#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AHDC1	27245	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	27875598	27875598	+	Missense_Mutation	SNP	G	G	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:27875598G>T	ENST00000247087.5	-	5	3625	c.3029C>A	c.(3028-3030)gCc>gAc	p.A1010D	AHDC1_ENST00000374011.2_Missense_Mutation_p.A1010D			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1010							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTGGGTGAGGCAGGGAGGCT	0.647																																					p.A1010D		.											.	AHDC1	90	0			c.C3029A						.						28.0	30.0	30.0					1																	27875598		2203	4298	6501	SO:0001583	missense	27245	exon6			GGTGAGGCAGGGA	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3029C>A	1.37:g.27875598G>T	ENSP00000247087:p.Ala1010Asp	27.0	0.0		37.0	4.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	37	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339478	0.41398	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.52754	0.65;0.65	5.79	5.79	0.91817	.	0.094954	0.42053	D	0.000777	T	0.44787	0.1310	N	0.19112	0.55	0.36409	D	0.863591	P	0.46784	0.884	P	0.47206	0.541	T	0.55885	-0.8070	10	0.87932	D	0	-12.2488	18.7978	0.92003	0.0:0.0:1.0:0.0	.	1010	Q5TGY3	AHDC1_HUMAN	D	1010	ENSP00000247087:A1010D;ENSP00000363123:A1010D	ENSP00000247087:A1010D	A	-	2	0	AHDC1	27748185	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.791000	0.62460	2.735000	0.93741	0.655000	0.94253	GCC	.		0.647	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
ARHGAP29	9411	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	94654393	94654393	+	Splice_Site	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:94654393C>T	ENST00000260526.6	-	15	1863	c.1681G>A	c.(1681-1683)Gga>Aga	p.G561R	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	561					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		ATAGATGTACCTGGACTTATA	0.353																																					p.G561R		.											.	ARHGAP29	296	0			c.G1681A						.						73.0	74.0	74.0					1																	94654393		2203	4299	6502	SO:0001630	splice_region_variant	9411	exon15			ATGTACCTGGACT		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1681+1G>A	1.37:g.94654393C>T		234.0	0.0		215.0	9.0	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904241	0.92035	.	.	ENSG00000137962	ENST00000260526	T	0.27104	1.69	5.64	5.64	0.86602	.	0.000000	0.37530	N	0.002042	T	0.39860	0.1094	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.81914	0.995;0.762	T	0.01371	-1.1372	9	.	.	.	-25.9961	18.8715	0.92317	0.0:1.0:0.0:0.0	.	561;561	F8VWZ8;Q52LW3	.;RHG29_HUMAN	R	561	ENSP00000260526:G561R	.	G	-	1	0	ARHGAP29	94426981	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.550000	0.73905	2.937000	0.99478	0.650000	0.86243	GGA	.		0.353	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	Missense_Mutation
CCSER1	401145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	91230460	91230460	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr4:91230460C>T	ENST00000509176.1	+	2	1313	c.1025C>T	c.(1024-1026)gCt>gTt	p.A342V	CCSER1_ENST00000432775.2_Missense_Mutation_p.A342V|CCSER1_ENST00000333691.8_Missense_Mutation_p.A342V	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	342																	GAAACCTCTGCTGCTAATCAG	0.423																																					p.A342V		.											.	.	.	0			c.C1025T						.						100.0	93.0	95.0					4																	91230460		1858	4105	5963	SO:0001583	missense	401145	exon2			CCTCTGCTGCTAA		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1025C>T	4.37:g.91230460C>T	ENSP00000425040:p.Ala342Val	191.0	0.0		217.0	70.0	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.340894	0.41498	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.51325	1.23;0.71;1.23	4.73	3.89	0.44902	.	0.315828	0.30510	N	0.009475	T	0.34366	0.0895	L	0.43152	1.355	0.27462	N	0.953121	B;B;B	0.28783	0.222;0.192;0.192	B;B;B	0.27262	0.046;0.043;0.078	T	0.31194	-0.9952	10	0.52906	T	0.07	-25.062	3.7418	0.08533	0.1341:0.583:0.1304:0.1524	.	342;342;342	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	V	342	ENSP00000425040:A342V;ENSP00000389283:A342V;ENSP00000329482:A342V	ENSP00000329482:A342V	A	+	2	0	FAM190A	91449483	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.463000	0.35277	1.317000	0.45149	-0.216000	0.12614	GCT	.		0.423	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
DDOST	1650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	20980769	20980769	+	Silent	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:20980769G>A	ENST00000375048.3	-	7	897	c.792C>T	c.(790-792)ttC>ttT	p.F264F	DDOST_ENST00000602624.2_Silent_p.F247F|DDOST_ENST00000415136.2_Silent_p.F227F|PINK1-AS_ENST00000451424.1_RNA	NM_005216.4	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic)	264					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|innate immune response (GO:0045087)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|response to cytokine (GO:0034097)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell activation (GO:0042110)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|protein complex (GO:0043234)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|skin(1)	13		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGAGTCGCTGAAGAAGTCGA	0.632																																					p.F264F		.											.	DDOST	90	0			c.C792T						.						38.0	35.0	36.0					1																	20980769		2164	4216	6380	SO:0001819	synonymous_variant	1650	exon7			GTCGCTGAAGAAG	D29643	CCDS212.1	1p36.1	2013-03-06	2013-03-06		ENSG00000244038	ENSG00000244038	2.4.1.119		2728	protein-coding gene	gene with protein product	"""oligosaccharyltransferase subunit 48"""	602202	"""dolichyl-diphosphooligosaccharide-protein glycosyltransferase"", ""dolichyl-diphosphooligosaccharide--protein glycosyltransferase"""			9367678	Standard	NM_005216		Approved	OST, KIAA0115, OST48, WBP1	uc001bdo.1	P39656	OTTHUMG00000002844	ENST00000375048.3:c.792C>T	1.37:g.20980769G>A		128.0	0.0		153.0	48.0	NM_005216	B2RDQ4|B4DJE3|B4DLI2|O43244|Q5VWA5|Q8NI93|Q9BUI2	Silent	SNP	ENST00000375048.3	37	CCDS212.1																																																																																			.		0.632	DDOST-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007961.2	NM_005216	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	92533065	92533065	+	Missense_Mutation	SNP	C	C	G			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr11:92533065C>G	ENST00000298047.6	+	9	6903	c.6886C>G	c.(6886-6888)Cta>Gta	p.L2296V	FAT3_ENST00000525166.1_Missense_Mutation_p.L2146V|FAT3_ENST00000409404.2_Missense_Mutation_p.L2296V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2296	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAATACAACACTATCAGAAGC	0.403										TCGA Ovarian(4;0.039)																											p.L2296V		.											.	FAT3	73	0			c.C6886G						.						94.0	84.0	87.0					11																	92533065		1900	4119	6019	SO:0001583	missense	120114	exon9			ACAACACTATCAG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6886C>G	11.37:g.92533065C>G	ENSP00000298047:p.Leu2296Val	159.0	0.0		145.0	12.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	7.659	0.684550	0.14973	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.45276	0.9;0.9;0.9	5.8	1.1	0.20463	.	.	.	.	.	T	0.29126	0.0724	N	0.12961	0.28	0.80722	D	1	D	0.58268	0.982	P	0.51193	0.662	T	0.03673	-1.1014	9	0.09843	T	0.71	.	10.3138	0.43725	0.0:0.4573:0.0:0.5427	.	2296	Q8TDW7-3	.	V	2296;2296;2146	ENSP00000298047:L2296V;ENSP00000387040:L2296V;ENSP00000432586:L2146V	ENSP00000298047:L2296V	L	+	1	2	FAT3	92172713	0.017000	0.18338	0.832000	0.32986	0.986000	0.74619	0.152000	0.16302	0.154000	0.19237	-0.312000	0.09012	CTA	.		0.403	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FIGN	55137	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	164467790	164467790	+	Silent	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr2:164467790T>C	ENST00000333129.3	-	3	866	c.552A>G	c.(550-552)gaA>gaG	p.E184E	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	184					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CTGGGGCATATTCCTGAGATG	0.502																																					p.E184E		.											.	FIGN	156	0			c.A552G						.						81.0	84.0	83.0					2																	164467790		2010	4173	6183	SO:0001819	synonymous_variant	55137	exon3			GGCATATTCCTGA	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.552A>G	2.37:g.164467790T>C		151.0	1.0		156.0	18.0	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Silent	SNP	ENST00000333129.3	37	CCDS2221.2																																																																																			.		0.502	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
GJA8	2703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	147380477	147380477	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:147380477G>A	ENST00000369235.1	+	1	395	c.395G>A	c.(394-396)aGc>aAc	p.S132N	GJA8_ENST00000240986.4_Missense_Mutation_p.S132N			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	132					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GTCAAGAAGAGCAGCGGCAGC	0.622																																					p.S132N	Melanoma(76;1255 1795 8195 52096)	.											.	GJA8	138	0			c.G395A						.						58.0	67.0	64.0					1																	147380477		2203	4300	6503	SO:0001583	missense	2703	exon2			AGAAGAGCAGCGG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.395G>A	1.37:g.147380477G>A	ENSP00000358238:p.Ser132Asn	52.0	0.0		53.0	11.0	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	ENST00000369235.1	37	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	g	6.216	0.408009	0.11754	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.97529	-4.42;-4.42	4.72	4.72	0.59763	.	1.187530	0.06334	N	0.706773	D	0.90438	0.7006	L	0.36672	1.1	0.30088	N	0.808548	B	0.02656	0.0	B	0.06405	0.002	T	0.80027	-0.1554	10	0.21014	T	0.42	.	11.1292	0.48336	0.0:0.1876:0.8124:0.0	.	132	P48165	CXA8_HUMAN	N	132	ENSP00000240986:S132N;ENSP00000358238:S132N	ENSP00000240986:S132N	S	+	2	0	GJA8	145847101	1.000000	0.71417	0.993000	0.49108	0.311000	0.27955	2.809000	0.47971	2.151000	0.67156	0.436000	0.28706	AGC	.		0.622	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
HTR7	3363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	92616999	92616999	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:92616999T>C	ENST00000336152.3	-	1	456	c.430A>G	c.(430-432)Atc>Gtc	p.I144V	HTR7_ENST00000371721.3_Missense_Mutation_p.I144V|HTR7_ENST00000371719.2_Missense_Mutation_p.I144V|HTR7_ENST00000277874.6_Missense_Mutation_p.I144V	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	144					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TTGCCCCCGATGAGGTCGGTG	0.597																																					p.I144V		.											.	HTR7	91	0			c.A430G						.						66.0	58.0	61.0					10																	92616999		2203	4300	6503	SO:0001583	missense	3363	exon1			CCCCGATGAGGTC	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.430A>G	10.37:g.92616999T>C	ENSP00000337949:p.Ile144Val	223.0	0.0		306.0	79.0	NM_019860	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	37	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883669	0.33255	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	4.97	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.10551	0.0258	N	0.10945	0.07	0.50171	D	0.99985	B;B	0.21821	0.061;0.035	B;B	0.20767	0.031;0.016	T	0.07121	-1.0789	10	0.02654	T	1	.	14.6436	0.68742	0.0:0.0:0.0:1.0	.	144;144	P34969;P34969-2	5HT7R_HUMAN;.	V	144	ENSP00000337949:I144V;ENSP00000277874:I144V;ENSP00000360784:I144V;ENSP00000360786:I144V	ENSP00000277874:I144V	I	-	1	0	HTR7	92606979	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.895000	0.48648	1.872000	0.54250	0.460000	0.39030	ATC	.		0.597	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
IGFN1	91156	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	201196307	201196307	+	Missense_Mutation	SNP	C	C	A	rs543665080		TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:201196307C>A	ENST00000335211.4	+	23	11214	c.11084C>A	c.(11083-11085)gCa>gAa	p.A3695E	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1238						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CTGGGCCAGGCAGTCAGCACT	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15052	0.0		0.0	False		,,,				2504	0.0				p.A3695E		.											.	IGFN1	71	0			c.C11084A						.						36.0	22.0	27.0					1																	201196307		2201	4299	6500	SO:0001583	missense	91156	exon23			GCCAGGCAGTCAG	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.11084C>A	1.37:g.201196307C>A	ENSP00000334714:p.Ala3695Glu	106.0	0.0		127.0	6.0	NM_001164586	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981139	0.53827	.	.	ENSG00000163395	ENST00000335211	T	0.67865	-0.29	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.81795	0.4898	M	0.77103	2.36	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	D	0.84135	0.0414	10	0.72032	D	0.01	.	15.8823	0.79213	0.0:1.0:0.0:0.0	.	3695	F8WAI1	.	E	3695	ENSP00000334714:A3695E	ENSP00000334714:A3695E	A	+	2	0	IGFN1	199462930	0.948000	0.32251	0.947000	0.38551	0.140000	0.21249	2.084000	0.41625	2.430000	0.82344	0.655000	0.94253	GCA	.		0.632	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
KIAA1279	26128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70775430	70775430	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:70775430C>T	ENST00000361983.4	+	7	1226	c.1124C>T	c.(1123-1125)tCt>tTt	p.S375F		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	375					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						GATGCCATCTCTGCAGTAGAA	0.413																																					p.S375F		.											.	KIAA1279	91	0			c.C1124T						.						119.0	112.0	115.0					10																	70775430		2203	4300	6503	SO:0001583	missense	26128	exon7			CCATCTCTGCAGT	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1124C>T	10.37:g.70775430C>T	ENSP00000354848:p.Ser375Phe	94.0	0.0		95.0	37.0	NM_015634	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	ENST00000361983.4	37	CCDS7284.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317605	0.40996	.	.	ENSG00000198954	ENST00000361983	T	0.48836	0.8	5.51	4.38	0.52667	.	0.351400	0.32819	N	0.005605	T	0.26231	0.0640	N	0.14661	0.345	0.33903	D	0.638776	P	0.42649	0.786	B	0.40329	0.326	T	0.34502	-0.9826	10	0.54805	T	0.06	-20.501	2.826	0.05485	0.283:0.5395:0.0:0.1775	.	375	Q96EK5	KBP_HUMAN	F	375	ENSP00000354848:S375F	ENSP00000354848:S375F	S	+	2	0	KIAA1279	70445436	0.980000	0.34600	1.000000	0.80357	0.997000	0.91878	2.115000	0.41921	2.763000	0.94921	0.650000	0.86243	TCT	.		0.413	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1	NM_015634	
LRFN1	57622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39804840	39804840	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr19:39804840C>T	ENST00000248668.4	-	1	1136	c.1137G>A	c.(1135-1137)gcG>gcA	p.A379A	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	379	Ig-like.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CGGGCGCCGTCGCTTCCCCAG	0.687																																					p.A379A		.											.	LRFN1	70	0			c.G1137A						.						25.0	31.0	29.0					19																	39804840		2176	4269	6445	SO:0001819	synonymous_variant	57622	exon1			CGCCGTCGCTTCC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1137G>A	19.37:g.39804840C>T		29.0	0.0		50.0	20.0	NM_020862	Q8TBS9	Silent	SNP	ENST00000248668.4	37	CCDS46071.1																																																																																			.		0.687	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862	
LRRC69	100130742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	92212905	92212905	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr8:92212905T>C	ENST00000448384.2	+	7	818	c.818T>C	c.(817-819)aTa>aCa	p.I273T	LRRC69_ENST00000343709.3_Missense_Mutation_p.I117T	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	273										endometrium(1)	1						ATGGATGACATAGAACGGTAC	0.363																																					p.I273T		.											.	.	.	0			c.T818C						.						211.0	170.0	182.0					8																	92212905		692	1591	2283	SO:0001583	missense	100130742	exon7			ATGACATAGAACG	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.818T>C	8.37:g.92212905T>C	ENSP00000400803:p.Ile273Thr	280.0	0.0		298.0	90.0	NM_001129890		Missense_Mutation	SNP	ENST00000448384.2	37		.	.	.	.	.	.	.	.	.	.	T	7.428	0.638193	0.14386	.	.	ENSG00000214954	ENST00000343709;ENST00000448384	T;T	0.56275	0.47;0.48	5.1	5.1	0.69264	.	0.225392	0.27906	U	0.017374	T	0.52273	0.1724	M	0.62723	1.935	0.09310	N	1	B;P	0.41188	0.079;0.741	B;B	0.41988	0.043;0.372	T	0.54241	-0.8323	10	0.54805	T	0.06	-2.4112	11.2927	0.49261	0.0:0.0:0.0:1.0	.	273;117	Q6ZNQ3;Q6ZNQ3-2	LRC69_HUMAN;.	T	117;273	ENSP00000343221:I117T;ENSP00000400803:I273T	ENSP00000343221:I117T	I	+	2	0	LRRC69	92282081	0.087000	0.21565	0.005000	0.12908	0.008000	0.06430	3.978000	0.56881	1.919000	0.55581	0.459000	0.35465	ATA	.		0.363	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000415207.1	NM_001129890	
LZIC	84328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9995639	9995639	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:9995639G>C	ENST00000377223.1	-	4	395	c.148C>G	c.(148-150)Ctg>Gtg	p.L50V	LZIC_ENST00000377213.1_Missense_Mutation_p.L50V|LZIC_ENST00000400903.2_Missense_Mutation_p.L50V|LZIC_ENST00000541052.1_Missense_Mutation_p.L71V	NM_032368.3	NP_115744.2	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing	50					response to ionizing radiation (GO:0010212)					breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		AGTTGCTCCAGAGTTTCCTTT	0.328																																					p.L50V		.											.	LZIC	90	0			c.C148G						.						149.0	155.0	153.0					1																	9995639		2203	4299	6502	SO:0001583	missense	84328	exon3			GCTCCAGAGTTTC	AB060688	CCDS107.1	1p36.22	2008-02-05			ENSG00000162441	ENSG00000162441			17497	protein-coding gene	gene with protein product		610458				11712074	Standard	NM_032368		Approved	MGC15436	uc001aqm.3	Q8WZA0	OTTHUMG00000001804	ENST00000377223.1:c.148C>G	1.37:g.9995639G>C	ENSP00000366430:p.Leu50Val	70.0	0.0		78.0	28.0	NM_032368	B2R6F0|B4E2N0|Q96IU1	Missense_Mutation	SNP	ENST00000377223.1	37	CCDS107.1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039200	0.35989	.	.	ENSG00000162441	ENST00000377223;ENST00000400903;ENST00000541052;ENST00000377213	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.63	3.39	0.38822	.	0.000000	0.64402	D	0.000001	T	0.20981	0.0505	L	0.33137	0.985	0.49130	D	0.999754	B;B	0.28512	0.214;0.087	B;B	0.20767	0.031;0.018	T	0.05037	-1.0910	9	.	.	.	.	12.5259	0.56085	0.1618:0.0:0.8382:0.0	.	71;50	B4E2N0;Q8WZA0	.;LZIC_HUMAN	V	50;50;71;50	ENSP00000366430:L50V;ENSP00000383695:L50V;ENSP00000437432:L71V;ENSP00000366418:L50V	.	L	-	1	2	LZIC	9918226	0.345000	0.24835	1.000000	0.80357	0.996000	0.88848	0.746000	0.26275	1.350000	0.45770	0.491000	0.48974	CTG	.		0.328	LZIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005037.1	NM_032368	
MYOF	26509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95109596	95109596	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr10:95109596T>C	ENST00000359263.4	-	36	4051	c.4052A>G	c.(4051-4053)aAc>aGc	p.N1351S	MYOF_ENST00000371502.4_Missense_Mutation_p.N1351S|MYOF_ENST00000358334.5_Missense_Mutation_p.N1338S|MYOF_ENST00000371501.4_Missense_Mutation_p.N1351S	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1351					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						ACTTGGAAAGTTGGGTGTCTT	0.453																																					p.N1351S		.											.	MYOF	93	0			c.A4052G						.						110.0	109.0	109.0					10																	95109596		1894	4118	6012	SO:0001583	missense	26509	exon36			GGAAAGTTGGGTG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4052A>G	10.37:g.95109596T>C	ENSP00000352208:p.Asn1351Ser	177.0	0.0		209.0	59.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.675819	0.88445	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	5.53	5.53	0.82687	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.83312	0.5227	M	0.89353	3.025	0.58432	D	0.999999	D;D	0.64830	0.994;0.972	D;P	0.63877	0.919;0.721	D	0.86513	0.1811	10	0.62326	D	0.03	-27.4168	15.6595	0.77174	0.0:0.0:0.0:1.0	.	1338;1351	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	S	1338;1351;1351;1351	ENSP00000351094:N1338S;ENSP00000352208:N1351S;ENSP00000360556:N1351S;ENSP00000360557:N1351S	ENSP00000351094:N1338S	N	-	2	0	MYOF	95099586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.985000	0.88162	2.102000	0.63906	0.459000	0.35465	AAC	.		0.453	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
OR5J2	282775	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55944717	55944717	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr11:55944717G>C	ENST00000312298.1	+	1	624	c.624G>C	c.(622-624)atG>atC	p.M208I		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M208I(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					TCATTGCCATGGCCACCTTCT	0.478																																					p.M208I		.											.	OR5J2	115	1	Substitution - Missense(1)	lung(1)	c.G624C						.						168.0	128.0	141.0					11																	55944717		2201	4296	6497	SO:0001583	missense	282775	exon1			TGCCATGGCCACC	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.624G>C	11.37:g.55944717G>C	ENSP00000310788:p.Met208Ile	308.0	1.0		309.0	96.0	NM_001005492	Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	37	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.301242	0.00243	.	.	ENSG00000174957	ENST00000312298	T	0.34275	1.37	4.55	0.121	0.14695	GPCR, rhodopsin-like superfamily (1);	0.615899	0.15672	N	0.250346	T	0.12305	0.0299	N	0.05441	-0.05	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.32268	-0.9913	10	0.02654	T	1	.	4.0132	0.09632	0.1572:0.1288:0.5818:0.1322	.	208	Q8NH18	OR5J2_HUMAN	I	208	ENSP00000310788:M208I	ENSP00000310788:M208I	M	+	3	0	OR5J2	55701293	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-0.947000	0.03901	0.461000	0.27071	0.591000	0.81541	ATG	.		0.478	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492	
PRSS1	5644	broad.mit.edu;bcgsc.ca	37	7	142460286	142460286	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr7:142460286C>T	ENST00000311737.7	+	4	465	c.459C>T	c.(457-459)gaC>gaT	p.D153D	PRSS1_ENST00000486171.1_Silent_p.D167D	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	153	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TCACAGCCGACTACCCAGACG	0.507																																					p.D153D		.											.	PRSS1	577	0			c.C459T						.						263.0	262.0	262.0					7																	142460286		2203	4300	6503	SO:0001819	synonymous_variant	5644	exon4			AGCCGACTACCCA	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.459C>T	7.37:g.142460286C>T		586.0	1.0		722.0	72.0	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	ENST00000311737.7	37	CCDS5872.1																																																																																			.		0.507	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
RSC1A1	6248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15988085	15988085	+	Silent	SNP	C	C	G			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:15988085C>G	ENST00000345034.1	+	1	1722	c.1722C>G	c.(1720-1722)gcC>gcG	p.A574A	DDI2_ENST00000480945.1_3'UTR	NM_006511.1	NP_006502.1	Q92681	RSCA1_HUMAN	regulatory solute carrier protein, family 1, member 1	574	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				intestinal absorption (GO:0050892)|negative regulation of transport (GO:0051051)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	brush border (GO:0005903)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel inhibitor activity (GO:0008200)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)	11		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00276)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TTTTTCCTGCCACAGATATTG	0.473																																					p.A574A		.											.	RSC1A1	91	0			c.C1722G						.						220.0	200.0	207.0					1																	15988085		2203	4300	6503	SO:0001819	synonymous_variant	6248	exon1			TCCTGCCACAGAT	BN000122, X82877	CCDS161.1	1p36.1	1998-08-25			ENSG00000215695	ENSG00000215695			10458	protein-coding gene	gene with protein product		601966					Standard	NM_006511		Approved	RS1	uc010obn.2	Q92681	OTTHUMG00000067830	ENST00000345034.1:c.1722C>G	1.37:g.15988085C>G		239.0	0.0		250.0	79.0	NM_006511	B2RBP5	Silent	SNP	ENST00000345034.1	37	CCDS161.1																																																																																			.		0.473	RSC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145500.1	NM_006511	
SERPINA11	256394	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	94912673	94912673	+	Silent	SNP	C	C	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr14:94912673C>A	ENST00000334708.3	-	3	976	c.912G>T	c.(910-912)ctG>ctT	p.L304L	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	304					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		CTTACCTGGGCAGGAGCAATT	0.572																																					p.L304L		.											.	SERPINA11	204	0			c.G912T						.						91.0	88.0	89.0					14																	94912673		2203	4300	6503	SO:0001819	synonymous_variant	256394	exon3			CCTGGGCAGGAGC	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.912G>T	14.37:g.94912673C>A		160.0	1.0		201.0	13.0	NM_001080451	B2RV07	Silent	SNP	ENST00000334708.3	37	CCDS32149.1																																																																																			.		0.572	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413091.1	NM_001080451	
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	51160334	51160334	+	Missense_Mutation	SNP	A	A	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr22:51160334A>T	ENST00000414786.2	+	21	4258	c.4031A>T	c.(4030-4032)gAg>gTg	p.E1344V	SHANK3_ENST00000262795.3_Missense_Mutation_p.E1374V|SHANK3_ENST00000445220.2_Missense_Mutation_p.E1360V			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1358	Pro-rich.				adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		TCTGGGGTGGAGGAGGCTGAC	0.697																																					p.E1344V		.											.	SHANK3	69	0			c.A4031T						.						14.0	16.0	15.0					22																	51160334		2007	4097	6104	SO:0001583	missense	85358	exon21			GGGTGGAGGAGGC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4031A>T	22.37:g.51160334A>T	ENSP00000464552:p.Glu1344Val	46.0	0.0		68.0	11.0	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	A	18.15	3.559285	0.65538	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.20738	2.05;2.05	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	M	0.83603	2.65	0.36862	D	0.888442	D;P;D	0.76494	0.998;0.808;0.999	D;B;D	0.83275	0.994;0.225;0.996	T	0.62793	-0.6779	10	0.87932	D	0	.	12.8612	0.57913	1.0:0.0:0.0:0.0	.	1358;1359;1374	D7UT47;Q9BYB0;F2Z3L0	.;SHAN3_HUMAN;.	V	1374;1360	ENSP00000442518:E1374V;ENSP00000446078:E1360V	ENSP00000442518:E1374V	E	+	2	0	SHANK3	49507200	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.610000	0.90902	1.928000	0.55862	0.379000	0.24179	GAG	.		0.697	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
SLC17A8	246213	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	100774721	100774721	+	Missense_Mutation	SNP	C	C	G			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr12:100774721C>G	ENST00000323346.5	+	2	657	c.344C>G	c.(343-345)cCg>cGg	p.P115R	SLC17A8_ENST00000392989.3_Missense_Mutation_p.P115R	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	115					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						GATGGAAAACCGGAAATTCAG	0.488																																					p.P115R		.											.	SLC17A8	93	0			c.C344G						.						173.0	170.0	171.0					12																	100774721		2203	4300	6503	SO:0001583	missense	246213	exon2			GAAAACCGGAAAT	AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.344C>G	12.37:g.100774721C>G	ENSP00000316909:p.Pro115Arg	220.0	1.0		269.0	74.0	NM_001145288	B3KXZ6|B7ZKV4|Q17RQ8	Missense_Mutation	SNP	ENST00000323346.5	37	CCDS9077.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465004	0.26335	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	T;T	0.71222	-0.14;-0.55	5.27	5.27	0.74061	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.059655	0.64402	D	0.000002	T	0.65260	0.2674	L	0.34521	1.04	0.58432	D	0.999991	B;P	0.35328	0.392;0.495	B;B	0.41088	0.347;0.303	T	0.59888	-0.7369	10	0.11794	T	0.64	.	18.8896	0.92392	0.0:1.0:0.0:0.0	.	115;115	Q8NDX2;Q8NDX2-2	VGLU3_HUMAN;.	R	115	ENSP00000316909:P115R;ENSP00000376715:P115R	ENSP00000316909:P115R	P	+	2	0	SLC17A8	99298852	0.995000	0.38212	1.000000	0.80357	0.949000	0.60115	3.234000	0.51320	2.466000	0.83321	0.591000	0.81541	CCG	.		0.488	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
SLC9A6	10479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135122263	135122263	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chrX:135122263G>C	ENST00000370698.3	+	15	1695	c.1660G>C	c.(1660-1662)Ggg>Cgg	p.G554R	SLC9A6_ENST00000370701.1_Missense_Mutation_p.G534R|SLC9A6_ENST00000370695.4_Missense_Mutation_p.G586R	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	554					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GACCCACAGCGGGCCTCCGCT	0.502																																					p.G586R		.											.	SLC9A6	131	0			c.G1756C						.						46.0	39.0	41.0					X																	135122263		2203	4300	6503	SO:0001583	missense	10479	exon15			CACAGCGGGCCTC	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1660G>C	X.37:g.135122263G>C	ENSP00000359732:p.Gly554Arg	118.0	0.0		151.0	96.0	NM_001042537	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776063	0.70107	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.69685	-0.42;-0.42;-0.42	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	L	0.45698	1.435	0.80722	D	1	D;P	0.89917	1.0;0.838	D;B	0.97110	1.0;0.446	T	0.71080	-0.4696	10	0.19147	T	0.46	.	17.4825	0.87677	0.0:0.0:1.0:0.0	.	586;554	Q92581-2;Q92581	.;SL9A6_HUMAN	R	534;554;586	ENSP00000359735:G534R;ENSP00000359732:G554R;ENSP00000359729:G586R	ENSP00000359729:G586R	G	+	1	0	SLC9A6	134949929	1.000000	0.71417	0.869000	0.34112	0.742000	0.42306	9.404000	0.97306	2.343000	0.79666	0.513000	0.50165	GGG	.		0.502	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
TMEM257	9142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	144909486	144909486	+	Silent	SNP	C	C	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chrX:144909486C>A	ENST00000408967.2	+	1	559	c.291C>A	c.(289-291)ccC>ccA	p.P97P		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	97						integral component of membrane (GO:0016021)											TGCAGTCTCCCAGGGCCCTGC	0.413																																					p.P97P		.											.	.	.	0			c.C291A						.						52.0	49.0	50.0					X																	144909486		2203	4300	6503	SO:0001819	synonymous_variant	9142	exon1			GTCTCCCAGGGCC	Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.291C>A	X.37:g.144909486C>A		107.0	0.0		124.0	68.0	NM_004709	Q14CW0	Silent	SNP	ENST00000408967.2	37	CCDS14681.1																																																																																			.		0.413	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709	
TMEM61	199964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	55452005	55452005	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr1:55452005G>A	ENST00000371268.3	+	2	525	c.251G>A	c.(250-252)gGc>gAc	p.G84D	RP11-12C17.2_ENST00000436960.1_RNA	NM_182532.1	NP_872338.1	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	84						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	4						CTGCTCATTGGCCTGCTGTGG	0.652																																					p.G84D		.											.	TMEM61	68	0			c.G251A						.						93.0	93.0	93.0					1																	55452005		2203	4300	6503	SO:0001583	missense	199964	exon2			TCATTGGCCTGCT	BC029775	CCDS601.1	1p32.3	2008-02-05			ENSG00000143001	ENSG00000143001			27296	protein-coding gene	gene with protein product						12477932	Standard	NM_182532		Approved		uc001cyd.3	Q8N0U2	OTTHUMG00000009991	ENST00000371268.3:c.251G>A	1.37:g.55452005G>A	ENSP00000360315:p.Gly84Asp	72.0	0.0		125.0	36.0	NM_182532		Missense_Mutation	SNP	ENST00000371268.3	37	CCDS601.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732199	0.48939	.	.	ENSG00000143001	ENST00000371268	T	0.62105	0.05	4.8	3.89	0.44902	.	0.000000	0.53938	D	0.000050	T	0.67813	0.2933	L	0.32530	0.975	0.29843	N	0.829037	D	0.89917	1.0	D	0.78314	0.991	T	0.66352	-0.5945	10	0.87932	D	0	-20.7621	11.2898	0.49244	0.0855:0.0:0.9145:0.0	.	84	Q8N0U2	TMM61_HUMAN	D	84	ENSP00000360315:G84D	ENSP00000360315:G84D	G	+	2	0	TMEM61	55224593	1.000000	0.71417	0.953000	0.39169	0.209000	0.24338	5.568000	0.67385	1.241000	0.43820	0.655000	0.94253	GGC	.		0.652	TMEM61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027683.1	NM_182532	
TOX	9760	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	59852023	59852023	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr8:59852023C>T	ENST00000361421.1	-	3	469	c.249G>A	c.(247-249)ctG>ctA	p.L83L		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	83						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TCAGGTGCACCAGCGAGTGGT	0.488																																					p.L83L	Pancreas(161;610 1969 17913 21374 22725)	.											.	TOX	227	0			c.G249A						.						136.0	118.0	124.0					8																	59852023		2203	4300	6503	SO:0001819	synonymous_variant	9760	exon3			GTGCACCAGCGAG		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.249G>A	8.37:g.59852023C>T		209.0	0.0		213.0	11.0	NM_014729	Q96AV5	Silent	SNP	ENST00000361421.1	37	CCDS34897.1																																																																																			.		0.488	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
TRAM1L1	133022	broad.mit.edu;bcgsc.ca	37	4	118005752	118005752	+	Silent	SNP	A	A	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr4:118005752A>T	ENST00000310754.4	-	1	984	c.798T>A	c.(796-798)atT>atA	p.I266I		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	266	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						GTACGGAAACAATTAAAGTCA	0.443																																					p.I266I		.											.	TRAM1L1	90	0			c.T798A						.						70.0	66.0	67.0					4																	118005752		2203	4300	6503	SO:0001819	synonymous_variant	133022	exon1			GGAAACAATTAAA	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.798T>A	4.37:g.118005752A>T		118.0	1.0		117.0	6.0	NM_152402	Q8N2L7	Silent	SNP	ENST00000310754.4	37	CCDS3707.1																																																																																			.		0.443	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
ZNF423	23090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	49671020	49671020	+	Silent	SNP	C	C	T			TCGA-MR-A520-01A-11D-A25V-10	TCGA-MR-A520-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	352fbbb4-88a5-4354-b1fa-3a01da3fbfa7	64b28729-b106-4b33-994d-f1710478466c	g.chr16:49671020C>T	ENST00000561648.1	-	4	2096	c.2043G>A	c.(2041-2043)ctG>ctA	p.L681L	ZNF423_ENST00000262383.2_Silent_p.L681L|ZNF423_ENST00000562520.1_Silent_p.L621L|ZNF423_ENST00000535559.1_Silent_p.L564L|ZNF423_ENST00000562871.1_Silent_p.L621L|ZNF423_ENST00000563137.2_Silent_p.L621L|ZNF423_ENST00000567169.1_Silent_p.L564L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	681					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AATGCACTGTCAGGTGCTGCA	0.582																																					p.L681L		.											.	ZNF423	228	0			c.G2043A						.						70.0	67.0	68.0					16																	49671020		2198	4300	6498	SO:0001819	synonymous_variant	23090	exon4			CACTGTCAGGTGC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2043G>A	16.37:g.49671020C>T		182.0	0.0		249.0	77.0	NM_015069	O94860|Q76N04|Q9NZ13	Silent	SNP	ENST00000561648.1	37	CCDS32445.1																																																																																			.		0.582	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
