773	9	.	.	.	-3.4905	12.5485	0.56214	0.0:0.0:0.1393:0.8607	.	631;631;631	B9EGP5;F8W1Z6;Q7Z3U7-4	.;.;.	P	631;631;631;631;559;631;631	ENSP00000377252:S631P;ENSP00000377250:S631P;ENSP00000280379:S631P;ENSP00000447407:S631P;ENSP00000377249:S631P;ENSP00000446635:S631P	.	S	+	1	0	MON2	61215747	1.000000	0.71417	0.994000	0.49952	0.353000	0.29299	2.615000	0.46368	0.928000	0.37168	0.533000	0.62120	TCC	T|0.999;G|0.001		0.388	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
MPP4	58538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202549803	202549803	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:202549803C>T	ENST00000409474.3	-	7	765	c.558G>A	c.(556-558)ggG>ggA	p.G186G	MPP4_ENST00000428900.2_Silent_p.G186G|MPP4_ENST00000315506.7_Silent_p.G186G|MPP4_ENST00000409143.1_Silent_p.G159G|MPP4_ENST00000396886.3_Silent_p.G142G|MPP4_ENST00000447335.2_Silent_p.G186G|MPP4_ENST00000359962.5_Silent_p.G186G	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	186	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						TCTCCGCCAGCCCACCGTGGA	0.517																																					p.G186G		.											.	MPP4	22	0			c.G558A						.						43.0	42.0	42.0					2																	202549803		1995	4190	6185	SO:0001819	synonymous_variant	58538	exon7			CGCCAGCCCACCG	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.558G>A	2.37:g.202549803C>T		95.0	0.0		121.0	35.0	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Silent	SNP	ENST00000409474.3	37	CCDS46491.1																																																																																			.		0.517	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
MYOCD	93649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12642602	12642602	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:12642602T>G	ENST00000343344.4	+	7	674	c.674T>G	c.(673-675)cTt>cGt	p.L225R	AC005358.1_ENST00000609971.1_Missense_Mutation_p.L129R|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.L225R			Q8IZQ8	MYCD_HUMAN	myocardin	225					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AAGCAGGGGCTTGGCCCCCCC	0.577																																					p.L225R		.											.	MYOCD	93	0			c.T674G						.						56.0	52.0	53.0					17																	12642602		2203	4300	6503	SO:0001583	missense	93649	exon7			AGGGGCTTGGCCC	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.674T>G	17.37:g.12642602T>G	ENSP00000341835:p.Leu225Arg	57.0	0.0		55.0	25.0	NM_001146312	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	T	8.148	0.786697	0.16189	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.46819	0.86	4.19	1.78	0.24846	.	0.549847	0.17527	N	0.171014	T	0.28167	0.0695	L	0.31926	0.97	0.09310	N	1	B;B;B	0.14012	0.004;0.009;0.007	B;B;B	0.12156	0.004;0.007;0.002	T	0.11470	-1.0586	10	0.15952	T	0.53	-13.1294	3.2337	0.06757	0.2748:0.1115:0.0:0.6137	.	129;225;225	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	R	225;225;129	ENSP00000341835:L225R	ENSP00000341835:L225R	L	+	2	0	MYOCD	12583327	0.002000	0.14202	0.039000	0.18376	0.463000	0.32649	0.417000	0.21214	0.766000	0.33244	0.482000	0.46254	CTT	.		0.577	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
MTMR4	9110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56584192	56584192	+	Silent	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:56584192T>G	ENST00000323456.5	-	10	1027	c.903A>C	c.(901-903)gcA>gcC	p.A301A	MTMR4_ENST00000579925.1_Silent_p.A301A	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	301	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTTGAGGAGCTGCTGTGCTCT	0.572																																					p.A301A		.											.	MTMR4	91	0			c.A903C						.						58.0	54.0	56.0					17																	56584192		2203	4300	6503	SO:0001819	synonymous_variant	9110	exon10			AGGAGCTGCTGTG	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.903A>C	17.37:g.56584192T>G		80.0	0.0		114.0	18.0	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Silent	SNP	ENST00000323456.5	37	CCDS11608.1																																																																																			.		0.572	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
N4BP1	9683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48596057	48596057	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:48596057G>A	ENST00000262384.3	-	2	733	c.497C>T	c.(496-498)gCc>gTc	p.A166V	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	166					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GTCTGCATGGGCTTCAACAAA	0.363																																					p.A166V		.											.	N4BP1	22	0			c.C497T						.						107.0	98.0	101.0					16																	48596057		1852	4094	5946	SO:0001583	missense	9683	exon2			GCATGGGCTTCAA	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.497C>T	16.37:g.48596057G>A	ENSP00000262384:p.Ala166Val	147.0	0.0		178.0	58.0	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010246	0.54361	.	.	ENSG00000102921	ENST00000262384	T	0.47177	0.85	5.31	5.31	0.75309	.	0.335103	0.34959	N	0.003555	T	0.39860	0.1094	L	0.47716	1.5	0.37372	D	0.911662	P	0.39665	0.682	B	0.35550	0.205	T	0.43572	-0.9383	10	0.30078	T	0.28	-10.5521	14.2163	0.65795	0.0:0.0:0.8506:0.1494	.	166	O75113	N4BP1_HUMAN	V	166	ENSP00000262384:A166V	ENSP00000262384:A166V	A	-	2	0	N4BP1	47153558	1.000000	0.71417	0.955000	0.39395	0.996000	0.88848	4.177000	0.58276	2.632000	0.89209	0.655000	0.94253	GCC	.		0.363	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29496954	29496954	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:29496954T>C	ENST00000358273.4	+	5	908	c.525T>C	c.(523-525)caT>caC	p.H175H	NF1_ENST00000431387.4_Silent_p.H175H|NF1_ENST00000356175.3_Silent_p.H175H	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	175					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTGATGTTCATGATATAGAAT	0.289			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.H175H		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	3353	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)	c.T525C						.						92.0	93.0	92.0					17																	29496954		2203	4299	6502	SO:0001819	synonymous_variant	4763	exon5	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TGTTCATGATATA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.525T>C	17.37:g.29496954T>C		64.0	0.0		84.0	28.0	NM_001128147	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.289	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
NLRP11	204801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56320455	56320455	+	Silent	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:56320455A>C	ENST00000589093.1	-	3	1614	c.1521T>G	c.(1519-1521)ctT>ctG	p.L507L	NLRP11_ENST00000592953.1_Silent_p.L408L|NLRP11_ENST00000589824.2_Silent_p.L507L|NLRP11_ENST00000443188.1_Silent_p.L507L|NLRP11_ENST00000360133.3_Silent_p.L507L			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	507							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		AGGATGTCTCAAGAATCTTTC	0.418																																					p.L507L		.											.	NLRP11	169	0			c.T1521G						.						118.0	117.0	118.0					19																	56320455		2203	4300	6503	SO:0001819	synonymous_variant	204801	exon5			TGTCTCAAGAATC	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1521T>G	19.37:g.56320455A>C		189.0	0.0		177.0	58.0	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	ENST00000589093.1	37	CCDS12935.1																																																																																			.		0.418	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
NOP2	4839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6673088	6673088	+	Missense_Mutation	SNP	G	G	A	rs555886597		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:6673088G>A	ENST00000322166.5	-	6	620	c.499C>T	c.(499-501)Cgg>Tgg	p.R167W	NOP2_ENST00000541778.1_Missense_Mutation_p.R163W|NOP2_ENST00000545200.1_Missense_Mutation_p.R163W|NOP2_ENST00000537442.1_Missense_Mutation_p.R167W|NOP2_ENST00000382421.3_Missense_Mutation_p.R200W|NOP2_ENST00000399466.2_Missense_Mutation_p.R163W|NOP2_ENST00000542015.1_Intron	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	167					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						TTCTGCTTCCGAGCAGCTCTT	0.527											OREG0021630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0014	5008	,	,		17442	0.0		0.0	False		,,,				2504	0.0				p.R200W		.											.	NOP2	92	0			c.C598T						.						40.0	40.0	40.0					12																	6673088		1860	4107	5967	SO:0001583	missense	4839	exon7			GCTTCCGAGCAGC		CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.499C>T	12.37:g.6673088G>A	ENSP00000313272:p.Arg167Trp	81.0	0.0	635	82.0	28.0	NM_001258309	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	ENST00000322166.5	37	CCDS58203.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447397	0.84101	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944;ENST00000542867;ENST00000536124	T;T;T;T;T;T;T;T;T	0.51071	2.43;2.33;2.45;2.43;2.43;2.43;0.86;0.8;0.72	5.83	5.83	0.93111	.	0.635618	0.16694	N	0.203439	T	0.58278	0.2111	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.998;0.994	P;P	0.56474	0.549;0.799	T	0.55366	-0.8152	10	0.51188	T	0.08	-5.7531	16.8431	0.85973	0.0:0.0:1.0:0.0	.	200;163	Q3KQS4;P46087-2	.;.	W	167;200;163;163;167;163;43;163;167	ENSP00000444437:R167W;ENSP00000371858:R200W;ENSP00000439422:R163W;ENSP00000382392:R163W;ENSP00000313272:R167W;ENSP00000443150:R163W;ENSP00000440754:R43W;ENSP00000443035:R163W;ENSP00000442895:R167W	ENSP00000313272:R167W	R	-	1	2	NOP2	6543349	0.993000	0.37304	0.972000	0.41901	0.978000	0.69477	4.481000	0.60250	2.764000	0.94973	0.557000	0.71058	CGG	.		0.527	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402614.1	NM_006170	
NOP56	10528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2633966	2633966	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr20:2633966C>G	ENST00000329276.5	+	3	651	c.135C>G	c.(133-135)atC>atG	p.I45M	MIR1292_ENST00000408135.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD86_ENST00000391196.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	45					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TCCACAGCATCGTTCGTCTGG	0.577																																					p.I45M		.											.	NOP56	92	0			c.C135G						.						288.0	253.0	265.0					20																	2633966		2203	4300	6503	SO:0001583	missense	10528	exon3			CAGCATCGTTCGT	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.135C>G	20.37:g.2633966C>G	ENSP00000370589:p.Ile45Met	303.0	0.0		261.0	44.0	NM_006392	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434073	0.25813	.	.	ENSG00000101361	ENST00000329276;ENST00000445139	T;T	0.57907	0.37;0.94	5.59	2.39	0.29439	NOP5, N-terminal (1);	0.261492	0.47852	D	0.000213	T	0.31136	0.0787	N	0.20304	0.555	0.41476	D	0.988136	B	0.34313	0.448	B	0.37943	0.261	T	0.09207	-1.0685	10	0.07030	T	0.85	-8.1595	7.2301	0.26038	0.0:0.6963:0.1418:0.1619	.	45	O00567	NOP56_HUMAN	M	45	ENSP00000370589:I45M;ENSP00000388497:I45M	ENSP00000370589:I45M	I	+	3	3	NOP56	2581966	0.997000	0.39634	1.000000	0.80357	0.974000	0.67602	0.318000	0.19504	1.375000	0.46248	0.555000	0.69702	ATC	.		0.577	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
NOXRED1	122945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77873885	77873885	+	Silent	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:77873885A>G	ENST00000380835.2	-	3	619	c.453T>C	c.(451-453)aaT>aaC	p.N151N	NOXRED1_ENST00000298358.3_Silent_p.N151N	NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	151					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						CTACGCAGATATTAGGCAGCT	0.488																																					p.N151N		.											.	.	.	0			c.T453C						.						134.0	121.0	125.0					14																	77873885		2203	4300	6503	SO:0001819	synonymous_variant	122945	exon3			GCAGATATTAGGC	AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.453T>C	14.37:g.77873885A>G		156.0	0.0		133.0	47.0	NM_001113475	B3KQ47|O95435	Silent	SNP	ENST00000380835.2	37	CCDS45142.1																																																																																			.		0.488	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414103.1	NM_138791	
NPC1L1	29881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44579886	44579886	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:44579886T>C	ENST00000289547.4	-	2	165	c.110A>G	c.(109-111)gAc>gGc	p.D37G	NPC1L1_ENST00000546276.1_Missense_Mutation_p.D37G|NPC1L1_ENST00000381160.3_Missense_Mutation_p.D37G|NPC1L1_ENST00000423141.1_Missense_Mutation_p.D37G	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	37					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCCACATTCGTCATAGAAGGC	0.592																																					p.D37G		.											.	NPC1L1	94	0			c.A110G						.						83.0	78.0	80.0					7																	44579886		2203	4300	6503	SO:0001583	missense	29881	exon2			CATTCGTCATAGA		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.110A>G	7.37:g.44579886T>C	ENSP00000289547:p.Asp37Gly	79.0	0.0		77.0	27.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	t	0.118	-1.129137	0.01756	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.17	4.01	0.46588	.	0.467062	0.20698	N	0.087336	T	0.68769	0.3037	N	0.16656	0.425	0.36115	D	0.845046	B;P;B;B	0.40197	0.001;0.706;0.0;0.002	B;P;B;B	0.53360	0.003;0.724;0.007;0.005	T	0.66575	-0.5889	10	0.02654	T	1	-10.1182	8.9584	0.35832	0.0:0.0896:0.0:0.9104	.	37;37;37;37	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	G	37	ENSP00000289547:D37G;ENSP00000370552:D37G;ENSP00000438033:D37G;ENSP00000404670:D37G	ENSP00000289547:D37G	D	-	2	0	NPC1L1	44546411	0.960000	0.32886	0.055000	0.19348	0.465000	0.32709	2.637000	0.46553	0.810000	0.34279	0.459000	0.35465	GAC	.		0.592	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
NRD1	4898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	52289359	52289359	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:52289359A>G	ENST00000354831.7	-	9	1529	c.1340T>C	c.(1339-1341)aTg>aCg	p.M447T	NRD1_ENST00000544028.1_Missense_Mutation_p.M247T|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Missense_Mutation_p.M379T|NRD1_ENST00000539524.1_Missense_Mutation_p.M315T	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	378					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CACTAAAGTCATGTAATGAGA	0.378																																					p.M447T		.											.	NRD1	90	0			c.T1340C						.						100.0	99.0	100.0					1																	52289359		2203	4300	6503	SO:0001583	missense	4898	exon9			AAAGTCATGTAAT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.1340T>C	1.37:g.52289359A>G	ENSP00000346890:p.Met447Thr	202.0	0.0		185.0	72.0	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	37	CCDS559.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.262266	0.80358	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.53	5.53	0.82687	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.51024	0.1650	H	0.95574	3.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.67074	-0.5762	10	0.87932	D	0	-11.9475	15.6605	0.77182	1.0:0.0:0.0:0.0	.	379;378;447	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	T	379;447;315;379;247	ENSP00000262679:M379T;ENSP00000346890:M447T;ENSP00000444416:M315T;ENSP00000442262:M247T	ENSP00000262679:M379T	M	-	2	0	NRD1	52061947	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.845000	0.92153	2.112000	0.64535	0.533000	0.62120	ATG	.		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228469861	228469861	+	Missense_Mutation	SNP	T	T	C	rs189169421	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:228469861T>C	ENST00000422127.1	+	31	8469	c.8425T>C	c.(8425-8427)Ttc>Ctc	p.F2809L	OBSCN_ENST00000284548.11_Missense_Mutation_p.F2809L|OBSCN_ENST00000570156.2_Missense_Mutation_p.F3238L|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Missense_Mutation_p.F1656L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2809	Ig-like 27.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.F3092V(1)|p.F2863V(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGAGGTGGTCTTCTCTGTGCG	0.652																																					p.F3238L		.											OBSCN_ENST00000359599,NS,carcinoma,0	OBSCN	403	2	Substitution - Missense(2)	stomach(2)	c.T9712C						.						32.0	38.0	36.0					1																	228469861		1988	4152	6140	SO:0001583	missense	84033	exon36			GTGGTCTTCTCTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.8425T>C	1.37:g.228469861T>C	ENSP00000409493:p.Phe2809Leu	254.0	0.0		303.0	172.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.225054	0.79576	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T	0.38560	1.13;1.13;1.13	4.21	4.21	0.49690	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.58538	0.2129	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	0.991;1.0;0.998	P;D;D	0.87578	0.904;0.997;0.998	T	0.57412	-0.7816	10	0.36615	T	0.2	.	13.6084	0.62061	0.0:0.0:0.0:1.0	.	2809;2809;2809	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	L	2809;2809;1656;508;215	ENSP00000284548:F2809L;ENSP00000409493:F2809L;ENSP00000352613:F1656L	ENSP00000284548:F2809L	F	+	1	0	OBSCN	226536484	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	7.599000	0.82757	1.679000	0.50963	0.379000	0.24179	TTC	T|0.999;G|0.001		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR4Q3	441669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20215878	20215878	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:20215878T>C	ENST00000331723.1	+	1	292	c.292T>C	c.(292-294)Tgc>Cgc	p.C98R		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTTTCAGGATGCCTGGCCCA	0.473																																					p.C98R		.											.	OR4Q3	71	0			c.T292C						.						60.0	61.0	61.0					14																	20215878		2203	4297	6500	SO:0001583	missense	441669	exon1			TCAGGATGCCTGG	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.292T>C	14.37:g.20215878T>C	ENSP00000330049:p.Cys98Arg	65.0	0.0		92.0	38.0	NM_172194	Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	14.45	2.538683	0.45176	.	.	ENSG00000182652	ENST00000331723	T	0.00545	6.67	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	U	0.000514	T	0.04363	0.0120	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00409	-1.1757	10	0.87932	D	0	.	11.7648	0.51924	0.0:0.0:0.0:1.0	.	98	Q8NH05	OR4Q3_HUMAN	R	98	ENSP00000330049:C98R	ENSP00000330049:C98R	C	+	1	0	OR4Q3	19285718	1.000000	0.71417	0.998000	0.56505	0.270000	0.26580	7.648000	0.83479	1.880000	0.54463	0.416000	0.27883	TGC	.		0.473	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2		
PACS2	23241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105818768	105818768	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:105818768A>C	ENST00000325438.8	+	3	765	c.261A>C	c.(259-261)caA>caC	p.Q87H	PACS2_ENST00000458164.2_Missense_Mutation_p.Q87H|PACS2_ENST00000447393.1_Missense_Mutation_p.Q87H|PACS2_ENST00000547217.1_Intron|PACS2_ENST00000430725.2_Missense_Mutation_p.Q20H			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	87					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CCAGTGGACAAGTGGAGACAG	0.577											OREG0022968	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q87H		.											.	PACS2	69	0			c.A261C						.						231.0	193.0	206.0					14																	105818768		2203	4300	6503	SO:0001583	missense	23241	exon3			TGGACAAGTGGAG	AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.261A>C	14.37:g.105818768A>C	ENSP00000321834:p.Gln87His	212.0	0.0	1392	205.0	72.0	NM_001100913	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	ENST00000325438.8	37	CCDS32168.1	.	.	.	.	.	.	.	.	.	.	A	8.958	0.969769	0.18659	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000546915	T;T;T;T	0.23348	1.93;1.91;1.91;1.91	4.71	0.966	0.19667	.	0.628217	0.15523	U	0.257917	T	0.08133	0.0203	N	0.02011	-0.69	0.35626	D	0.809808	B;B;B;B	0.13145	0.007;0.003;0.005;0.001	B;B;B;B	0.15052	0.009;0.012;0.006;0.002	T	0.21415	-1.0246	10	0.26408	T	0.33	-8.2172	5.0815	0.14659	0.545:0.2895:0.1654:0.0	.	87;87;87;96	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	H	20;87;87;87;20	ENSP00000393524:Q20H;ENSP00000321834:Q87H;ENSP00000399732:Q87H;ENSP00000393559:Q87H	ENSP00000321834:Q87H	Q	+	3	2	PACS2	104889813	0.000000	0.05858	0.999000	0.59377	0.981000	0.71138	-1.989000	0.01480	0.010000	0.14839	-0.379000	0.06801	CAA	.		0.577	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000409209.1	XM_377355	
PAIP2	51247	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	138704424	138704429	+	In_Frame_Del	DEL	CAAGAG	CAAGAG	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	CAAGAG	CAAGAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:138704424_138704429delCAAGAG	ENST00000394795.2	+	4	1312_1317	c.321_326delCAAGAG	c.(319-327)gtcaagagc>gtc	p.KS108del	PAIP2_ENST00000511381.1_3'UTR|PAIP2_ENST00000510080.1_In_Frame_Del_p.KS108del|CTB-43P18.1_ENST00000503553.3_RNA|SLC23A1_ENST00000353963.3_Intron|PAIP2_ENST00000265192.4_In_Frame_Del_p.KS108del|PAIP2_ENST00000511706.1_In_Frame_Del_p.KS48del|SLC23A1_ENST00000348729.3_Intron			Q9BPZ3	PAIP2_HUMAN	poly(A) binding protein interacting protein 2	108	PABPC1-interacting motif-2 (PAM2).				memory (GO:0007613)|negative regulation of translational initiation (GO:0045947)|regulation of long-term synaptic potentiation (GO:1900271)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mRNA binding (GO:0003729)|translation repressor activity (GO:0030371)			kidney(1)|large_intestine(2)|lung(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTTTCCAGGTCAAGAGCAATCTGAAT	0.374																																					p.107_109del		.											.	PAIP2	68	0			c.321_326del						.																																			SO:0001651	inframe_deletion	51247	exon4			CCAGGTCAAGAGC	AF151052	CCDS4211.1	5q32	2008-02-05			ENSG00000120727	ENSG00000120727			17970	protein-coding gene	gene with protein product		605604				11172725, 16804161	Standard	NM_016480		Approved	PAIP2A	uc003led.3	Q9BPZ3	OTTHUMG00000129227	ENST00000394795.2:c.321_326delCAAGAG	5.37:g.138704424_138704429delCAAGAG	ENSP00000378275:p.Lys108_Ser109del	165.0	0.0		132.0	25.0	NM_001033112	B2RBI1|D3DQC6|Q49A06|Q9H0Y5|Q9P0Q8	In_Frame_Del	DEL	ENST00000394795.2	37	CCDS4211.1																																																																																			.		0.374	PAIP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373002.1	NM_016480	
PC	5091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66618658	66618658	+	Silent	SNP	C	C	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:66618658C>G	ENST00000393958.2	-	16	2169	c.2076G>C	c.(2074-2076)gcG>gcC	p.A692A	PC_ENST00000393960.1_Silent_p.A692A|PC_ENST00000393955.2_Silent_p.A692A|PC_ENST00000528224.1_5'Flank|PC_ENST00000529047.1_5'Flank	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	692	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CACTTCCTGCCGCCTCCATGC	0.587																																					p.A692A		.											.	PC	228	0			c.G2076C						.						75.0	71.0	73.0					11																	66618658		2200	4295	6495	SO:0001819	synonymous_variant	5091	exon16			TCCTGCCGCCTCC	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.2076G>C	11.37:g.66618658C>G		48.0	0.0		66.0	28.0	NM_000920	B4DN00|Q16705	Silent	SNP	ENST00000393958.2	37	CCDS8152.1																																																																																			.		0.587	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PDE1C	5137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	31793110	31793110	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:31793110G>T	ENST00000396191.1	-	18	2473	c.2018C>A	c.(2017-2019)gCa>gAa	p.A673E	PDE1C_ENST00000321453.7_Missense_Mutation_p.A673E|PDE1C_ENST00000396193.1_Missense_Mutation_p.A733E	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	673					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GACTGAAGGTGCATAGGAGCT	0.463																																					p.A733E		.											.	PDE1C	94	0			c.C2198A						.						199.0	194.0	195.0					7																	31793110		876	1991	2867	SO:0001583	missense	5137	exon19			GAAGGTGCATAGG	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.2018C>A	7.37:g.31793110G>T	ENSP00000379494:p.Ala673Glu	149.0	0.0		179.0	70.0	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	37	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038316	0.54896	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453	T;T;T	0.73363	-0.74;-0.73;-0.73	5.36	5.36	0.76844	.	0.555039	0.19528	N	0.112115	T	0.66761	0.2822	N	0.24115	0.695	0.80722	D	1	D;D	0.55385	0.971;0.971	P;P	0.49012	0.598;0.497	T	0.67496	-0.5656	10	0.52906	T	0.07	.	9.9121	0.41413	0.0897:0.0:0.9103:0.0	.	733;673	E9PE92;Q14123	.;PDE1C_HUMAN	E	733;673;673	ENSP00000379496:A733E;ENSP00000379494:A673E;ENSP00000318105:A673E	ENSP00000318105:A673E	A	-	2	0	PDE1C	31759635	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.669000	0.46825	2.789000	0.95967	0.591000	0.81541	GCA	.		0.463	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
PDE4A	5141	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	10531543	10531543	+	Silent	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:10531543C>A	ENST00000352831.6	+	1	213	c.103C>A	c.(103-105)Cgg>Agg	p.R35R	PDE4A_ENST00000380702.2_Intron|PDE4A_ENST00000592685.1_Intron	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	35					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	GCACCTGTGGCGGCAGCCTCG	0.746																																					p.R35R		.											.	PDE4A	523	0			c.C103A						.						6.0	7.0	7.0					19																	10531543		1211	3022	4233	SO:0001819	synonymous_variant	5141	exon1			CTGTGGCGGCAGC		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.103C>A	19.37:g.10531543C>A		24.0	0.0		20.0	12.0	NM_001111307	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Silent	SNP	ENST00000352831.6	37	CCDS45961.1																																																																																			.		0.746	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
PDE4DIP	9659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	144921895	144921895	+	Silent	SNP	A	A	G	rs587609805		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:144921895A>G	ENST00000369354.3	-	9	1323	c.1134T>C	c.(1132-1134)ttT>ttC	p.F378F	PDE4DIP_ENST00000369351.3_Silent_p.F378F|PDE4DIP_ENST00000529945.1_Silent_p.F541F|PDE4DIP_ENST00000313382.9_Silent_p.F444F|PDE4DIP_ENST00000369349.3_Silent_p.F378F|PDE4DIP_ENST00000479408.2_Silent_p.F165F|PDE4DIP_ENST00000369356.4_Silent_p.F378F|PDE4DIP_ENST00000313431.9_Silent_p.F541F|PDE4DIP_ENST00000369359.4_Silent_p.F515F|PDE4DIP_ENST00000530740.1_Silent_p.F515F			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	378					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAGCCTCTACAAATTGCACAC	0.438			T	PDGFRB	MPD																																p.F541F		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	663	0			c.T1623C						.						419.0	438.0	431.0					1																	144921895		2203	4296	6499	SO:0001819	synonymous_variant	9659	exon5			CTCTACAAATTGC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1134T>C	1.37:g.144921895A>G		358.0	0.0		418.0	55.0	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1																																																																																			.		0.438	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PDHX	8050	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	35006206	35006206	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:35006206A>C	ENST00000227868.4	+	9	1197	c.1113A>C	c.(1111-1113)aaA>aaC	p.K371N	PDHX_ENST00000477173.3_3'UTR|PDHX_ENST00000430469.2_Missense_Mutation_p.K144N|PDHX_ENST00000448838.3_Missense_Mutation_p.K356N			O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	371					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	16	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			CAACAGATAAAGGCTTACTTA	0.403																																					p.K371N		.											.	PDHX	226	0			c.A1113C						.						102.0	99.0	100.0					11																	35006206		2202	4298	6500	SO:0001583	missense	8050	exon9			AGATAAAGGCTTA	U82328	CCDS7896.1, CCDS44569.1, CCDS53616.1	11p13	2008-02-05			ENSG00000110435	ENSG00000110435			21350	protein-coding gene	gene with protein product		608769				9467010, 12372595	Standard	NM_003477		Approved	E3BP, proX, PDX1, OPDX, DLDBP	uc001mvt.3	O00330	OTTHUMG00000166491	ENST00000227868.4:c.1113A>C	11.37:g.35006206A>C	ENSP00000227868:p.Lys371Asn	140.0	0.0		131.0	28.0	NM_003477	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	ENST00000227868.4	37	CCDS7896.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.118|4.118	0.020021|0.020021	0.08006|0.08006	.|.	.|.	ENSG00000110435|ENSG00000110435	ENST00000448838;ENST00000227868;ENST00000430469|ENST00000526309	T;T;T|T	0.40756|0.43294	1.02;1.02;1.02|0.95	5.55|5.55	4.43|4.43	0.53597|0.53597	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);|.	0.469168|0.469168	0.24357|0.24357	N|N	0.039228|0.039228	T|T	0.28034|0.28034	0.0691|0.0691	N|N	0.20304|0.20304	0.555|0.555	0.43740|0.43740	D|D	0.996232|0.996232	P;B;B|.	0.35493|.	0.505;0.031;0.072|.	B;B;B|.	0.38296|.	0.27;0.11;0.043|.	T|T	0.06516|0.06516	-1.0822|-1.0822	10|8	0.25106|0.19590	T|T	0.35|0.45	-5.5828|-5.5828	6.172|6.172	0.20422|0.20422	0.7824:0.0:0.0758:0.1418|0.7824:0.0:0.0758:0.1418	.|.	144;356;371|.	E9PBP7;E9PB14;O00330|.	.;.;ODPX_HUMAN|.	N|T	356;371;144|59	ENSP00000389404:K356N;ENSP00000227868:K371N;ENSP00000415695:K144N|ENSP00000433204:K59T	ENSP00000227868:K371N|ENSP00000433204:K59T	K|K	+|+	3|2	2|0	PDHX|PDHX	34962782|34962782	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.546000|0.546000	0.35178|0.35178	2.450000|2.450000	0.44943|0.44943	0.932000|0.932000	0.37266|0.37266	-0.376000|-0.376000	0.06991|0.06991	AAA|AAG	.		0.403	PDHX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390017.1	NM_003477	
PDK2	5164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48174927	48174927	+	Splice_Site	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:48174927T>C	ENST00000503176.1	+	2	420	c.259T>C	c.(259-261)Tgg>Cgg	p.W87R	PDK2_ENST00000007708.3_Splice_Site_p.W23R	NM_002611.4	NP_002602.2	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase, isozyme 2	87					cellular metabolic process (GO:0044237)|cellular response to nutrient (GO:0031670)|cellular response to reactive oxygen species (GO:0034614)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of gluconeogenesis (GO:0006111)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	20						GGTGCAGAGCTGGTGAGACCC	0.617									Autosomal Dominant Polycystic Kidney Disease																												p.W87R		.											.	PDK2	803	0			c.T259C						.						70.0	58.0	62.0					17																	48174927		2203	4300	6503	SO:0001630	splice_region_variant	5164	exon2	Familial Cancer Database	ADPKD	CAGAGCTGGTGAG	L42451	CCDS11559.1, CCDS56039.1	17q21.33	2012-07-18	2005-11-16		ENSG00000005882	ENSG00000005882			8810	protein-coding gene	gene with protein product		602525	"""pyruvate dehydrogenase kinase, isoenzyme 2"""			7499431	Standard	NM_001199898		Approved	PDHK2	uc002iqc.3	Q15119	OTTHUMG00000161948	ENST00000503176.1:c.260+1T>C	17.37:g.48174927T>C		42.0	0.0		62.0	16.0	NM_002611	A8K3A7|B3KNW0|Q6P515|Q9BS05	Missense_Mutation	SNP	ENST00000503176.1	37	CCDS11559.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.365910	0.82463	.	.	ENSG00000005882	ENST00000007708;ENST00000508030;ENST00000503176;ENST00000503614;ENST00000505440;ENST00000512238	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	4.07	4.07	0.47477	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.158952	0.45606	D	0.000350	T	0.63965	0.2556	H	0.96547	3.84	0.80722	D	1	P	0.45078	0.85	P	0.53006	0.715	T	0.75331	-0.3355	10	0.66056	D	0.02	-1.2336	12.4738	0.55801	0.0:0.0:0.0:1.0	.	87	Q15119	PDK2_HUMAN	R	23;23;87;23;23;23	ENSP00000007708:W23R;ENSP00000427682:W23R;ENSP00000420927:W87R;ENSP00000425265:W23R;ENSP00000425615:W23R;ENSP00000421178:W23R	ENSP00000007708:W23R	W	+	1	0	PDK2	45529926	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.661000	0.83786	1.857000	0.53885	0.519000	0.50382	TGG	.		0.617	PDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366492.2	NM_002611	Missense_Mutation
Unknown	0	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	17	62407077	62407077	+	IGR	SNP	C	C	T	rs541440037	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:62407077C>T								TEX2 (66416 upstream) : MILR1 (54491 downstream)																							CTGCTTTCCACGGCATCTACA	0.428													C|||	2	0.000399361	0.0	0.0	5008	,	,		18616	0.002		0.0	False		,,,				2504	0.0				p.V3M		.											.	.	.	0			c.G7A						.						65.0	63.0	64.0					17																	62407077		1965	4170	6135	SO:0001628	intergenic_variant	5175	exon1			TTTCCACGGCATC																													17.37:g.62407077C>T		72.0	0.0		101.0	42.0	NM_000442		Missense_Mutation	SNP		37																																																																																				.	0	0.428								
PECR	55825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	216923626	216923626	+	Silent	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:216923626T>A	ENST00000265322.7	-	4	572	c.498A>T	c.(496-498)ccA>ccT	p.P166P	PECR_ENST00000497889.1_5'UTR	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	166					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	ACACAGCTAATGGAAATCCAG	0.378																																					p.P166P		.											.	PECR	90	0			c.A498T						.						121.0	116.0	117.0					2																	216923626		2203	4300	6503	SO:0001819	synonymous_variant	55825	exon4			AGCTAATGGAAAT	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.498A>T	2.37:g.216923626T>A		202.0	0.0		192.0	66.0	NM_018441	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Silent	SNP	ENST00000265322.7	37	CCDS33375.1																																																																																			.		0.378	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
PGM3	5238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	83896734	83896734	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:83896734T>C	ENST00000283977.4	-	3	333	c.207A>G	c.(205-207)caA>caG	p.Q69Q	PGM3_ENST00000506587.1_Silent_p.Q178Q|PGM3_ENST00000512866.1_Silent_p.Q150Q|PGM3_ENST00000513973.1_Silent_p.Q150Q					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TACCATGGAATTGACCTCCTA	0.299																																					p.Q178Q		.											.	PGM3	90	0			c.A534G						.						76.0	71.0	73.0					6																	83896734		2203	4300	6503	SO:0001819	synonymous_variant	5238	exon5			ATGGAATTGACCT	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.207A>G	6.37:g.83896734T>C		216.0	0.0		246.0	74.0	NM_001199917		Silent	SNP	ENST00000283977.4	37																																																																																				.		0.299	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
PHLDA1	22822	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	76425350	76425350	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:76425350C>T	ENST00000266671.5	-	1	2362	c.172G>A	c.(172-174)Gac>Aac	p.D58N	PHLDA1_ENST00000602540.1_5'UTR|RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	58					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				CCTCTGCCGTCCTCTTGCGAG	0.711																																					p.D58N		.											.	PHLDA1	90	0			c.G172A						.						5.0	6.0	6.0					12																	76425350		1945	4058	6003	SO:0001583	missense	22822	exon1			TGCCGTCCTCTTG	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.172G>A	12.37:g.76425350C>T	ENSP00000266671:p.Asp58Asn	122.0	0.0		155.0	66.0	NM_007350	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	ENST00000266671.5	37	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.573008	0.45798	.	.	ENSG00000139289	ENST00000266671	T	0.47177	0.85	4.37	2.36	0.29203	.	.	.	.	.	T	0.30541	0.0768	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.23119	-1.0197	9	0.87932	D	0	.	4.6949	0.12799	0.0:0.6627:0.0:0.3373	.	58	Q8WV24	PHLA1_HUMAN	N	58	ENSP00000266671:D58N	ENSP00000266671:D58N	D	-	1	0	PHLDA1	74711617	0.000000	0.05858	0.918000	0.36340	0.766000	0.43426	-0.167000	0.09940	1.056000	0.40484	0.555000	0.69702	GAC	.		0.711	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
PHLDB2	90102	hgsc.bcm.edu;bcgsc.ca	37	3	111632427	111632427	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:111632427delT	ENST00000431670.2	+	3	2008	c.1597delT	c.(1597-1599)tttfs	p.F533fs	PHLDB2_ENST00000412622.1_Frame_Shift_Del_p.F533fs|PHLDB2_ENST00000495180.1_Frame_Shift_Del_p.F119fs|PHLDB2_ENST00000481953.1_Frame_Shift_Del_p.F533fs|PHLDB2_ENST00000393925.3_Frame_Shift_Del_p.F533fs|PHLDB2_ENST00000477695.1_Frame_Shift_Del_p.F533fs|PHLDB2_ENST00000393923.3_Frame_Shift_Del_p.F560fs	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	533						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TGCCAGCTTCTTTACCCCCAG	0.567																																					p.F560fs		.											.	PHLDB2	96	0			c.1678delT						.						131.0	135.0	134.0					3																	111632427		2203	4300	6503	SO:0001589	frameshift_variant	90102	exon4			AGCTTCTTTACCC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1597delT	3.37:g.111632427delT	ENSP00000405405:p.Phe533fs	115.0	0.0		150.0	51.0	NM_001134437	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Frame_Shift_Del	DEL	ENST00000431670.2	37	CCDS46886.1																																																																																			.		0.567	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PIGV	55650	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27124244	27124259	+	Frame_Shift_Del	DEL	GTTCTCCAGTCACACG	GTTCTCCAGTCACACG	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	GTTCTCCAGTCACACG	GTTCTCCAGTCACACG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:27124244_27124259delGTTCTCCAGTCACACG	ENST00000374145.1	+	4	2073_2088	c.1391_1406delGTTCTCCAGTCACACG	c.(1390-1407)tgttctccagtcacacgafs	p.CSPVTR464fs	PIGV_ENST00000078527.4_Frame_Shift_Del_p.CSPVTR464fs|PIGV_ENST00000449950.2_Frame_Shift_Del_p.CSPVTR236fs	NM_001202554.1	NP_001189483.1	Q9NUD9	PIGV_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class V	464					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	14		all_cancers(24;3.93e-26)|all_epithelial(13;3.96e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.26e-54)|Epithelial(14;2.85e-53)|OV - Ovarian serous cystadenocarcinoma(117;1.91e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000504)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.0222)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		TGGAAAACCTGTTCTCCAGTCACACGATACATTCTA	0.5																																					p.464_469del		.											.	PIGV	91	0			c.1391_1406del						.																																			SO:0001589	frameshift_variant	55650	exon4			AAACCTGTTCTCC	AK000484	CCDS287.1	1p36.11	2013-02-26	2006-06-28		ENSG00000060642	ENSG00000060642		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	26031	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 2"", ""dol-P-Man dependent GPI mannosyltransferase"""	610274	"""phosphatidylinositol glycan, class V"""			15623507	Standard	NM_017837		Approved	FLJ20477	uc001bmz.3	Q9NUD9	OTTHUMG00000004005	ENST00000374145.1:c.1391_1406delGTTCTCCAGTCACACG	1.37:g.27124244_27124259delGTTCTCCAGTCACACG	ENSP00000363260:p.Cys464fs	150.0	0.0		117.0	23.0	NM_001202554	D3DPL2|Q5JYG7|Q5JYG8|Q5JYG9|Q9NX26	Frame_Shift_Del	DEL	ENST00000374145.1	37	CCDS287.1																																																																																			.		0.500	PIGV-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011441.1	NM_017837	
PI4KB	5298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	151280253	151280253	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:151280253C>A	ENST00000368873.1	-	4	1147	c.979G>T	c.(979-981)Gaa>Taa	p.E327*	PI4KB_ENST00000271657.5_Nonsense_Mutation_p.E339*|PI4KB_ENST00000368872.1_Nonsense_Mutation_p.E312*|PI4KB_ENST00000368874.4_Nonsense_Mutation_p.E312*|PI4KB_ENST00000529142.1_5'UTR|PI4KB_ENST00000368875.2_Nonsense_Mutation_p.E339*			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	327					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTGATGAATTCTCTCTCAGGA	0.527																																					p.E339X	Colon(154;765 1838 9854 28443 37492)	.											.	PI4KB	268	0			c.G1015T						.						79.0	78.0	78.0					1																	151280253		2203	4300	6503	SO:0001587	stop_gained	5298	exon5			TGAATTCTCTCTC	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.979G>T	1.37:g.151280253C>A	ENSP00000357867:p.Glu327*	219.0	0.0		226.0	105.0	NM_002651	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Nonsense_Mutation	SNP	ENST00000368873.1	37		.	.	.	.	.	.	.	.	.	.	C	41	9.065859	0.99053	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000368872	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-12.6846	18.82	0.92092	0.0:1.0:0.0:0.0	.	.	.	.	X	312;339;339;327;312	.	ENSP00000271657:E339X	E	-	1	0	PI4KB	149546877	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.409000	0.80053	2.797000	0.96272	0.563000	0.77884	GAA	.		0.527	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
PKD1	5310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2140513	2140513	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:2140513T>C	ENST00000262304.4	-	45	12425	c.12217A>G	c.(12217-12219)Acc>Gcc	p.T4073A	RP11-304L19.1_ENST00000570072.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.T4072A|MIR1225_ENST00000408729.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4073					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GGACACAGGGTAGAGAGCCCA	0.667																																					p.T4073A		.											.	PKD1	91	0			c.A12217G						.						26.0	29.0	28.0					16																	2140513		2182	4287	6469	SO:0001583	missense	5310	exon45			ACAGGGTAGAGAG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12217A>G	16.37:g.2140513T>C	ENSP00000262304:p.Thr4073Ala	52.0	0.0		76.0	28.0	NM_001009944	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	t	7.338	0.620302	0.14193	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.70986	-0.53;-0.53	4.27	-2.42	0.06542	Polycystin cation channel, PKD1/PKD2 (1);	0.571256	0.16534	N	0.210241	T	0.29389	0.0732	N	0.01267	-0.92	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.36553	-0.9743	10	0.07482	T	0.82	.	4.277	0.10813	0.1093:0.5499:0.1216:0.2192	.	4072;4073	P98161-3;P98161	.;PKD1_HUMAN	A	4073;4072;3407	ENSP00000262304:T4073A;ENSP00000399501:T4072A	ENSP00000262304:T4073A	T	-	1	0	PKD1	2080514	0.000000	0.05858	0.051000	0.19133	0.008000	0.06430	0.060000	0.14342	-0.235000	0.09767	0.255000	0.18592	ACC	.		0.667	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PLCD1	5333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38061825	38061825	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:38061825T>A	ENST00000334661.4	-	2	275	c.53A>T	c.(52-54)gAt>gTt	p.D18V	PLCD1_ENST00000479619.1_5'Flank|PLCD1_ENST00000463876.1_Missense_Mutation_p.D39V	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	18					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CGCCTGTAGATCCTCATCATC	0.567																																					p.D39V		.											.	PLCD1	226	0			c.A116T						.						86.0	73.0	77.0					3																	38061825		2203	4300	6503	SO:0001583	missense	5333	exon2			TGTAGATCCTCAT		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.53A>T	3.37:g.38061825T>A	ENSP00000335600:p.Asp18Val	124.0	0.0		100.0	30.0	NM_001130964	B3KR14|Q86VN8	Missense_Mutation	SNP	ENST00000334661.4	37	CCDS2671.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.125712	0.56721	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	T;T	0.61742	0.08;0.08	5.09	3.89	0.44902	Pleckstrin homology-type (1);	0.136584	0.64402	D	0.000004	T	0.69548	0.3123	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.973	T	0.65940	-0.6046	10	0.14252	T	0.57	.	12.0793	0.53662	0.0:0.0:0.1441:0.8559	.	18;39	P51178;B3KR14	PLCD1_HUMAN;.	V	39;18	ENSP00000430344:D39V;ENSP00000335600:D18V	ENSP00000335600:D18V	D	-	2	0	PLCD1	38036829	1.000000	0.71417	0.733000	0.30861	0.259000	0.26198	7.929000	0.87595	0.838000	0.34948	0.379000	0.24179	GAT	.		0.567	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
PLK2	10769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	57752800	57752800	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:57752800T>C	ENST00000274289.3	-	8	1428	c.1128A>G	c.(1126-1128)aaA>aaG	p.K376K	PLK2_ENST00000502671.1_5'UTR	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	376					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TTGCTTTGTCTTTTTTGCCAC	0.328																																					p.K376K		.											.	PLK2	409	0			c.A1128G						.						70.0	73.0	72.0					5																	57752800		2203	4300	6503	SO:0001819	synonymous_variant	10769	exon8			TTTGTCTTTTTTG		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.1128A>G	5.37:g.57752800T>C		96.0	0.0		145.0	53.0	NM_006622	O60679|Q96CV7|Q9UE61	Silent	SNP	ENST00000274289.3	37	CCDS3974.1	.	.	.	.	.	.	.	.	.	.	T	9.658	1.143357	0.21205	.	.	ENSG00000145632	ENST00000442330	.	.	.	5.28	1.75	0.24633	.	0.047044	0.85682	D	0.000000	T	0.38134	0.1029	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.05468	-1.0883	6	0.13108	T	0.6	-23.5228	6.9577	0.24580	0.0:0.3579:0.0:0.6421	.	.	.	.	R	362	.	ENSP00000401861:K362R	K	-	2	0	PLK2	57788557	0.986000	0.35501	1.000000	0.80357	0.999000	0.98932	0.216000	0.17585	0.862000	0.35528	0.533000	0.62120	AAG	.		0.328	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214150.1	NM_006622	
POU2F2	5452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42599725	42599725	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:42599725C>T	ENST00000526816.2	-	10	941	c.926G>A	c.(925-927)cGc>cAc	p.R309H	POU2F2_ENST00000560558.1_Missense_Mutation_p.R254H|POU2F2_ENST00000529952.1_Missense_Mutation_p.R309H|POU2F2_ENST00000342301.4_Missense_Mutation_p.R309H|POU2F2_ENST00000529067.1_Missense_Mutation_p.R293H|POU2F2_ENST00000389341.5_Missense_Mutation_p.R293H|POU2F2_ENST00000560398.1_Missense_Mutation_p.R315H|POU2F2_ENST00000533720.1_Missense_Mutation_p.R293H			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	309					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	TAAGGCGAAGCGGACGTTTGT	0.672																																					p.R309H		.											.	POU2F2	227	0			c.G926A						.						35.0	37.0	36.0					19																	42599725		2203	4300	6503	SO:0001583	missense	5452	exon10			GCGAAGCGGACGT		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.926G>A	19.37:g.42599725C>T	ENSP00000431603:p.Arg309His	88.0	0.0		77.0	11.0	NM_001207025	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	C	33	5.254243	0.95336	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95	4.09	4.09	0.47781	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98444	0.9482	M	0.92317	3.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.993;1.0	D	0.99453	1.0941	10	0.87932	D	0	.	15.6188	0.76790	0.0:1.0:0.0:0.0	.	293;309;293	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	H	293;309;309;293;308;293;309	ENSP00000373992:R293H;ENSP00000339369:R309H;ENSP00000437221:R293H;ENSP00000437224:R293H;ENSP00000436988:R309H	ENSP00000292077:R309H	R	-	2	0	POU2F2	47291565	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.774000	0.62339	2.271000	0.75665	0.655000	0.94253	CGC	.		0.672	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
PRKCZ	5590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	2103755	2103755	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:2103755G>T	ENST00000400921.2	+	10	1347	c.664G>T	c.(664-666)Ggt>Tgt	p.G222C	PRKCZ_ENST00000479263.1_3'UTR|PRKCZ_ENST00000400920.1_Missense_Mutation_p.G222C	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	405					actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	CCTGGGCCCTGGTGACACAAC	0.642																																					p.G405C		.											.	PRKCZ	1465	0			c.G1213T						.						67.0	59.0	62.0					1																	2103755		2203	4300	6503	SO:0001583	missense	5590	exon13			GGCCCTGGTGACA	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.664G>T	1.37:g.2103755G>T	ENSP00000383712:p.Gly222Cys	124.0	0.0		104.0	25.0	NM_002744	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	ENST00000400921.2	37	CCDS41229.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031664	0.54790	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000400920	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.21	5.21	0.72293	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83635	0.5297	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	D	0.86231	0.1637	10	0.87932	D	0	.	16.6546	0.85225	0.0:0.0:1.0:0.0	.	301;229;301;405	E9PCW2;B3KUN5;B7Z2J7;Q05513	.;.;.;KPCZ_HUMAN	C	405;222;301;222	ENSP00000367830:G405C;ENSP00000383712:G222C;ENSP00000426412:G301C;ENSP00000383711:G222C	ENSP00000367830:G405C	G	+	1	0	PRKCZ	2093615	1.000000	0.71417	0.131000	0.22000	0.005000	0.04900	8.822000	0.92013	2.599000	0.87857	0.650000	0.86243	GGT	.		0.642	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
PRKD2	25865	hgsc.bcm.edu;broad.mit.edu	37	19	47214295	47214320	+	Splice_Site	DEL	GCTGTAGGCGGAAAATAGGGGTGGAT	GCTGTAGGCGGAAAATAGGGGTGGAT	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	GCTGTAGGCGGAAAATAGGGGTGGAT	GCTGTAGGCGGAAAATAGGGGTGGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:47214295_47214320delGCTGTAGGCGGAAAATAGGGGTGGAT	ENST00000291281.4	-	3	605	c.380delATCCACCCCTATTTTCCGCCTACAGC	c.(379-381)gat>gt	p.D127fs	MIR320E_ENST00000390179.3_RNA|PRKD2_ENST00000601806.1_5'UTR|PRKD2_ENST00000595515.1_Splice_Site_p.D127fs|PRKD2_ENST00000600194.1_5'UTR|PRKD2_ENST00000433867.1_Splice_Site_p.D127fs			Q9BZL6	KPCD2_HUMAN	protein kinase D2	127					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GGTGGCCGAGGCTGTAGGCGGAAAATAGGGGTGGATGCTTGAGGCG	0.593																																					p.127_127del		.											.	PRKD2	759	0			c.380_380del						.																																			SO:0001630	splice_region_variant	25865	exon3			GCCGAGGCTGTAG	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.380-1ATCCACCCCTATTTTCCGCCTACAGC>-	19.37:g.47214295_47214320delGCTGTAGGCGGAAAATAGGGGTGGAT		189.0	0.0		111.0	14.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Frame_Shift_Del	DEL	ENST00000291281.4	37	CCDS12689.1																																																																																			.		0.593	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	Frame_Shift_Del
PRKDC	5591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	48856412	48856412	+	Splice_Site	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:48856412C>A	ENST00000523565.1	-	9	865		c.e9+1		PRKDC_ENST00000314191.2_Splice_Site|PRKDC_ENST00000338368.3_Splice_Site			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CAGAATCCTACCTGAGGGCAC	0.294								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			c.808+1G>T						.						34.0	33.0	33.0					8																	48856412		1806	4065	5871	SO:0001630	splice_region_variant	5591	exon10			ATCCTACCTGAGG		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.12643+1G>T	8.37:g.48856412C>A		136.0	0.0		133.0	40.0	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Splice_Site	SNP	ENST00000523565.1	37		.	.	.	.	.	.	.	.	.	.	C	21.7	4.184371	0.78677	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4438	0.90676	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKDC	49018965	1.000000	0.71417	0.983000	0.44433	0.939000	0.58152	5.808000	0.69165	2.601000	0.87937	0.563000	0.77884	.	.		0.294	PRKDC-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000377896.1	NM_001081640	Intron
PSMA4	5685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78837279	78837279	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:78837279A>T	ENST00000044462.7	+	6	506	c.356A>T	c.(355-357)cAa>cTa	p.Q119L	PSMA4_ENST00000413382.2_Missense_Mutation_p.Q48L|PSMA4_ENST00000557929.1_3'UTR|PSMA4_ENST00000560217.1_Missense_Mutation_p.Q88L|PSMA4_ENST00000559082.1_Missense_Mutation_p.Q119L|PSMA4_ENST00000558341.1_Intron|PSMA4_ENST00000558281.1_Missense_Mutation_p.Q119L|PSMA4_ENST00000558094.1_Missense_Mutation_p.Q31L	NM_002789.4	NP_002780.1	P25789	PSA4_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 4	119					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						GATATCAAACAAGCTTATACA	0.313																																					p.Q119L		.											.	PSMA4	90	0			c.A356T						.						86.0	84.0	85.0					15																	78837279		2196	4293	6489	SO:0001583	missense	5685	exon6			TCAAACAAGCTTA	BC005361	CCDS10303.1, CCDS45319.1	15q24.1	2004-01-19			ENSG00000041357	ENSG00000041357		"""Proteasome (prosome, macropain) subunits"""	9533	protein-coding gene	gene with protein product		176846				2025653	Standard	NM_002789		Approved	HC9, HsT17706	uc010blf.3	P25789	OTTHUMG00000143859	ENST00000044462.7:c.356A>T	15.37:g.78837279A>T	ENSP00000044462:p.Gln119Leu	93.0	0.0		73.0	23.0	NM_001102667	D3DW86|Q53XP2|Q567Q5|Q8TBD1	Missense_Mutation	SNP	ENST00000044462.7	37	CCDS10303.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.683284	0.88542	.	.	ENSG00000041357	ENST00000413382;ENST00000044462	T;T	0.24908	1.83;1.83	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.53883	0.1824	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58595	-0.7609	10	0.87932	D	0	-23.0772	16.1699	0.81801	1.0:0.0:0.0:0.0	.	119	P25789	PSA4_HUMAN	L	48;119	ENSP00000402118:Q48L;ENSP00000044462:Q119L	ENSP00000044462:Q119L	Q	+	2	0	PSMA4	76624334	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	9.072000	0.93986	2.217000	0.71921	0.533000	0.62120	CAA	.		0.313	PSMA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290107.5	NM_002789	
PTGR1	22949	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	114341085	114341086	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:114341085_114341086insTT	ENST00000407693.2	-	7	903_904	c.641_642insAA	c.(640-642)tatfs	p.Y214fs	PTGR1_ENST00000309195.5_Frame_Shift_Ins_p.Y214fs|PTGR1_ENST00000538962.1_Frame_Shift_Ins_p.Y214fs|PTGR1_ENST00000238248.3_Frame_Shift_Ins_p.Y91fs	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	214					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						CATTATCAAAATAACAATCATA	0.376																																					p.Y214_F215delinsX	Ovarian(200;132 2151 7551 19220 46064)	.											.	PTGR1	90	0			c.642_643insAA						.																																			SO:0001589	frameshift_variant	22949	exon7			ATCAAAATAACAA	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.641_642insAA	9.37:g.114341085_114341086insTT	ENSP00000385763:p.Tyr214fs	136.0	0.0		112.0	13.0	NM_001146108	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Nonsense_Mutation	INS	ENST00000407693.2	37	CCDS6779.1																																																																																			.		0.376	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
PTPN18	26469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131117002	131117002	+	Silent	SNP	G	G	T	rs138461234	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:131117002G>T	ENST00000175756.5	+	4	413	c.312G>T	c.(310-312)acG>acT	p.T104T	PTPN18_ENST00000420717.1_3'UTR|PTPN18_ENST00000347849.3_Intron	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	104	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					ACATTGCCACGCAAGGACCCT	0.607																																					p.T104T		.											.	PTPN18	229	0			c.G312T						.						98.0	89.0	92.0					2																	131117002		2203	4300	6503	SO:0001819	synonymous_variant	26469	exon4			TGCCACGCAAGGA	X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.312G>T	2.37:g.131117002G>T		119.0	0.0		98.0	30.0	NM_014369	B4E1E6|Q53P42	Silent	SNP	ENST00000175756.5	37	CCDS2161.1																																																																																			G|0.996;C|0.004		0.607	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2		
PXDNL	137902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	52323847	52323847	+	Silent	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:52323847A>G	ENST00000356297.4	-	16	2125	c.2025T>C	c.(2023-2025)cgT>cgC	p.R675R	PXDNL_ENST00000543296.1_Silent_p.R675R	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	675					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCTGCTTCACACGTTCCCGTA	0.517																																					p.R675R		.											.	PXDNL	70	0			c.T2025C						.						58.0	59.0	59.0					8																	52323847		2012	4180	6192	SO:0001819	synonymous_variant	137902	exon16			CTTCACACGTTCC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2025T>C	8.37:g.52323847A>G		179.0	0.0		227.0	71.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	37	CCDS47855.1																																																																																			.		0.517	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
RAB40C	57799	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	16	677600	677600	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:677600G>C	ENST00000248139.3	+	6	1027	c.824G>C	c.(823-825)cGg>cCg	p.R275P	RAB40C_ENST00000538492.1_Missense_Mutation_p.R275P|RAB40C_ENST00000535977.1_Missense_Mutation_p.R275P|RAB40C_ENST00000539661.1_Missense_Mutation_p.R275P	NM_021168.4	NP_066991.3	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family	275					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	6		Hepatocellular(780;0.0218)				AACTGCTCGCGGAGTAACTGC	0.697																																					p.R275P	Melanoma(123;1631 1690 28262 44104 44957)	.											.	RAB40C	227	0			c.G824C						.						51.0	54.0	53.0					16																	677600		2201	4300	6501	SO:0001583	missense	57799	exon6			GCTCGCGGAGTAA	Z84779	CCDS10413.1	16p13.3	2008-07-28	2003-10-14		ENSG00000197562	ENSG00000197562		"""RAB, member RAS oncogene"""	18285	protein-coding gene	gene with protein product			"""RAS-like, family 8, member C"""	RASL8C		11697911, 18485483	Standard	NM_021168		Approved	RARL	uc021szv.1	Q96S21	OTTHUMG00000047854	ENST00000248139.3:c.824G>C	16.37:g.677600G>C	ENSP00000248139:p.Arg275Pro	90.0	0.0		81.0	24.0	NM_021168	A2IDE2|D3DU54|O60795|Q4TT41|Q5PXE8|Q6PIU5	Missense_Mutation	SNP	ENST00000248139.3	37	CCDS10413.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.371574	0.24771	.	.	ENSG00000197562	ENST00000535977;ENST00000539661;ENST00000538492;ENST00000248139	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	4.85	4.85	0.62838	.	0.061993	0.64402	D	0.000013	T	0.65903	0.2736	L	0.36672	1.1	0.24015	N	0.99616	P;P	0.41041	0.736;0.586	B;B	0.41412	0.356;0.182	T	0.65409	-0.6175	10	0.87932	D	0	.	16.9555	0.86258	0.0:0.0:1.0:0.0	.	275;256	Q96S21;Q5PXE8	RB40C_HUMAN;.	P	275	ENSP00000438492:R275P;ENSP00000445050:R275P;ENSP00000438382:R275P;ENSP00000248139:R275P	ENSP00000248139:R275P	R	+	2	0	RAB40C	617601	0.711000	0.27906	0.053000	0.19242	0.839000	0.47603	4.008000	0.57103	2.228000	0.72767	0.561000	0.74099	CGG	.		0.697	RAB40C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109079.4	NM_021168	
RAB4A	5867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	229431599	229431599	+	Missense_Mutation	SNP	G	G	T	rs141754859		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:229431599G>T	ENST00000366690.4	+	4	440	c.232G>T	c.(232-234)Gtg>Ttg	p.V78L	RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	78					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				TTCCAGGTCCGTGACGAGAAG	0.502																																					p.V78L	Esophageal Squamous(11;250 603 9619 16563)	.											.	RAB4A	182	0			c.G232T						.						78.0	81.0	80.0					1																	229431599		2203	4300	6503	SO:0001583	missense	5867	exon4			AGGTCCGTGACGA	BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.232G>T	1.37:g.229431599G>T	ENSP00000355651:p.Val78Leu	110.0	0.0		125.0	32.0	NM_004578	Q5T7P7|Q9BQ44	Missense_Mutation	SNP	ENST00000366690.4	37	CCDS31050.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705486	0.48412	.	.	ENSG00000168118	ENST00000366690	T	0.71461	-0.57	4.58	4.58	0.56647	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	N	0.11756	0.17	0.80722	D	1	B	0.31640	0.333	P	0.44561	0.453	T	0.68526	-0.5385	10	0.62326	D	0.03	.	14.572	0.68218	0.0:0.0:1.0:0.0	.	73	P20338	RAB4A_HUMAN	L	78	ENSP00000355651:V78L	ENSP00000355651:V78L	V	+	1	0	RAB4A	227498222	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	8.984000	0.93482	2.498000	0.84270	0.655000	0.94253	GTG	G|1.000;A|0.000		0.502	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091727.3	NM_004578	
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170346578	170346578	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:170346578T>G	ENST00000523189.1	+	11	1399	c.1235T>G	c.(1234-1236)tTt>tGt	p.F412C		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	412					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACGAAGGCCTTTATCACTTCT	0.368			T	TRD@	ALL																																p.F412C		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	524	0			c.T1235G						.						165.0	162.0	163.0					5																	170346578		2203	4300	6503	SO:0001583	missense	64901	exon11			AGGCCTTTATCAC	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1235T>G	5.37:g.170346578T>G	ENSP00000427975:p.Phe412Cys	190.0	0.0		193.0	73.0	NM_022897	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	t	18.00	3.526548	0.64860	.	.	ENSG00000204764	ENST00000523189;ENST00000545246	T	0.66638	-0.22	5.68	3.1	0.35709	Armadillo-type fold (1);	0.188901	0.37483	N	0.002065	T	0.71417	0.3337	M	0.67397	2.05	0.46927	D	0.999256	D	0.60160	0.987	P	0.54372	0.75	T	0.72975	-0.4128	10	0.72032	D	0.01	-13.5708	9.1	0.36662	0.5695:0.0:0.0:0.4305	.	412	Q9H2T7	RBP17_HUMAN	C	412;308	ENSP00000427975:F412C	ENSP00000373770:F412C	F	+	2	0	RANBP17	170279183	1.000000	0.71417	0.995000	0.50966	0.855000	0.48748	5.654000	0.67974	0.942000	0.37525	0.477000	0.44152	TTT	.		0.368	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
RCC1	1104	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	28861881	28861881	+	Missense_Mutation	SNP	G	G	C	rs528320406		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:28861881G>C	ENST00000373833.6	+	9	935	c.650G>C	c.(649-651)cGg>cCg	p.R217P	RCC1_ENST00000373832.1_Missense_Mutation_p.R217P|RCC1_ENST00000398958.2_Missense_Mutation_p.R217P|RCC1_ENST00000429051.1_3'UTR|RCC1_ENST00000373831.3_Missense_Mutation_p.R248P			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	217					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.R217Q(1)		breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CGTGGTGGCCGGCAAGGCCTC	0.602																																					p.R248P		.											.	RCC1	228	1	Substitution - Missense(1)	large_intestine(1)	c.G743C						.						69.0	66.0	67.0					1																	28861881		2203	4300	6503	SO:0001583	missense	1104	exon7			GTGGCCGGCAAGG	X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.650G>C	1.37:g.28861881G>C	ENSP00000362939:p.Arg217Pro	105.0	1.0		123.0	43.0	NM_001048194	Q16269|Q6NT97	Missense_Mutation	SNP	ENST00000373833.6	37	CCDS323.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916429	0.92249	.	.	ENSG00000180198	ENST00000398958;ENST00000427469;ENST00000434290;ENST00000373833;ENST00000419074;ENST00000373832;ENST00000373831;ENST00000411533;ENST00000430407	D;D;D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	5.56	5.56	0.83823	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.099752	0.64402	D	0.000003	D	0.93249	0.7849	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.987;0.997;0.994	D	0.93541	0.6878	10	0.72032	D	0.01	-19.5465	18.2548	0.90016	0.0:0.0:1.0:0.0	.	248;234;217	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	P	217;217;253;217;217;217;248;234;217	ENSP00000381931:R217P;ENSP00000402740:R217P;ENSP00000405258:R253P;ENSP00000362939:R217P;ENSP00000402260:R217P;ENSP00000362938:R217P;ENSP00000362937:R248P;ENSP00000413644:R234P;ENSP00000394650:R217P	ENSP00000362937:R248P	R	+	2	0	RCC1	28734468	1.000000	0.71417	0.995000	0.50966	0.939000	0.58152	6.108000	0.71522	2.890000	0.99128	0.655000	0.94253	CGG	.		0.602	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010323.3	NM_001269	
RASAL2	9462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	178269226	178269226	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:178269226T>C	ENST00000367649.3	+	3	782	c.430T>C	c.(430-432)Tac>Cac	p.Y144H	RASAL2_ENST00000448150.3_Missense_Mutation_p.Y126H			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GTTTCCCGAGTACCCACCAGA	0.483											OREG0014010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y144H		.											.	RASAL2	155	0			c.T430C						.						66.0	69.0	68.0					1																	178269226		2203	4300	6503	SO:0001583	missense	9462	exon3			CCCGAGTACCCAC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.430T>C	1.37:g.178269226T>C	ENSP00000356621:p.Tyr144His	74.0	0.0	1945	86.0	44.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000367649.3	37	CCDS1321.2	.	.	.	.	.	.	.	.	.	.	T	19.59	3.855975	0.71834	.	.	ENSG00000075391	ENST00000448150;ENST00000367649	T;T	0.20332	2.08;2.08	5.61	5.61	0.85477	.	0.074262	0.56097	D	0.000036	T	0.35913	0.0948	L	0.36672	1.1	0.46061	D	0.998844	D	0.69078	0.997	D	0.75484	0.986	T	0.03017	-1.1082	10	0.34782	T	0.22	.	15.0834	0.72133	0.0:0.0:0.0:1.0	.	144	F8W755	.	H	126;144	ENSP00000407768:Y126H;ENSP00000356621:Y144H	ENSP00000356621:Y144H	Y	+	1	0	RASAL2	176535849	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	5.728000	0.68531	2.254000	0.74563	0.533000	0.62120	TAC	.		0.483	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352415.1	NM_170692	
RIMS2	9699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	104898096	104898096	+	Silent	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:104898096T>G	ENST00000436393.2	+	2	844	c.603T>G	c.(601-603)tcT>tcG	p.S201S	RIMS2_ENST00000507740.1_Silent_p.S231S|RIMS2_ENST00000406091.3_Silent_p.S423S|RIMS2_ENST00000262231.10_Silent_p.S231S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S231S(3)|p.S459S(2)|p.S201S(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACCAAGTTCTTATGCACAAA	0.478										HNSCC(12;0.0054)																											p.S423S		.											RIMS2,colon,carcinoma,0	RIMS2	279	7	Substitution - coding silent(7)	large_intestine(7)	c.T1269G						.						85.0	80.0	81.0					8																	104898096		1935	4137	6072	SO:0001819	synonymous_variant	9699	exon4			AAGTTCTTATGCA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.603T>G	8.37:g.104898096T>G		81.0	0.0		67.0	28.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37																																																																																				.		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
RNF146	81847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	127608258	127608258	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:127608258A>C	ENST00000368314.1	+	3	924	c.500A>C	c.(499-501)aAg>aCg	p.K167T	RNF146_ENST00000309649.3_Missense_Mutation_p.K166T|RNF146_ENST00000610153.1_Missense_Mutation_p.K167T|ECHDC1_ENST00000488087.1_5'Flank|RNF146_ENST00000356799.2_3'UTR|RNF146_ENST00000608991.1_Missense_Mutation_p.K166T	NM_001242850.1|NM_001242851.1	NP_001229779.1|NP_001229780.1	Q9NTX7	RN146_HUMAN	ring finger protein 146	167	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly-ADP-D-ribose binding (GO:0072572)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(226;0.0407)|all cancers(137;0.2)		AGGAAGATTAAGCGAGATATA	0.413																																					p.K167T		.											.	RNF146	226	0			c.A500C						.						72.0	73.0	72.0					6																	127608258		2203	4300	6503	SO:0001583	missense	81847	exon3			AGATTAAGCGAGA	AK027558	CCDS5136.1, CCDS56449.1	6q22.1-q22.33	2008-02-05			ENSG00000118518	ENSG00000118518		"""RING-type (C3HC4) zinc fingers"""	21336	protein-coding gene	gene with protein product		612137					Standard	NM_001242844		Approved	DKFZp434O1427, dactylidin, dJ351K20.1	uc021zes.1	Q9NTX7	OTTHUMG00000015522	ENST00000368314.1:c.500A>C	6.37:g.127608258A>C	ENSP00000357297:p.Lys167Thr	77.0	0.0		90.0	23.0	NM_001242850	E1P572|Q6FIB2|Q7L8H4|Q96K03|Q96T06|Q9NTX6	Missense_Mutation	SNP	ENST00000368314.1	37	CCDS56449.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.915839	0.73098	.	.	ENSG00000118518	ENST00000368314;ENST00000356799;ENST00000309649	T;T;T	0.54071	0.59;0.59;0.59	5.8	5.8	0.92144	WWE domain (2);WWE domain, subgroup (1);	0.046631	0.85682	D	0.000000	T	0.66366	0.2782	M	0.73319	2.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70317	-0.4905	10	0.62326	D	0.03	-17.7046	16.1639	0.81739	1.0:0.0:0.0:0.0	.	167	Q9NTX7	RN146_HUMAN	T	167;166;166	ENSP00000357297:K167T;ENSP00000349253:K166T;ENSP00000309365:K166T	ENSP00000309365:K166T	K	+	2	0	RNF146	127649951	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.039000	0.93777	2.219000	0.72066	0.533000	0.62120	AAG	.		0.413	RNF146-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042112.1	NM_030963	
RPL35	11224	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	127622525	127622525	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:127622525G>A	ENST00000348462.3	-	3	207	c.159C>T	c.(157-159)tcC>tcT	p.S53S	ARPC5L_ENST00000353214.2_5'Flank|RPL35_ENST00000373570.4_Silent_p.S53S	NM_007209.3	NP_009140.1	P42766	RL35_HUMAN	ribosomal protein L35	53					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4				GBM - Glioblastoma multiforme(294;0.182)		CACGGGCAATGGATTTCCGGA	0.483																																					p.S53S		.											.	RPL35	91	0			c.C159T						.						88.0	86.0	87.0					9																	127622525		2203	4300	6503	SO:0001819	synonymous_variant	11224	exon3			GGCAATGGATTTC	U12465	CCDS6858.1	9q34.1	2011-04-06			ENSG00000136942	ENSG00000136942		"""L ribosomal proteins"""	10344	protein-coding gene	gene with protein product	"""60S ribosomal protein L35"""					11401437	Standard	NM_007209		Approved	L35	uc004boy.1	P42766	OTTHUMG00000020659	ENST00000348462.3:c.159C>T	9.37:g.127622525G>A		116.0	1.0		112.0	36.0	NM_007209	A8K4V7|Q4VBY5|Q5JTN5|Q6IBC7|Q96QJ7|Q9BYF4	Silent	SNP	ENST00000348462.3	37	CCDS6858.1	.	.	.	.	.	.	.	.	.	.	G	2.029	-0.422974	0.04734	.	.	ENSG00000136942	ENST00000373570	.	.	.	5.29	-0.854	0.10705	.	.	.	.	.	T	0.55737	0.1939	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51276	-0.8726	4	.	.	.	.	9.8789	0.41220	0.5648:0.0:0.4352:0.0	.	.	.	.	Y	53	.	.	H	-	1	0	RPL35	126662346	1.000000	0.71417	0.987000	0.45799	0.102000	0.19082	0.776000	0.26704	-0.008000	0.14320	-0.254000	0.11334	CAT	.		0.483	RPL35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054035.1	NM_007209	
RPP40	10799	broad.mit.edu;bcgsc.ca	37	6	4996528	4996528	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:4996528C>T	ENST00000380051.2	-	6	730	c.686G>A	c.(685-687)gGa>gAa	p.G229E	RPP40_ENST00000319533.5_Missense_Mutation_p.G206E|RPP40_ENST00000464646.1_Missense_Mutation_p.G169E	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	229					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				CTCTGGCGTTCCCTCCAGCTC	0.557																																					p.G229E		.											.	RPP40	90	0			c.G686A						.						68.0	69.0	69.0					6																	4996528		2203	4300	6503	SO:0001583	missense	10799	exon6			GGCGTTCCCTCCA	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.686G>A	6.37:g.4996528C>T	ENSP00000369391:p.Gly229Glu	101.0	0.0		97.0	4.0	NM_006638	Q5VX97|Q8WVK8	Missense_Mutation	SNP	ENST00000380051.2	37	CCDS34333.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063535	0.76187	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	T;T;T	0.39787	1.06;1.06;1.06	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.58293	0.2112	M	0.74546	2.27	0.48901	D	0.999722	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.55909	-0.8066	10	0.36615	T	0.2	-1.9238	18.0092	0.89218	0.0:1.0:0.0:0.0	.	206;229	O75818-2;O75818	.;RPP40_HUMAN	E	229;206;169	ENSP00000369391:G229E;ENSP00000317998:G206E;ENSP00000419431:G169E	ENSP00000317998:G206E	G	-	2	0	RPP40	4941527	0.996000	0.38824	0.033000	0.17914	0.001000	0.01503	5.498000	0.66931	2.490000	0.84030	0.650000	0.86243	GGA	.		0.557	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	NM_006638	
RPRD2	23248	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	150437008	150437008	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:150437008A>G	ENST00000369068.4	+	10	1421	c.1417A>G	c.(1417-1419)Agt>Ggt	p.S473G	RPRD2_ENST00000539519.1_Missense_Mutation_p.S447G|RPRD2_ENST00000401000.4_Missense_Mutation_p.S447G|RPRD2_ENST00000492220.1_3'UTR	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	473	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ACCAGGGGTCAGTCCTGCATC	0.478											OREG0013786	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S473G		.											.	RPRD2	23	0			c.A1417G						.						45.0	57.0	53.0					1																	150437008		2062	4187	6249	SO:0001583	missense	23248	exon10			GGGGTCAGTCCTG	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.1417A>G	1.37:g.150437008A>G	ENSP00000358064:p.Ser473Gly	34.0	0.0	1732	57.0	21.0	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	37	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.663718	0.88251	.	.	ENSG00000163125	ENST00000401000;ENST00000539519;ENST00000369068	T;T;T	0.51817	0.72;0.74;0.69	5.34	5.34	0.76211	.	0.053884	0.85682	D	0.000000	T	0.56848	0.2013	M	0.61703	1.905	0.58432	D	0.999998	D;D;D	0.71674	0.99;0.996;0.998	P;P;D	0.66084	0.824;0.874;0.941	T	0.60429	-0.7265	10	0.56958	D	0.05	-10.5769	15.4877	0.75578	1.0:0.0:0.0:0.0	.	447;473;447	B4E2Q6;Q5VT52;Q5VT52-3	.;RPRD2_HUMAN;.	G	447;447;473	ENSP00000383785:S447G;ENSP00000445482:S447G;ENSP00000358064:S473G	ENSP00000358064:S473G	S	+	1	0	RPRD2	148703632	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.118000	0.89577	2.248000	0.74166	0.533000	0.62120	AGT	.		0.478	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
RPS10	6204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	34389539	34389539	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:34389539T>C	ENST00000326199.8	-	4	461	c.368A>G	c.(367-369)gAc>gGc	p.D123G	RPS10_ENST00000344700.3_Missense_Mutation_p.D123G|RPS10_ENST00000494077.1_5'UTR|RPS10-NUDT3_ENST00000605528.1_Missense_Mutation_p.D123G	NM_001014.4|NM_001203245.2|NM_001204091.1	NP_001005.1|NP_001190174.1|NP_001191020.1	P46783	RS10_HUMAN	ribosomal protein S10	123					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	9						GGTATCTCTGTCAGCTTCCCC	0.507																																					p.D123G	Colon(121;749 1624 4895 8687 22360)	.											.	RPS10	90	0			c.A368G						.						255.0	258.0	257.0					6																	34389539		2203	4300	6503	SO:0001583	missense	6204	exon4			TCTCTGTCAGCTT	U14972	CCDS4792.1	6p21.31	2011-04-05			ENSG00000124614	ENSG00000124614		"""S ribosomal proteins"""	10383	protein-coding gene	gene with protein product		603632				7772601, 9582194	Standard	NM_001014		Approved	MGC88819, S10		P46783	OTTHUMG00000014546	ENST00000326199.8:c.368A>G	6.37:g.34389539T>C	ENSP00000347271:p.Asp123Gly	104.0	0.0		113.0	34.0	NM_001203245	B2R4E3|Q5TZC0	Missense_Mutation	SNP	ENST00000326199.8	37	CCDS4792.1	.	.	.	.	.	.	.	.	.	.	T	17.83	3.484904	0.63962	.	.	ENSG00000124614	ENST00000326199;ENST00000344700	T;T	0.80480	-1.33;-1.38	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.70518	0.3233	L	0.61387	1.9	0.80722	D	1	B	0.12630	0.006	B	0.12837	0.008	T	0.71090	-0.4693	10	0.49607	T	0.09	-15.5093	15.5772	0.76400	0.0:0.0:0.0:1.0	.	123	P46783	RS10_HUMAN	G	123	ENSP00000347271:D123G;ENSP00000363169:D123G	ENSP00000347271:D123G	D	-	2	0	RPS10	34497517	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.817000	0.86213	2.141000	0.66446	0.482000	0.46254	GAC	.		0.507	RPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040230.1		
RRS1	23212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	67341483	67341483	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr8:67341483G>A	ENST00000320270.2	+	1	221	c.117G>A	c.(115-117)ctG>ctA	p.L39L	RP11-346I3.4_ENST00000499642.1_lincRNA	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	39					hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			TGGGCAACCTGCTGGCGTCGG	0.672											OREG0018806	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L39L		.											.	RRS1	90	0			c.G117A						.						49.0	39.0	43.0					8																	67341483		2186	4296	6482	SO:0001819	synonymous_variant	23212	exon1			CAACCTGCTGGCG	BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.117G>A	8.37:g.67341483G>A		161.0	0.0	1098	202.0	77.0	NM_015169	Q9BUX8	Silent	SNP	ENST00000320270.2	37	CCDS6189.1																																																																																			.		0.672	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380126.1	NM_015169	
RXFP2	122042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32371491	32371491	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr13:32371491A>C	ENST00000298386.2	+	17	2011	c.1940A>C	c.(1939-1941)gAt>gCt	p.D647A	RXFP2_ENST00000380314.1_Missense_Mutation_p.D623A	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	647					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)	p.D647A(1)		cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		GTGTTCTCTGATGCCATCTGC	0.403																																					p.D647A		.											.	RXFP2	90	1	Substitution - Missense(1)	large_intestine(1)	c.A1940C						.						221.0	213.0	216.0					13																	32371491		2203	4300	6503	SO:0001583	missense	122042	exon17			TCTCTGATGCCAT	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.1940A>C	13.37:g.32371491A>C	ENSP00000298386:p.Asp647Ala	186.0	0.0		229.0	94.0	NM_130806	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350196	0.82132	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.36878	1.23;1.23	5.66	5.66	0.87406	GPCR, rhodopsin-like superfamily (1);	0.093559	0.64402	D	0.000001	T	0.64757	0.2627	M	0.88450	2.955	0.80722	D	1	D;D	0.57899	0.981;0.981	D;D	0.63192	0.912;0.912	T	0.72414	-0.4301	10	0.72032	D	0.01	.	15.8843	0.79232	1.0:0.0:0.0:0.0	.	623;647	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	A	623;647	ENSP00000369670:D623A;ENSP00000298386:D647A	ENSP00000298386:D647A	D	+	2	0	RXFP2	31269491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.753000	0.91637	2.164000	0.68074	0.533000	0.62120	GAT	.		0.403	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
SAMD3	154075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	130536349	130536349	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:130536349T>C	ENST00000368134.2	-	5	678	c.70A>G	c.(70-72)Aga>Gga	p.R24G	SAMD3_ENST00000439090.2_Missense_Mutation_p.R24G|SAMD3_ENST00000532763.1_Missense_Mutation_p.R24G|SAMD3_ENST00000437477.2_Missense_Mutation_p.R24G|SAMD3_ENST00000457563.2_Missense_Mutation_p.R48G|SAMD3_ENST00000324172.6_Missense_Mutation_p.R24G|SAMD3_ENST00000533296.1_5'UTR	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	24	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.									breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		CCTTGAAATCTATGAACTAGC	0.393																																					p.R24G		.											.	SAMD3	91	0			c.A70G						.						95.0	95.0	95.0					6																	130536349		2203	4300	6503	SO:0001583	missense	154075	exon3			GAAATCTATGAAC	AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.70A>G	6.37:g.130536349T>C	ENSP00000357116:p.Arg24Gly	100.0	0.0		127.0	40.0	NM_001017373	B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	ENST00000368134.2	37	CCDS34539.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.092704	0.76756	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477;ENST00000532763;ENST00000324172;ENST00000532309;ENST00000531544;ENST00000529723	T;T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.9	5.9	0.94986	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.074521	0.64402	D	0.000019	T	0.45216	0.1331	N	0.24115	0.695	0.40848	D	0.983723	D;D;D	0.71674	0.998;0.976;0.961	D;P;P	0.67900	0.954;0.724;0.819	T	0.54754	-0.8246	10	0.87932	D	0	.	14.9005	0.70675	0.0:0.0:0.0:1.0	.	48;24;24	B4DY20;Q8N6K7-2;Q8N6K7	.;.;SAMD3_HUMAN	G	24;48;24;24;24;24;24;24;24	ENSP00000357116:R24G;ENSP00000402092:R48G;ENSP00000403565:R24G;ENSP00000391163:R24G;ENSP00000436088:R24G;ENSP00000324874:R24G;ENSP00000436115:R24G;ENSP00000435875:R24G;ENSP00000434139:R24G	ENSP00000324874:R24G	R	-	1	2	SAMD3	130578042	1.000000	0.71417	0.945000	0.38365	0.887000	0.51463	5.172000	0.65003	2.259000	0.74868	0.523000	0.50628	AGA	.		0.393	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042197.3	NM_152552	
SART3	9733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	108932816	108932816	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:108932816A>C	ENST00000228284.3	-	7	1190	c.956T>G	c.(955-957)tTt>tGt	p.F319C	SART3_ENST00000431469.2_Missense_Mutation_p.F319C	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	319					cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						TTTCATCTCAAAATCGATATA	0.468									Porokeratosis																												p.F319C		.											.	SART3	91	0			c.T956G						.						99.0	86.0	91.0					12																	108932816		2203	4300	6503	SO:0001583	missense	9733	exon7	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	ATCTCAAAATCGA	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.956T>G	12.37:g.108932816A>C	ENSP00000228284:p.Phe319Cys	145.0	0.0		162.0	63.0	NM_014706	A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	ENST00000228284.3	37	CCDS9117.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.828191	0.90955	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000412617;ENST00000546815	T;T;T	0.38887	1.11;1.11;1.11	6.06	6.06	0.98353	.	0.047341	0.85682	D	0.000000	T	0.67942	0.2947	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.996;0.996	P;D;P;P	0.65573	0.906;0.936;0.784;0.847	T	0.73062	-0.4101	10	0.66056	D	0.02	-15.9919	16.6127	0.84892	1.0:0.0:0.0:0.0	.	267;337;319;319	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	C	319;319;267;337	ENSP00000228284:F319C;ENSP00000414453:F319C;ENSP00000449386:F337C	ENSP00000228284:F319C	F	-	2	0	SART3	107456946	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	4.498000	0.60373	2.322000	0.78497	0.528000	0.53228	TTT	.		0.468	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404094.1		
SCAMP4	113178	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	1924232	1924242	+	Frame_Shift_Del	DEL	GCCCGAGTACC	GCCCGAGTACC	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	GCCCGAGTACC	GCCCGAGTACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:1924232_1924242delGCCCGAGTACC	ENST00000316097.8	+	7	906_916	c.639_649delGCCCGAGTACC	c.(637-651)ctgcccgagtaccccfs	p.PEYP214fs	SCAMP4_ENST00000409472.1_Frame_Shift_Del_p.PEYP180fs	NM_079834.2	NP_524558.1	Q969E2	SCAM4_HUMAN	secretory carrier membrane protein 4	214					protein transport (GO:0015031)	integral component of membrane (GO:0016021)							Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAACAGCCTGCCCGAGTACCCCACTGTGCC	0.654																																					p.213_217del		.											.	SCAMP4	68	0			c.639_649del						.																																			SO:0001589	frameshift_variant	113178	exon7			CAGCCTGCCCGAG	AK091166	CCDS45903.1	19p13.3	2013-02-21			ENSG00000227500	ENSG00000227500		"""Secretory carrier membrane proteins"""	30385	protein-coding gene	gene with protein product		613764					Standard	NM_079834		Approved	FLJ33847	uc002luj.4	Q969E2	OTTHUMG00000154590	ENST00000316097.8:c.639_649delGCCCGAGTACC	19.37:g.1924232_1924242delGCCCGAGTACC	ENSP00000316007:p.Pro214fs	77.0	0.0		37.0	13.0	NM_079834	Q8N2N1|Q8NAV0	Frame_Shift_Del	DEL	ENST00000316097.8	37	CCDS45903.1																																																																																			.		0.654	SCAMP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336210.3	NM_079834	
SCYL1	57410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65293085	65293085	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:65293085A>C	ENST00000270176.5	+	2	229	c.152A>C	c.(151-153)aAg>aCg	p.K51T	SCYL1_ENST00000279270.6_Missense_Mutation_p.K51T|SCYL1_ENST00000524944.1_Missense_Mutation_p.K51T|SCYL1_ENST00000527009.1_5'UTR|SCYL1_ENST00000533862.1_Missense_Mutation_p.K51T|SCYL1_ENST00000420247.2_Missense_Mutation_p.K51T|SCYL1_ENST00000525364.1_Missense_Mutation_p.K51T	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						TATGATGTGAAGCCTGGCGCG	0.602																																					p.K51T		.											.	SCYL1	333	0			c.A152C						.						37.0	42.0	40.0					11																	65293085		2020	4174	6194	SO:0001583	missense	57410	exon2			ATGTGAAGCCTGG	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.152A>C	11.37:g.65293085A>C	ENSP00000270176:p.Lys51Thr	109.0	0.0		122.0	38.0	NM_020680	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	37	CCDS41672.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634123	0.47049	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000417543	T;T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78	4.72	3.55	0.40652	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.348434	0.30593	N	0.009284	T	0.64594	0.2612	L	0.46567	1.45	0.30946	N	0.725326	B;P;B;B	0.36789	0.051;0.57;0.036;0.1	B;B;B;B	0.39258	0.141;0.295;0.037;0.217	T	0.65821	-0.6075	10	0.56958	D	0.05	0.1943	3.871	0.09036	0.7112:0.0:0.101:0.1878	.	51;51;51;51	E9PS17;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;NTKL_HUMAN	T	51	ENSP00000270176:K51T;ENSP00000431635:K51T;ENSP00000408192:K51T;ENSP00000437254:K51T;ENSP00000433450:K51T;ENSP00000279270:K51T;ENSP00000432175:K51T	ENSP00000270176:K51T	K	+	2	0	SCYL1	65049661	1.000000	0.71417	0.983000	0.44433	0.987000	0.75469	3.685000	0.54678	0.596000	0.29794	0.448000	0.29417	AAG	.		0.602	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
SCYL3	57147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	169847817	169847817	+	Silent	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:169847817C>A	ENST00000367770.1	-	2	356	c.309G>T	c.(307-309)ggG>ggT	p.G103G	SCYL3_ENST00000470238.1_5'UTR|SCYL3_ENST00000367772.4_Silent_p.G103G|SCYL3_ENST00000367771.6_Silent_p.G103G			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	103	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGTCATAGATCCCAGCACAGA	0.483																																					p.G103G		.											.	SCYL3	361	0			c.G309T						.						129.0	125.0	126.0					1																	169847817		2203	4300	6503	SO:0001819	synonymous_variant	57147	exon3			ATAGATCCCAGCA	BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.309G>T	1.37:g.169847817C>A		260.0	0.0		391.0	208.0	NM_020423	A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Silent	SNP	ENST00000367770.1	37	CCDS1287.1																																																																																			.		0.483	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087550.4	NM_181093	
SEPT6	23157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	118827051	118827051	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chrX:118827051T>C	ENST00000343984.5	-	1	282	c.18A>G	c.(16-18)atA>atG	p.I6M	SEPT6_ENST00000394617.2_Missense_Mutation_p.I6M|SEPT6_ENST00000489216.1_Missense_Mutation_p.I6M|SEPT6_ENST00000354416.3_Missense_Mutation_p.I6M|SEPT6_ENST00000394616.4_5'Flank|SEPT6_ENST00000394610.1_Missense_Mutation_p.I6M|SEPT6_ENST00000354228.4_Missense_Mutation_p.I6M|SEPT6_ENST00000360156.7_Missense_Mutation_p.I6M	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	6					cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						CCTGGCGAGCTATATCGGTCG	0.682			T	MLL	AML																																p.I6M		.		Dom	yes		X	Xq24	23157	septin 6		L	.	SEPT6	969	0			c.A18G						.						14.0	11.0	12.0					X																	118827051		2138	4179	6317	SO:0001583	missense	23157	exon1			GCGAGCTATATCG	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.18A>G	X.37:g.118827051T>C	ENSP00000341524:p.Ile6Met	185.0	0.0		122.0	77.0	NM_145802	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Missense_Mutation	SNP	ENST00000343984.5	37	CCDS14584.1	.	.	.	.	.	.	.	.	.	.	t	12.99	2.102449	0.37145	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394617;ENST00000520510	T;T;T;T;T;T;T	0.54675	0.61;0.61;0.61;0.61;0.61;0.61;0.56	3.91	3.91	0.45181	.	.	.	.	.	T	0.30572	0.0769	N	0.16656	0.425	0.80722	D	1	P;P;B	0.37636	0.603;0.533;0.041	B;B;B	0.33521	0.165;0.109;0.057	T	0.06427	-1.0827	9	0.22706	T	0.39	.	8.2275	0.31577	0.0:0.0:0.0:1.0	.	6;6;6	F5H1J5;Q14141;Q548C9	.;SEPT6_HUMAN;.	M	6	ENSP00000353278:I6M;ENSP00000346169:I6M;ENSP00000418715:I6M;ENSP00000346397:I6M;ENSP00000378108:I6M;ENSP00000341524:I6M;ENSP00000378115:I6M	ENSP00000341524:I6M	I	-	3	3	SEPT6	118711079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.598000	0.36740	1.759000	0.51996	0.478000	0.44815	ATA	.		0.682	SEPT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058059.1	NM_145802	
SH2B3	10019	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111884570	111884570	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:111884570A>C	ENST00000341259.2	+	3	1103	c.746A>C	c.(745-747)aAg>aCg	p.K249T	SH2B3_ENST00000538307.1_Missense_Mutation_p.K47T	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	249	PH.				blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	TCAAGGCCCAAGCTACAAGCA	0.532																																					p.K249T		.											.	SH2B3	91	0			c.A746C						.						72.0	69.0	70.0					12																	111884570		2203	4300	6503	SO:0001583	missense	10019	exon3			GGCCCAAGCTACA	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.746A>C	12.37:g.111884570A>C	ENSP00000345492:p.Lys249Thr	128.0	1.0		125.0	48.0	NM_005475	B9EGG5|O95184	Missense_Mutation	SNP	ENST00000341259.2	37	CCDS9153.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.006497	0.54361	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.78003	-1.14;1.46	5.02	3.87	0.44632	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.045423	0.85682	D	0.000000	D	0.86053	0.5841	M	0.76574	2.34	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.86026	0.1510	10	0.87932	D	0	-2.3297	10.4957	0.44777	0.9235:0.0:0.0765:0.0	.	47;113;249	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	T	249;59;47	ENSP00000345492:K249T;ENSP00000440597:K47T	ENSP00000345492:K249T	K	+	2	0	SH2B3	110368953	1.000000	0.71417	0.999000	0.59377	0.194000	0.23727	3.188000	0.50958	0.768000	0.33290	0.379000	0.24179	AAG	.		0.532	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
SIM2	6493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38117328	38117328	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr21:38117328C>T	ENST00000290399.6	+	10	2080	c.1467C>T	c.(1465-1467)tgC>tgT	p.C489C	SIM2_ENST00000430056.3_Silent_p.C489C	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	489	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						GCGGTGAATGCCAGTGGCATT	0.587																																					p.C489C		.											.	SIM2	90	0			c.C1467T						.						69.0	60.0	63.0					21																	38117328		2203	4300	6503	SO:0001819	synonymous_variant	6493	exon10			TGAATGCCAGTGG		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.1467C>T	21.37:g.38117328C>T		116.0	0.0		128.0	38.0	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Silent	SNP	ENST00000290399.6	37	CCDS13646.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376642	0.24857	.	.	ENSG00000159263	ENST00000431229;ENST00000481730	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	T	0.73984	0.3657	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73842	-0.3855	4	.	.	.	.	18.1411	0.89639	0.0:1.0:0.0:0.0	.	.	.	.	S	427;86	.	.	P	+	1	0	SIM2	37039198	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.871000	0.56077	2.337000	0.79520	0.558000	0.71614	CCA	.		0.587	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
SKIV2L2	23517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	54619962	54619962	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:54619962T>A	ENST00000230640.5	+	3	529	c.275T>A	c.(274-276)tTg>tAg	p.L92*	SKIV2L2_ENST00000504388.1_3'UTR|SKIV2L2_ENST00000545714.1_Intron	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	92					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTTTTAAGTTTGGCAGACCTG	0.358																																					p.L92X	Melanoma(2;92 134 23744 29976 33782)	.											.	SKIV2L2	92	0			c.T275A						.						74.0	66.0	69.0					5																	54619962		2203	4299	6502	SO:0001587	stop_gained	23517	exon3			TAAGTTTGGCAGA	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.275T>A	5.37:g.54619962T>A	ENSP00000230640:p.Leu92*	85.0	0.0		115.0	51.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Nonsense_Mutation	SNP	ENST00000230640.5	37	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	T	37	6.483372	0.97603	.	.	ENSG00000039123	ENST00000230640	.	.	.	5.55	5.55	0.83447	.	0.073017	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-13.2739	14.6889	0.69070	0.0:0.0:0.0:1.0	.	.	.	.	X	92	.	ENSP00000230640:L92X	L	+	2	0	SKIV2L2	54655719	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.259000	0.78381	2.118000	0.64928	0.533000	0.62120	TTG	.		0.358	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
SLC22A25	387601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62931493	62931493	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:62931493C>A	ENST00000306494.6	-	9	1446	c.1447G>T	c.(1447-1449)Gct>Tct	p.A483S	SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						ATGAGGGAAGCCAGGGCTCCC	0.463																																					p.A483S		.											.	SLC22A25	72	0			c.G1447T						.						143.0	155.0	151.0					11																	62931493		2201	4298	6499	SO:0001583	missense	387601	exon9			GGGAAGCCAGGGC	AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.1447G>T	11.37:g.62931493C>A	ENSP00000307443:p.Ala483Ser	295.0	0.0		286.0	97.0	NM_199352		Missense_Mutation	SNP	ENST00000306494.6	37	CCDS31592.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008867	0.35415	.	.	ENSG00000196600	ENST00000306494	T	0.60299	0.2	4.56	-8.59	0.00893	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.329351	0.31041	N	0.008370	T	0.54532	0.1864	L	0.50847	1.595	0.09310	N	0.999999	P	0.40578	0.722	P	0.49012	0.598	T	0.59177	-0.7503	10	0.33141	T	0.24	.	17.4989	0.87726	0.8335:0.1665:0.0:0.0	.	483	Q6T423	S22AP_HUMAN	S	483	ENSP00000307443:A483S	ENSP00000307443:A483S	A	-	1	0	SLC22A25	62688069	0.011000	0.17503	0.000000	0.03702	0.001000	0.01503	-0.159000	0.10056	-1.918000	0.01072	-1.390000	0.01156	GCT	.		0.463	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352	
SLC2A2	6514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	170723139	170723139	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:170723139A>G	ENST00000314251.3	-	7	977	c.898T>C	c.(898-900)Tac>Cac	p.Y300H	SLC2A2_ENST00000382808.4_Missense_Mutation_p.Y181H	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	300					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	GGCTGTCGGTAGCTGGAATTG	0.413																																					p.Y300H		.											.	SLC2A2	515	0			c.T898C						.						205.0	185.0	192.0					3																	170723139		2203	4300	6503	SO:0001583	missense	6514	exon7			GTCGGTAGCTGGA	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.898T>C	3.37:g.170723139A>G	ENSP00000323568:p.Tyr300His	215.0	0.0		198.0	65.0	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	ENST00000314251.3	37	CCDS3215.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478654	0.44044	.	.	ENSG00000163581	ENST00000314251;ENST00000382808	T;T	0.75050	-0.9;-0.9	5.53	4.37	0.52481	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.105660	0.64402	N	0.000002	T	0.77405	0.4125	M	0.89163	3.01	0.58432	D	0.999992	P	0.42337	0.776	B	0.40134	0.32	T	0.78219	-0.2289	10	0.44086	T	0.13	.	11.4699	0.50261	0.9291:0.0:0.0709:0.0	.	300	P11168	GTR2_HUMAN	H	300;181	ENSP00000323568:Y300H;ENSP00000372258:Y181H	ENSP00000323568:Y300H	Y	-	1	0	SLC2A2	172205833	1.000000	0.71417	0.180000	0.23079	0.115000	0.19883	7.137000	0.77295	1.030000	0.39839	0.482000	0.46254	TAC	.		0.413	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
SLC35B1	10237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47781491	47781491	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:47781491T>G	ENST00000240333.6	-	6	747	c.626A>C	c.(625-627)aAc>aCc	p.N209T	SLC35B1_ENST00000415270.2_Missense_Mutation_p.N246T			P78383	S35B1_HUMAN	solute carrier family 35, member B1	209					transport (GO:0006810)|UDP-galactose transmembrane transport (GO:0072334)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	UDP-galactose transmembrane transporter activity (GO:0005459)			endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(1)	7						CGACCAAAGGTTGATGTTCAG	0.532																																					p.N209T		.											.	SLC35B1	90	0			c.A626C						.						232.0	184.0	201.0					17																	47781491		2203	4300	6503	SO:0001583	missense	10237	exon6			CAAAGGTTGATGT	D16978	CCDS11552.1, CCDS11552.2	17q21.32	2013-05-22			ENSG00000121073	ENSG00000121073		"""Solute carriers"""	20798	protein-coding gene	gene with protein product		610790				9010752	Standard	NM_005827		Approved	UGTREL1	uc002iph.1	P78383	OTTHUMG00000161638	ENST00000240333.6:c.626A>C	17.37:g.47781491T>G	ENSP00000240333:p.Asn209Thr	279.0	0.0		395.0	127.0	NM_005827	B4DEC4|J3KQV4|Q96EW7	Missense_Mutation	SNP	ENST00000240333.6	37	CCDS11552.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.998075	0.93227	.	.	ENSG00000121073	ENST00000240333;ENST00000415270;ENST00000504260;ENST00000502406;ENST00000503334;ENST00000508520;ENST00000502268;ENST00000435059;ENST00000514907;ENST00000515850	T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66184	-0.5987	10	0.59425	D	0.04	-0.5432	16.3021	0.82825	0.0:0.0:0.0:1.0	.	209;142;209	B4DJG9;D3DTX1;P78383	.;.;S35B1_HUMAN	T	209;246;85;85;142;212;85;209;178;243	ENSP00000240333:N209T;ENSP00000409548:N246T;ENSP00000423323:N142T;ENSP00000424367:N212T;ENSP00000426961:N178T;ENSP00000427689:N243T	ENSP00000240333:N209T	N	-	2	0	SLC35B1	45136490	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.993000	0.88291	2.326000	0.78906	0.533000	0.62120	AAC	.		0.532	SLC35B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365564.2	NM_005827	
SLC44A4	80736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31833747	31833747	+	Missense_Mutation	SNP	C	C	T	rs149591801	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:31833747C>T	ENST00000229729.6	-	14	1410	c.1390G>A	c.(1390-1392)Gtc>Atc	p.V464I	SLC44A4_ENST00000544672.1_Missense_Mutation_p.V388I|SLC44A4_ENST00000375562.4_Missense_Mutation_p.V422I	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	464					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V464I(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	CCAGCGAGGACGCATTGGCCC	0.557													C|||	6	0.00119808	0.0	0.0	5008	,	,		19077	0.0		0.0	False		,,,				2504	0.0061				p.V464I		.											.	SLC44A4	156	2	Substitution - Missense(2)	prostate(2)	c.G1390A						.	C	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	69.0	67.0	68.0		1264,1162,1390	4.3	1.0	6	dbSNP_134	68	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	SLC44A4	NM_001178044.1,NM_001178045.1,NM_025257.2	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	422/669,388/635,464/711	31833747	2,13004	2203	4300	6503	SO:0001583	missense	80736	exon14			CGAGGACGCATTG	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1390G>A	6.37:g.31833747C>T	ENSP00000229729:p.Val464Ile	113.0	0.0		122.0	48.0	NM_025257	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	CCDS4724.2	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666032	0.47677	0.0	2.33E-4	ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672	T;T;T	0.24350	1.86;1.86;1.86	5.21	4.34	0.51931	.	0.136893	0.49916	D	0.000127	T	0.19127	0.0459	L	0.58583	1.82	0.33101	D	0.539257	P	0.48503	0.911	P	0.46940	0.532	T	0.03957	-1.0989	10	0.46703	T	0.11	-17.9757	12.7587	0.57350	0.0:0.9198:0.0:0.0802	.	464	Q53GD3	CTL4_HUMAN	I	464;422;388	ENSP00000229729:V464I;ENSP00000364712:V422I;ENSP00000444109:V388I	ENSP00000229729:V464I	V	-	1	0	SLC44A4	31941726	0.995000	0.38212	1.000000	0.80357	0.863000	0.49368	2.759000	0.47573	1.434000	0.47414	0.655000	0.94253	GTC	C|1.000;T|0.000		0.557	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
SLC9C1	285335	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	111939985	111939985	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:111939985T>A	ENST00000305815.5	-	14	1912	c.1660A>T	c.(1660-1662)Aag>Tag	p.K554*	SLC9C1_ENST00000487372.1_Nonsense_Mutation_p.K506*	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	554					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TTTCCCTTCTTCTCACCAAAA	0.398																																					p.K554X		.											.	.	.	0			c.A1660T						.						122.0	123.0	122.0					3																	111939985		2203	4300	6503	SO:0001587	stop_gained	285335	exon14			CCTTCTTCTCACC	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1660A>T	3.37:g.111939985T>A	ENSP00000306627:p.Lys554*	164.0	0.0		145.0	42.0	NM_183061	Q6ZRP4|Q7RTP2	Nonsense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	T	40	8.164813	0.98686	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	.	.	.	5.41	4.26	0.50523	.	0.349053	0.25711	N	0.028809	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.015	0.30376	0.0:0.0927:0.0:0.9073	.	.	.	.	X	554;506	.	ENSP00000306627:K554X	K	-	1	0	SLC9A10	113422675	1.000000	0.71417	0.995000	0.50966	0.922000	0.55478	3.896000	0.56266	0.878000	0.35920	0.482000	0.46254	AAG	.		0.398	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
SND1	27044	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	127338946	127338946	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:127338946A>G	ENST00000354725.3	+	4	561	c.367A>G	c.(367-369)Att>Gtt	p.I123V		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	123	TNase-like 1. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						TGGGGAAAACATTGCAGAATC	0.473																																					p.I123V		.											.	SND1	92	0			c.A367G						.						88.0	83.0	84.0					7																	127338946		2203	4300	6503	SO:0001583	missense	27044	exon4			GAAAACATTGCAG		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.367A>G	7.37:g.127338946A>G	ENSP00000346762:p.Ile123Val	85.0	0.0		100.0	5.0	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.251242	0.22880	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.28895	1.59	6.06	6.06	0.98353	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.044361	0.85682	D	0.000000	T	0.17662	0.0424	N	0.12182	0.205	0.53005	D	0.999963	B	0.24576	0.106	B	0.29077	0.098	T	0.06215	-1.0839	10	0.05351	T	0.99	-15.0494	14.5647	0.68168	1.0:0.0:0.0:0.0	.	123	Q7KZF4	SND1_HUMAN	V	123;113	ENSP00000346762:I123V	ENSP00000346762:I123V	I	+	1	0	SND1	127126182	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.038000	0.64177	2.322000	0.78497	0.528000	0.53228	ATT	.		0.473	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
SP3	6670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	174820648	174820648	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:174820648T>G	ENST00000310015.6	-	4	1122	c.592A>C	c.(592-594)Aat>Cat	p.N198H	SP3_ENST00000483084.1_5'Flank|SP3_ENST00000418194.2_Missense_Mutation_p.N130H|SP3_ENST00000455789.2_Missense_Mutation_p.N145H	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	198	Transactivation domain (Gln-rich).				B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			CTTTCTTGATTTATACCCCCA	0.428																																					p.N198H		.											.	SP3	227	0			c.A592C						.						208.0	218.0	215.0					2																	174820648		2203	4300	6503	SO:0001583	missense	6670	exon4			CTTGATTTATACC	M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.592A>C	2.37:g.174820648T>G	ENSP00000310301:p.Asn198His	208.0	0.0		193.0	63.0	NM_003111	A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Missense_Mutation	SNP	ENST00000310015.6	37	CCDS2254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.04|14.04	2.417320|2.417320	0.42918|0.42918	.|.	.|.	ENSG00000172845|ENSG00000172845	ENST00000310015;ENST00000455789;ENST00000418194|ENST00000416195	T;T;T|.	0.05025|.	3.52;3.51;3.51|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.204262|.	0.53938|.	D|.	0.000055|.	T|.	0.43634|.	0.1256|.	L|L	0.34521|0.34521	1.04|1.04	0.33341|0.33341	D|D	0.569885|0.569885	P;P;D|.	0.54964|.	0.947;0.913;0.969|.	P;B;P|.	0.50970|.	0.453;0.339;0.655|.	T|.	0.56062|.	-0.8041|.	10|.	0.56958|.	D|.	0.05|.	.|.	10.7032|10.7032	0.45939|0.45939	0.0:0.0708:0.0:0.9292|0.0:0.0708:0.0:0.9292	.|.	195;198;145|.	B7ZLN9;Q02447;Q02447-6|.	.;SP3_HUMAN;.|.	H|Y	198;145;130|154	ENSP00000310301:N198H;ENSP00000388903:N145H;ENSP00000406140:N130H|.	ENSP00000310301:N198H|.	N|X	-|-	1|3	0|2	SP3|SP3	174528894|174528894	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.149000|2.149000	0.42244|0.42244	2.272000|2.272000	0.75746|0.75746	0.460000|0.460000	0.39030|0.39030	AAT|TAA	.		0.428	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1	NM_003111	
SPECC1L	23384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24718668	24718668	+	Missense_Mutation	SNP	A	A	G	rs200752862		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr22:24718668A>G	ENST00000314328.9	+	5	2005	c.1720A>G	c.(1720-1722)Ata>Gta	p.I574V	SPECC1L_ENST00000437398.1_Missense_Mutation_p.I574V|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.I574V|SPECC1L_ENST00000541492.1_Missense_Mutation_p.I574V|SPECC1L_ENST00000416735.1_Intron	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	574					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CAGTGACCAGATAGAGATGAA	0.463																																					p.I574V		.											.	SPECC1L	92	0			c.A1720G						.						65.0	66.0	65.0					22																	24718668		2203	4300	6503	SO:0001583	missense	23384	exon4			GACCAGATAGAGA	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1720A>G	22.37:g.24718668A>G	ENSP00000325785:p.Ile574Val	71.0	0.0		79.0	27.0	NM_001145468	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	A	8.231	0.804758	0.16467	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.60548	0.18;2.66;0.18;3.18	5.5	3.26	0.37387	.	0.147419	0.64402	D	0.000011	T	0.35307	0.0927	N	0.16368	0.405	0.34147	D	0.667089	B;B	0.20780	0.048;0.002	B;B	0.18871	0.023;0.001	T	0.39251	-0.9623	10	0.20046	T	0.44	-26.7237	8.2368	0.31631	0.7908:0.1353:0.0739:0.0	.	574;574	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	V	602;574;574;574;574	ENSP00000393363:I574V;ENSP00000405671:I574V;ENSP00000325785:I574V;ENSP00000439633:I574V	ENSP00000325785:I574V	I	+	1	0	SPECC1L	23048668	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.508000	0.35769	2.099000	0.63709	0.533000	0.62120	ATA	.		0.463	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
SPECC1L	23384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24718674	24718674	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr22:24718674A>C	ENST00000314328.9	+	5	2011	c.1726A>C	c.(1726-1728)Atg>Ctg	p.M576L	SPECC1L_ENST00000437398.1_Missense_Mutation_p.M576L|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.M576L|SPECC1L_ENST00000541492.1_Missense_Mutation_p.M576L|SPECC1L_ENST00000416735.1_Intron	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	576					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CCAGATAGAGATGAATCGCCT	0.468																																					p.M576L		.											.	SPECC1L	92	0			c.A1726C						.						67.0	69.0	68.0					22																	24718674		2203	4300	6503	SO:0001583	missense	23384	exon4			ATAGAGATGAATC	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1726A>C	22.37:g.24718674A>C	ENSP00000325785:p.Met576Leu	66.0	0.0		82.0	27.0	NM_001145468	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	A	0.997	-0.692057	0.03303	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.56941	0.43;2.9;0.43;3.43	5.5	1.9	0.25705	.	0.143693	0.64402	D	0.000005	T	0.13884	0.0336	N	0.00538	-1.39	0.31301	N	0.688266	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.35226	-0.9797	10	0.02654	T	1	-23.8918	6.1584	0.20350	0.6338:0.1386:0.2276:0.0	.	576;576	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	L	604;576;576;576;576	ENSP00000393363:M576L;ENSP00000405671:M576L;ENSP00000325785:M576L;ENSP00000439633:M576L	ENSP00000325785:M576L	M	+	1	0	SPECC1L	23048674	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.481000	0.35476	0.405000	0.25532	0.533000	0.62120	ATG	.		0.468	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
SPTLC2	9517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78021746	78021746	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:78021746C>T	ENST00000216484.2	-	8	1266	c.1073G>A	c.(1072-1074)gGt>gAt	p.G358D	SPTLC2_ENST00000556264.1_5'Flank	NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	358					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	CTCCACCACACCCCGGCCTGT	0.517																																					p.G358D		.											.	SPTLC2	92	0			c.G1073A						.						103.0	109.0	107.0					14																	78021746		2203	4300	6503	SO:0001583	missense	9517	exon8			ACCACACCCCGGC	AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.1073G>A	14.37:g.78021746C>T	ENSP00000216484:p.Gly358Asp	164.0	0.0		127.0	46.0	NM_004863	Q16685	Missense_Mutation	SNP	ENST00000216484.2	37	CCDS9865.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909563	0.92107	.	.	ENSG00000100596	ENST00000216484	D	0.96459	-4.02	4.89	4.89	0.63831	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99162	0.9710	H	0.99682	4.7	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98556	1.0639	10	0.87932	D	0	-13.6121	18.6117	0.91288	0.0:1.0:0.0:0.0	.	358	O15270	SPTC2_HUMAN	D	358	ENSP00000216484:G358D	ENSP00000216484:G358D	G	-	2	0	SPTLC2	77091499	1.000000	0.71417	0.997000	0.53966	0.928000	0.56348	7.502000	0.81614	2.712000	0.92718	0.650000	0.86243	GGT	.		0.517	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414030.1	NM_004863	
SRBD1	55133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	45812829	45812829	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:45812829T>G	ENST00000263736.4	-	5	795	c.733A>C	c.(733-735)Att>Ctt	p.I245L		NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	245					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TAACGTATAATGAAGGGAATT	0.348																																					p.I245L		.											.	SRBD1	90	0			c.A733C						.						112.0	115.0	114.0					2																	45812829		2203	4300	6503	SO:0001583	missense	55133	exon5			GTATAATGAAGGG	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.733A>C	2.37:g.45812829T>G	ENSP00000263736:p.Ile245Leu	134.0	0.0		104.0	25.0	NM_018079	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	37	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.985232	0.53934	.	.	ENSG00000068784	ENST00000263736	T	0.63580	-0.05	5.04	5.04	0.67666	Tex-like protein, N-terminal (1);Tex-like protein, HTH domain (1);	0.075235	0.53938	D	0.000059	T	0.72574	0.3477	M	0.93507	3.425	0.80722	D	1	B	0.25235	0.121	B	0.26416	0.069	T	0.76591	-0.2903	10	0.87932	D	0	.	14.6045	0.68466	0.0:0.0:0.0:1.0	.	245	Q8N5C6	SRBD1_HUMAN	L	245	ENSP00000263736:I245L	ENSP00000263736:I245L	I	-	1	0	SRBD1	45666333	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.851000	0.62896	2.113000	0.64589	0.455000	0.32223	ATT	.		0.348	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
SSBP2	23635	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	80762867	80762867	+	Intron	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr5:80762867T>A	ENST00000320672.4	-	9	781				SSBP2_ENST00000509053.1_Intron|SSBP2_ENST00000514493.1_Intron|SSBP2_ENST00000515395.1_Silent_p.S166S|SSBP2_ENST00000505980.1_Intron	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)		SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		AGTTCTGTAATGATAACCAAG	0.418																																					p.S196S		.											.	SSBP2	223	0			c.A588T						.						73.0	69.0	70.0					5																	80762867		2203	4300	6503	SO:0001627	intron_variant	23635	exon9			CTGTAATGATAAC	AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.571-7A>T	5.37:g.80762867T>A		250.0	1.0		204.0	74.0	NM_001256732	B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	Silent	SNP	ENST00000320672.4	37	CCDS4056.1																																																																																			.		0.418	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239249.1	NM_012446	
STON1	11037	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	48818835	48818835	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:48818835delA	ENST00000406226.1	+	4	2169	c.1974delA	c.(1972-1974)ggafs	p.G658fs	STON1-GTF2A1L_ENST00000405008.1_Frame_Shift_Del_p.G658fs|STON1-GTF2A1L_ENST00000402114.2_Frame_Shift_Del_p.G658fs|STON1-GTF2A1L_ENST00000394754.1_Frame_Shift_Del_p.G658fs|STON1-GTF2A1L_ENST00000309827.2_Frame_Shift_Del_p.G658fs|STON1-GTF2A1L_ENST00000394751.3_Frame_Shift_Del_p.G658fs|STON1_ENST00000309835.3_Frame_Shift_Del_p.G658fs|STON1_ENST00000404752.1_Frame_Shift_Del_p.G658fs	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	658	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAGAGCTTGGATCAGACCAAG	0.428																																					p.G658fs		.											.	STON1	91	0			c.1974delA						.						192.0	185.0	187.0					2																	48818835		2203	4300	6503	SO:0001589	frameshift_variant	11037	exon4			GCTTGGATCAGAC	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1974delA	2.37:g.48818835delA	ENSP00000384615:p.Gly658fs	256.0	0.0		217.0	36.0	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Frame_Shift_Del	DEL	ENST00000406226.1	37	CCDS1841.1																																																																																			.		0.428	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
STON1	11037	hgsc.bcm.edu;bcgsc.ca	37	2	48818838	48818838	+	Silent	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:48818838A>T	ENST00000406226.1	+	4	2172	c.1977A>T	c.(1975-1977)tcA>tcT	p.S659S	STON1-GTF2A1L_ENST00000405008.1_Silent_p.S659S|STON1-GTF2A1L_ENST00000402114.2_Silent_p.S659S|STON1-GTF2A1L_ENST00000394754.1_Silent_p.S659S|STON1-GTF2A1L_ENST00000309827.2_Silent_p.S659S|STON1-GTF2A1L_ENST00000394751.3_Silent_p.S659S|STON1_ENST00000309835.3_Silent_p.S659S|STON1_ENST00000404752.1_Silent_p.S659S	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	659	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AGCTTGGATCAGACCAAGAAA	0.428																																					p.S659S		.											.	STON1	91	0			c.A1977T						.						191.0	185.0	187.0					2																	48818838		2203	4300	6503	SO:0001819	synonymous_variant	11037	exon4			TGGATCAGACCAA	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1977A>T	2.37:g.48818838A>T		258.0	0.0		216.0	36.0	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	ENST00000406226.1	37	CCDS1841.1																																																																																			.		0.428	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
STON1	11037	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	48818840	48818841	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:48818840_48818841delAC	ENST00000406226.1	+	4	2174_2175	c.1979_1980delAC	c.(1978-1980)gacfs	p.D660fs	STON1-GTF2A1L_ENST00000405008.1_Frame_Shift_Del_p.D660fs|STON1-GTF2A1L_ENST00000402114.2_Frame_Shift_Del_p.D660fs|STON1-GTF2A1L_ENST00000394754.1_Frame_Shift_Del_p.D660fs|STON1-GTF2A1L_ENST00000309827.2_Frame_Shift_Del_p.D660fs|STON1-GTF2A1L_ENST00000394751.3_Frame_Shift_Del_p.D660fs|STON1_ENST00000309835.3_Frame_Shift_Del_p.D660fs|STON1_ENST00000404752.1_Frame_Shift_Del_p.D660fs	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	660	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTGGATCAGACCAAGAAATTC	0.431																																					p.660_660del		.											.	STON1	91	0			c.1979_1980del						.																																			SO:0001589	frameshift_variant	11037	exon4			GATCAGACCAAGA	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1979_1980delAC	2.37:g.48818840_48818841delAC	ENSP00000384615:p.Asp660fs	255.0	0.0		216.0	35.0	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Frame_Shift_Del	DEL	ENST00000406226.1	37	CCDS1841.1																																																																																			.		0.431	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
TAF1C	9013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84216853	84216853	+	Silent	SNP	C	C	T	rs187518651	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr16:84216853C>T	ENST00000567759.1	-	5	587	c.405G>A	c.(403-405)gcG>gcA	p.A135A	TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000341690.6_Silent_p.A68A|TAF1C_ENST00000570117.1_Intron|TAF1C_ENST00000566732.1_Silent_p.A135A|TAF1C_ENST00000378541.4_Silent_p.A135A|TAF1C_ENST00000541676.1_Silent_p.A68A	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	135					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CACTCACCCCCGCTCCCTCCA	0.612													c|||	3	0.000599042	0.0	0.0	5008	,	,		18561	0.0		0.001	False		,,,				2504	0.002				p.A135A		.											.	TAF1C	91	0			c.G405A						.						83.0	80.0	81.0					16																	84216853		2200	4300	6500	SO:0001819	synonymous_variant	9013	exon5			CACCCCCGCTCCC	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.405G>A	16.37:g.84216853C>T		62.0	0.0		67.0	26.0	NM_001243156	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	CCDS32496.1																																																																																			C|0.999;T|0.000		0.612	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433045.2	NM_139353	
TAF6L	10629	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	62554224	62554224	+	Missense_Mutation	SNP	G	G	C	rs377750789		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:62554224G>C	ENST00000294168.3	+	11	1526	c.1325G>C	c.(1324-1326)cGg>cCg	p.R442P	TMEM179B_ENST00000333449.4_5'Flank|RP11-727F15.12_ENST00000601484.1_RNA|TMEM223_ENST00000527073.1_Intron|TMEM179B_ENST00000533861.1_5'Flank	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	442					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						GACATCTACCGGGAGCTCTAC	0.711											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R442P		.											.	TAF6L	93	0			c.G1325C						.						18.0	21.0	20.0					11																	62554224		2201	4297	6498	SO:0001583	missense	10629	exon11			TCTACCGGGAGCT	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.1325G>C	11.37:g.62554224G>C	ENSP00000294168:p.Arg442Pro	47.0	0.0	1062	78.0	29.0	NM_006473	B2RAT0|Q96HA6	Missense_Mutation	SNP	ENST00000294168.3	37	CCDS8035.1	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172347	0.38315	.	.	ENSG00000162227	ENST00000294168	T	0.47528	0.84	4.54	2.65	0.31530	.	0.417293	0.24334	N	0.039428	T	0.29850	0.0746	N	0.24115	0.695	0.80722	D	1	B	0.21147	0.052	B	0.19946	0.027	T	0.05649	-1.0872	10	0.33940	T	0.23	-3.5302	7.386	0.26882	0.2018:0.0:0.7982:0.0	.	442	Q9Y6J9	TAF6L_HUMAN	P	442	ENSP00000294168:R442P	ENSP00000294168:R442P	R	+	2	0	TAF6L	62310800	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.175000	0.42491	0.643000	0.30638	0.561000	0.74099	CGG	.		0.711	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395352.1	NM_006473	
TAP1	6890	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32821062	32821062	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:32821062A>G	ENST00000354258.4	-	1	693	c.532T>C	c.(532-534)Tca>Cca	p.S178P	PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000395330.1_Intron|PSMB9_ENST00000453265.2_5'Flank|TAP1_ENST00000425148.2_5'Flank	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	178					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GCTCCCCATGAGATCAGCTCT	0.642																																					p.S178P		.											.	TAP1	91	0			c.T532C						.						17.0	13.0	14.0					6																	32821062		1508	2696	4204	SO:0001583	missense	6890	exon1			CCCATGAGATCAG		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.532T>C	6.37:g.32821062A>G	ENSP00000346206:p.Ser178Pro	91.0	1.0		155.0	54.0	NM_000593	Q16149|Q96CP4	Missense_Mutation	SNP	ENST00000354258.4	37	CCDS4758.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.110688	0.56398	.	.	ENSG00000168394	ENST00000354258	D	0.88741	-2.42	4.02	1.35	0.21983	.	0.781295	0.10049	U	0.722469	T	0.77844	0.4191	L	0.29908	0.895	0.20307	N	0.999915	D	0.60575	0.988	P	0.51657	0.676	T	0.67221	-0.5725	10	0.36615	T	0.2	0.5682	8.0249	0.30431	0.5698:0.4302:0.0:0.0	.	178	Q03518	TAP1_HUMAN	P	178	ENSP00000346206:S178P	ENSP00000346206:S178P	S	-	1	0	TAP1	32929040	0.000000	0.05858	0.039000	0.18376	0.028000	0.11728	0.507000	0.22675	0.575000	0.29434	0.519000	0.50382	TCA	.		0.642	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
TAP1	6890	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	32821435	32821435	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr6:32821435G>A	ENST00000354258.4	-	1	320	c.159C>T	c.(157-159)gaC>gaT	p.D53D	PSMB9_ENST00000374859.2_5'Flank|PSMB9_ENST00000395330.1_Intron|PSMB9_ENST00000453265.2_5'Flank|TAP1_ENST00000425148.2_5'Flank	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	53					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	CGCCGTCCCGGTCCCGGCCGG	0.736																																					p.D53D		.											.	TAP1	91	0			c.C159T						.						7.0	9.0	8.0					6																	32821435		1458	2659	4117	SO:0001819	synonymous_variant	6890	exon1			GTCCCGGTCCCGG		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.159C>T	6.37:g.32821435G>A		32.0	0.0		41.0	16.0	NM_000593	Q16149|Q96CP4	Silent	SNP	ENST00000354258.4	37	CCDS4758.1																																																																																			.		0.736	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076087.2	NM_000593	
TEAD2	8463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49845749	49845749	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:49845749C>G	ENST00000311227.2	-	11	1266	c.1176G>C	c.(1174-1176)caG>caC	p.Q392H	CTC-301O7.4_ENST00000358234.4_lincRNA|TEAD2_ENST00000601519.1_Missense_Mutation_p.Q395H|TEAD2_ENST00000598810.1_Missense_Mutation_p.Q396H|TEAD2_ENST00000593945.1_Missense_Mutation_p.Q396H|TEAD2_ENST00000539846.1_Missense_Mutation_p.Q264H|TEAD2_ENST00000377214.4_Missense_Mutation_p.Q395H	NM_001256659.1|NM_003598.1	NP_001243588.1|NP_003589.1	Q15562	TEAD2_HUMAN	TEA domain family member 2	392	Transcriptional activation. {ECO:0000255}.				gene expression (GO:0010467)|hippo signaling (GO:0035329)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	29		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		GCTCAGGCAGCTGCCGCAACT	0.612																																					p.Q396H		.											.	TEAD2	92	0			c.G1188C						.						73.0	66.0	68.0					19																	49845749		2203	4300	6503	SO:0001583	missense	8463	exon12			AGGCAGCTGCCGC	X94440	CCDS12761.1, CCDS58670.1, CCDS58671.1, CCDS59406.1	19q13.3	2008-07-22							11715	protein-coding gene	gene with protein product		601729				9889009, 8702974	Standard	NM_003598		Approved	TEF-4, ETF, TEF4	uc031rls.1	Q15562		ENST00000311227.2:c.1176G>C	19.37:g.49845749C>G	ENSP00000310701:p.Gln392His	154.0	0.0		181.0	63.0	NM_001256660	B4DTJ6|M0R1T9|Q8NA25|Q96IG3	Missense_Mutation	SNP	ENST00000311227.2	37	CCDS12761.1	.	.	.	.	.	.	.	.	.	.	C	1.446	-0.566263	0.03910	.	.	ENSG00000074219	ENST00000311227;ENST00000377214;ENST00000539846	T;T;T	0.28895	1.59;1.59;1.59	3.9	3.9	0.45041	.	0.105828	0.40728	N	0.001032	T	0.18045	0.0433	N	0.01809	-0.71	0.46416	D	0.999039	D;B;P	0.55385	0.971;0.0;0.948	P;B;P	0.55161	0.77;0.002;0.601	T	0.08086	-1.0739	10	0.02654	T	1	-21.84	14.2043	0.65725	0.0:1.0:0.0:0.0	.	264;392;395	B4DTJ6;Q15562;Q8NA25	.;TEAD2_HUMAN;.	H	392;395;264	ENSP00000310701:Q392H;ENSP00000366419:Q395H;ENSP00000437928:Q264H	ENSP00000310701:Q392H	Q	-	3	2	TEAD2	54537561	0.987000	0.35691	1.000000	0.80357	0.964000	0.63967	0.242000	0.18087	2.127000	0.65507	0.609000	0.83330	CAG	.		0.612	TEAD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465465.1	NM_003598	
THAP2	83591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	72070666	72070666	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr12:72070666C>T	ENST00000308086.2	+	3	1966	c.465C>T	c.(463-465)tgC>tgT	p.C155C	RP11-293I14.2_ENST00000548802.1_Intron	NM_031435.3	NP_113623.1	Q9H0W7	THAP2_HUMAN	THAP domain containing, apoptosis associated protein 2	155						nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	10						TGAAAACTTGCCTACAAAAGG	0.368																																					p.C155C		.											.	THAP2	91	0			c.C465T						.						87.0	85.0	86.0					12																	72070666		2203	4300	6503	SO:0001819	synonymous_variant	83591	exon3			AACTTGCCTACAA	BC008358	CCDS9001.1	12q21.1	2013-01-25				ENSG00000173451		"""THAP (C2CH-type zinc finger) domain containing"""	20854	protein-coding gene	gene with protein product		612531				12575992	Standard	NM_031435		Approved	DKFZP564I0422	uc001swq.3	Q9H0W7	OTTHUMG00000169556	ENST00000308086.2:c.465C>T	12.37:g.72070666C>T		166.0	1.0		170.0	55.0	NM_031435	B2R8P3	Silent	SNP	ENST00000308086.2	37	CCDS9001.1																																																																																			.		0.368	THAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404796.1	NM_031435	
TJP1	7082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	30011153	30011153	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr15:30011153T>C	ENST00000346128.6	-	21	3667	c.3193A>G	c.(3193-3195)Agc>Ggc	p.S1065G	TJP1_ENST00000545208.2_Missense_Mutation_p.S985G|TJP1_ENST00000356107.6_Missense_Mutation_p.S1065G|TJP1_ENST00000400011.2_Missense_Mutation_p.S989G	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1065					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCCGTATAGCTTGAGGACTCG	0.463																																					p.S1065G	Melanoma(77;681 1843 6309 6570)	.											.	TJP1	95	0			c.A3193G						.						312.0	308.0	310.0					15																	30011153		2071	4207	6278	SO:0001583	missense	7082	exon21			TATAGCTTGAGGA		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3193A>G	15.37:g.30011153T>C	ENSP00000281537:p.Ser1065Gly	424.0	0.0		355.0	103.0	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	T	0.176	-1.066831	0.01934	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.05081	3.5;3.62	5.93	-0.31	0.12765	.	0.588912	0.21894	N	0.067548	T	0.03783	0.0107	N	0.25144	0.715	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.46884	-0.9159	10	0.10902	T	0.67	.	10.4411	0.44466	0.0:0.4047:0.0:0.5953	.	1058;985;1065;989	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	G	1065;989;1065;985;985	ENSP00000281537:S1065G;ENSP00000382890:S989G	ENSP00000281537:S1065G	S	-	1	0	TJP1	27798445	0.003000	0.15002	0.002000	0.10522	0.697000	0.40408	0.153000	0.16323	-0.077000	0.12752	0.460000	0.39030	AGC	.		0.463	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TLE1	7088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	84300807	84300807	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:84300807T>C	ENST00000376499.3	-	3	1194	c.130A>G	c.(130-132)Aaa>Gaa	p.K44E	TLE1_ENST00000376472.1_5'UTR|TLE1_ENST00000376463.1_5'UTR	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	44	Gln-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CATTCCAATTTAAGGCTAGGA	0.348																																					p.K44E	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											.	TLE1	92	0			c.A130G						.						111.0	100.0	104.0					9																	84300807		2202	4300	6502	SO:0001583	missense	7088	exon3			CCAATTTAAGGCT		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.130A>G	9.37:g.84300807T>C	ENSP00000365682:p.Lys44Glu	209.0	0.0		188.0	62.0	NM_005077	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.965384	0.92855	.	.	ENSG00000196781	ENST00000376499;ENST00000355002;ENST00000418319	T;T	0.60040	0.22;0.93	5.69	5.69	0.88448	Groucho/TLE, N-terminal Q-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.82263	0.4999	M	0.94021	3.485	0.80722	D	1	D;D;D;D;D;D	0.76494	0.997;0.999;0.999;0.996;0.987;0.998	D;D;D;D;D;D	0.91635	0.989;0.998;0.983;0.988;0.945;0.999	D	0.87160	0.2214	10	0.87932	D	0	-13.6039	15.9446	0.79784	0.0:0.0:0.0:1.0	.	44;44;44;71;44;44	B4E345;B4DEF9;A6NFH2;Q59EF7;Q5T3G3;Q04724	.;.;.;.;.;TLE1_HUMAN	E	44	ENSP00000365682:K44E;ENSP00000391347:K44E	ENSP00000347102:K44E	K	-	1	0	TLE1	83490627	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.158000	0.67659	0.459000	0.35465	AAA	.		0.348	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
TMEM138	51524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61131920	61131920	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:61131920T>C	ENST00000278826.6	+	2	617	c.58T>C	c.(58-60)Tat>Cat	p.Y20H	CYB561A3_ENST00000544118.1_5'Flank|TMEM138_ENST00000381787.2_5'Flank|CYB561A3_ENST00000546151.1_5'Flank|CYB561A3_ENST00000426130.2_5'Flank|CYB561A3_ENST00000294072.4_5'Flank|TMEM138_ENST00000540194.1_3'UTR|CYB561A3_ENST00000447532.2_5'Flank|CYB561A3_ENST00000540317.1_5'Flank|TMEM138_ENST00000542946.1_Missense_Mutation_p.Y20H	NM_016464.4	NP_057548.1	Q9NPI0	TM138_HUMAN	transmembrane protein 138	20					cilium assembly (GO:0042384)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|vacuole (GO:0005773)				central_nervous_system(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5						GCTGCTGTCCTATGACCTCTT	0.522																																					p.Y20H		.											.	TMEM138	90	0			c.T58C						.						188.0	158.0	168.0					11																	61131920		2203	4299	6502	SO:0001583	missense	51524	exon2			CTGTCCTATGACC	AF151030	CCDS8005.1	11q12.2	2014-01-28			ENSG00000149483	ENSG00000149483			26944	protein-coding gene	gene with protein product		614459					Standard	NM_016464		Approved	HSPC196, JBTS16	uc001nrl.2	Q9NPI0	OTTHUMG00000168145	ENST00000278826.6:c.58T>C	11.37:g.61131920T>C	ENSP00000278826:p.Tyr20His	132.0	0.0		152.0	50.0	NM_016464	A6NGA7|B4E044|Q5JPE1	Missense_Mutation	SNP	ENST00000278826.6	37	CCDS8005.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.583514	0.86748	.	.	ENSG00000149483	ENST00000278826;ENST00000542946	D;T	0.88741	-2.42;-1.1	5.32	5.32	0.75619	.	0.237778	0.35585	N	0.003111	D	0.92034	0.7476	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.999;0.993;0.988	D;P;P	0.67548	0.952;0.885;0.885	D	0.92136	0.5716	10	0.49607	T	0.09	-19.1299	14.9817	0.71316	0.0:0.0:0.0:1.0	.	20;20;20	B4E044;Q9NPI0-2;Q9NPI0	.;.;TM138_HUMAN	H	20	ENSP00000278826:Y20H;ENSP00000445792:Y20H	ENSP00000278826:Y20H	Y	+	1	0	TMEM138	60888496	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.705000	0.84606	2.010000	0.58986	0.460000	0.39030	TAT	.		0.522	TMEM138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398399.2	NM_016464	
TMEM33	55161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	41941283	41941289	+	Frame_Shift_Del	DEL	CATCAAA	CATCAAA	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	CATCAAA	CATCAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:41941283_41941289delCATCAAA	ENST00000504986.1	+	3	576_582	c.211_217delCATCAAA	c.(211-219)catcaaagafs	p.HQR71fs	TMEM33_ENST00000325094.5_Frame_Shift_Del_p.HQR71fs|TMEM33_ENST00000513702.1_Frame_Shift_Del_p.HQR71fs	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	71						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)		p.H71Y(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						TCTGAGGCTGCATCAAAGATTACCACA	0.459																																					p.71_73del		.											.	TMEM33	91	1	Substitution - Missense(1)	endometrium(1)	c.211_217del						.																																			SO:0001589	frameshift_variant	55161	exon3			AGGCTGCATCAAA	BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.211_217delCATCAAA	4.37:g.41941283_41941289delCATCAAA	ENSP00000422473:p.His71fs	274.0	0.0		234.0	17.0	NM_018126	B3KSS8|Q9H953	Frame_Shift_Del	DEL	ENST00000504986.1	37	CCDS3464.1																																																																																			.		0.459	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216834.2	NM_018126	
TMEM33	55161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	41941291	41941298	+	Frame_Shift_Del	DEL	ATTACCAC	ATTACCAC	-			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	ATTACCAC	ATTACCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:41941291_41941298delATTACCAC	ENST00000504986.1	+	3	584_591	c.219_226delATTACCAC	c.(217-228)agattaccacacfs	p.LPH74fs	TMEM33_ENST00000325094.5_Frame_Shift_Del_p.LPH74fs|TMEM33_ENST00000513702.1_Frame_Shift_Del_p.LPH74fs	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	74						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)				endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						TGCATCAAAGATTACCACACTTCCAGTT	0.466																																					p.73_76del		.											.	TMEM33	91	0			c.219_226del						.																																			SO:0001589	frameshift_variant	55161	exon3			TCAAAGATTACCA	BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.219_226delATTACCAC	4.37:g.41941291_41941298delATTACCAC	ENSP00000422473:p.Leu74fs	276.0	0.0		221.0	17.0	NM_018126	B3KSS8|Q9H953	Frame_Shift_Del	DEL	ENST00000504986.1	37	CCDS3464.1																																																																																			.		0.466	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216834.2	NM_018126	
TNFSF13B	10673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	108922722	108922722	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr13:108922722C>T	ENST00000375887.4	+	2	552	c.374C>T	c.(373-375)tCc>tTc	p.S125F	TNFSF13B_ENST00000479435.1_3'UTR|TNFSF13B_ENST00000542136.1_Missense_Mutation_p.S125F|TNFSF13B_ENST00000430559.1_Missense_Mutation_p.S125F	NM_006573.4	NP_006564.1	Q9Y275	TN13B_HUMAN	tumor necrosis factor (ligand) superfamily, member 13b	125					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|cell proliferation (GO:0008283)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			large_intestine(1)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)		Belimumab(DB08879)	GAAGGCAACTCCAGTCAGAAC	0.463																																					p.S125F		.											.	TNFSF13B	659	0			c.C374T						.						102.0	103.0	103.0					13																	108922722		2203	4300	6503	SO:0001583	missense	10673	exon2			GCAACTCCAGTCA	AF136293	CCDS9509.1, CCDS45067.1	13q32-q34	2008-05-14			ENSG00000102524	ENSG00000102524		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11929	protein-coding gene	gene with protein product		603969		TNFSF20		10331498, 10359578	Standard	NM_006573		Approved	BAFF, THANK, BLYS, TALL-1, TALL1, CD257	uc001vqr.3	Q9Y275	OTTHUMG00000017329	ENST00000375887.4:c.374C>T	13.37:g.108922722C>T	ENSP00000365048:p.Ser125Phe	97.0	0.0		93.0	33.0	NM_006573	E0ADT7|Q6FHD6|Q7Z5J2	Missense_Mutation	SNP	ENST00000375887.4	37	CCDS9509.1	.	.	.	.	.	.	.	.	.	.	C	6.527	0.465383	0.12402	.	.	ENSG00000102524	ENST00000430559;ENST00000375887;ENST00000542136	T;T;T	0.50813	0.73;0.73;0.73	5.17	3.45	0.39498	.	1.913480	0.01809	N	0.033334	T	0.44159	0.1280	L	0.36672	1.1	0.09310	N	0.999999	B;B	0.10296	0.003;0.001	B;B	0.11329	0.006;0.002	T	0.35500	-0.9786	10	0.66056	D	0.02	-2.8546	9.0086	0.36127	0.0:0.831:0.0:0.169	.	125;125	Q9Y275-2;Q9Y275	.;TN13B_HUMAN	F	125	ENSP00000389540:S125F;ENSP00000365048:S125F;ENSP00000445334:S125F	ENSP00000365048:S125F	S	+	2	0	TNFSF13B	107720723	0.155000	0.22806	0.575000	0.28536	0.146000	0.21551	1.164000	0.31810	0.582000	0.29556	0.655000	0.94253	TCC	.		0.463	TNFSF13B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045739.3		
TNNI2	7136	broad.mit.edu;mdanderson.org	37	11	1860927	1860927	+	Start_Codon_SNP	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:1860927A>T	ENST00000381906.1	+	2	70	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	TNNI2_ENST00000381911.1_Start_Codon_SNP_p.M1L|TNNI2_ENST00000252898.7_Start_Codon_SNP_p.M1L|TNNI2_ENST00000381905.3_5'Flank	NM_001145829.1	NP_001139301.1	P48788	TNNI2_HUMAN	troponin I type 2 (skeletal, fast)	1					muscle filament sliding (GO:0030049)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|nucleus (GO:0005634)|troponin complex (GO:0005861)	troponin T binding (GO:0031014)			lung(8)|prostate(1)|urinary_tract(1)	10		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GGACCTCAGGATGGGAGAGTA	0.637																																					.		.											.	TNNI2	90	0			.						.						169.0	134.0	146.0					11																	1860927		2202	4299	6501	SO:0001582	initiator_codon_variant	7136	.			CTCAGGATGGGAG	L21715	CCDS31333.1, CCDS53594.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130598	ENSG00000130598			11946	protein-coding gene	gene with protein product	"""troponin I, fast-twitch skeletal muscle isoform"", ""troponin I fast twitch 2"""	191043	"""troponin I, skeletal, fast"", ""arthrogryposis multiplex congenita, distal, type 2B"""	AMCD2B		9016781, 12592607	Standard	NM_001145829		Approved	FSSV, DA2B	uc010qxe.1	P48788	OTTHUMG00000012253	ENST00000381906.1:c.1A>T	11.37:g.1860927A>T	ENSP00000371331:p.Met1Leu	131.0	0.0		94.0	27.0	.	A6NIV8|A6NJU5	Translation_Start_Site	SNP	ENST00000381906.1	37	CCDS31333.1	.	.	.	.	.	.	.	.	.	.	a	12.66	2.003980	0.35320	.	.	ENSG00000130598	ENST00000381911;ENST00000381906;ENST00000252898	D;D;D	0.96011	-3.88;-3.88;-3.88	3.69	3.69	0.42338	.	0.601602	0.11663	U	0.541638	D	0.95903	0.8666	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.94673	0.7858	7	0.87932	D	0	-0.7243	8.9332	0.35684	1.0:0.0:0.0:0.0	.	.	.	.	L	1	ENSP00000371336:M1L;ENSP00000371331:M1L;ENSP00000252898:M1L	ENSP00000252898:M1L	M	+	1	0	TNNI2	1817503	0.985000	0.35326	0.995000	0.50966	0.860000	0.49131	0.645000	0.24782	1.684000	0.51022	0.260000	0.18958	ATG	.		0.637	TNNI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034046.2	NM_003282	Missense_Mutation
TPR	7175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186295352	186295352	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:186295352C>T	ENST00000367478.4	-	41	6201	c.5905G>A	c.(5905-5907)Gag>Aag	p.E1969K		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1969					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		tcatcttcctcatcctcttca	0.408			T	NTRK1	papillary thyroid																																p.E1969K		.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	228	0			c.G5905A						.						75.0	71.0	72.0					1																	186295352		2036	4192	6228	SO:0001583	missense	7175	exon41			CTTCCTCATCCTC	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5905G>A	1.37:g.186295352C>T	ENSP00000356448:p.Glu1969Lys	135.0	0.0		140.0	73.0	NM_003292	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077916	0.36662	.	.	ENSG00000047410	ENST00000367478	T	0.26810	1.71	4.03	4.03	0.46877	.	0.388706	0.29100	N	0.013159	T	0.43986	0.1272	L	0.59436	1.845	0.46279	D	0.998969	P	0.52842	0.956	P	0.62184	0.899	T	0.22208	-1.0223	10	0.38643	T	0.18	.	16.1447	0.81559	0.0:1.0:0.0:0.0	.	1969	P12270	TPR_HUMAN	K	1969	ENSP00000356448:E1969K	ENSP00000356448:E1969K	E	-	1	0	TPR	184561975	1.000000	0.71417	0.997000	0.53966	0.815000	0.46073	3.231000	0.51294	2.544000	0.85801	0.655000	0.94253	GAG	.		0.408	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
TRIM71	131405	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	32932714	32932714	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr3:32932714A>G	ENST00000383763.5	+	4	2081	c.2018A>G	c.(2017-2019)gAc>gGc	p.D673G		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	673					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTGACAAGGACAATCATCGC	0.587																																					p.D673G		.											.	TRIM71	92	0			c.A2018G						.						55.0	60.0	58.0					3																	32932714		2124	4229	6353	SO:0001583	missense	131405	exon4			ACAAGGACAATCA		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.2018A>G	3.37:g.32932714A>G	ENSP00000373272:p.Asp673Gly	74.0	2.0		81.0	31.0	NM_001039111		Missense_Mutation	SNP	ENST00000383763.5	37	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	A	19.54	3.847604	0.71603	.	.	ENSG00000206557	ENST00000383763	T	0.69561	-0.41	5.73	5.73	0.89815	Six-bladed beta-propeller, TolB-like (1);	0.044542	0.85682	D	0.000000	T	0.58637	0.2136	N	0.16743	0.435	0.80722	D	1	P	0.37398	0.593	P	0.44897	0.463	T	0.59118	-0.7514	10	0.32370	T	0.25	-58.2965	14.8221	0.70082	1.0:0.0:0.0:0.0	.	673	Q2Q1W2	LIN41_HUMAN	G	673	ENSP00000373272:D673G	ENSP00000373272:D673G	D	+	2	0	TRIM71	32907718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.204000	0.95041	2.186000	0.69663	0.528000	0.53228	GAC	.		0.587	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
TRMT10B	158234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	37776352	37776352	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:37776352G>C	ENST00000297994.3	+	8	859	c.794G>C	c.(793-795)aGa>aCa	p.R265T	TRMT10B_ENST00000537911.1_Missense_Mutation_p.R214T|TRMT10B_ENST00000377754.2_Missense_Mutation_p.R170T|RP11-613M10.9_ENST00000540557.1_Intron|TRMT10B_ENST00000377753.2_Missense_Mutation_p.R187T	NM_144964.2	NP_659401.2	Q6PF06	TM10B_HUMAN	tRNA methyltransferase 10 homolog B (S. cerevisiae)	265	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.						methyltransferase activity (GO:0008168)										TACATGGTCAGAAACCAGAAT	0.443																																					p.R265T		.											.	.	.	0			c.G794C						.						55.0	51.0	52.0					9																	37776352		1905	4133	6038	SO:0001583	missense	158234	exon8			TGGTCAGAAACCA	BC057774	CCDS43804.1, CCDS69598.1, CCDS69600.1, CCDS69601.1	9p13.1	2012-06-28	2012-06-28	2012-06-28	ENSG00000165275	ENSG00000165275			26454	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 3"""	RG9MTD3		14702039	Standard	XM_005251373		Approved	FLJ31455, bA3J10.9	uc004aai.3	Q6PF06	OTTHUMG00000019933	ENST00000297994.3:c.794G>C	9.37:g.37776352G>C	ENSP00000297994:p.Arg265Thr	213.0	0.0		203.0	76.0	NM_144964	B7Z216|B7Z3D3|Q05DJ4|Q5QP83|Q8NAG2|Q96N36	Missense_Mutation	SNP	ENST00000297994.3	37	CCDS43804.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240460	0.39598	.	.	ENSG00000165275	ENST00000377753;ENST00000537911;ENST00000377754;ENST00000297994	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	5.28	-0.546	0.11840	.	0.245392	0.47093	D	0.000248	T	0.21387	0.0515	L	0.46157	1.445	0.80722	D	1	P;P;B;B;B	0.44344	0.485;0.833;0.408;0.026;0.316	B;P;B;B;B	0.49140	0.297;0.601;0.346;0.054;0.288	T	0.05257	-1.0896	10	0.20046	T	0.44	-3.1555	9.4421	0.38675	0.522:0.0:0.478:0.0	.	154;187;214;170;265	B7Z9F7;B7Z216;B7Z3D3;Q6PF06-2;Q6PF06	.;.;.;.;RG9D3_HUMAN	T	187;214;170;265	ENSP00000366982:R187T;ENSP00000444997:R214T;ENSP00000366983:R170T;ENSP00000297994:R265T	ENSP00000297994:R265T	R	+	2	0	RG9MTD3	37766352	0.625000	0.27111	0.141000	0.22245	0.466000	0.32739	0.737000	0.26144	-0.012000	0.14223	-0.136000	0.14681	AGA	.		0.443	TRMT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052482.1	NM_144964	
TSHZ2	128553	broad.mit.edu;bcgsc.ca	37	20	51872734	51872734	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr20:51872734A>G	ENST00000371497.5	+	2	3624	c.2737A>G	c.(2737-2739)Aca>Gca	p.T913A	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.T910A|TSHZ2_ENST00000603338.2_Missense_Mutation_p.T910A	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	913					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AACGGGCGGGACAAAATTTCT	0.468																																					p.T913A		.											.	TSHZ2	232	0			c.A2737G						.						68.0	69.0	69.0					20																	51872734		2203	4300	6503	SO:0001583	missense	128553	exon2			GGCGGGACAAAAT	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2737A>G	20.37:g.51872734A>G	ENSP00000360552:p.Thr913Ala	99.0	0.0		104.0	6.0	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	37	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	A	17.05	3.291049	0.59976	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.20881	2.05;2.04	5.8	4.67	0.58626	Homeobox (1);	0.046978	0.85682	D	0.000000	T	0.39462	0.1079	L	0.49126	1.545	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.16070	-1.0415	10	0.87932	D	0	-0.6052	12.8764	0.57991	0.8639:0.1361:0.0:0.0	.	913	Q9NRE2	TSH2_HUMAN	A	913;910;439	ENSP00000360552:T913A;ENSP00000333114:T910A	ENSP00000333114:T910A	T	+	1	0	TSHZ2	51306141	1.000000	0.71417	0.981000	0.43875	0.753000	0.42808	8.956000	0.93066	0.975000	0.38392	0.523000	0.50628	ACA	.		0.468	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
TTC17	55761	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	43411274	43411274	+	Missense_Mutation	SNP	A	A	G	rs567857161		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:43411274A>G	ENST00000039989.4	+	3	336	c.322A>G	c.(322-324)Aat>Gat	p.N108D	RP11-484D2.4_ENST00000394183.2_RNA|TTC17_ENST00000299240.6_Missense_Mutation_p.N108D	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	108					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						ACAGAGACATAATAAAGAAGA	0.408																																					p.N108D		.											.	TTC17	95	0			c.A322G						.						147.0	137.0	141.0					11																	43411274		2203	4300	6503	SO:0001583	missense	55761	exon3			AGACATAATAAAG	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.322A>G	11.37:g.43411274A>G	ENSP00000039989:p.Asn108Asp	199.0	1.0		220.0	68.0	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	37	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	A	11.02	1.515475	0.27123	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.31510	1.49;1.49	4.87	4.87	0.63330	.	0.048157	0.85682	D	0.000000	T	0.30103	0.0754	N	0.22421	0.69	0.36238	D	0.853051	D;P;D	0.64830	0.958;0.867;0.994	P;B;P	0.54664	0.577;0.267;0.758	T	0.24657	-1.0154	10	0.29301	T	0.29	-18.2799	10.0798	0.42381	0.8502:0.0:0.0:0.1498	.	108;108;108	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	D	108	ENSP00000299240:N108D;ENSP00000039989:N108D	ENSP00000039989:N108D	N	+	1	0	TTC17	43367850	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.852000	0.75430	1.944000	0.56390	0.460000	0.39030	AAT	.		0.408	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
TUBAL3	79861	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5437356	5437356	+	Silent	SNP	G	G	A	rs141292428	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr10:5437356G>A	ENST00000380419.3	-	3	367	c.330C>T	c.(328-330)taC>taT	p.Y110Y	TUBAL3_ENST00000479328.1_Silent_p.Y70Y	NM_024803.2	NP_079079.1	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	110					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(7)|prostate(2)|skin(3)	25						GGCCTCGCGCGTAATTGTTAG	0.617													G|||	7	0.00139776	0.0053	0.0	5008	,	,		17960	0.0		0.0	False		,,,				2504	0.0				p.Y110Y		.											.	TUBAL3	91	0			c.C330T						.	G	,	16,4390	23.3+/-48.9	0,16,2187	141.0	133.0	136.0		210,330	-8.2	0.0	10	dbSNP_134	136	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TUBAL3	NM_001171864.1,NM_024803.2	,	0,16,6487	AA,AG,GG		0.0,0.3631,0.123	,	70/407,110/447	5437356	16,12990	2203	4300	6503	SO:0001819	synonymous_variant	79861	exon3			TCGCGCGTAATTG	AK025318	CCDS7066.2, CCDS53491.1	10p15.1	2007-03-15			ENSG00000178462	ENSG00000178462		"""Tubulins"""	23534	protein-coding gene	gene with protein product							Standard	NM_024803		Approved	FLJ21665	uc001ihy.3	A6NHL2	OTTHUMG00000017595	ENST00000380419.3:c.330C>T	10.37:g.5437356G>A		134.0	0.0		112.0	31.0	NM_024803	B4DKL2|Q4QQJ5|Q9H6Z0	Silent	SNP	ENST00000380419.3	37	CCDS7066.2																																																																																			G|0.998;A|0.002		0.617	TUBAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046548.2	NM_024803	
TVP23C	201158	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	15406305	15406305	+	Missense_Mutation	SNP	T	T	A	rs141163711		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:15406305T>A	ENST00000225576.3	-	6	799	c.704A>T	c.(703-705)cAg>cTg	p.Q235L	TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	235						integral component of membrane (GO:0016021)		p.Q235P(1)									GGGCGCCATCTGTTGGCAGTT	0.587																																					p.Q235L		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.A704T						.						26.0	30.0	28.0					17																	15406305		2203	4300	6503	SO:0001583	missense	201158	exon6			GCCATCTGTTGGC	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.704A>T	17.37:g.15406305T>A	ENSP00000225576:p.Gln235Leu	148.0	0.0		132.0	36.0	NM_145301	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.649236	0.47362	.	.	ENSG00000175106	ENST00000225576	T	0.25912	1.77	3.65	2.54	0.30619	.	34.810200	0.00166	U	0.000001	T	0.20861	0.0502	N	0.22421	0.69	0.80722	D	1	P	0.47409	0.895	B	0.41332	0.354	T	0.15263	-1.0443	10	0.72032	D	0.01	-33.3475	6.0157	0.19601	0.0:0.1193:0.0:0.8807	.	235	Q96ET8	F18B2_HUMAN	L	235	ENSP00000225576:Q235L	ENSP00000225576:Q235L	Q	-	2	0	FAM18B2	15347030	0.932000	0.31603	0.718000	0.30602	0.101000	0.19017	1.117000	0.31234	0.752000	0.32923	0.377000	0.23210	CAG	T|1.000;C|0.000		0.587	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
UBAC2	337867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	99853763	99853763	+	Intron	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr13:99853763G>A	ENST00000403766.3	+	1	166				UBAC2_ENST00000376440.2_Missense_Mutation_p.G33E|UBAC2-AS1_ENST00000426037.2_lincRNA	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2						protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CGTGGCGAGGGAGCGCAGCTG	0.498											OREG0022482	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G33E		.											.	UBAC2	91	0			c.G98A						.						140.0	118.0	126.0					13																	99853763		2203	4300	6503	SO:0001627	intron_variant	337867	exon1			GCGAGGGAGCGCA	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.31+570G>A	13.37:g.99853763G>A		503.0	0.0	1346	501.0	166.0	NM_177967	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Missense_Mutation	SNP	ENST00000403766.3	37	CCDS45064.1	.	.	.	.	.	.	.	.	.	.	g	12.25	1.881257	0.33255	.	.	ENSG00000134882	ENST00000376440	.	.	.	3.06	0.758	0.18432	.	.	.	.	.	T	0.22551	0.0544	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21690	-1.0238	6	.	.	.	.	4.478	0.11753	0.6724:0.0:0.3276:0.0	.	33	Q8NBM4-2	.	E	33	.	.	G	+	2	0	UBAC2	98651764	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	0.107000	0.15375	0.148000	0.19059	0.454000	0.30748	GGA	.		0.498	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045588.1	NM_177967	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19482082	19482082	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:19482082G>T	ENST00000375254.3	-	43	6180	c.6153C>A	c.(6151-6153)ttC>ttA	p.F2051L	UBR4_ENST00000375217.2_Missense_Mutation_p.F2051L|UBR4_ENST00000375226.2_Missense_Mutation_p.F2051L|UBR4_ENST00000375267.2_Missense_Mutation_p.F2051L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2051					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CATTGAAAAGGAAGGTAACAT	0.438																																					p.F2051L		.											.	UBR4	612	0			c.C6153A						.						107.0	100.0	103.0					1																	19482082		2203	4300	6503	SO:0001583	missense	23352	exon43			GAAAAGGAAGGTA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6153C>A	1.37:g.19482082G>T	ENSP00000364403:p.Phe2051Leu	223.0	0.0		244.0	68.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850305	0.71719	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;3.06	5.14	1.03	0.20045	.	0.000000	0.85682	D	0.000000	T	0.29914	0.0748	L	0.43701	1.375	0.80722	D	1	P	0.49447	0.924	P	0.57776	0.827	T	0.02464	-1.1155	10	0.56958	D	0.05	.	11.2082	0.48782	0.2556:0.0:0.7444:0.0	.	2051	Q5T4S7	UBR4_HUMAN	L	2051;2051;2051;2051;761;1267	ENSP00000364403:F2051L;ENSP00000364416:F2051L;ENSP00000364365:F2051L;ENSP00000364374:F2051L;ENSP00000404897:F761L	ENSP00000364365:F2051L	F	-	3	2	UBR4	19354669	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.762000	0.38451	0.362000	0.24319	0.650000	0.86243	TTC	.		0.438	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UGT1A9	54600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234581246	234581246	+	Silent	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:234581246T>A	ENST00000354728.4	+	1	748	c.666T>A	c.(664-666)cgT>cgA	p.R222R	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Silent_p.R222R			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	222					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TATGCCACCGTTTTTTCAAAA	0.433																																					p.R222R		.											.	UGT1A9	91	0			c.T666A						.						215.0	224.0	221.0					2																	234581246		2203	4300	6503	SO:0001819	synonymous_variant	54600	exon1			CCACCGTTTTTTC	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.666T>A	2.37:g.234581246T>A		414.0	0.0		341.0	117.0	NM_021027	B8K285|P36509|Q9HAX0	Silent	SNP	ENST00000354728.4	37	CCDS2505.1																																																																																			.		0.433	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
UGT1A9	54600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	234581248	234581248	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:234581248T>A	ENST00000354728.4	+	1	750	c.668T>A	c.(667-669)tTt>tAt	p.F223Y	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609637.1_Missense_Mutation_p.F223Y			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	223					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TGCCACCGTTTTTTCAAAAAT	0.438																																					p.F223Y		.											.	UGT1A9	91	0			c.T668A						.						214.0	223.0	220.0					2																	234581248		2203	4300	6503	SO:0001583	missense	54600	exon1			ACCGTTTTTTCAA	AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.668T>A	2.37:g.234581248T>A	ENSP00000346768:p.Phe223Tyr	411.0	0.0		336.0	113.0	NM_021027	B8K285|P36509|Q9HAX0	Missense_Mutation	SNP	ENST00000354728.4	37	CCDS2505.1	.	.	.	.	.	.	.	.	.	.	T	7.881	0.730240	0.15507	.	.	ENSG00000241119	ENST00000354728	T	0.61158	0.13	3.22	1.98	0.26296	.	.	.	.	.	T	0.43722	0.1260	L	0.47078	1.49	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.15052	0.012;0.012	T	0.28554	-1.0040	9	0.22706	T	0.39	.	3.6356	0.08147	0.1655:0.1881:0.0:0.6464	.	223;223	Q5DSZ5;O60656	.;UD19_HUMAN	Y	223	ENSP00000346768:F223Y	ENSP00000346768:F223Y	F	+	2	0	UGT1A9	234245987	0.000000	0.05858	0.003000	0.11579	0.034000	0.12701	-0.034000	0.12225	0.395000	0.25257	0.362000	0.22060	TTT	.		0.438	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000130995.1	NM_021027	
UPK3B	80761	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	76141019	76141019	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:76141019C>T	ENST00000257632.5	+	2	574	c.446C>T	c.(445-447)gCc>gTc	p.A149V	UPK3B_ENST00000419923.2_Missense_Mutation_p.A149V|UPK3B_ENST00000394849.1_Missense_Mutation_p.A94V|UPK3B_ENST00000448265.3_Missense_Mutation_p.A149V|UPK3B_ENST00000334348.3_Missense_Mutation_p.A94V|UPK3B_ENST00000443097.2_Missense_Mutation_p.A94V			Q9BT76	UPK3B_HUMAN	uroplakin 3B	149					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				GACATTCCGGCCTCCCCACAG	0.657																																					p.A149V		.											.	UPK3B	90	0			c.C446T						.						16.0	15.0	16.0					7																	76141019		2199	4292	6491	SO:0001583	missense	80761	exon2			TTCCGGCCTCCCC	BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.446C>T	7.37:g.76141019C>T	ENSP00000257632:p.Ala149Val	415.0	0.0		416.0	109.0	NM_030570	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Missense_Mutation	SNP	ENST00000257632.5	37	CCDS5588.1	.	.	.	.	.	.	.	.	.	.	.	11.50	1.655888	0.29425	.	.	ENSG00000243566	ENST00000334348;ENST00000419923;ENST00000448265;ENST00000443097;ENST00000257632;ENST00000394849	T;T;T;T;T;T	0.55930	0.49;1.42;1.42;0.49;1.42;1.43	5.08	5.08	0.68730	.	0.528723	0.18103	N	0.151631	T	0.41003	0.1140	N	0.14661	0.345	0.20307	N	0.999912	P;P;P	0.49253	0.921;0.867;0.525	P;B;B	0.45913	0.497;0.295;0.165	T	0.25433	-1.0132	9	.	.	.	-13.7506	13.9688	0.64225	0.0:1.0:0.0:0.0	.	94;149;94	Q9BT76-2;Q9BT76;A6NHH5	.;UPK3B_HUMAN;.	V	94;149;149;94;149;94	ENSP00000334938:A94V;ENSP00000441602:A149V;ENSP00000441284:A149V;ENSP00000444585:A94V;ENSP00000257632:A149V;ENSP00000378319:A94V	.	A	+	2	0	UPK3B	75978955	0.000000	0.05858	0.151000	0.22473	0.045000	0.14185	0.370000	0.20433	2.362000	0.80069	0.467000	0.42956	GCC	.		0.657	UPK3B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313978.2	NM_030570	
VAV3	10451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	108322079	108322079	+	Silent	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:108322079A>T	ENST00000370056.4	-	3	631	c.357T>A	c.(355-357)ccT>ccA	p.P119P	VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Silent_p.P119P|VAV3_ENST00000371846.4_Silent_p.P54P	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	119	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		CCAATGCTATAGGTGTTCGAG	0.328																																					p.P119P		.											.	VAV3	1339	0			c.T357A						.						117.0	110.0	113.0					1																	108322079		2203	4300	6503	SO:0001819	synonymous_variant	10451	exon3			TGCTATAGGTGTT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.357T>A	1.37:g.108322079A>T		83.0	0.0		112.0	39.0	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Silent	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	A	8.499	0.863779	0.17250	.	.	ENSG00000134215	ENST00000490388	.	.	.	5.66	-1.36	0.09085	.	.	.	.	.	T	0.23766	0.0575	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26710	-1.0095	4	.	.	.	.	1.9031	0.03272	0.432:0.2491:0.0737:0.2451	.	.	.	.	Q	114	.	.	L	-	2	0	VAV3	108123602	0.066000	0.20996	0.901000	0.35422	0.579000	0.36224	-0.941000	0.03925	-0.533000	0.06323	0.528000	0.53228	CTA	.		0.328	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
URB2	9816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	229779359	229779359	+	Silent	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:229779359G>A	ENST00000258243.2	+	5	3850	c.3714G>A	c.(3712-3714)ggG>ggA	p.G1238G		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1238						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TAGAGGTTGGGACGACAGAGG	0.498																																					p.G1238G		.											.	URB2	174	0			c.G3714A						.						180.0	164.0	170.0					1																	229779359		2203	4300	6503	SO:0001819	synonymous_variant	9816	exon5			GGTTGGGACGACA	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3714G>A	1.37:g.229779359G>A		208.0	0.0		253.0	127.0	NM_014777	Q5VYC9	Silent	SNP	ENST00000258243.2	37	CCDS31052.1																																																																																			.		0.498	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
VEGFC	7424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177608449	177608449	+	Missense_Mutation	SNP	G	G	C	rs373146571		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr4:177608449G>C	ENST00000280193.2	-	6	1452	c.1037C>G	c.(1036-1038)aCc>aGc	p.T346S	VEGFC_ENST00000507638.1_5'Flank|RP11-313E19.2_ENST00000509194.1_RNA|RP11-313E19.2_ENST00000504017.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	346	4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		TCTGGGGCAGGTTCTTTTACA	0.433																																					p.T346S		.											VEGFC,NS,carcinoma,-1	VEGFC	710	0			c.C1037G						.						264.0	235.0	244.0					4																	177608449		1849	4101	5950	SO:0001583	missense	7424	exon6			GGGCAGGTTCTTT	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.1037C>G	4.37:g.177608449G>C	ENSP00000280193:p.Thr346Ser	257.0	0.0		230.0	89.0	NM_005429	B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322855	0.23994	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.61	3.79	0.43588	.	0.184991	0.46442	D	0.000282	T	0.45856	0.1363	L	0.36672	1.1	0.34618	D	0.718292	B	0.17852	0.024	B	0.18561	0.022	T	0.52434	-0.8576	9	0.22109	T	0.4	-6.1851	13.1086	0.59261	0.0689:0.1239:0.8072:0.0	.	346	P49767	VEGFC_HUMAN	S	346	.	ENSP00000280193:T346S	T	-	2	0	VEGFC	177845443	0.950000	0.32346	0.994000	0.49952	0.923000	0.55619	1.903000	0.39858	1.364000	0.46038	0.650000	0.86243	ACC	.		0.433	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
VPS51	738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	64877952	64877952	+	Splice_Site	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:64877952A>G	ENST00000279281.3	+	8	1970		c.e8-1		AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_Splice_Site|TM7SF2_ENST00000540748.1_5'Flank|TM7SF2_ENST00000279263.7_5'Flank|TM7SF2_ENST00000345348.5_5'Flank	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)						autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TTTTACCACCAGGTGGGGCTC	0.597											OREG0021071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	.	.	0			c.1879-2A>G						.						97.0	104.0	102.0					11																	64877952		2201	4297	6498	SO:0001630	splice_region_variant	738	exon8			ACCACCAGGTGGG	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.1879-1A>G	11.37:g.64877952A>G		149.0	0.0	1079	148.0	59.0	NM_013265	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Splice_Site	SNP	ENST00000279281.3	37	CCDS8093.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.060064	0.55432	.	.	ENSG00000149823	ENST00000279281;ENST00000526856	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5937	0.56456	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C11orf2	64634528	1.000000	0.71417	0.999000	0.59377	0.571000	0.35966	8.770000	0.91746	2.141000	0.66446	0.402000	0.26972	.	.		0.597	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265	Intron
VPS53	55275	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	531471	531479	+	Splice_Site	DEL	TCTAGTAAA	TCTAGTAAA	-	rs188572742	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	TCTAGTAAA	TCTAGTAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:531471_531479delTCTAGTAAA	ENST00000571805.1	-	9	824	c.688delTTTACTAGA	c.(688-690)ttt>tt	p.F230del	VPS53_ENST00000574029.1_Intron|VPS53_ENST00000437048.2_Splice_Site_p.F230del|VPS53_ENST00000401468.3_Intron|VPS53_ENST00000446250.2_Splice_Site_p.F32del|VPS53_ENST00000291074.5_Splice_Site_p.F201del|VPS53_ENST00000576149.1_5'UTR			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	230					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CCTCCTGGTCTCTAGTAAAACAAACATGT	0.407																																					p.230_230del		.											.	VPS53	90	0			c.688_688del						.																																			SO:0001630	splice_region_variant	55275	exon9			CTGGTCTCTAGTA		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.688-1TTTACTAGA>-	17.37:g.531471_531479delTCTAGTAAA		103.0	0.0		72.0	20.0	NM_001128159	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Frame_Shift_Del	DEL	ENST00000571805.1	37																																																																																				.		0.407	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289	In_Frame_Del
WBSCR22	114049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73105342	73105342	+	Splice_Site	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr7:73105342C>A	ENST00000265758.2	+	6	517	c.459C>A	c.(457-459)ctC>ctA	p.L153L	WBSCR22_ENST00000423166.2_Intron|WBSCR22_ENST00000423497.1_Splice_Site_p.L153L	NM_017528.4	NP_059998.2	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	153					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|large_intestine(2)|lung(9)|prostate(1)	13		Lung NSC(55;0.0908)|all_lung(88;0.198)				TTTCTGTTCTCGTGAGTATAA	0.473																																					p.L153L		.											.	WBSCR22	90	0			c.C459A						.						238.0	225.0	230.0					7																	73105342		2203	4300	6503	SO:0001630	splice_region_variant	114049	exon6			TGTTCTCGTGAGT	AF420248	CCDS5557.1, CCDS56490.1	7q11.23	2012-06-12			ENSG00000071462	ENSG00000071462			16405	protein-coding gene	gene with protein product	"""metastasis-related methyltransferase 1"""	615733				12073013, 11978965, 21148752	Standard	NM_001202560		Approved	MGC19709, MGC2022, MGC5140, PP3381, WBMT, MERM1	uc003tyt.3	O43709	OTTHUMG00000023306	ENST00000265758.2:c.459+1C>A	7.37:g.73105342C>A		361.0	0.0		329.0	117.0	NM_001202560	A8K501|C9K060|Q96P12|Q9BQ58|Q9HBP9	Silent	SNP	ENST00000265758.2	37	CCDS5557.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802309	0.90538	.	.	ENSG00000071462	ENST00000442099	.	.	.	5.37	-1.11	0.09840	.	.	.	.	.	T	0.55178	0.1904	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46803	-0.9165	4	.	.	.	-20.6338	9.4661	0.38813	0.0:0.2736:0.4255:0.3009	.	.	.	.	S	33	.	.	R	+	1	0	WBSCR22	72743278	1.000000	0.71417	0.912000	0.35992	0.793000	0.44817	1.556000	0.36288	-0.600000	0.05790	-0.657000	0.03884	CGT	.		0.473	WBSCR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252303.1		Silent
CFAP57	149465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43638463	43638463	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr1:43638463T>C	ENST00000372492.4	+	2	363	c.39T>C	c.(37-39)ggT>ggC	p.G13G	EBNA1BP2_ENST00000472982.1_5'Flank|EBNA1BP2_ENST00000431635.2_5'Flank|EBNA1BP2_ENST00000236051.2_5'Flank|WDR65_ENST00000528956.1_Silent_p.G13G	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		13										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATGTTTTTGGTCTTCGATCCC	0.478																																					p.G13G		.											.	WDR65	91	0			c.T39C						.						145.0	128.0	134.0					1																	43638463		2203	4300	6503	SO:0001819	synonymous_variant	149465	exon2			TTTTGGTCTTCGA																												ENST00000372492.4:c.39T>C	1.37:g.43638463T>C		158.0	0.0		170.0	27.0	NM_001195831	A6NKQ3|Q17RI9|Q5TAI0	Silent	SNP	ENST00000372492.4	37																																																																																				.		0.478	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
WWC3	55841	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	10094158	10094158	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chrX:10094158A>G	ENST00000380861.4	+	15	2309	c.1918A>G	c.(1918-1920)Atc>Gtc	p.I640V	WWC3_ENST00000454666.1_Missense_Mutation_p.I640V	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	640	C2.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TTGCAGCCACATCCGAGTCTA	0.607																																					p.I640V		.											.	WWC3	134	0			c.A1918G						.						180.0	177.0	178.0					X																	10094158		2203	4300	6503	SO:0001583	missense	55841	exon15			AGCCACATCCGAG	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.1918A>G	X.37:g.10094158A>G	ENSP00000370242:p.Ile640Val	112.0	0.0		121.0	79.0	NM_015691	A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	ENST00000380861.4	37	CCDS14136.1	.	.	.	.	.	.	.	.	.	.	A	3.393	-0.123822	0.06795	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.23348	1.91;1.91	4.86	-0.459	0.12179	C2 calcium/lipid-binding domain, CaLB (1);	0.510624	0.22758	N	0.055985	T	0.15652	0.0377	L	0.31120	0.905	0.29179	N	0.876653	B	0.06786	0.001	B	0.12156	0.007	T	0.23976	-1.0173	9	.	.	.	-12.8248	10.3375	0.43858	0.5:0.0:0.5:0.0	.	640	Q9ULE0	WWC3_HUMAN	V	640;640;135	ENSP00000370242:I640V;ENSP00000399584:I640V	.	I	+	1	0	WWC3	10054158	0.995000	0.38212	0.611000	0.29010	0.045000	0.14185	0.883000	0.28200	-0.489000	0.06716	-0.314000	0.08810	ATC	.		0.607	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
ZBTB16	7704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	114113007	114113007	+	Silent	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:114113007C>T	ENST00000335953.4	+	5	1952	c.1572C>T	c.(1570-1572)aaC>aaT	p.N524N	ZBTB16_ENST00000392996.2_Silent_p.N524N|RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000535379.1_3'UTR	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	524					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GTGAGTGCAACCGCACCTTCC	0.632																																					p.N524N		.											.	ZBTB16	659	0			c.C1572T						.						57.0	45.0	49.0					11																	114113007		2201	4296	6497	SO:0001819	synonymous_variant	7704	exon5			GTGCAACCGCACC	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1572C>T	11.37:g.114113007C>T		126.0	0.0		124.0	49.0	NM_006006	Q8TAL4	Silent	SNP	ENST00000335953.4	37	CCDS8367.1																																																																																			.		0.632	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
ZC3H8	84524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	112989510	112989510	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:112989510T>G	ENST00000409573.2	-	7	877	c.748A>C	c.(748-750)Aag>Cag	p.K250Q	ZC3H8_ENST00000272570.5_Missense_Mutation_p.K250Q|ZC3H8_ENST00000476902.1_5'Flank			Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	250					apoptotic process (GO:0006915)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to antibiotic (GO:0046677)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|T cell homeostasis (GO:0043029)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	7						TGGTAAAACTTACAAGGATAT	0.313																																					p.K250Q		.											.	ZC3H8	226	0			c.A748C						.						89.0	88.0	88.0					2																	112989510		1889	4135	6024	SO:0001583	missense	84524	exon7			AAAACTTACAAGG	AF334161	CCDS46392.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000144161	ENSG00000144161		"""Zinc fingers, CCCH-type domain containing"""	30941	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 8"""	ZC3HDC8		12477932	Standard	NM_032494		Approved	Fliz1	uc021vmw.1	Q8N5P1	OTTHUMG00000153270	ENST00000409573.2:c.748A>C	2.37:g.112989510T>G	ENSP00000386488:p.Lys250Gln	63.0	0.0		74.0	24.0	NM_032494	Q9BZ75	Missense_Mutation	SNP	ENST00000409573.2	37	CCDS46392.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470279	0.63625	.	.	ENSG00000144161	ENST00000409573;ENST00000272570	T;T	0.39787	1.06;1.06	4.73	4.73	0.59995	Zinc finger, CCCH-type (2);	1.625670	0.03800	N	0.264353	T	0.71384	0.3333	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.53781	-0.8390	10	0.72032	D	0.01	1.4205	14.3393	0.66614	0.0:0.0:0.0:1.0	.	250	Q8N5P1	ZC3H8_HUMAN	Q	250	ENSP00000386488:K250Q;ENSP00000272570:K250Q	ENSP00000272570:K250Q	K	-	1	0	ZC3H8	112705981	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.248000	0.78268	2.103000	0.63969	0.379000	0.24179	AAG	.		0.313	ZC3H8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330521.3	NM_032494	
ZFP37	7539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	115805892	115805892	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:115805892G>C	ENST00000374227.3	-	4	1033	c.1006C>G	c.(1006-1008)Ctt>Gtt	p.L336V	ZFP37_ENST00000555206.1_Missense_Mutation_p.L337V|ZFP37_ENST00000553380.1_Missense_Mutation_p.L351V	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TGTACAACAAGGTGTGACTTT	0.423																																					p.L336V		.											.	ZFP37	92	0			c.C1006G						.						120.0	113.0	116.0					9																	115805892		2203	4300	6503	SO:0001583	missense	7539	exon4			CAACAAGGTGTGA	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.1006C>G	9.37:g.115805892G>C	ENSP00000363344:p.Leu336Val	177.0	0.0		128.0	46.0	NM_003408	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	ENST00000374227.3	37	CCDS6787.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537518	0.27475	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.52983	0.64;0.64;0.64	4.0	4.0	0.46444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38272	N	0.001745	T	0.71558	0.3354	M	0.90814	3.15	0.31599	N	0.652919	B;B;D	0.67145	0.236;0.443;0.996	B;B;D	0.66196	0.17;0.233;0.942	T	0.78971	-0.1993	10	0.87932	D	0	-11.2728	14.4119	0.67119	0.0:0.0:1.0:0.0	.	337;351;336	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	V	336;337;351	ENSP00000363344:L336V;ENSP00000451310:L337V;ENSP00000452552:L351V	ENSP00000363344:L336V	L	-	1	0	ZFP37	114845713	0.622000	0.27085	1.000000	0.80357	0.999000	0.98932	2.049000	0.41288	2.524000	0.85096	0.563000	0.77884	CTT	.		0.423	ZFP37-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055439.1	NM_003408	
ZFP82	284406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36884388	36884388	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:36884388T>G	ENST00000392161.3	-	5	1096	c.854A>C	c.(853-855)aAa>aCa	p.K285T	ZFP82_ENST00000392171.1_Missense_Mutation_p.K285T	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	285					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCCACACTCTTTACACACATA	0.453																																					p.K285T		.											.	ZFP82	91	0			c.A854C						.						150.0	147.0	148.0					19																	36884388		2203	4300	6503	SO:0001583	missense	284406	exon5			CACTCTTTACACA	AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.854A>C	19.37:g.36884388T>G	ENSP00000431265:p.Lys285Thr	118.0	0.0		121.0	64.0	NM_133466	Q8NC63|Q8TF53	Missense_Mutation	SNP	ENST00000392161.3	37	CCDS12493.1	.	.	.	.	.	.	.	.	.	.	T	8.717	0.913484	0.17907	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	T;T	0.08458	3.09;3.09	4.34	0.932	0.19466	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.336296	0.21375	N	0.075562	T	0.04998	0.0134	N	0.17248	0.465	0.21473	N	0.999675	B	0.06786	0.001	B	0.16289	0.015	T	0.35847	-0.9772	10	0.44086	T	0.13	.	8.0553	0.30602	0.0:0.094:0.5441:0.3619	.	285	Q8N141	ZFP82_HUMAN	T	285	ENSP00000431265:K285T;ENSP00000446080:K285T	ENSP00000431265:K285T	K	-	2	0	ZFP82	41576228	0.000000	0.05858	0.999000	0.59377	0.801000	0.45260	-2.029000	0.01430	0.301000	0.22738	-0.418000	0.06021	AAA	.		0.453	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109552.2	NM_133466	
ZNF215	7762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6977459	6977459	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:6977459C>A	ENST00000278319.5	+	7	1839	c.1251C>A	c.(1249-1251)aaC>aaA	p.N417K	ZNF215_ENST00000414517.2_Missense_Mutation_p.N417K|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	417					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		GATTCTTCAACCGACGTACAA	0.428																																					p.N417K		.											.	ZNF215	514	0			c.C1251A						.						78.0	76.0	76.0					11																	6977459		2201	4296	6497	SO:0001583	missense	7762	exon7			CTTCAACCGACGT	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1251C>A	11.37:g.6977459C>A	ENSP00000278319:p.Asn417Lys	38.0	0.0		43.0	14.0	NM_013250	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021184	0.35701	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.14893	2.47;2.47	4.85	-1.48	0.08745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000253	T	0.05640	0.0148	N	0.04669	-0.19	0.09310	N	1	B	0.29552	0.248	B	0.31245	0.126	T	0.21484	-1.0244	10	0.54805	T	0.06	-4.9298	1.5037	0.02482	0.1444:0.288:0.1408:0.4269	.	417	Q9UL58	ZN215_HUMAN	K	417	ENSP00000278319:N417K;ENSP00000393202:N417K	ENSP00000278319:N417K	N	+	3	2	ZNF215	6934035	0.000000	0.05858	0.046000	0.18839	0.579000	0.36224	-2.095000	0.01350	-0.131000	0.11578	-0.175000	0.13238	AAC	.		0.428	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1		
ZNF22	7570	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	45499035	45499035	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr10:45499035C>A	ENST00000298299.3	+	2	812	c.219C>A	c.(217-219)caC>caA	p.H73Q	CEP164P1_ENST00000456938.2_RNA|C10orf25_ENST00000298298.1_5'Flank	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22	73					odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				TTTTTCAACACCAGAAGATCC	0.393																																					p.H73Q		.											.	ZNF22	154	0			c.C219A						.						52.0	53.0	52.0					10																	45499035		2203	4300	6503	SO:0001583	missense	7570	exon2			TCAACACCAGAAG	BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.219C>A	10.37:g.45499035C>A	ENSP00000298299:p.His73Gln	47.0	0.0		43.0	12.0	NM_006963	Q5T741|Q96FM4	Missense_Mutation	SNP	ENST00000298299.3	37	CCDS7211.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684432	0.68157	.	.	ENSG00000165512	ENST00000298299	D	0.99974	-10.2	5.12	0.975	0.19721	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000088	D	0.99971	0.9990	M	0.90922	3.16	0.42499	D	0.992926	D	0.89917	1.0	D	0.87578	0.998	D	0.94939	0.8089	10	0.87932	D	0	-29.3728	8.2413	0.31662	0.0:0.6166:0.0:0.3834	.	73	P17026	ZNF22_HUMAN	Q	73	ENSP00000298299:H73Q	ENSP00000298299:H73Q	H	+	3	2	ZNF22	44819041	0.008000	0.16893	1.000000	0.80357	0.993000	0.82548	-0.067000	0.11579	0.277000	0.22141	0.655000	0.94253	CAC	.		0.393	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047761.1	NM_006963	
ZNF383	163087	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	37734483	37734484	+	Frame_Shift_Del	DEL	CC	CC	-	rs149725989		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:37734483_37734484delCC	ENST00000589413.1	+	8	1928_1929	c.1345_1346delCC	c.(1345-1347)cccfs	p.P449fs	ZNF383_ENST00000590503.1_Frame_Shift_Del_p.P449fs|ZNF383_ENST00000352998.3_Frame_Shift_Del_p.P449fs			Q8NA42	ZN383_HUMAN	zinc finger protein 383	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGGTGAAAAGCCCTATAACTGT	0.366																																					p.449_449del		.											.	ZNF383	92	0			c.1345_1346del						.																																			SO:0001589	frameshift_variant	163087	exon5			GAAAAGCCCTATA	AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.1345_1346delCC	19.37:g.37734483_37734484delCC	ENSP00000464871:p.Pro449fs	79.0	0.0		66.0	20.0	NM_152604	Q6X2C7	Frame_Shift_Del	DEL	ENST00000589413.1	37	CCDS12501.1																																																																																			.		0.366	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458141.1	NM_152604	
ZNF397	84307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	32826113	32826113	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr18:32826113C>T	ENST00000330501.7	+	4	1597	c.1444C>T	c.(1444-1446)Cag>Tag	p.Q482*	ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000592264.1_Intron|ZNF397_ENST00000261333.6_Intron	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	482					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						GGAACCTTATCAGTGTAATGA	0.398																																					p.Q482X		.											.	ZNF397	90	0			c.C1444T						.						113.0	115.0	114.0					18																	32826113		692	1591	2283	SO:0001587	stop_gained	84307	exon4			CCTTATCAGTGTA	BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.1444C>T	18.37:g.32826113C>T	ENSP00000331577:p.Gln482*	172.0	0.0		169.0	64.0	NM_001135178	Q9BRM2	Nonsense_Mutation	SNP	ENST00000330501.7	37	CCDS45852.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164590	0.94727	.	.	ENSG00000186812	ENST00000330501	.	.	.	4.31	3.35	0.38373	.	0.000000	0.32231	N	0.006391	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9308	0.24439	0.1946:0.617:0.1884:0.0	.	.	.	.	X	482	.	.	Q	+	1	0	ZNF397	31080111	0.000000	0.05858	1.000000	0.80357	0.823000	0.46562	-0.637000	0.05459	2.392000	0.81423	0.305000	0.20034	CAG	.		0.398	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442398.1	NM_032347	
ZNF560	147741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9578276	9578276	+	Silent	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:9578276T>C	ENST00000301480.4	-	10	1560	c.1347A>G	c.(1345-1347)ggA>ggG	p.G449G		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						CTCTCAAATGTCCAAAAAGAG	0.398																																					p.G449G		.											.	ZNF560	158	0			c.A1347G						.						134.0	147.0	143.0					19																	9578276		2203	4300	6503	SO:0001819	synonymous_variant	147741	exon10			CAAATGTCCAAAA	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1347A>G	19.37:g.9578276T>C		146.0	0.0		131.0	56.0	NM_152476	Q495S9|Q495T1	Silent	SNP	ENST00000301480.4	37	CCDS12214.1																																																																																			.		0.398	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
ZNF432	9668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52538392	52538392	+	Silent	SNP	A	A	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:52538392A>T	ENST00000594154.1	-	5	752	c.540T>A	c.(538-540)tcT>tcA	p.S180S	ZNF432_ENST00000221315.5_Silent_p.S180S			O94892	ZN432_HUMAN	zinc finger protein 432	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TTGTACTTACAGAGAATTTAG	0.353																																					p.S180S		.											.	ZNF432	154	0			c.T540A						.						66.0	65.0	65.0					19																	52538392		2203	4300	6503	SO:0001819	synonymous_variant	9668	exon5			ACTTACAGAGAAT	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.540T>A	19.37:g.52538392A>T		81.0	0.0		100.0	30.0	NM_014650		Silent	SNP	ENST00000594154.1	37	CCDS12848.1																																																																																			.		0.353	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650	
ZNF594	84622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	5085970	5085970	+	Missense_Mutation	SNP	G	G	T	rs181984106	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:5085970G>T	ENST00000399604.4	-	1	1722	c.1582C>A	c.(1582-1584)Cgc>Agc	p.R528S	ZNF594_ENST00000575779.1_Missense_Mutation_p.R528S			Q96JF6	ZN594_HUMAN	zinc finger protein 594	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						AAAGCTGTGCGCCAAATGAAG	0.463																																					p.R528S		.											.	ZNF594	71	0			c.C1582A						.						103.0	100.0	101.0					17																	5085970		2167	4290	6457	SO:0001583	missense	84622	exon2			CTGTGCGCCAAAT	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.1582C>A	17.37:g.5085970G>T	ENSP00000382513:p.Arg528Ser	166.0	0.0		160.0	61.0	NM_032530	Q6RFS0	Missense_Mutation	SNP	ENST00000399604.4	37	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.359912	0.00016	.	.	ENSG00000180626	ENST00000399604;ENST00000389222	T	0.14144	2.53	0.886	-1.77	0.07982	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05456	0.0144	N	0.17564	0.495	0.09310	N	1	B	0.28605	0.217	B	0.24394	0.053	T	0.40232	-0.9574	9	0.02654	T	1	.	6.1087	0.20087	0.4474:0.0:0.5526:0.0	.	528	Q96JF6	ZN594_HUMAN	S	528;123	ENSP00000382513:R528S	ENSP00000373874:R123S	R	-	1	0	ZNF594	5026694	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.225000	0.01212	-2.113000	0.00833	-2.108000	0.00357	CGC	G|0.999;A|0.001		0.463	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
ZNF618	114991	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	116770657	116770657	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr9:116770657C>T	ENST00000374126.5	+	8	773	c.674C>T	c.(673-675)gCa>gTa	p.A225V	ZNF618_ENST00000288466.7_Missense_Mutation_p.A193V			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						GAGAACCGGGCAGGTAAGTCC	0.632																																					p.A193V		.											.	ZNF618	22	0			c.C578T						.						73.0	84.0	80.0					9																	116770657		1966	4131	6097	SO:0001583	missense	114991	exon7			ACCGGGCAGGTAA	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.674C>T	9.37:g.116770657C>T	ENSP00000363241:p.Ala225Val	123.0	0.0		112.0	34.0	NM_133374	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	ENST00000374126.5	37		.	.	.	.	.	.	.	.	.	.	C	15.35	2.806307	0.50421	.	.	ENSG00000157657	ENST00000374126;ENST00000288466;ENST00000374124	T;T	0.19394	4.33;2.15	5.98	5.98	0.97165	.	0.144170	0.47852	D	0.000203	T	0.31295	0.0792	N	0.19112	0.55	0.27485	N	0.952452	D;B;B;B;P	0.63880	0.993;0.19;0.44;0.239;0.705	D;B;B;B;B	0.68192	0.956;0.068;0.118;0.167;0.359	T	0.10730	-1.0617	10	0.45353	T	0.12	-9.4771	15.9562	0.79889	0.0:1.0:0.0:0.0	.	193;193;225;193;193	B5MDS3;B9EG82;Q5T7W0;Q5T7W0-2;Q5T7W0-3	.;.;ZN618_HUMAN;.;.	V	225;193;193	ENSP00000288466:A193V;ENSP00000363239:A193V	ENSP00000288466:A193V	A	+	2	0	ZNF618	115810478	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.218000	0.58554	2.847000	0.97988	0.591000	0.81541	GCA	.		0.632	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983	
ZNF638	27332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	71577282	71577282	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr2:71577282G>A	ENST00000409544.1	+	2	1828	c.1198G>A	c.(1198-1200)Gat>Aat	p.D400N	ZNF638_ENST00000355812.3_Missense_Mutation_p.D400N|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Missense_Mutation_p.D400N|ZNF638_ENST00000264447.4_Missense_Mutation_p.D400N	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	400					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTCACATGCTGATGCCCAGAA	0.408																																					p.D400N		.											.	ZNF638	94	0			c.G1198A						.						142.0	140.0	141.0					2																	71577282		2203	4300	6503	SO:0001583	missense	27332	exon2			CATGCTGATGCCC	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1198G>A	2.37:g.71577282G>A	ENSP00000386433:p.Asp400Asn	58.0	0.0		82.0	6.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266494	0.40095	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.74842	-0.29;-0.88;0.3;-0.27;1.32;1.32	5.85	4.98	0.66077	.	0.377447	0.29335	N	0.012444	T	0.60379	0.2264	N	0.14661	0.345	0.28440	N	0.916847	D;P;P;P;P	0.56521	0.976;0.873;0.873;0.799;0.787	P;B;P;B;B	0.46452	0.517;0.42;0.517;0.272;0.42	T	0.54576	-0.8273	10	0.15499	T	0.54	-10.4049	12.5196	0.56052	0.08:0.0:0.92:0.0	.	506;400;400;400;400	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	N	400;506;400;400;400;400	ENSP00000386669:D400N;ENSP00000438189:D506N;ENSP00000348066:D400N;ENSP00000367033:D400N;ENSP00000264447:D400N;ENSP00000386433:D400N	ENSP00000264447:D400N	D	+	1	0	ZNF638	71430790	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.860000	0.48372	1.493000	0.48517	0.655000	0.94253	GAT	.		0.408	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
ZNF652	22834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47390068	47390068	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr17:47390068T>C	ENST00000362063.2	-	3	1358	c.1040A>G	c.(1039-1041)cAc>cGc	p.H347R	ZNF652_ENST00000430262.2_Missense_Mutation_p.H347R	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			ACCAACCATGTGTTTCCGCAC	0.383																																					p.H347R		.											.	ZNF652	91	0			c.A1040G						.						71.0	71.0	71.0					17																	47390068		2203	4300	6503	SO:0001583	missense	22834	exon3			ACCATGTGTTTCC	AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1040A>G	17.37:g.47390068T>C	ENSP00000354686:p.His347Arg	80.0	0.0		121.0	32.0	NM_001145365	A4QPD9|Q5H9Q0	Missense_Mutation	SNP	ENST00000362063.2	37	CCDS32677.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.447319	0.84101	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	D;D	0.86865	-2.18;-2.18	5.67	5.67	0.87782	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95834	0.8644	H	0.97131	3.945	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.97268	0.9909	10	0.87932	D	0	-15.4672	15.5774	0.76404	0.0:0.0:0.0:1.0	.	347	Q9Y2D9	ZN652_HUMAN	R	347	ENSP00000354686:H347R;ENSP00000416305:H347R	ENSP00000354686:H347R	H	-	2	0	ZNF652	44745067	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.164000	0.68074	0.482000	0.46254	CAC	.		0.383	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364524.1	NM_014897	
ZNF675	171392	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	23837293	23837293	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr19:23837293T>G	ENST00000359788.4	-	4	610	c.442A>C	c.(442-444)Aaa>Caa	p.K148Q	ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	148				K -> E (in Ref. 1; AAK95822). {ECO:0000305}.	bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTCACATATTTATCACATTGA	0.308																																					p.K148Q		.											.	ZNF675	228	0			c.A442C						.						68.0	68.0	68.0					19																	23837293		2202	4298	6500	SO:0001583	missense	171392	exon4			CATATTTATCACA		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.442A>C	19.37:g.23837293T>G	ENSP00000352836:p.Lys148Gln	97.0	0.0		119.0	6.0	NM_138330	Q8N211	Missense_Mutation	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	9.941	1.217491	0.22373	.	.	ENSG00000197372	ENST00000359788	T	0.27256	1.68	0.916	-0.309	0.12769	.	.	.	.	.	T	0.24198	0.0586	M	0.65320	2	0.09310	N	1	B	0.32350	0.366	B	0.37304	0.246	T	0.28267	-1.0049	9	0.35671	T	0.21	.	3.793	0.08728	0.0:0.6215:0.0:0.3785	.	148	Q8TD23	ZN675_HUMAN	Q	148	ENSP00000352836:K148Q	ENSP00000352836:K148Q	K	-	1	0	ZNF675	23629133	0.000000	0.05858	0.292000	0.24919	0.289000	0.27227	-0.259000	0.08721	0.257000	0.21650	0.254000	0.18369	AAA	.		0.308	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	
RAD9A	5883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	67163617	67163618	+	Missense_Mutation	DNP	TC	TC	AG	rs185216264		TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:67163617_67163618TC>AG	ENST00000307980.2	+	8	798_799	c.705_706TC>AG	c.(703-708)aaTCtt>aaAGtt	p.235_236NL>KV	PPP1CA_ENST00000532446.1_5'Flank|RAD9A_ENST00000535644.1_3'UTR|RNU6-1238P_ENST00000517215.1_RNA	NM_001243224.1|NM_004584.2	NP_001230153.1|NP_004575.1	Q99638	RAD9A_HUMAN	RAD9 homolog A (S. pombe)	235					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|enzyme binding (GO:0019899)|exodeoxyribonuclease III activity (GO:0008853)|histone deacetylase binding (GO:0042826)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			lung(7)|upper_aerodigestive_tract(1)	8			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			CAAACTTGAATCTTAGCATTCA	0.594								Other conserved DNA damage response genes																													p.NL235KV		.											.	.	.	0			.						.																																			SO:0001583	missense	5883	.			CTTGAATCTTAGC	U53174	CCDS8159.1	11q13.1-q13.2	2008-02-05	2003-07-21	2003-07-23	ENSG00000172613	ENSG00000172613			9827	protein-coding gene	gene with protein product		603761	"""RAD9 (S. pombe) homolog"""	RAD9		8943031	Standard	NM_004584		Approved		uc001okr.3	Q99638	OTTHUMG00000167670	Exception_encountered	11.37:g.67163617_67163618delinsAG	ENSP00000311360:p.N235_L236delinsKV	145.0	0.0		142.0	51.0	.	B2RCZ8|Q6FI29|Q96C41	Missense_Mutation	DNP	ENST00000307980.2	37	CCDS8159.1																																																																																			.		0.594	RAD9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395481.2	NM_004584	
ZW10	9183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	113619110	113619110	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr11:113619110T>G	ENST00000200135.3	-	8	1102	c.958A>C	c.(958-960)Aaa>Caa	p.K320Q		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	320					ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		GTAGATGTTTTTTCATTTTCC	0.378																																					p.K320Q		.											.	ZW10	228	0			c.A958C						.						97.0	90.0	93.0					11																	113619110		2201	4296	6497	SO:0001583	missense	9183	exon8			ATGTTTTTTCATT	U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.958A>C	11.37:g.113619110T>G	ENSP00000200135:p.Lys320Gln	167.0	0.0		196.0	67.0	NM_004724	A1A528	Missense_Mutation	SNP	ENST00000200135.3	37	CCDS8363.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.859870	0.32884	.	.	ENSG00000086827	ENST00000200135	T	0.48522	0.81	5.49	5.49	0.81192	.	0.313273	0.35013	N	0.003503	T	0.42314	0.1197	L	0.57536	1.79	0.53005	D	0.999965	B	0.29136	0.234	B	0.34536	0.185	T	0.26643	-1.0097	10	0.13853	T	0.58	-8.3319	8.3543	0.32321	0.0:0.147:0.0:0.853	.	320	O43264	ZW10_HUMAN	Q	320	ENSP00000200135:K320Q	ENSP00000200135:K320Q	K	-	1	0	ZW10	113124320	1.000000	0.71417	0.663000	0.29738	0.073000	0.16967	3.217000	0.51184	2.218000	0.71995	0.533000	0.62120	AAA	.		0.378	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724	
RIN3	79890	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	93154522	93154523	+	Missense_Mutation	DNP	GC	GC	TT	rs554426241	byFrequency	TCGA-G3-A3CK-01A-11D-A20W-10	TCGA-G3-A3CK-10A-01D-A20W-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1127b561-ea40-4d5e-95df-daa0a5ebc1e4	b9244ba4-a36a-415f-8975-7e933dd7d8a4	g.chr14:93154522_93154523GC>TT	ENST00000216487.7	+	10	3042_3043	c.2883_2884GC>TT	c.(2881-2886)cgGCcc>cgTTcc	p.P962S	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	962	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				TTGTCTACCGGCCCCTGGACGG	0.733																																					p.P962S		.											.	.	.	0			.						.																																			SO:0001583	missense	79890	.			CTACCGGCCCCTG	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		Exception_encountered	14.37:g.93154522_93154523delinsTT	ENSP00000216487:p.Pro962Ser	29.0	0.0		41.0	19.0	.	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	DNP	ENST00000216487.7	37	CCDS32144.1																																																																																			.		0.733	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1		
