#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA3	21	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2338103	2338103	+	Silent	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:2338103G>T	ENST00000301732.5	-	21	3628	c.2928C>A	c.(2926-2928)tcC>tcA	p.S976S	ABCA3_ENST00000382381.3_Silent_p.S918S	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	976					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GACCCAGCTGGGAGGTCCCGG	0.647																																					p.S976S		.											.	ABCA3	1015	0			c.C2928A						.						48.0	42.0	44.0					16																	2338103		2198	4300	6498	SO:0001819	synonymous_variant	21	exon21			CAGCTGGGAGGTC	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2928C>A	16.37:g.2338103G>T		37.0	1.0		23.0	11.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1																																																																																			.		0.647	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	94510167	94510167	+	Splice_Site	SNP	A	A	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:94510167A>C	ENST00000370225.3	-	20	3137		c.e20+1			NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4						phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGTGTCGCTTACTGGTGGAAC	0.612																																					.		.											.	ABCA4	162	0			c.3050+2T>G						.						140.0	120.0	126.0					1																	94510167		2203	4300	6503	SO:0001630	splice_region_variant	24	exon21			TCGCTTACTGGTG	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3050+1T>G	1.37:g.94510167A>C		79.0	0.0		86.0	31.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Splice_Site	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.491407	0.84962	.	.	ENSG00000198691	ENST00000370225	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCA4	94282755	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	.	.		0.612	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	Intron
ABCC10	89845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43402429	43402429	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:43402429G>T	ENST00000372530.4	+	4	1666	c.1451G>T	c.(1450-1452)cGa>cTa	p.R484L	ABCC10_ENST00000244533.3_Missense_Mutation_p.R441L|ABCC10_ENST00000443426.2_3'UTR	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	484	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CTGGGAGCCCGAGTAGAGGCC	0.612																																					p.R484L		.											.	ABCC10	96	0			c.G1451T						.						91.0	100.0	97.0					6																	43402429		2203	4300	6503	SO:0001583	missense	89845	exon4			GAGCCCGAGTAGA	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.1451G>T	6.37:g.43402429G>T	ENSP00000361608:p.Arg484Leu	53.0	0.0		103.0	29.0	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.613558	0.66672	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.90955	-2.76;-2.76;-2.76	5.93	5.07	0.68467	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.063358	0.64402	D	0.000009	D	0.85750	0.5769	L	0.55103	1.725	0.39852	D	0.973255	B;P	0.48503	0.257;0.911	B;P	0.48840	0.313;0.592	D	0.83983	0.0333	10	0.22706	T	0.39	-29.659	11.9694	0.53055	0.1379:0.0:0.8621:0.0	.	441;484	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	L	40;484;441	ENSP00000361593:R40L;ENSP00000361608:R484L;ENSP00000244533:R441L	ENSP00000244533:R441L	R	+	2	0	ABCC10	43510407	1.000000	0.71417	0.901000	0.35422	0.959000	0.62525	5.277000	0.65586	1.529000	0.49120	0.655000	0.94253	CGA	.		0.612	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
ADAM11	4185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42854925	42854925	+	Silent	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:42854925C>T	ENST00000200557.6	+	22	2026	c.1857C>T	c.(1855-1857)atC>atT	p.I619I	ADAM11_ENST00000535346.1_Silent_p.I419I	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	619	Cys-rich.				integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				TGGGAGACATCAGTAGTGTCA	0.592																																					p.I619I		.											.	ADAM11	227	0			c.C1857T						.						104.0	100.0	101.0					17																	42854925		2203	4300	6503	SO:0001819	synonymous_variant	4185	exon22			AGACATCAGTAGT	D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.1857C>T	17.37:g.42854925C>T		63.0	0.0		64.0	28.0	NM_002390	Q14808|Q14809|Q14810	Silent	SNP	ENST00000200557.6	37	CCDS11486.1	.	.	.	.	.	.	.	.	.	.	C	8.381	0.837598	0.16891	.	.	ENSG00000073670	ENST00000355638	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.011	0.86406	0.0:1.0:0.0:0.0	.	.	.	.	X	523	.	ENSP00000347856:Q523X	Q	+	1	0	ADAM11	40210451	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	0.776000	0.26704	2.374000	0.81015	0.561000	0.74099	CAG	.		0.592	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
ADAMTS12	81792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	33649699	33649699	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:33649699A>G	ENST00000504830.1	-	8	1629	c.1294T>C	c.(1294-1296)Tgg>Cgg	p.W432R	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.W432R	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	432	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CACTTGGACCATGTCAGCGGA	0.537										HNSCC(64;0.19)																											p.W432R		.											.	ADAMTS12	232	0			c.T1294C						.						161.0	135.0	144.0					5																	33649699		2203	4300	6503	SO:0001583	missense	81792	exon8			TGGACCATGTCAG	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1294T>C	5.37:g.33649699A>G	ENSP00000422554:p.Trp432Arg	30.0	0.0		46.0	14.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.028153	0.75390	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.10477	2.87;2.87	5.73	5.73	0.89815	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	T	0.49932	0.1586	H	0.97491	4.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69049	-0.5248	10	0.87932	D	0	.	16.024	0.80528	1.0:0.0:0.0:0.0	.	432;432	P58397-3;P58397	.;ATS12_HUMAN	R	432	ENSP00000422554:W432R;ENSP00000344847:W432R	ENSP00000344847:W432R	W	-	1	0	ADAMTS12	33685456	1.000000	0.71417	0.972000	0.41901	0.509000	0.34042	9.197000	0.94985	2.190000	0.69967	0.448000	0.29417	TGG	.		0.537	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
AFAP1L1	134265	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	148687115	148687115	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:148687115G>C	ENST00000296721.4	+	7	784	c.686G>C	c.(685-687)cGg>cCg	p.R229P	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.R229P|AFAP1L1_ENST00000522492.1_3'UTR	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	229	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCTGCTGCGGAAAAAGCGT	0.627																																					p.R229P		.											.	AFAP1L1	136	0			c.G686C						.						72.0	59.0	64.0					5																	148687115		2203	4300	6503	SO:0001583	missense	134265	exon7			TGCTGCGGAAAAA	AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.686G>C	5.37:g.148687115G>C	ENSP00000296721:p.Arg229Pro	45.0	0.0		56.0	23.0	NM_001146337	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	ENST00000296721.4	37	CCDS34274.1	.	.	.	.	.	.	.	.	.	.	G	31	5.067216	0.93898	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	T;T	0.13538	2.58;2.58	4.89	4.89	0.63831	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.053504	0.64402	D	0.000001	T	0.44159	0.1280	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.83275	0.996;0.992;0.899	T	0.51020	-0.8758	10	0.87932	D	0	-28.754	18.243	0.89974	0.0:0.0:1.0:0.0	.	229;229;229	Q8TED9-2;Q8TED9;Q8TED9-3	.;AF1L1_HUMAN;.	P	229	ENSP00000296721:R229P;ENSP00000424427:R229P	ENSP00000296721:R229P	R	+	2	0	AFAP1L1	148667308	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.543000	0.85770	0.561000	0.74099	CGG	.		0.627	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105414443	105414443	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr14:105414443C>A	ENST00000333244.5	-	7	7464	c.7345G>T	c.(7345-7347)Gtg>Ttg	p.V2449L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2449						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCACCTCCACGCTGGGCTGA	0.637																																					p.V2449L		.											.	AHNAK2	47	0			c.G7345T						.						119.0	139.0	132.0					14																	105414443		2022	4165	6187	SO:0001583	missense	113146	exon7			CCTCCACGCTGGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7345G>T	14.37:g.105414443C>A	ENSP00000353114:p.Val2449Leu	60.0	0.0		57.0	20.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	7.724	0.697765	0.15106	.	.	ENSG00000185567	ENST00000333244	T	0.00675	5.88	3.74	-0.409	0.12378	.	.	.	.	.	T	0.01870	0.0059	L	0.56396	1.775	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.48151	-0.9060	9	0.22706	T	0.39	.	1.0989	0.01680	0.1388:0.268:0.3048:0.2885	.	2449	Q8IVF2	AHNK2_HUMAN	L	2449	ENSP00000353114:V2449L	ENSP00000353114:V2449L	V	-	1	0	AHNAK2	104485488	0.839000	0.29477	0.003000	0.11579	0.029000	0.11900	1.122000	0.31295	-0.169000	0.10834	-1.440000	0.01072	GTG	.		0.637	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AHR	196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17375399	17375399	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:17375399G>T	ENST00000242057.4	+	9	1792	c.1149G>T	c.(1147-1149)caG>caT	p.Q383H	AHR_ENST00000492120.1_3'UTR	NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	383	PAC.				apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q383H(2)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	TTGTAACTCAGAGACCACTAA	0.348																																					p.Q383H		.											.	AHR	227	2	Substitution - Missense(2)	lung(2)	c.G1149T						.						71.0	63.0	66.0					7																	17375399		2202	4300	6502	SO:0001583	missense	196	exon9			AACTCAGAGACCA	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.1149G>T	7.37:g.17375399G>T	ENSP00000242057:p.Gln383His	71.0	0.0		76.0	26.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990438	0.54041	.	.	ENSG00000106546	ENST00000242057	T	0.05447	3.44	5.98	-1.41	0.08941	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.43152	1.355	0.44798	D	0.997802	B	0.28128	0.201	B	0.31390	0.129	T	0.22277	-1.0221	10	0.62326	D	0.03	.	12.8346	0.57765	0.6126:0.0:0.3874:0.0	.	383	P35869	AHR_HUMAN	H	383	ENSP00000242057:Q383H	ENSP00000242057:Q383H	Q	+	3	2	AHR	17341924	0.995000	0.38212	0.977000	0.42913	0.859000	0.49053	0.361000	0.20267	-0.292000	0.08999	0.591000	0.81541	CAG	.		0.348	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
ANXA6	309	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	150516818	150516818	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:150516818T>C	ENST00000354546.5	-	6	610	c.383A>G	c.(382-384)cAc>cGc	p.H128R	ANXA6_ENST00000377751.5_Intron|ANXA6_ENST00000521512.1_Intron|ANXA6_ENST00000523714.1_Missense_Mutation_p.H96R|ANXA6_ENST00000356496.5_Missense_Mutation_p.H128R	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	128					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACCAGCTGGTGCATCTGCTC	0.512																																					p.H128R		.											.	ANXA6	22	0			c.A383G						.						54.0	52.0	53.0					5																	150516818		2022	4202	6224	SO:0001583	missense	309	exon6			AGCTGGTGCATCT	J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.383A>G	5.37:g.150516818T>C	ENSP00000346550:p.His128Arg	66.0	1.0		74.0	28.0	NM_001155	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	ENST00000354546.5	37	CCDS47315.1	.	.	.	.	.	.	.	.	.	.	T	6.275	0.418769	0.11870	.	.	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000356496;ENST00000540153;ENST00000521749;ENST00000517757	T;T;T;T;T	0.02709	4.19;4.19;4.19;4.19;4.19	5.63	4.45	0.53987	Annexin repeat, conserved site (1);	0.141714	0.64402	D	0.000006	T	0.02047	0.0064	N	0.16903	0.455	0.53005	D	0.999965	B;B	0.25441	0.126;0.005	B;B	0.29176	0.099;0.008	T	0.35798	-0.9774	10	0.02654	T	1	.	11.2243	0.48875	0.1376:0.0:0.0:0.8624	.	128;128	A6NN80;P08133	.;ANXA6_HUMAN	R	128;96;128;2;96;96	ENSP00000346550:H128R;ENSP00000430517:H96R;ENSP00000348889:H128R;ENSP00000430429:H96R;ENSP00000430572:H96R	ENSP00000346550:H128R	H	-	2	0	ANXA6	150497011	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.084000	0.64462	0.953000	0.37825	0.529000	0.55759	CAC	.		0.512	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2	NM_001155	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21236253	21236253	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:21236253G>C	ENST00000233242.1	-	25	4122	c.3995C>G	c.(3994-3996)tCt>tGt	p.S1332C		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1332					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAACTCTCGAGATGGCAGATG	0.483																																					p.S1332C		.											.	APOB	175	0			c.C3995G						.						137.0	134.0	135.0					2																	21236253		2203	4300	6503	SO:0001583	missense	338	exon25			TCTCGAGATGGCA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3995C>G	2.37:g.21236253G>C	ENSP00000233242:p.Ser1332Cys	59.0	0.0		56.0	20.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857566	0.51376	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00940	5.52	5.53	5.53	0.82687	.	0.415780	0.23165	N	0.051196	T	0.04588	0.0125	M	0.64997	1.995	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	T	0.33007	-0.9885	10	0.87932	D	0	.	19.8609	0.96783	0.0:0.0:1.0:0.0	.	1332	P04114	APOB_HUMAN	C	1332	ENSP00000233242:S1332C	ENSP00000233242:S1332C	S	-	2	0	APOB	21089758	0.981000	0.34729	0.368000	0.25939	0.152000	0.21847	6.188000	0.72045	2.771000	0.95319	0.563000	0.77884	TCT	.		0.483	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21255274	21255274	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:21255274T>C	ENST00000233242.1	-	10	1431	c.1304A>G	c.(1303-1305)gAt>gGt	p.D435G	APOB_ENST00000399256.4_Missense_Mutation_p.D435G	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	435	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTGCGCTGATCCCTCGCCAT	0.572																																					p.D435G		.											.	APOB	175	0			c.A1304G						.						82.0	77.0	79.0					2																	21255274		2203	4300	6503	SO:0001583	missense	338	exon10			CGCTGATCCCTCG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1304A>G	2.37:g.21255274T>C	ENSP00000233242:p.Asp435Gly	42.0	0.0		18.0	6.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.969959	0.34754	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.42513	0.97;0.97	5.26	4.09	0.47781	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.320212	0.26328	N	0.025009	T	0.28764	0.0713	N	0.22421	0.69	0.22710	N	0.99883	B	0.17465	0.022	B	0.21360	0.034	T	0.15435	-1.0437	10	0.26408	T	0.33	.	11.7308	0.51735	0.1324:0.0:0.0:0.8676	.	435	P04114	APOB_HUMAN	G	435	ENSP00000233242:D435G;ENSP00000382200:D435G	ENSP00000233242:D435G	D	-	2	0	APOB	21108779	1.000000	0.71417	0.992000	0.48379	0.968000	0.65278	2.969000	0.49232	0.924000	0.37069	0.528000	0.53228	GAT	.		0.572	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOOL	139322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	84301522	84301522	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:84301522A>G	ENST00000373173.2	+	2	173	c.86A>G	c.(85-87)gAg>gGg	p.E29G		NM_198450.5	NP_940852.3	Q6UXV4	MIC27_HUMAN	apolipoprotein O-like	29						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCCAAACAAGAGGAATCCAAA	0.348																																					p.E29G		.											.	APOOL	130	0			c.A86G						.						82.0	74.0	77.0					X																	84301522		1857	4089	5946	SO:0001583	missense	139322	exon2			AACAAGAGGAATC	AK130506	CCDS48138.1	Xq21.1	2007-01-17	2007-01-17	2007-01-17	ENSG00000155008	ENSG00000155008			24009	protein-coding gene	gene with protein product			"""chromosome X open reading frame 33"", ""family with sequence similarity 121A"""	CXorf33, FAM121A		12975309	Standard	NM_198450		Approved	UNQ8193, AAIR8193	uc004eem.3	Q6UXV4	OTTHUMG00000021930	ENST00000373173.2:c.86A>G	X.37:g.84301522A>G	ENSP00000362268:p.Glu29Gly	560.0	0.0		505.0	250.0	NM_198450	Q3KNU7|Q5H9D1	Missense_Mutation	SNP	ENST00000373173.2	37	CCDS48138.1	.	.	.	.	.	.	.	.	.	.	A	15.38	2.817798	0.50633	.	.	ENSG00000155008	ENST00000373173;ENST00000373169	.	.	.	4.53	4.53	0.55603	.	0.386776	0.28566	N	0.014881	T	0.38825	0.1055	L	0.57536	1.79	0.30455	N	0.774838	P	0.40578	0.722	B	0.41374	0.355	T	0.49072	-0.8977	9	0.48119	T	0.1	-15.6633	7.151	0.25610	0.8951:0.0:0.1049:0.0	.	29	Q6UXV4	APOOL_HUMAN	G	29	.	ENSP00000362264:E29G	E	+	2	0	APOOL	84188178	1.000000	0.71417	0.491000	0.27477	0.811000	0.45836	3.436000	0.52856	1.776000	0.52262	0.481000	0.45027	GAG	.		0.348	APOOL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057385.2	NM_198450	
ATMIN	23300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81076059	81076059	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:81076059T>C	ENST00000299575.4	+	3	660	c.636T>C	c.(634-636)acT>acC	p.T212T	ATMIN_ENST00000564241.1_Silent_p.T56T|ATMIN_ENST00000566488.1_Silent_p.T56T|ATMIN_ENST00000539819.1_Intron	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	212					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						TCTACCGAACTGGGCACGAGA	0.517																																					p.T212T		.											.	ATMIN	68	0			c.T636C						.						85.0	62.0	70.0					16																	81076059		2202	4300	6502	SO:0001819	synonymous_variant	23300	exon3			CCGAACTGGGCAC	BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.636T>C	16.37:g.81076059T>C		32.0	0.0		31.0	14.0	NM_015251	A8K4H8|Q68DC9	Silent	SNP	ENST00000299575.4	37	CCDS32494.1																																																																																			.		0.517	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432140.1	NM_015251	
ATPAF1	64756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47110923	47110923	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:47110923T>C	ENST00000371937.4	-	7	698	c.594A>G	c.(592-594)ctA>ctG	p.L198L	ATPAF1_ENST00000542495.1_Silent_p.L47L|ATPAF1_ENST00000574428.1_Intron|ATPAF1_ENST00000532925.1_Silent_p.L110L|ATPAF1_ENST00000576409.1_Silent_p.L221L|ATPAF1_ENST00000329231.4_Intron	NM_022745.4	NP_073582.3	Q5TC12	ATPF1_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 1	198					protein complex assembly (GO:0006461)	mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Acute lymphoblastic leukemia(166;0.155)					GCAGAGCACATAGAAACTGTG	0.373																																					p.L221L	Melanoma(138;107 1777 21672 30337 52312)	.											.	ATPAF1	90	0			c.A663G						.						124.0	118.0	120.0					1																	47110923		2203	4300	6503	SO:0001819	synonymous_variant	64756	exon7			AGCACATAGAAAC	AK026004	CCDS541.1, CCDS41327.1, CCDS541.2, CCDS41327.2, CCDS57997.1, CCDS57998.1	1p33-p32.3	2012-10-12			ENSG00000123472	ENSG00000123472		"""Mitochondrial respiratory chain complex assembly factors"""	18803	protein-coding gene	gene with protein product		608917				11410595	Standard	NM_022745		Approved	FLJ22351, Atp11p, ATP11	uc001cqh.4	Q5TC12	OTTHUMG00000007988	ENST00000371937.4:c.594A>G	1.37:g.47110923T>C		34.0	0.0		42.0	27.0	NM_022745	B1AQW7|B7Z7D6|B7Z7I6|Q9H6E3	Silent	SNP	ENST00000371937.4	37		.	.	.	.	.	.	.	.	.	.	T	7.749	0.702937	0.15172	.	.	ENSG00000123472	ENST00000534216	.	.	.	5.81	-8.29	0.01009	.	.	.	.	.	T	0.32010	0.0815	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43212	-0.9405	4	.	.	.	-8.3799	0.3819	0.00396	0.2212:0.2637:0.2117:0.3034	.	.	.	.	C	53	.	.	Y	-	2	0	ATPAF1	46883510	0.000000	0.05858	0.796000	0.32109	0.834000	0.47266	-2.665000	0.00848	-1.173000	0.02758	-0.137000	0.14449	TAT	.		0.373	ATPAF1-201	KNOWN	basic	protein_coding	protein_coding		NM_022745	
BCL11B	64919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	99641711	99641711	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr14:99641711A>T	ENST00000357195.3	-	4	1471	c.1462T>A	c.(1462-1464)Tcc>Acc	p.S488T	BCL11B_ENST00000443726.2_Missense_Mutation_p.S294T|BCL11B_ENST00000345514.2_Missense_Mutation_p.S417T	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	488					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCGTCGTCGGAGCGGCCGGCC	0.716			T	TLX3	T-ALL																																p.S488T		.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	1147	0			c.T1462A						.						7.0	8.0	7.0					14																	99641711		2147	4190	6337	SO:0001583	missense	64919	exon4			CGTCGGAGCGGCC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1462T>A	14.37:g.99641711A>T	ENSP00000349723:p.Ser488Thr	28.0	0.0		27.0	13.0	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	A	17.90	3.502345	0.64298	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.13307	2.61;2.63;2.6	3.62	3.62	0.41486	.	0.000000	0.64402	D	0.000010	T	0.26557	0.0649	L	0.52905	1.665	0.51012	D	0.999907	D;D	0.63046	0.992;0.991	D;P	0.65140	0.932;0.771	T	0.02617	-1.1133	10	0.20046	T	0.44	-11.4963	12.5401	0.56165	1.0:0.0:0.0:0.0	.	417;488	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	T	488;417;294	ENSP00000349723:S488T;ENSP00000280435:S417T;ENSP00000387419:S294T	ENSP00000280435:S417T	S	-	1	0	BCL11B	98711464	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.101000	0.76997	1.426000	0.47256	0.379000	0.24179	TCC	.		0.716	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32706429	32706429	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:32706429G>C	ENST00000421745.2	+	38	7584	c.7450G>C	c.(7450-7452)Gac>Cac	p.D2484H		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2484					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TAAAGAAATTGACCTTGAGTT	0.348																																					p.D2484H	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.G7450C						.						98.0	106.0	103.0					2																	32706429		2203	4300	6503	SO:0001583	missense	57448	exon38			GAAATTGACCTTG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.7450G>C	2.37:g.32706429G>C	ENSP00000393596:p.Asp2484His	210.0	0.0		215.0	110.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	27.4	4.823696	0.90873	.	.	ENSG00000115760	ENST00000421745	T	0.77098	-1.07	5.22	5.22	0.72569	.	0.126770	0.50627	D	0.000111	T	0.81927	0.4926	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.84845	0.0810	10	0.87932	D	0	.	18.7825	0.91939	0.0:0.0:1.0:0.0	.	2484	Q9NR09	BIRC6_HUMAN	H	2484	ENSP00000393596:D2484H	ENSP00000393596:D2484H	D	+	1	0	BIRC6	32559933	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.447000	0.97595	2.446000	0.82766	0.460000	0.39030	GAC	.		0.348	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BOD1L1	259282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	13601419	13601419	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:13601419T>A	ENST00000040738.5	-	10	7240	c.7105A>T	c.(7105-7107)Agc>Tgc	p.S2369C		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2369						nucleus (GO:0005634)	DNA binding (GO:0003677)										TTGTGCTTGCTCACTTCTGTG	0.542																																					p.S2369C		.											.	.	.	0			c.A7105T						.						132.0	112.0	119.0					4																	13601419		2203	4300	6503	SO:0001583	missense	259282	exon10			GCTTGCTCACTTC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.7105A>T	4.37:g.13601419T>A	ENSP00000040738:p.Ser2369Cys	144.0	0.0		135.0	50.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	16.16	3.043323	0.55003	.	.	ENSG00000038219	ENST00000040738	T	0.08807	3.05	5.22	1.43	0.22495	.	0.611515	0.15479	N	0.260187	T	0.12475	0.0303	L	0.54323	1.7	0.09310	N	1	D	0.63046	0.992	P	0.52710	0.707	T	0.14254	-1.0479	10	0.87932	D	0	-3.7656	3.5239	0.07752	0.0:0.2654:0.1966:0.538	.	2369	Q8NFC6	BOD1L_HUMAN	C	2369	ENSP00000040738:S2369C	ENSP00000040738:S2369C	S	-	1	0	BOD1L	13210517	0.002000	0.14202	0.001000	0.08648	0.018000	0.09664	1.219000	0.32479	0.305000	0.22832	0.528000	0.53228	AGC	.		0.542	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
BTLA	151888	broad.mit.edu;ucsc.edu	37	3	112190146	112190146	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:112190146G>T	ENST00000334529.5	-	3	662	c.460C>A	c.(460-462)Ctc>Atc	p.L154I	BTLA_ENST00000474965.1_5'Flank|BTLA_ENST00000383680.4_Intron	NM_181780.3	NP_861445	Q7Z6A9	BTLA_HUMAN	B and T lymphocyte associated	154					immune response-regulating cell surface receptor signaling pathway (GO:0002768)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of B cell proliferation (GO:0030889)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|cervix(2)|large_intestine(1)|lung(5)|prostate(1)	11		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)				CGATACAGGAGCCAGGGTCTG	0.468																																					p.L154I		.											.	BTLA	90	0			c.C460A						.						156.0	141.0	147.0					3																	112190146		2203	4300	6503	SO:0001583	missense	151888	exon3			ACAGGAGCCAGGG	AY293286	CCDS33819.1, CCDS43130.1	3q13.2	2013-01-11			ENSG00000186265	ENSG00000186265		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21087	protein-coding gene	gene with protein product		607925				12796776	Standard	NM_001085357		Approved	BTLA1, CD272	uc003dza.4	Q7Z6A9	OTTHUMG00000159255	ENST00000334529.5:c.460C>A	3.37:g.112190146G>T	ENSP00000333919:p.Leu154Ile	65.0	0.0		38.0	4.0	NM_181780	Q3B831|Q3HS85|Q6ZNH9	Missense_Mutation	SNP	ENST00000334529.5	37	CCDS33819.1	.	.	.	.	.	.	.	.	.	.	G	2.104	-0.405258	0.04832	.	.	ENSG00000186265	ENST00000334529	T	0.29397	1.57	4.0	-0.0659	0.13766	.	0.448335	0.18650	N	0.135023	T	0.11750	0.0286	N	0.08118	0	0.22873	N	0.998621	B	0.17038	0.02	B	0.12156	0.007	T	0.13737	-1.0498	10	0.48119	T	0.1	-1.5247	1.7563	0.02983	0.116:0.2925:0.3457:0.2458	.	154	Q7Z6A9	BTLA_HUMAN	I	154	ENSP00000333919:L154I	ENSP00000333919:L154I	L	-	1	0	BTLA	113672836	0.991000	0.36638	0.167000	0.22817	0.068000	0.16541	0.379000	0.20585	-0.027000	0.13873	-0.136000	0.14681	CTC	.		0.468	BTLA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354101.1	NM_181780	
C1orf180	439927	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	85096333	85096333	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:85096333T>A	ENST00000370624.1	-	3	463	c.336A>T	c.(334-336)tcA>tcT	p.S112S	C1orf180_ENST00000327308.3_Silent_p.S112S					chromosome 1 open reading frame 180																		ctctaggatctgagggcagct	0.507																																					.		.											.	.	.	0			.						.																																			SO:0001819	synonymous_variant	439927	.			AGGATCTGAGGGC	AK092806		1p22.3	2013-01-15			ENSG00000180869	ENSG00000180869			26647	other	unknown							Standard	NR_027379		Approved	FLJ35487	uc010ory.1	Q8NAE3	OTTHUMG00000009923	ENST00000370624.1:c.336A>T	1.37:g.85096333T>A		73.0	0.0		112.0	48.0	.		RNA	SNP	ENST00000370624.1	37																																																																																				.		0.507	C1orf180-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027461.1	NR_027379	
C1orf27	54953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186348970	186348970	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:186348970T>A	ENST00000287859.6	+	2	178	c.53T>A	c.(52-54)aTa>aAa	p.I18K	C1orf27_ENST00000432021.3_Missense_Mutation_p.I18K|C1orf27_ENST00000367470.3_Missense_Mutation_p.I18K|C1orf27_ENST00000419367.3_Missense_Mutation_p.I18K	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	18						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						CTTTCAAACATAAATCTCCAA	0.323																																					p.I18K		.											.	C1orf27	23	0			c.T53A						.						137.0	137.0	137.0					1																	186348970		1814	4075	5889	SO:0001583	missense	54953	exon2			CAAACATAAATCT	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.53T>A	1.37:g.186348970T>A	ENSP00000287859:p.Ile18Lys	120.0	0.0		203.0	82.0	NM_001164245	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	ENST00000287859.6	37	CCDS53448.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.017445	0.54576	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	T;T	0.48836	0.8;0.82	5.33	5.33	0.75918	.	0.467872	0.20767	N	0.086055	T	0.45276	0.1334	L	0.50333	1.59	0.30318	N	0.787863	P;B;B	0.35208	0.49;0.21;0.21	B;B;B	0.37422	0.249;0.148;0.148	T	0.53236	-0.8467	10	0.46703	T	0.11	-26.9905	12.8427	0.57813	0.0:0.0:0.0:1.0	.	18;18;18	E9PFR7;Q5SWX8-2;Q5SWX8	.;.;ODR4_HUMAN	K	18	ENSP00000395084:I18K;ENSP00000287859:I18K	ENSP00000287859:I18K	I	+	2	0	C1orf27	184615593	0.906000	0.30813	0.435000	0.26784	0.981000	0.71138	5.728000	0.68531	2.011000	0.59026	0.528000	0.53228	ATA	.		0.323	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
CARD11	84433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2987241	2987241	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:2987241G>A	ENST00000396946.4	-	3	591	c.188C>T	c.(187-189)gCc>gTc	p.A63V	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	63	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CAGCATAGGGGCATTAAGCAC	0.542			Mis		DLBCL																																p.A63V		.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	870	0			c.C188T						.						263.0	194.0	218.0					7																	2987241		2203	4300	6503	SO:0001583	missense	84433	exon3			ATAGGGGCATTAA	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.188C>T	7.37:g.2987241G>A	ENSP00000380150:p.Ala63Val	118.0	0.0		121.0	61.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513505	0.64522	.	.	ENSG00000198286	ENST00000396946;ENST00000356408	T;T	0.25749	1.78;2.04	5.15	5.15	0.70609	DEATH-like (2);Caspase Recruitment (2);	0.050244	0.85682	D	0.000000	T	0.20981	0.0505	N	0.22421	0.69	0.42369	D	0.992445	P	0.37731	0.607	B	0.39465	0.3	T	0.04041	-1.0982	10	0.59425	D	0.04	-21.0585	13.9603	0.64175	0.0:0.0:0.8482:0.1518	.	63	Q9BXL7	CAR11_HUMAN	V	63	ENSP00000380150:A63V;ENSP00000348779:A63V	ENSP00000348779:A63V	A	-	2	0	CARD11	2953767	1.000000	0.71417	0.109000	0.21407	0.843000	0.47879	7.169000	0.77578	2.585000	0.87301	0.650000	0.86243	GCC	.		0.542	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
CARD8	22900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48734142	48734142	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:48734142G>C	ENST00000359009.4	-	5	661	c.349C>G	c.(349-351)Ctg>Gtg	p.L117V	CARD8_ENST00000521613.1_Missense_Mutation_p.L172V|ZNF114_ENST00000597695.1_Intron|CARD8_ENST00000519940.1_Missense_Mutation_p.L222V|CARD8_ENST00000391898.3_Missense_Mutation_p.L222V|CARD8_ENST00000447740.2_Missense_Mutation_p.L172V|CARD8_ENST00000520015.1_Missense_Mutation_p.L222V|CARD8_ENST00000520153.1_Missense_Mutation_p.L172V|CARD8_ENST00000357778.5_5'UTR|CARD8_ENST00000520753.1_Missense_Mutation_p.L222V			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	117					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		TGGTGCTGCAGGTCCAGGGCC	0.597																																					p.L222V		.											.	CARD8	227	0			c.C664G						.						52.0	45.0	47.0					19																	48734142		2203	4300	6503	SO:0001583	missense	22900	exon6			GCTGCAGGTCCAG	AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.349C>G	19.37:g.48734142G>C	ENSP00000351901:p.Leu117Val	27.0	0.0		28.0	8.0	NM_001184900	B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Missense_Mutation	SNP	ENST00000359009.4	37		.	.	.	.	.	.	.	.	.	.	G	9.334	1.061243	0.19987	.	.	ENSG00000105483	ENST00000447740;ENST00000391898;ENST00000359009;ENST00000520753;ENST00000520153;ENST00000520015;ENST00000521613;ENST00000519940	T;T;T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33	1.7	0.644	0.17776	.	.	.	.	.	T	0.20700	0.0498	L	0.31664	0.95	0.09310	N	1	D;D;D;D;D;D;D;D	0.69078	0.997;0.997;0.997;0.997;0.974;0.996;0.996;0.997	D;D;D;D;D;D;D;D	0.79108	0.992;0.987;0.987;0.987;0.953;0.978;0.986;0.992	T	0.21518	-1.0243	9	0.16896	T	0.51	.	3.9882	0.09525	0.2263:0.0:0.7737:0.0	.	141;222;222;155;222;172;117;117	B5KVR7;E9PEM7;B5KVR6;Q6MZI8;Q9Y2G2-3;G3XAM9;Q9Y2G2-2;Q9Y2G2	.;.;.;.;.;.;.;CARD8_HUMAN	V	172;222;117;222;172;222;172;222	ENSP00000391248:L172V;ENSP00000375767:L222V;ENSP00000351901:L117V;ENSP00000429839:L222V;ENSP00000428736:L172V;ENSP00000430747:L222V;ENSP00000427858:L172V;ENSP00000428883:L222V	ENSP00000351901:L117V	L	-	1	2	CARD8	53425954	0.012000	0.17670	0.011000	0.14972	0.108000	0.19459	0.573000	0.23699	0.266000	0.21894	0.655000	0.94253	CTG	.		0.597	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014959	
CD300LB	124599	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72519756	72519756	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:72519756G>A	ENST00000392621.1	-	3	520	c.516C>T	c.(514-516)acC>acT	p.T172T	CD300LB_ENST00000314401.3_Silent_p.T172T	NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	135					cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						TATTGCTGTTGGTAGGTGAGC	0.547																																					p.T172T		.											.	CD300LB	91	0			c.C516T						.						198.0	141.0	160.0					17																	72519756		2203	4300	6503	SO:0001819	synonymous_variant	124599	exon3			GCTGTTGGTAGGT	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.516C>T	17.37:g.72519756G>A		77.0	0.0		87.0	34.0	NM_174892	Q1EG73|Q8IX40|Q8N6D1	Silent	SNP	ENST00000392621.1	37	CCDS11700.1																																																																																			.		0.547	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145082.2	NM_174892	
CDC42BPA	8476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	227216680	227216680	+	Silent	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:227216680G>T	ENST00000366769.3	-	29	5296	c.4005C>A	c.(4003-4005)acC>acA	p.T1335T	CDC42BPA_ENST00000366765.3_Silent_p.T1348T|CDC42BPA_ENST00000334218.5_Silent_p.T1335T|CDC42BPA_ENST00000366766.2_Silent_p.T1370T|CDC42BPA_ENST00000535525.1_Silent_p.T1315T|CDC42BPA_ENST00000366767.3_Silent_p.T1254T|CDC42BPA_ENST00000366764.2_Silent_p.T1307T	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				TTCTGTGACGGGTCTTGCTCT	0.438																																					p.T1335T		.											.	CDC42BPA	549	0			c.C4005A						.						73.0	67.0	69.0					1																	227216680		2203	4300	6503	SO:0001819	synonymous_variant	8476	exon29			GTGACGGGTCTTG	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.4005C>A	1.37:g.227216680G>T		26.0	0.0		56.0	14.0	NM_003607		Silent	SNP	ENST00000366769.3	37	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	G	5.784	0.328964	0.10956	.	.	ENSG00000143776	ENST00000448940;ENST00000442054;ENST00000429440;ENST00000441725	.	.	.	5.32	1.29	0.21616	.	.	.	.	.	T	0.44746	0.1308	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20773	-1.0265	4	.	.	.	.	2.8943	0.05686	0.1889:0.2564:0.4215:0.1331	.	.	.	.	T	538;664;233;560	.	.	P	-	1	0	CDC42BPA	225283303	0.127000	0.22367	0.995000	0.50966	0.964000	0.63967	-0.620000	0.05565	-0.128000	0.11641	-1.128000	0.01989	CCG	.		0.438	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
CES1	1066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55850865	55850865	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:55850865A>G	ENST00000361503.4	-	8	1043	c.913T>C	c.(913-915)Tct>Cct	p.S305P	CES1_ENST00000422046.2_Missense_Mutation_p.S305P|CES1_ENST00000360526.3_Missense_Mutation_p.S306P			P23141	EST1_HUMAN	carboxylesterase 1	305				S -> M (in Ref. 14; AA sequence). {ECO:0000305}.	epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	AAGTCCAGAGATAAGAATTTC	0.483																																					p.S306P	NSCLC(162;1801 2756 42904 52896)	.											.	CES1	68	0			c.T916C						.						126.0	140.0	135.0					16																	55850865		2198	4300	6498	SO:0001583	missense	1066	exon8			CCAGAGATAAGAA	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.913T>C	16.37:g.55850865A>G	ENSP00000355193:p.Ser305Pro	53.0	0.0		60.0	9.0	NM_001025195	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	12.17	1.856645	0.32791	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.68765	-0.35;-0.35;-0.35	4.4	-7.66	0.01277	Carboxylesterase, type B (1);	3.847600	0.00868	N	0.001992	T	0.37019	0.0988	N	0.04203	-0.255	0.09310	N	1	B;B;B	0.25390	0.125;0.125;0.103	B;B;B	0.27380	0.079;0.079;0.047	T	0.23368	-1.0190	10	0.29301	T	0.29	.	2.1327	0.03754	0.1177:0.3691:0.2497:0.2634	.	305;305;306	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	P	306;305;305;170	ENSP00000353720:S306P;ENSP00000355193:S305P;ENSP00000390492:S305P	ENSP00000353720:S306P	S	-	1	0	CES1	54408366	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.357000	0.00499	-1.568000	0.01670	-0.475000	0.04921	TCT	.		0.483	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
CFTR	1080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117307000	117307000	+	Silent	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:117307000C>T	ENST00000003084.6	+	27	4413	c.4281C>T	c.(4279-4281)atC>atT	p.I1427I	CFTR_ENST00000454343.1_Silent_p.I1366I	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1427	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	ACGATTCCATCCAGAAACTGC	0.542									Cystic Fibrosis																												p.I1427I		.											.	CFTR	518	0			c.C4281T						.						58.0	50.0	53.0					7																	117307000		2203	4300	6503	SO:0001819	synonymous_variant	1080	exon27	Familial Cancer Database	CF	TTCCATCCAGAAA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.4281C>T	7.37:g.117307000C>T		89.0	0.0		105.0	47.0	NM_000492	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Silent	SNP	ENST00000003084.6	37	CCDS5773.1																																																																																			.		0.542	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
CHML	1122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	241799048	241799048	+	Silent	SNP	T	T	G	rs369552093		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:241799048T>G	ENST00000366553.1	-	1	184	c.21A>C	c.(19-21)acA>acC	p.T7T	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	7					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CATCAAACTCTGTGGGAAGAT	0.428																																					p.T7T		.											.	CHML	96	0			c.A21C						.	T	,	0,4406		0,0,2203	60.0	62.0	62.0		21,	2.8	1.0	1		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,intron	CHML,OPN3	NM_001821.3,NM_014322.2	,	0,1,6502	GG,GT,TT		0.0116,0.0,0.0077	,	7/657,	241799048	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1122	exon1			AAACTCTGTGGGA	X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.21A>C	1.37:g.241799048T>G		130.0	0.0		197.0	51.0	NM_001821	B2RAB9|Q17RE0|Q9H1Y4	Silent	SNP	ENST00000366553.1	37	CCDS31073.1																																																																																			.		0.428	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821	
CHRM2	1129	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	136700608	136700608	+	Frame_Shift_Del	DEL	A	A	-			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:136700608delA	ENST00000445907.2	+	3	1524	c.996delA	c.(994-996)ccafs	p.P332fs	hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Frame_Shift_Del_p.P332fs|CHRM2_ENST00000402486.3_Frame_Shift_Del_p.P332fs|CHRM2_ENST00000401861.1_Frame_Shift_Del_p.P332fs|CHRM2_ENST00000453373.1_Frame_Shift_Del_p.P332fs|hsa-mir-490_ENST00000439694.1_RNA|CHRM2_ENST00000320658.5_Frame_Shift_Del_p.P332fs|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000597642.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	332					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CCAAGACCCCAAAAAGTGACT	0.453																																					p.P332fs		.											.	CHRM2	94	0			c.996delA						.						103.0	103.0	103.0					7																	136700608		2203	4300	6503	SO:0001589	frameshift_variant	1129	exon3			GACCCCAAAAAGT		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.996delA	7.37:g.136700608delA	ENSP00000399745:p.Pro332fs	73.0	0.0		76.0	40.0	NM_001006632	Q4VBK6|Q9P1X9	Frame_Shift_Del	DEL	ENST00000445907.2	37	CCDS5843.1																																																																																			.		0.453	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
CIZ1	25792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130929424	130929424	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:130929424G>T	ENST00000393608.1	-	15	2517	c.2315C>A	c.(2314-2316)tCc>tAc	p.S772Y	CIZ1_ENST00000325721.8_Missense_Mutation_p.S743Y|CIZ1_ENST00000541172.1_Missense_Mutation_p.S671Y|CIZ1_ENST00000277465.4_Missense_Mutation_p.S744Y|CIZ1_ENST00000372948.3_Missense_Mutation_p.S716Y|CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000538431.1_Missense_Mutation_p.S798Y|CIZ1_ENST00000372938.5_Missense_Mutation_p.S772Y|CIZ1_ENST00000357558.5_Missense_Mutation_p.S744Y|CIZ1_ENST00000372954.1_Missense_Mutation_p.S692Y	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	772					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						CTCCTCTCTGGATATATCTCT	0.597																																					p.S828Y		.											.	CIZ1	92	0			c.C2483A						.						91.0	69.0	76.0					9																	130929424		2203	4300	6503	SO:0001583	missense	25792	exon16			TCTCTGGATATAT	AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.2315C>A	9.37:g.130929424G>T	ENSP00000377232:p.Ser772Tyr	53.0	0.0		60.0	29.0	NM_001257975	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Missense_Mutation	SNP	ENST00000393608.1	37	CCDS6894.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719921	0.68844	.	.	ENSG00000148337	ENST00000372954;ENST00000393608;ENST00000538431;ENST00000357558;ENST00000325721;ENST00000537314;ENST00000541172;ENST00000277465;ENST00000372948;ENST00000372938;ENST00000415526	T;T;T;T;T;T;T;T;T;T	0.37915	1.17;1.34;1.35;1.49;1.34;1.76;1.49;1.17;1.34;1.92	5.15	3.25	0.37280	.	0.671596	0.13180	N	0.407638	T	0.48169	0.1485	L	0.48642	1.525	0.09310	N	1	D;D;D;D;D;D;D	0.76494	0.999;0.996;0.998;0.997;0.998;0.998;0.984	D;P;D;D;D;D;P	0.68039	0.949;0.851;0.929;0.955;0.931;0.953;0.804	T	0.26258	-1.0108	10	0.72032	D	0.01	-6.3263	7.7015	0.28625	0.0835:0.0:0.7545:0.1621	.	798;711;716;692;772;743;744	B7Z3U7;B4E0A3;Q9ULV3-4;Q9ULV3-3;Q9ULV3;Q9ULV3-2;Q5SYW2	.;.;.;.;CIZ1_HUMAN;.;.	Y	692;772;798;744;743;711;671;744;716;772;694	ENSP00000362045:S692Y;ENSP00000377232:S772Y;ENSP00000439244:S798Y;ENSP00000350169:S744Y;ENSP00000320374:S743Y;ENSP00000445057:S671Y;ENSP00000277465:S744Y;ENSP00000362039:S716Y;ENSP00000362029:S772Y;ENSP00000398011:S694Y	ENSP00000277465:S744Y	S	-	2	0	CIZ1	129969245	0.150000	0.22732	0.000000	0.03702	0.691000	0.40173	3.056000	0.49923	0.642000	0.30620	0.655000	0.94253	TCC	.		0.597	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054399.1	NM_012127	
CLDN18	51208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	137748665	137748665	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:137748665T>C	ENST00000183605.5	+	4	756	c.530T>C	c.(529-531)gTg>gCg	p.V177A	CLDN18_ENST00000343735.4_Missense_Mutation_p.V177A	NM_016369.3	NP_057453.1	P56856	CLD18_HUMAN	claudin 18	177					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						GCTCTGTTCGTGGGCTGGGTC	0.587																																					p.V177A		.											.	CLDN18	92	0			c.T530C						.						59.0	50.0	53.0					3																	137748665		2203	4299	6502	SO:0001583	missense	51208	exon4			TGTTCGTGGGCTG	AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000183605.5:c.530T>C	3.37:g.137748665T>C	ENSP00000183605:p.Val177Ala	106.0	0.0		62.0	33.0	NM_016369	A5PL21|Q96PH4	Missense_Mutation	SNP	ENST00000183605.5	37	CCDS3095.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.646182	0.87958	.	.	ENSG00000066405	ENST00000343735;ENST00000183605;ENST00000536138	D;D	0.89123	-2.47;-2.47	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.93667	0.7977	M	0.69823	2.125	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76575	0.988;0.988;0.982	D	0.94417	0.7637	10	0.87932	D	0	.	15.2795	0.73770	0.0:0.0:0.0:1.0	.	166;177;177	B4DNX6;P56856;P56856-2	.;CLD18_HUMAN;.	A	177;177;166	ENSP00000340939:V177A;ENSP00000183605:V177A	ENSP00000183605:V177A	V	+	2	0	CLDN18	139231355	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.687000	0.74552	2.070000	0.61991	0.533000	0.62120	GTG	.		0.587	CLDN18-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357199.2	NM_001002026	
CLIP2	7461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73752825	73752825	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:73752825G>A	ENST00000395060.1	+	2	169	c.169G>A	c.(169-171)Gca>Aca	p.A57T	CLIP2_ENST00000223398.6_Missense_Mutation_p.A57T|CLIP2_ENST00000361545.5_Missense_Mutation_p.A57T			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	57						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CTCCCCGGCCGCAGCTGCTGC	0.667																																					p.A57T		.											.	CLIP2	93	0			c.G169A						.						17.0	16.0	17.0					7																	73752825		2200	4297	6497	SO:0001583	missense	7461	exon3			CCGGCCGCAGCTG	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.169G>A	7.37:g.73752825G>A	ENSP00000378500:p.Ala57Thr	72.0	0.0		79.0	34.0	NM_032421	O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	G	7.788	0.710979	0.15239	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.59502	0.26;0.27;0.26	4.75	-0.955	0.10356	Cytoskeleton-associated protein, Gly-rich domain (1);	0.685507	0.13103	N	0.413608	T	0.28797	0.0714	N	0.12182	0.205	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.0	T	0.13495	-1.0507	10	0.16420	T	0.52	-5.5102	2.8167	0.05458	0.3051:0.0:0.3593:0.3356	.	57;57	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	T	57	ENSP00000223398:A57T;ENSP00000355151:A57T;ENSP00000378500:A57T	ENSP00000223398:A57T	A	+	1	0	CLIP2	73390761	0.000000	0.05858	0.000000	0.03702	0.552000	0.35366	-0.839000	0.04368	-0.054000	0.13266	0.462000	0.41574	GCA	.		0.667	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
CLMP	79827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	122954395	122954395	+	Silent	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr11:122954395A>T	ENST00000448775.2	-	4	889	c.549T>A	c.(547-549)tcT>tcA	p.S183S	CLMP_ENST00000530371.1_5'UTR	NM_024769.2	NP_079045.1	Q9H6B4	CLMP_HUMAN	CXADR-like membrane protein	183	Ig-like C2-type 2.				digestive tract development (GO:0048565)	cell surface (GO:0009986)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	14						TACCAATCCTAGATTTGGGAG	0.468																																					p.S183S		.											.	CLMP	91	0			c.T549A						.						148.0	118.0	128.0					11																	122954395		2202	4299	6501	SO:0001819	synonymous_variant	79827	exon4			AATCCTAGATTTG	BC009371	CCDS8441.1	11q24	2013-01-29			ENSG00000166250	ENSG00000166250		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24039	protein-coding gene	gene with protein product	"""adipocyte-specific adhesion molecule"", ""coxsackie- and adenovirus receptor-like membrane protein"", ""adipocyte adhesion molecule"""	611693				12851705, 14573622	Standard	NM_024769		Approved	ASAM, FLJ22415, ACAM	uc001pyt.3	Q9H6B4		ENST00000448775.2:c.549T>A	11.37:g.122954395A>T		61.0	0.0		44.0	10.0	NM_024769		Silent	SNP	ENST00000448775.2	37	CCDS8441.1																																																																																			.		0.468	CLMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387542.1	NM_024769	
CNBD1	168975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	88249211	88249211	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:88249211T>C	ENST00000518476.1	+	6	693	c.642T>C	c.(640-642)taT>taC	p.Y214Y	CNBD1_ENST00000522427.1_3'UTR	NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	214										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						CAAACGTGTATAAAAATCTGA	0.363																																					p.Y214Y		.											.	CNBD1	3	0			c.T642C						.						143.0	128.0	133.0					8																	88249211		1841	4087	5928	SO:0001819	synonymous_variant	168975	exon6			CGTGTATAAAAAT	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.642T>C	8.37:g.88249211T>C		87.0	0.0		153.0	53.0	NM_173538		Silent	SNP	ENST00000518476.1	37	CCDS55259.1																																																																																			.		0.363	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375113.2	NM_173538	
COL18A1	80781	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	46911137	46911137	+	Splice_Site	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr21:46911137A>T	ENST00000359759.4	+	21	3333		c.e21-1		COL18A1_ENST00000400337.2_Splice_Site|COL18A1_ENST00000355480.5_Splice_Site			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CTCCTCTTCCAGGGAGATCCA	0.701																																					.		.											.	COL18A1	90	0			c.2068-2A>T						.						26.0	32.0	30.0					21																	46911137		1933	4117	6050	SO:0001630	splice_region_variant	80781	exon22			TCTTCCAGGGAGA		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3313-1A>T	21.37:g.46911137A>T		146.0	0.0		165.0	69.0	NM_130445	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Splice_Site	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	A	9.978	1.227280	0.22542	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4665	0.27324	0.7793:0.2206:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL18A1	45735565	0.992000	0.36948	1.000000	0.80357	0.162000	0.22319	1.727000	0.38095	1.753000	0.51906	0.459000	0.35465	.	.		0.701	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		Intron
COL2A1	1280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48370680	48370680	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:48370680T>A	ENST00000380518.3	-	48	3514	c.3350A>T	c.(3349-3351)gAc>gTc	p.D1117V	COL2A1_ENST00000337299.6_Missense_Mutation_p.D1048V|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1117	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CTCTCCTTTGTCACCTCTGGG	0.637																																					p.D1117V		.											.	COL2A1	92	0			c.A3350T						.						36.0	30.0	32.0					12																	48370680		2203	4300	6503	SO:0001583	missense	1280	exon48			CCTTTGTCACCTC	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.3350A>T	12.37:g.48370680T>A	ENSP00000369889:p.Asp1117Val	55.0	0.0		41.0	17.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	37	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.786203	0.70337	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.92858	-3.12;-3.12	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.93064	0.7792	L	0.27053	0.805	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.87578	0.998;0.995	D	0.94252	0.7494	10	0.87932	D	0	.	15.1548	0.72733	0.0:0.0:0.0:1.0	.	1048;1117	P02458-1;P02458	.;CO2A1_HUMAN	V	1117;1048;1048	ENSP00000369889:D1117V;ENSP00000338213:D1048V	ENSP00000338213:D1048V	D	-	2	0	COL2A1	46656947	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.991000	0.88244	2.064000	0.61679	0.460000	0.39030	GAC	.		0.637	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
COL4A6	1288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	107423750	107423750	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:107423750A>T	ENST00000372216.4	-	25	2229	c.2129T>A	c.(2128-2130)tTa>tAa	p.L710*	COL4A6_ENST00000545689.1_Nonsense_Mutation_p.L709*|COL4A6_ENST00000538570.1_Nonsense_Mutation_p.L709*|COL4A6_ENST00000394872.2_Nonsense_Mutation_p.L710*|COL4A6_ENST00000334504.7_Nonsense_Mutation_p.L709*	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	710	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						CTTACCTGGTAATTCAGGAAG	0.527									Alport syndrome with Diffuse Leiomyomatosis																												p.L710X	Melanoma(87;1895 1945 2589 7165)	.											.	COL4A6	199	0			c.T2129A						.						67.0	51.0	56.0					X																	107423750		2203	4299	6502	SO:0001587	stop_gained	1288	exon25	Familial Cancer Database		CCTGGTAATTCAG	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2129T>A	X.37:g.107423750A>T	ENSP00000361290:p.Leu710*	114.0	0.0		120.0	53.0	NM_001847	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Nonsense_Mutation	SNP	ENST00000372216.4	37	CCDS14541.1	.	.	.	.	.	.	.	.	.	.	A	37	6.271289	0.97431	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	.	.	.	5.07	5.07	0.68467	.	0.238854	0.21755	N	0.069617	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	9.1344	0.36866	0.8238:0.0:0.0:0.1762	.	.	.	.	X	710;709;710;709;709;709	.	ENSP00000334733:L709X	L	-	2	0	COL4A6	107310406	0.058000	0.20735	0.893000	0.35052	0.194000	0.23727	1.471000	0.35365	1.940000	0.56252	0.417000	0.27973	TTA	.		0.527	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
CPA5	93979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	130002351	130002351	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:130002351C>A	ENST00000485477.1	+	7	1736	c.607C>A	c.(607-609)Cat>Aat	p.H203N	CPA5_ENST00000474905.1_Missense_Mutation_p.H203N|CPA5_ENST00000393213.3_Missense_Mutation_p.H203N|CPA5_ENST00000355388.3_Missense_Mutation_p.H203N|CPA5_ENST00000466363.2_Missense_Mutation_p.H203N|CPA5_ENST00000461828.1_Missense_Mutation_p.H203N|CPA5_ENST00000431780.2_Missense_Mutation_p.H203N			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	203						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GTGGATCACCCATGCCACCGG	0.562																																					p.H203N		.											.	CPA5	92	0			c.C607A						.						48.0	44.0	45.0					7																	130002351		2203	4300	6503	SO:0001583	missense	93979	exon8			ATCACCCATGCCA	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.607C>A	7.37:g.130002351C>A	ENSP00000420237:p.His203Asn	34.0	0.0		35.0	22.0	NM_080385	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	37	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632346	0.67015	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89;2.89;2.89	5.61	5.61	0.85477	Peptidase M14, carboxypeptidase A (3);	0.090096	0.49305	D	0.000160	T	0.15825	0.0381	L	0.53729	1.69	0.44194	D	0.997015	P;B	0.35944	0.529;0.271	B;B	0.38156	0.236;0.266	T	0.02037	-1.1225	9	.	.	.	.	18.6123	0.91290	0.0:1.0:0.0:0.0	.	203;203	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	N	203	ENSP00000347549:H203N;ENSP00000418183:H203N;ENSP00000419025:H203N;ENSP00000420237:H203N;ENSP00000393045:H203N;ENSP00000417314:H203N;ENSP00000376907:H203N	.	H	+	1	0	CPA5	129789587	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	7.389000	0.79806	2.627000	0.88993	0.591000	0.81541	CAT	.		0.562	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
CRLF1	9244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18710417	18710417	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:18710417G>T	ENST00000392386.3	-	2	548	c.355C>A	c.(355-357)Cgt>Agt	p.R119S		NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	119	Ig-like C2-type.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						CTGCCGTCACGGGCGTGGCAC	0.652																																					p.R119S		.											CRLF1,brain,glioma,+1	CRLF1	514	0			c.C355A						.																																			SO:0001583	missense	9244	exon2			CGTCACGGGCGTG	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.355C>A	19.37:g.18710417G>T	ENSP00000376188:p.Arg119Ser	39.0	0.0		45.0	18.0	NM_004750	Q9UHH5	Missense_Mutation	SNP	ENST00000392386.3	37	CCDS32962.1	.	.	.	.	.	.	.	.	.	.	G	9.078	0.998652	0.19121	.	.	ENSG00000006016	ENST00000392386	D	0.85773	-2.03	5.23	5.23	0.72850	Immunoglobulin-like fold (1);	0.681186	0.15402	N	0.264279	T	0.65523	0.2699	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48019	-0.9071	10	0.12103	T	0.63	-5.7136	12.4733	0.55799	0.0:0.0:0.8324:0.1676	.	119	O75462	CRLF1_HUMAN	S	119	ENSP00000376188:R119S	ENSP00000376188:R119S	R	-	1	0	CRLF1	18571417	0.670000	0.27512	0.485000	0.27403	0.546000	0.35178	1.277000	0.33167	2.449000	0.82847	0.511000	0.50034	CGT	.		0.652	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1		
CROCC	9696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17280833	17280833	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:17280833G>T	ENST00000375541.5	+	22	3371	c.3302G>T	c.(3301-3303)aGc>aTc	p.S1101I	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GATGCCCAGAGCCGGCAGGAG	0.647																																					p.S1101I		.											.	CROCC	137	0			c.G3302T						.						38.0	42.0	41.0					1																	17280833		2203	4299	6502	SO:0001583	missense	9696	exon22			CCCAGAGCCGGCA	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3302G>T	1.37:g.17280833G>T	ENSP00000364691:p.Ser1101Ile	58.0	0.0		71.0	31.0	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814195	0.32053	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.52057	0.68	4.5	2.61	0.31194	.	.	.	.	.	T	0.28896	0.0717	N	0.20401	0.57	0.28496	N	0.914225	B;B;B	0.19706	0.038;0.005;0.009	B;B;B	0.18561	0.022;0.015;0.015	T	0.18681	-1.0329	9	0.40728	T	0.16	.	4.5226	0.11966	0.1945:0.0:0.6292:0.1763	.	964;404;1101	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	I	1101;982	ENSP00000364691:S1101I	ENSP00000364691:S1101I	S	+	2	0	CROCC	17153420	0.923000	0.31300	1.000000	0.80357	0.939000	0.58152	0.937000	0.28951	0.597000	0.29811	0.561000	0.74099	AGC	.		0.647	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
CSAD	51380	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	53553988	53553988	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:53553988T>G	ENST00000444623.1	-	14	1349	c.1082A>C	c.(1081-1083)gAc>gCc	p.D361A	CSAD_ENST00000453446.2_Missense_Mutation_p.D361A|CSAD_ENST00000379843.3_Missense_Mutation_p.D214A|CSAD_ENST00000379846.1_Missense_Mutation_p.D214A|CSAD_ENST00000267085.4_Missense_Mutation_p.D388A|RP11-1136G11.8_ENST00000550908.1_lincRNA	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	361					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	CTTCAGACAGTCCACACGGCG	0.622																																					p.D388A	Ovarian(109;252 1546 16882 28524 44645)	.											.	CSAD	91	0			c.A1163C						.						114.0	101.0	105.0					12																	53553988		2203	4300	6503	SO:0001583	missense	51380	exon14			AGACAGTCCACAC	AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1082A>C	12.37:g.53553988T>G	ENSP00000415485:p.Asp361Ala	29.0	0.0		33.0	5.0	NM_015989	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Missense_Mutation	SNP	ENST00000444623.1	37	CCDS58235.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.870587	0.91587	.	.	ENSG00000139631	ENST00000308926;ENST00000379843;ENST00000267085;ENST00000379846;ENST00000444623;ENST00000398047;ENST00000453446	T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17	4.67	4.67	0.58626	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.095813	0.64402	D	0.000001	T	0.69223	0.3087	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.78843	-0.2044	10	0.87932	D	0	-21.8356	13.5402	0.61671	0.0:0.0:0.0:1.0	.	388;361;214	Q9Y600-3;Q9Y600;Q9Y600-2	.;CSAD_HUMAN;.	A	450;214;388;214;361;322;361	ENSP00000369172:D214A;ENSP00000267085:D388A;ENSP00000369175:D214A;ENSP00000415485:D361A;ENSP00000410648:D361A	ENSP00000267085:D388A	D	-	2	0	CSAD	51840255	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.430000	0.80321	2.100000	0.63781	0.533000	0.62120	GAC	.		0.622	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113529405	113529405	+	Silent	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:113529405A>T	ENST00000297405.5	-	28	4858	c.4614T>A	c.(4612-4614)acT>acA	p.T1538T	CSMD3_ENST00000455883.2_Silent_p.T1434T|CSMD3_ENST00000352409.3_Silent_p.T1538T|CSMD3_ENST00000343508.3_Silent_p.T1498T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1538	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCCCATTTCGAGTCCCATTCA	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T1538T		.											.	CSMD3	1132	0			c.T4614A						.						76.0	68.0	71.0					8																	113529405		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon28			ATTTCGAGTCCCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4614T>A	8.37:g.113529405A>T		72.0	0.0		125.0	14.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTBP2	1488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	126715391	126715391	+	Intron	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:126715391T>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Missense_Mutation_p.Q313L	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		GTCAAAGCCCTGCTGCAGTAG	0.677																																					p.Q313L		.											.	CTBP2	90	0			c.A938T						.						33.0	35.0	34.0					10																	126715391		2203	4300	6503	SO:0001627	intron_variant	1488	exon1			AAGCCCTGCTGCA	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12174A>T	10.37:g.126715391T>A		74.0	0.0		30.0	27.0	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Missense_Mutation	SNP	ENST00000337195.5	37	CCDS7643.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.989875	0.54041	.	.	ENSG00000175029	ENST00000309035	D	0.84442	-1.85	4.88	3.66	0.41972	.	0.336302	0.27406	N	0.019501	T	0.79569	0.4468	.	.	.	0.80722	D	1	B	0.20052	0.041	B	0.23716	0.048	T	0.77851	-0.2434	9	0.54805	T	0.06	.	10.7314	0.46098	0.1424:0.0:0.0:0.8576	.	313	P56545-2	.	L	313	ENSP00000311825:Q313L	ENSP00000311825:Q313L	Q	-	2	0	CTBP2	126705381	1.000000	0.71417	0.987000	0.45799	0.252000	0.25951	4.911000	0.63328	1.962000	0.57031	0.533000	0.62120	CAG	.		0.677	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	T	rs121913396|rs121913416		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:41266098A>T	ENST00000349496.5	+	3	375	c.95A>T	c.(94-96)gAc>gTc	p.D32V	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32V|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32V	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1	CTNNB1	24361	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95T						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>T	3.37:g.41266098A>T	ENSP00000344456:p.Asp32Val	122.0	0.0		150.0	73.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184569	0.78677	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74325	-0.3702	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	V	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25V;ENSP00000385604:D32V;ENSP00000412219:D32V;ENSP00000379486:D32V;ENSP00000344456:D32V;ENSP00000411226:D25V;ENSP00000379488:D32V;ENSP00000409302:D32V;ENSP00000401599:D32V	ENSP00000344456:D32V	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CWC22	57703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	180851443	180851443	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:180851443T>C	ENST00000410053.3	-	4	484	c.185A>G	c.(184-186)tAt>tGt	p.Y62C	CWC22_ENST00000295749.6_Missense_Mutation_p.Y62C	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	62	Arg-rich.				mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						GCTACTATCATAAGAACGTCC	0.343																																					p.Y62C		.											.	CWC22	90	0			c.A185G						.						82.0	76.0	78.0					2																	180851443		1854	4090	5944	SO:0001583	missense	57703	exon4			CTATCATAAGAAC		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.185A>G	2.37:g.180851443T>C	ENSP00000387006:p.Tyr62Cys	46.0	0.0		60.0	23.0	NM_020943	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	ENST00000410053.3	37	CCDS46465.1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.529659	0.64860	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.29397	2.02;2.02;1.57	5.95	5.95	0.96441	.	0.557628	0.19602	N	0.110375	T	0.34279	0.0892	L	0.47716	1.5	0.32634	N	0.521591	D	0.59357	0.985	P	0.46796	0.527	T	0.45760	-0.9239	10	0.36615	T	0.2	-15.8069	14.1434	0.65334	0.0:0.0:0.0:1.0	.	62	Q9HCG8	CWC22_HUMAN	C	62	ENSP00000387006:Y62C;ENSP00000295749:Y62C;ENSP00000384159:Y62C	ENSP00000295749:Y62C	Y	-	2	0	CWC22	180559688	1.000000	0.71417	0.996000	0.52242	0.843000	0.47879	3.014000	0.49590	2.268000	0.75426	0.533000	0.62120	TAT	.		0.343	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
BRINP1	1620	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	121929740	121929740	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:121929740G>A	ENST00000265922.3	-	8	2369	c.1908C>T	c.(1906-1908)ggC>ggT	p.G636G	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	636					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GGTCCACGGGGCCCTGGCCAG	0.557																																					p.G636G		.											.	DBC1	582	0			c.C1908T						.						138.0	134.0	135.0					9																	121929740		2203	4300	6503	SO:0001819	synonymous_variant	1620	exon8			CACGGGGCCCTGG	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1908C>T	9.37:g.121929740G>A		63.0	1.0		87.0	46.0	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	ENST00000265922.3	37	CCDS6822.1																																																																																			.		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	121930107	121930107	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:121930107G>T	ENST00000265922.3	-	8	2002	c.1541C>A	c.(1540-1542)aCc>aAc	p.T514N	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	514					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GTCAAAGAAGGTGTCGAGGCG	0.567																																					p.T514N		.											.	DBC1	582	0			c.C1541A						.						225.0	161.0	183.0					9																	121930107		2203	4300	6503	SO:0001583	missense	1620	exon8			AAGAAGGTGTCGA	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1541C>A	9.37:g.121930107G>T	ENSP00000265922:p.Thr514Asn	57.0	0.0		68.0	25.0	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727914	0.69074	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.14640	2.49	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	N	0.16368	0.405	0.80722	D	1	D	0.57899	0.981	D	0.67231	0.95	T	0.03453	-1.1035	10	0.42905	T	0.14	-25.0014	19.91	0.97023	0.0:0.0:1.0:0.0	.	514	O60477	DBC1_HUMAN	N	514	ENSP00000265922:T514N	ENSP00000265922:T514N	T	-	2	0	DBC1	120969928	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.911000	0.87458	2.702000	0.92279	0.655000	0.94253	ACC	.		0.567	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	155256019	155256019	+	Splice_Site	SNP	C	C	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:155256019C>G	ENST00000357232.4	-	8	1216		c.e8+1		DCHS2_ENST00000339452.1_Splice_Site|DCHS2_ENST00000507542.1_Splice_Site	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TAAGTACTTACTCAAGGGCTC	0.373																																					.		.											.	DCHS2	94	0			c.1216+1G>C						.						103.0	102.0	102.0					4																	155256019		2203	4300	6503	SO:0001630	splice_region_variant	54798	exon9			TACTTACTCAAGG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1216+1G>C	4.37:g.155256019C>G		47.0	0.0		26.0	9.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Splice_Site	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029069	0.75504	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCHS2	155475469	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	5.137000	0.64789	2.941000	0.99782	0.655000	0.94253	.	.		0.373	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	Intron
DDX1	1653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	15736869	15736869	+	Silent	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:15736869A>T	ENST00000381341.2	+	5	533	c.144A>T	c.(142-144)acA>acT	p.T48T	DDX1_ENST00000233084.3_Silent_p.T48T			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	48	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		CTGCAGAAACAGGAAGTGGCA	0.274																																					p.T48T		.											.	DDX1	253	0			c.A144T						.						75.0	80.0	78.0					2																	15736869		2203	4300	6503	SO:0001819	synonymous_variant	1653	exon4			AGAAACAGGAAGT	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.144A>T	2.37:g.15736869A>T		474.0	1.0		528.0	236.0	NM_004939	B4DME8|B4DPN6	Silent	SNP	ENST00000381341.2	37	CCDS1686.1																																																																																			.		0.274	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939	
DENND3	22898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142190927	142190927	+	Missense_Mutation	SNP	C	C	T	rs201075864	byFrequency	TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:142190927C>T	ENST00000262585.2	+	17	2956	c.2678C>T	c.(2677-2679)gCg>gTg	p.A893V	DENND3_ENST00000518806.1_3'UTR|DENND3_ENST00000519811.1_Missense_Mutation_p.A973V|DENND3_ENST00000424248.1_Missense_Mutation_p.A841V	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	893					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.A893V(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			TTCCCACAAGCGGTGGACGTG	0.577													C|||	2	0.000399361	0.0	0.0	5008	,	,		17918	0.0		0.0	False		,,,				2504	0.002				p.A893V		.											.	DENND3	91	1	Substitution - Missense(1)	large_intestine(1)	c.C2678T						.						62.0	58.0	59.0					8																	142190927		2203	4300	6503	SO:0001583	missense	22898	exon17			CACAAGCGGTGGA	AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.2678C>T	8.37:g.142190927C>T	ENSP00000262585:p.Ala893Val	25.0	0.0		66.0	16.0	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390099	0.82902	.	.	ENSG00000105339	ENST00000262585;ENST00000424248;ENST00000519811;ENST00000517985	T;T;T	0.15834	2.84;2.39;2.82	4.61	3.74	0.42951	WD40 repeat-like-containing domain (1);	0.207546	0.45361	D	0.000370	T	0.27594	0.0678	M	0.64997	1.995	0.37300	D	0.908673	D;D	0.69078	0.997;0.997	P;P	0.51055	0.657;0.657	T	0.26849	-1.0091	10	0.72032	D	0.01	-25.6476	12.675	0.56889	0.0:0.9196:0.0:0.0804	.	973;893	E9PF32;A2RUS2	.;DEND3_HUMAN	V	893;841;973;53	ENSP00000262585:A893V;ENSP00000410594:A841V;ENSP00000428714:A973V	ENSP00000262585:A893V	A	+	2	0	DENND3	142260109	0.993000	0.37304	0.010000	0.14722	0.001000	0.01503	3.643000	0.54374	0.936000	0.37367	0.563000	0.77884	GCG	C|0.999;T|0.001		0.577	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	31576572	31576572	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:31576572T>A	ENST00000389082.5	-	11	2693	c.2429A>T	c.(2428-2430)cAg>cTg	p.Q810L	DENND5B_ENST00000306833.6_Missense_Mutation_p.Q845L|DENND5B_ENST00000536562.1_Missense_Mutation_p.Q845L	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	810	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TTCTCTGTCCTGAAATTGAAT	0.358																																					p.Q810L		.											.	DENND5B	24	0			c.A2429T						.						239.0	226.0	230.0					12																	31576572		1896	4121	6017	SO:0001583	missense	160518	exon11			CTGTCCTGAAATT	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2429A>T	12.37:g.31576572T>A	ENSP00000373734:p.Gln810Leu	134.0	0.0		134.0	85.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.057133	0.55325	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.04406	3.63;3.74;3.74	4.99	4.99	0.66335	RUN (2);	0.066096	0.64402	D	0.000009	T	0.07324	0.0185	L	0.58669	1.825	0.80722	D	1	B;B	0.17038	0.02;0.016	B;B	0.21708	0.029;0.036	T	0.22208	-1.0223	10	0.21540	T	0.41	-21.5486	13.9354	0.64021	0.0:0.0:0.0:1.0	.	810;845	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	L	810;845;845	ENSP00000373734:Q810L;ENSP00000306482:Q845L;ENSP00000444889:Q845L	ENSP00000306482:Q845L	Q	-	2	0	DENND5B	31467839	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.251000	0.78297	2.213000	0.71641	0.533000	0.62120	CAG	.		0.358	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38802359	38802359	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:38802359G>A	ENST00000359357.3	+	30	3910	c.3656G>A	c.(3655-3657)gGa>gAa	p.G1219E	DNAH8_ENST00000449981.2_Missense_Mutation_p.G1436E|DNAH8_ENST00000441566.1_Missense_Mutation_p.G1219E			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1219					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTACAGGAAGGACCTATGGTT	0.323																																					p.G1436E		.											.	DNAH8	615	0			c.G4307A						.						115.0	117.0	117.0					6																	38802359		2203	4299	6502	SO:0001583	missense	1769	exon32			AGGAAGGACCTAT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.3656G>A	6.37:g.38802359G>A	ENSP00000352312:p.Gly1219Glu	177.0	0.0		256.0	70.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	24.8	4.572165	0.86542	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.26660	1.78;1.78;1.72	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.55178	0.1904	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.62891	-0.6758	10	0.59425	D	0.04	.	19.8002	0.96504	0.0:0.0:1.0:0.0	.	1219	Q96JB1	DYH8_HUMAN	E	1424;1424;1219;1219	ENSP00000333363:G1424E;ENSP00000352312:G1219E;ENSP00000402294:G1219E	ENSP00000333363:G1424E	G	+	2	0	DNAH8	38910337	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	9.213000	0.95133	2.674000	0.91012	0.655000	0.94253	GGA	.		0.323	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DOCK10	55619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	225652011	225652011	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:225652011T>A	ENST00000258390.7	-	49	5589	c.5522A>T	c.(5521-5523)gAg>gTg	p.E1841V	DOCK10_ENST00000409592.3_Missense_Mutation_p.E1835V	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1841	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCGTTGTTTCTCAAAGACAGC	0.368																																					p.E1841V		.											.	DOCK10	92	0			c.A5522T						.						150.0	143.0	145.0					2																	225652011		1923	4142	6065	SO:0001583	missense	55619	exon49			TGTTTCTCAAAGA	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5522A>T	2.37:g.225652011T>A	ENSP00000258390:p.Glu1841Val	73.0	0.0		61.0	24.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.127142	0.77549	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.29917	1.55;1.56	5.83	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.93763	3.455	0.52501	D	0.999955	D;D;D;D	0.89917	0.986;0.999;1.0;1.0	P;D;D;D	0.81914	0.844;0.983;0.995;0.992	T	0.70916	-0.4742	10	0.87932	D	0	.	10.9579	0.47368	0.0:0.0728:0.0:0.9272	.	1841;662;1835;503	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	V	1835;1841;346	ENSP00000386694:E1835V;ENSP00000258390:E1841V	ENSP00000258390:E1841V	E	-	2	0	DOCK10	225360255	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	1.030000	0.39839	0.528000	0.53228	GAG	.		0.368	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DOPEY2	9980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	37618611	37618611	+	Silent	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr21:37618611C>T	ENST00000399151.3	+	19	4418	c.4333C>T	c.(4333-4335)Ctg>Ttg	p.L1445L		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1445					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCTGAAGCTGCTGCAGGTGCT	0.597																																					p.L1445L		.											.	DOPEY2	91	0			c.C4333T						.						35.0	37.0	36.0					21																	37618611		2203	4300	6503	SO:0001819	synonymous_variant	9980	exon19			AAGCTGCTGCAGG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.4333C>T	21.37:g.37618611C>T		30.0	0.0		49.0	14.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	37	CCDS13643.1																																																																																			.		0.597	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
DZIP3	9666	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	108405433	108405433	+	Splice_Site	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:108405433T>A	ENST00000361582.3	+	28	3379		c.e28+2		DZIP3_ENST00000463306.1_Splice_Site	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3						protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						GCAAACCAGGTACCTTAGTTT	0.428																																					.		.											.	DZIP3	91	0			c.3149+2T>A						.						104.0	105.0	105.0					3																	108405433		2203	4300	6503	SO:0001630	splice_region_variant	9666	exon28			ACCAGGTACCTTA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.3149+2T>A	3.37:g.108405433T>A		202.0	1.0		152.0	40.0	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Splice_Site	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648922	0.47362	.	.	ENSG00000198919	ENST00000361582;ENST00000463306	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1713	0.48573	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DZIP3	109888123	1.000000	0.71417	0.993000	0.49108	0.465000	0.32709	3.432000	0.52824	2.127000	0.65507	0.397000	0.26171	.	.		0.428	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	Intron
DZIP1L	199221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	137787109	137787109	+	Silent	SNP	T	T	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:137787109T>G	ENST00000327532.2	-	13	2078	c.1716A>C	c.(1714-1716)ccA>ccC	p.P572P	DZIP1L_ENST00000488595.1_5'Flank	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	572					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						TCTGACGAGTTGGTGGGGGTG	0.662																																					p.P572P		.											.	DZIP1L	92	0			c.A1716C						.						55.0	64.0	61.0					3																	137787109		2203	4300	6503	SO:0001819	synonymous_variant	199221	exon13			ACGAGTTGGTGGG	AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.1716A>C	3.37:g.137787109T>G		86.0	0.0		78.0	17.0	NM_173543	C9JUG5|Q96M38	Silent	SNP	ENST00000327532.2	37	CCDS3096.1																																																																																			.		0.662	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1	NM_173543	
EFHC2	80258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	44109644	44109644	+	Silent	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:44109644G>T	ENST00000420999.1	-	5	737	c.654C>A	c.(652-654)acC>acA	p.T218T		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	218							calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						ACTGTTTCAGGGTGTCGAGGG	0.453																																					p.T218T		.											.	EFHC2	135	0			c.C654A						.						75.0	70.0	72.0					X																	44109644		1936	4124	6060	SO:0001819	synonymous_variant	80258	exon5			TTTCAGGGTGTCG	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.654C>A	X.37:g.44109644G>T		91.0	0.0		85.0	33.0	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Silent	SNP	ENST00000420999.1	37	CCDS55405.1	.	.	.	.	.	.	.	.	.	.	G	0.067	-1.211491	0.01555	.	.	ENSG00000183690	ENST00000441230	.	.	.	5.8	-3.49	0.04724	.	.	.	.	.	T	0.41511	0.1162	.	.	.	0.43857	D	0.996452	.	.	.	.	.	.	T	0.30736	-0.9968	4	.	.	.	-7.8933	3.9001	0.09157	0.5455:0.0883:0.1923:0.1739	.	.	.	.	T	199	.	.	P	-	1	0	EFHC2	43994588	0.961000	0.32948	0.007000	0.13788	0.005000	0.04900	0.015000	0.13355	-1.037000	0.03283	-0.853000	0.03031	CCT	.		0.453	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	
ENPP6	133121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	185074757	185074757	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:185074757C>T	ENST00000296741.2	-	2	512	c.371G>A	c.(370-372)tGg>tAg	p.W124*		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	124					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		CAGAGTGACCCACAGAGGTTC	0.488																																					p.W124X		.											.	ENPP6	90	0			c.G371A						.						136.0	115.0	122.0					4																	185074757		2203	4300	6503	SO:0001587	stop_gained	133121	exon2			GTGACCCACAGAG	AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.371G>A	4.37:g.185074757C>T	ENSP00000296741:p.Trp124*	130.0	0.0		113.0	55.0	NM_153343	Q4W5Q1|Q96M57	Nonsense_Mutation	SNP	ENST00000296741.2	37	CCDS3834.1	.	.	.	.	.	.	.	.	.	.	C	39	7.334371	0.98217	.	.	ENSG00000164303	ENST00000296741;ENST00000512353	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.1584	19.2788	0.94042	0.0:1.0:0.0:0.0	.	.	.	.	X	124;36	.	ENSP00000296741:W124X	W	-	2	0	ENPP6	185311751	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.487000	0.81328	2.567000	0.86603	0.655000	0.94253	TGG	.		0.488	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	NM_153343	
ERP44	23071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	102784454	102784454	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:102784454C>T	ENST00000262455.6	-	5	540	c.341G>A	c.(340-342)cGt>cAt	p.R114H		NM_015051.1	NP_055866.1	Q9BS26	ERP44_HUMAN	endoplasmic reticulum protein 44	114	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|glycoprotein metabolic process (GO:0009100)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)	19						CATCCCATTACGAAACAATTT	0.393																																					p.R114H		.											.	ERP44	90	0			c.G341A						.						150.0	140.0	144.0					9																	102784454		2203	4300	6503	SO:0001583	missense	23071	exon5			CCATTACGAAACA	AB011145	CCDS35082.1	9q22.33	2011-10-19	2009-02-23	2009-02-23	ENSG00000023318	ENSG00000023318		"""Protein disulfide isomerases"""	18311	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 10"""	609170	"""thioredoxin domain containing 4 (endoplasmic reticulum)"""	TXNDC4		11847130	Standard	NM_015051		Approved	KIAA0573, PDIA10	uc004bam.3	Q9BS26	OTTHUMG00000020363	ENST00000262455.6:c.341G>A	9.37:g.102784454C>T	ENSP00000262455:p.Arg114His	220.0	0.0		243.0	52.0	NM_015051	O60319|Q4VXC1|Q5VWZ7|Q6UW14|Q8WX67	Missense_Mutation	SNP	ENST00000262455.6	37	CCDS35082.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131960	0.77662	.	.	ENSG00000023318	ENST00000262455	T	0.42131	0.98	5.81	4.91	0.64330	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.41743	0.1172	L	0.49513	1.565	0.80722	D	1	B	0.34181	0.44	B	0.36418	0.224	T	0.44081	-0.9351	10	0.72032	D	0.01	-2.8096	15.3023	0.73962	0.0:0.9319:0.0:0.0681	.	114	Q9BS26	ERP44_HUMAN	H	114	ENSP00000262455:R114H	ENSP00000262455:R114H	R	-	2	0	ERP44	101824275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.406000	0.80017	2.752000	0.94435	0.557000	0.71058	CGT	.		0.393	ERP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053402.1	XM_088476	
FAM163A	148753	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	179783084	179783084	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:179783084T>C	ENST00000341785.4	+	5	660	c.264T>C	c.(262-264)tgT>tgC	p.C88C	RP11-12M5.3_ENST00000453051.1_RNA|RP11-12M5.3_ENST00000415218.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	88						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GCCAGCCCTGTGGGGTGGCCG	0.677																																					p.C88C		.											.	FAM163A	91	0			c.T264C						.						29.0	27.0	28.0					1																	179783084		2203	4298	6501	SO:0001819	synonymous_variant	148753	exon5			GCCCTGTGGGGTG	BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.264T>C	1.37:g.179783084T>C		62.0	1.0		57.0	20.0	NM_173509	A8K8R7	Silent	SNP	ENST00000341785.4	37	CCDS1333.1																																																																																			.		0.677	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085300.1	NM_173509	
FAIM3	9214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207087190	207087190	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:207087190T>C	ENST00000367091.3	-	2	430	c.287A>G	c.(286-288)gAa>gGa	p.E96G	FAIM3_ENST00000528654.1_Intron|FAIM3_ENST00000442471.2_Intron|FAIM3_ENST00000420007.2_Missense_Mutation_p.E96G	NM_005449.4	NP_005440.1	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3	96	Ig-like.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|negative regulation of apoptotic process (GO:0043066)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(84;0.201)					GCTGTCACTTTCTGTCAGCTG	0.532																																					p.E96G		.											.	FAIM3	90	0			c.A287G						.						124.0	117.0	119.0					1																	207087190		2203	4300	6503	SO:0001583	missense	9214	exon2			TCACTTTCTGTCA	AF057557	CCDS1473.1, CCDS44304.1	1q32.1	2013-01-11			ENSG00000162894	ENSG00000162894		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14315	protein-coding gene	gene with protein product		606015				9586636, 1563211	Standard	NM_005449		Approved	TOSO	uc001hey.3	O60667	OTTHUMG00000036457	ENST00000367091.3:c.287A>G	1.37:g.207087190T>C	ENSP00000356058:p.Glu96Gly	133.0	0.0		190.0	52.0	NM_005449	A8K7J2|B7Z6Z0|D9MWM3	Missense_Mutation	SNP	ENST00000367091.3	37	CCDS1473.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.607150	0.46527	.	.	ENSG00000162894	ENST00000367091;ENST00000420007;ENST00000525793;ENST00000529560;ENST00000530505	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.28	5.28	0.74379	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.557125	0.16209	N	0.224579	T	0.33585	0.0868	M	0.79011	2.435	0.09310	N	1	P	0.43231	0.801	P	0.46419	0.516	T	0.22521	-1.0214	10	0.37606	T	0.19	-2.0442	11.6259	0.51145	0.0:0.0:0.0:1.0	.	96	O60667	FAIM3_HUMAN	G	96;96;96;96;127	ENSP00000356058:E96G;ENSP00000403356:E96G;ENSP00000432936:E96G;ENSP00000437331:E96G;ENSP00000436316:E127G	ENSP00000356058:E96G	E	-	2	0	FAIM3	205153813	0.001000	0.12720	0.005000	0.12908	0.248000	0.25809	0.917000	0.28665	1.998000	0.58463	0.533000	0.62120	GAA	.		0.532	FAIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088677.1	NM_005449	
FAM189A1	23359	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	29429300	29429300	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr15:29429300G>A	ENST00000261275.4	-	6	727	c.728C>T	c.(727-729)cCa>cTa	p.P243L		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	243	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						AGGCGGGAGTGGGGGGATGAA	0.627																																					p.P243L		.											.	FAM189A1	22	0			c.C728T						.						54.0	63.0	60.0					15																	29429300		692	1591	2283	SO:0001583	missense	23359	exon6			GGGAGTGGGGGGA		CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.728C>T	15.37:g.29429300G>A	ENSP00000261275:p.Pro243Leu	28.0	0.0		21.0	8.0	NM_015307	A0PK09	Missense_Mutation	SNP	ENST00000261275.4	37	CCDS45198.1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023303	0.54683	.	.	ENSG00000104059	ENST00000261275	T	0.03580	3.88	5.37	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.17704	0.0425	M	0.79123	2.44	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.00351	-1.1796	10	0.87932	D	0	-13.941	13.1276	0.59364	0.0773:0.0:0.9227:0.0	.	243	O60320	F1891_HUMAN	L	243	ENSP00000261275:P243L	ENSP00000261275:P243L	P	-	2	0	FAM189A1	27216592	1.000000	0.71417	0.047000	0.18901	0.089000	0.18198	9.511000	0.98006	1.265000	0.44215	-0.251000	0.11542	CCA	.		0.627	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417254.1	NM_015307	
FBLN2	2199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	13612450	13612450	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:13612450T>G	ENST00000295760.7	+	2	664	c.595T>G	c.(595-597)Tat>Gat	p.Y199D	FBLN2_ENST00000535798.1_Missense_Mutation_p.Y225D|FBLN2_ENST00000404922.3_Missense_Mutation_p.Y199D|FBLN2_ENST00000492059.1_Missense_Mutation_p.Y199D	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	199	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCCCTACAGCTATGACCAGGA	0.667																																					p.Y199D		.											.	FBLN2	91	0			c.T595G						.						25.0	30.0	28.0					3																	13612450		2075	4197	6272	SO:0001583	missense	2199	exon2			TACAGCTATGACC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.595T>G	3.37:g.13612450T>G	ENSP00000295760:p.Tyr199Asp	41.0	0.0		62.0	23.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.879202	0.72294	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.82526	-1.62;-1.57;-1.52;-1.57	5.47	5.47	0.80525	.	0.349516	0.28301	N	0.015841	D	0.87474	0.6186	L	0.50333	1.59	0.35661	D	0.812574	D;D;D	0.89917	0.998;1.0;0.993	D;D;P	0.85130	0.991;0.997;0.865	D	0.90766	0.4668	10	0.87932	D	0	.	10.0187	0.42029	0.0:0.0755:0.0:0.9245	.	199;199;225	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	D	225;199;199;199	ENSP00000445705:Y225D;ENSP00000384169:Y199D;ENSP00000295760:Y199D;ENSP00000420042:Y199D	ENSP00000295760:Y199D	Y	+	1	0	FBLN2	13587450	0.981000	0.34729	0.993000	0.49108	0.940000	0.58332	0.000000	0.12993	2.095000	0.63458	0.456000	0.33151	TAT	.		0.667	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
FBXO44	93611	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	11718615	11718615	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:11718615G>A	ENST00000251547.5	+	4	500	c.418G>A	c.(418-420)Gac>Aac	p.D140N	FBXO44_ENST00000251546.4_Intron|FBXO44_ENST00000376768.1_Missense_Mutation_p.G130E|FBXO44_ENST00000376762.4_Intron|FBXO44_ENST00000376760.1_Intron|FBXO44_ENST00000376770.1_Missense_Mutation_p.D140N	NM_033182.5	NP_149438.2	Q9H4M3	FBX44_HUMAN	F-box protein 44	140	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGGTGGTGGACCTCAAGGC	0.662																																					p.D140N		.											.	FBXO44	227	0			c.G418A						.						36.0	39.0	38.0					1																	11718615		2203	4300	6503	SO:0001583	missense	93611	exon4			GTGGTGGACCTCA	AY040878	CCDS131.1, CCDS132.1	1p36.21	2008-03-26			ENSG00000132879	ENSG00000132879		"""F-boxes /  ""other"""""	24847	protein-coding gene	gene with protein product		609111				12383498	Standard	XM_005263535		Approved	FBX30, FBG3, MGC14140, Fbxo6a, Fbx44	uc001asm.3	Q9H4M3	OTTHUMG00000002071	ENST00000251547.5:c.418G>A	1.37:g.11718615G>A	ENSP00000251547:p.Asp140Asn	47.0	0.0		39.0	18.0	NM_033182	B3KNZ2|B7Z743|Q5TGX2|Q5TGX4|Q5TGX5|Q68DJ9|Q8WWY2	Missense_Mutation	SNP	ENST00000251547.5	37	CCDS132.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.88|18.88	3.718457|3.718457	0.68844|0.68844	.|.	.|.	ENSG00000132879|ENSG00000132879	ENST00000376770;ENST00000251547|ENST00000376768	T;T|T	0.53423|0.47528	0.62;0.62|0.84	5.37|5.37	5.37|5.37	0.77165|0.77165	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);|.	.|0.155509	.|0.56097	.|D	.|0.000023	T|T	0.61702|0.61702	0.2368|0.2368	M|M	0.69358|0.69358	2.11|2.11	0.32830|0.32830	D|D	0.503958|0.503958	B|D	0.19445|0.69078	0.036|0.997	B|P	0.20184|0.60789	0.028|0.879	T|T	0.72843|0.72843	-0.4170|-0.4170	9|10	0.54805|0.66056	T|D	0.06|0.02	.|.	11.7153|11.7153	0.51650|0.51650	0.0844:0.0:0.9156:0.0|0.0844:0.0:0.9156:0.0	.|.	140|130	Q9H4M3|B7Z1P2	FBX44_HUMAN|.	N|E	140|130	ENSP00000365961:D140N;ENSP00000251547:D140N|ENSP00000365959:G130E	ENSP00000251547:D140N|ENSP00000365959:G130E	D|G	+|+	1|2	0|0	FBXO44|FBXO44	11641202|11641202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	2.221000|2.221000	0.42917|0.42917	2.520000|2.520000	0.84964|0.84964	0.549000|0.549000	0.68633|0.68633	GAC|GGA	.		0.662	FBXO44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005761.1	NM_183412	
FLAD1	80308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154961247	154961247	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:154961247C>A	ENST00000292180.3	+	2	1361	c.1039C>A	c.(1039-1041)Ccc>Acc	p.P347T	FLAD1_ENST00000368432.1_Missense_Mutation_p.P250T|FLAD1_ENST00000315144.10_Missense_Mutation_p.P250T|FLAD1_ENST00000368428.1_5'UTR|FLAD1_ENST00000295530.2_Missense_Mutation_p.P80T|FLAD1_ENST00000368433.1_Missense_Mutation_p.P347T|FLAD1_ENST00000405236.2_Missense_Mutation_p.P248T|FLAD1_ENST00000368431.3_Missense_Mutation_p.P248T	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	347					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TGCCCGTTTGCCCCAGGGATC	0.577																																					p.P347T		.											.	FLAD1	93	0			c.C1039A						.						65.0	63.0	64.0					1																	154961247		2203	4300	6503	SO:0001583	missense	80308	exon2			CGTTTGCCCCAGG		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.1039C>A	1.37:g.154961247C>A	ENSP00000292180:p.Pro347Thr	41.0	0.0		71.0	25.0	NM_025207	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682819	0.68157	.	.	ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000368431;ENST00000292180;ENST00000405236;ENST00000295530	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75466	0.3853	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;0.992;1.0	D;D;D	0.97110	1.0;0.914;0.999	T	0.74297	-0.3711	9	0.56958	D	0.05	-26.9382	19.5221	0.95189	0.0:1.0:0.0:0.0	.	80;347;248	Q5T191;Q8NFF5;Q8NFF5-4	.;FAD1_HUMAN;.	T	347;250;250;248;347;248;80	.	ENSP00000292180:P347T	P	+	1	0	FLAD1	153227871	1.000000	0.71417	0.997000	0.53966	0.396000	0.30629	6.729000	0.74775	2.941000	0.99782	0.655000	0.94253	CCC	.		0.577	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207	
FOXM1	2305	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2983155	2983155	+	Missense_Mutation	SNP	G	G	A	rs143720765		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:2983155G>A	ENST00000359843.3	-	2	558	c.490C>T	c.(490-492)Cgg>Tgg	p.R164W	FOXM1_ENST00000537018.1_5'UTR|FOXM1_ENST00000361953.3_Missense_Mutation_p.R164W|FOXM1_ENST00000342628.2_Missense_Mutation_p.R164W	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	164					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CAGGTCTCCCGTTTCTGCTCG	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		18708	0.0		0.001	False		,,,				2504	0.0				p.R164W		.											.	FOXM1	227	0			c.C490T						.	G	TRP/ARG,TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	113.0	110.0	111.0		490,490,490	-2.5	0.0	12	dbSNP_134	111	7,8593	5.7+/-21.5	0,7,4293	yes	missense,missense,missense	FOXM1	NM_021953.3,NM_202002.2,NM_202003.2	101,101,101	0,9,6494	AA,AG,GG		0.0814,0.0454,0.0692	benign,benign,benign	164/764,164/802,164/749	2983155	9,12997	2203	4300	6503	SO:0001583	missense	2305	exon2			TCTCCCGTTTCTG	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.490C>T	12.37:g.2983155G>A	ENSP00000352901:p.Arg164Trp	145.0	1.0		141.0	78.0	NM_001243089	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	ENST00000359843.3	37	CCDS8515.1	.	.	.	.	.	.	.	.	.	.	G	6.829	0.522032	0.13005	4.54E-4	8.14E-4	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.93019	-3.08;-3.15;-3.07	4.76	-2.5	0.06384	.	1.201950	0.05602	N	0.576586	T	0.71863	0.3390	N	0.00237	-1.79	0.09310	N	1	B;B;B;B;B	0.15141	0.001;0.001;0.002;0.001;0.012	B;B;B;B;B	0.09377	0.001;0.001;0.001;0.001;0.004	T	0.66685	-0.5861	10	0.20046	T	0.44	.	4.1554	0.10258	0.5264:0.0:0.1954:0.2782	.	164;164;164;164;164	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	W	164	ENSP00000342307:R164W;ENSP00000354492:R164W;ENSP00000352901:R164W	ENSP00000342307:R164W	R	-	1	2	FOXM1	2853416	0.590000	0.26815	0.001000	0.08648	0.011000	0.07611	0.603000	0.24149	-0.365000	0.08076	-0.253000	0.11424	CGG	G|1.000;A|0.000		0.537	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000398272.1	NM_021953	
FRMD4B	23150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	69221075	69221075	+	Silent	SNP	G	G	A	rs373666395		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:69221075G>A	ENST00000398540.3	-	23	3125	c.3042C>T	c.(3040-3042)aaC>aaT	p.N1014N	FRMD4B_ENST00000478263.1_Silent_p.N666N|FRMD4B_ENST00000542259.1_Silent_p.N960N	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	1014					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TACTCTCCAGGTTGTCTTCCA	0.433																																					p.N1014N		.											.	FRMD4B	72	0			c.C3042T						.						253.0	233.0	239.0					3																	69221075		1904	4125	6029	SO:0001819	synonymous_variant	23150	exon23			CTCCAGGTTGTCT	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.3042C>T	3.37:g.69221075G>A		171.0	0.0		143.0	53.0	NM_015123	Q8TAI3	Silent	SNP	ENST00000398540.3	37	CCDS46863.1																																																																																			.		0.433	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
FSIP2	401024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	2	186670102	186670102	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:186670102G>T	ENST00000424728.1	+	17	16069	c.16069G>T	c.(16069-16071)Gaa>Taa	p.E5357*	FSIP2_ENST00000343098.5_Nonsense_Mutation_p.E5446*			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5357				E -> D (in Ref. 2; BX648733). {ECO:0000305}.						NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TTTTGTATATGAACAGTTCAT	0.303																																					p.E5446X		.											.	FSIP2	90	0			c.G16336T						.						62.0	59.0	60.0					2																	186670102		1839	4080	5919	SO:0001587	stop_gained	401024	exon17			GTATATGAACAGT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.16069G>T	2.37:g.186670102G>T	ENSP00000401306:p.Glu5357*	217.0	0.0		168.0	85.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Nonsense_Mutation	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	G	56	25.340874	0.99964	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	.	.	.	5.28	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	9.5051	0.39042	0.0943:0.0:0.9057:0.0	.	.	.	.	X	5446;5357	.	ENSP00000344403:E5446X	E	+	1	0	FSIP2	186378347	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	3.088000	0.50175	1.466000	0.48025	0.460000	0.39030	GAA	.		0.303	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
FUT5	2527	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	5866696	5866696	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:5866696T>A	ENST00000588525.1	-	2	1128	c.1041A>T	c.(1039-1041)gcA>gcT	p.A347A	FUT5_ENST00000252675.5_Silent_p.A347A	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	347					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						AGAAAGCCAGTGCCCAGCTGA	0.642																																					p.A347A		.											.	FUT5	90	0			c.A1041T						.						43.0	48.0	46.0					19																	5866696		2203	4300	6503	SO:0001819	synonymous_variant	2527	exon2			AGCCAGTGCCCAG		CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.1041A>T	19.37:g.5866696T>A		115.0	0.0		115.0	41.0	NM_002034	A8K4X2	Silent	SNP	ENST00000588525.1	37	CCDS12154.1																																																																																			.		0.642	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452213.1	NM_002034	
GLB1	2720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33110391	33110391	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:33110391T>A	ENST00000399402.3	-	3	358	c.227A>T	c.(226-228)tAt>tTt	p.Y76F	GLB1_ENST00000445488.2_Missense_Mutation_p.Y154F|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Missense_Mutation_p.Y106F	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	106					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				CCGAAGAAAATATTCCACATC	0.557																																					p.Y106F		.											.	GLB1	135	0			c.A317T						.						117.0	118.0	118.0					3																	33110391		1959	4162	6121	SO:0001583	missense	2720	exon3			AGAAAATATTCCA	M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.227A>T	3.37:g.33110391T>A	ENSP00000382333:p.Tyr76Phe	75.0	0.0		78.0	35.0	NM_000404	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	ENST00000399402.3	37	CCDS43062.1	.	.	.	.	.	.	.	.	.	.	T	9.618	1.133071	0.21041	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000450835	D;D;D;D	0.97976	-4.64;-4.64;-4.64;-4.64	4.1	2.94	0.34122	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.828672	0.11361	N	0.571919	D	0.94899	0.8351	L	0.33485	1.01	0.22127	N	0.99934	B;B;B	0.32604	0.377;0.377;0.377	B;B;B	0.38985	0.173;0.173;0.287	D	0.89970	0.4093	10	0.48119	T	0.1	-0.9445	5.5218	0.16938	0.0:0.0913:0.1736:0.7351	.	106;106;154	Q53G40;P16278;B7Z6Q5	.;BGAL_HUMAN;.	F	76;106;154;76	ENSP00000382333:Y76F;ENSP00000306920:Y106F;ENSP00000393377:Y154F;ENSP00000403264:Y76F	ENSP00000306920:Y106F	Y	-	2	0	GLB1	33085395	1.000000	0.71417	0.018000	0.16275	0.259000	0.26198	5.788000	0.69020	0.636000	0.30508	-0.250000	0.11733	TAT	.		0.557	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	NM_000404	
GLB1L3	112937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134188589	134188589	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr11:134188589C>A	ENST00000431683.2	+	19	1844	c.1844C>A	c.(1843-1845)cCt>cAt	p.P615H		NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	615					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		AATATTGGGCCTCAGAAAACA	0.423																																					p.P615H		.											.	GLB1L3	69	0			c.C1844A						.						142.0	130.0	133.0					11																	134188589		1924	4118	6042	SO:0001583	missense	112937	exon19			TTGGGCCTCAGAA		CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.1844C>A	11.37:g.134188589C>A	ENSP00000396615:p.Pro615His	120.0	0.0		84.0	37.0	NM_001080407	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	ENST00000431683.2	37	CCDS44780.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.446167	0.43429	.	.	ENSG00000166105	ENST00000431683	D	0.99667	-6.34	5.01	5.01	0.66863	Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99708	0.9888	M	0.94021	3.485	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.97461	1.0034	10	0.87932	D	0	.	15.75	0.77976	0.0:1.0:0.0:0.0	.	615	Q8NCI6	GLBL3_HUMAN	H	615	ENSP00000396615:P615H	ENSP00000396615:P615H	P	+	2	0	GLB1L3	133693799	1.000000	0.71417	0.384000	0.26145	0.006000	0.05464	5.493000	0.66899	2.776000	0.95493	0.558000	0.71614	CCT	.		0.423	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	
GPR45	11250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	105858703	105858703	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:105858703G>A	ENST00000258456.1	+	1	504	c.388G>A	c.(388-390)Gtg>Atg	p.V130M		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						CATCATCAGCGTGGACCGCTT	0.622																																					p.V130M		.											.	GPR45	154	0			c.G388A						.						66.0	62.0	63.0					2																	105858703		2203	4300	6503	SO:0001583	missense	11250	exon1			ATCAGCGTGGACC	AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.388G>A	2.37:g.105858703G>A	ENSP00000258456:p.Val130Met	114.0	0.0		117.0	64.0	NM_007227	Q6NWS4|Q6NXU6	Missense_Mutation	SNP	ENST00000258456.1	37	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809463	0.70797	.	.	ENSG00000135973	ENST00000258456	T	0.44083	0.93	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.61540	0.2355	M	0.65975	2.015	0.58432	D	0.99999	D	0.89917	1.0	D	0.85130	0.997	T	0.64918	-0.6294	10	0.87932	D	0	-20.3605	12.7943	0.57551	0.0821:0.0:0.9179:0.0	.	130	Q9Y5Y3	GPR45_HUMAN	M	130	ENSP00000258456:V130M	ENSP00000258456:V130M	V	+	1	0	GPR45	105225135	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.440000	0.52886	2.337000	0.79520	0.462000	0.41574	GTG	.		0.622	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227	
GRIN2D	2906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	48925128	48925128	+	Nonsense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:48925128T>A	ENST00000263269.3	+	10	2266	c.2178T>A	c.(2176-2178)taT>taA	p.Y726*		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	726					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCAGCAACTATCCCGACATGC	0.637																																					p.Y726X		.											.	GRIN2D	156	0			c.T2178A						.						100.0	92.0	95.0					19																	48925128		2203	4300	6503	SO:0001587	stop_gained	2906	exon10			CAACTATCCCGAC	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2178T>A	19.37:g.48925128T>A	ENSP00000263269:p.Tyr726*	93.0	0.0		87.0	28.0	NM_000836		Nonsense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	T	40	8.002541	0.98605	.	.	ENSG00000105464	ENST00000263269	.	.	.	4.43	2.31	0.28768	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4031	0.21650	0.0:0.6572:0.0:0.3428	.	.	.	.	X	726	.	ENSP00000263269:Y726X	Y	+	3	2	GRIN2D	53616940	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	0.591000	0.23969	1.144000	0.42321	0.533000	0.62120	TAT	.		0.637	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
H1FOO	132243	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	129266304	129266304	+	Silent	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:129266304C>A	ENST00000324382.2	+	2	164	c.159C>A	c.(157-159)ccC>ccA	p.P53P	H1FOO_ENST00000503977.1_5'Flank	NM_153833.1	NP_722575.1	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	53	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				meiotic nuclear division (GO:0007126)|negative regulation of stem cell differentiation (GO:2000737)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of DNA methylation (GO:0044030)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|female germ cell nucleus (GO:0001674)|nucleosome (GO:0000786)|nucleus (GO:0005634)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|lung(4)|skin(1)	6						GCCGCCACCCCCCGGTGCTAC	0.701																																					p.P53P		.											.	H1FOO	91	0			c.C159A						.						6.0	5.0	6.0					3																	129266304		1995	3901	5896	SO:0001819	synonymous_variant	132243	exon2			CCACCCCCCGGTG	AY158091	CCDS3064.1	3q21.3	2011-01-27			ENSG00000178804	ENSG00000178804		"""Histones / Replication-independent"""	18463	protein-coding gene	gene with protein product						12408966	Standard	NM_153833		Approved		uc003emu.3	Q8IZA3	OTTHUMG00000159541	ENST00000324382.2:c.159C>A	3.37:g.129266304C>A		85.0	0.0		43.0	10.0	NM_153833	Q86WT7	Silent	SNP	ENST00000324382.2	37	CCDS3064.1																																																																																			.		0.701	H1FOO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356100.3	NM_153833	
HCN4	10021	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	73615218	73615218	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr15:73615218G>A	ENST00000261917.3	-	8	4209	c.3216C>T	c.(3214-3216)ccC>ccT	p.P1072P		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	1072	Pro-rich.				blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGGTGAGCGGGGGTGTGCCCC	0.741																																					p.P1072P		.											.	HCN4	96	0			c.C3216T						.						4.0	7.0	6.0					15																	73615218		1952	3920	5872	SO:0001819	synonymous_variant	10021	exon8			GAGCGGGGGTGTG	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.3216C>T	15.37:g.73615218G>A		29.0	0.0		21.0	14.0	NM_005477	Q9UMQ7	Silent	SNP	ENST00000261917.3	37	CCDS10248.1																																																																																			.		0.741	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186056637	186056637	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:186056637A>T	ENST00000271588.4	+	60	9452	c.9223A>T	c.(9223-9225)Act>Tct	p.T3075S	HMCN1_ENST00000367492.2_Missense_Mutation_p.T3075S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3075	Ig-like C2-type 29.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAGAGAGGGAACTTCTGTGTC	0.428																																					p.T3075S		.											.	HMCN1	113	0			c.A9223T						.						102.0	101.0	102.0					1																	186056637		2203	4299	6502	SO:0001583	missense	83872	exon60			GAGGGAACTTCTG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9223A>T	1.37:g.186056637A>T	ENSP00000271588:p.Thr3075Ser	85.0	0.0		113.0	44.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	4.011	-0.000682	0.07819	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.70869	-0.52;-0.52	5.59	0.0385	0.14200	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.360497	0.34507	N	0.003904	T	0.37544	0.1007	N	0.02658	-0.545	0.09310	N	1	P	0.44309	0.832	B	0.43508	0.422	T	0.48980	-0.8986	10	0.10377	T	0.69	.	4.8784	0.13667	0.4643:0.0:0.1411:0.3947	.	3075	Q96RW7	HMCN1_HUMAN	S	3075	ENSP00000271588:T3075S;ENSP00000356462:T3075S	ENSP00000271588:T3075S	T	+	1	0	HMCN1	184323260	0.000000	0.05858	0.022000	0.16811	0.334000	0.28698	0.912000	0.28597	0.050000	0.15949	0.533000	0.62120	ACT	.		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMGN5	79366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	80370663	80370663	+	Nonsense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:80370663C>A	ENST00000358130.2	-	7	662	c.334G>T	c.(334-336)Gga>Tga	p.G112*	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	112					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						ttttctcctcccttttctGTG	0.368																																					p.G112X		.											.	HMGN5	130	0			c.G334T						.						56.0	39.0	45.0					X																	80370663		2196	4289	6485	SO:0001587	stop_gained	79366	exon7			CTCCTCCCTTTTC	AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.334G>T	X.37:g.80370663C>A	ENSP00000350848:p.Gly112*	547.0	0.0		532.0	257.0	NM_030763	Q5JSL1	Nonsense_Mutation	SNP	ENST00000358130.2	37	CCDS14448.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978415	0.53720	.	.	ENSG00000198157	ENST00000358130;ENST00000447319;ENST00000373250;ENST00000430960	.	.	.	3.79	2.92	0.33932	.	0.264959	0.19931	U	0.102873	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	6.5942	0.22664	0.0:0.8663:0.0:0.1337	.	.	.	.	X	112;92;102;112	.	ENSP00000350848:G112X	G	-	1	0	HMGN5	80257319	0.000000	0.05858	0.016000	0.15963	0.270000	0.26580	0.036000	0.13819	0.966000	0.38159	0.544000	0.68410	GGA	.		0.368	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057354.1	NM_030763	
HNRNPH1	3187	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	179045165	179045165	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:179045165C>A	ENST00000356731.5	-	5	2231	c.696G>T	c.(694-696)agG>agT	p.R232S	HNRNPH1_ENST00000442819.2_Missense_Mutation_p.R232S|HNRNPH1_ENST00000524180.1_5'Flank|HNRNPH1_ENST00000329433.6_Missense_Mutation_p.R232S|HNRNPH1_ENST00000510411.1_Missense_Mutation_p.R232S|HNRNPH1_ENST00000393432.4_Missense_Mutation_p.R232S|HNRNPH1_ENST00000511300.2_5'Flank			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	232					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						AAGCACCACGCCTCATCCTCT	0.493																																					p.R232S		.											.	HNRNPH1	22	0			c.G696T						.						175.0	151.0	159.0					5																	179045165		2203	4300	6503	SO:0001583	missense	3187	exon6			ACCACGCCTCATC	BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.696G>T	5.37:g.179045165C>A	ENSP00000349168:p.Arg232Ser	104.0	2.0		83.0	51.0	NM_001257293	B3KW86|D3DWQ2|Q6IBM4	Missense_Mutation	SNP	ENST00000356731.5	37	CCDS4446.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	7.884|7.884	0.730930|0.730930	0.15507|0.15507	.|.	.|.	ENSG00000169045|ENSG00000169045	ENST00000521173|ENST00000393432;ENST00000442819;ENST00000356731;ENST00000329433;ENST00000510411;ENST00000523921	.|T;T;T;T;T;T	.|0.12774	.|2.86;2.86;2.86;2.82;2.85;2.65	5.51|5.51	0.423|0.423	0.16463|0.16463	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.20536|0.20536	0.0494|0.0494	M|M	0.84846|0.84846	2.72|2.72	0.80722|0.80722	D|D	1|1	.|B	.|0.31989	.|0.35	.|B	.|0.36335	.|0.222	T|T	0.04281|0.04281	-1.0963|-1.0963	5|10	.|0.36615	.|T	.|0.2	-12.2194|-12.2194	10.6051|10.6051	0.45390|0.45390	0.0:0.5048:0.0:0.4952|0.0:0.5048:0.0:0.4952	.|.	.|232	.|P31943	.|HNRH1_HUMAN	V|S	107|232;232;232;232;232;46	.|ENSP00000377082:R232S;ENSP00000397797:R232S;ENSP00000349168:R232S;ENSP00000327539:R232S;ENSP00000426275:R232S;ENSP00000429270:R46S	.|ENSP00000327539:R232S	G|R	-|-	2|3	0|2	HNRNPH1|HNRNPH1	178977771|178977771	0.917000|0.917000	0.31117|0.31117	0.999000|0.999000	0.59377|0.59377	0.817000|0.817000	0.46193|0.46193	-0.036000|-0.036000	0.12185|0.12185	0.069000|0.069000	0.16605|0.16605	0.573000|0.573000	0.79308|0.79308	GGC|AGG	.		0.493	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253497.3	NM_005520	
HPSE2	60495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	100995494	100995494	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:100995494T>A	ENST00000370552.3	-	1	125	c.66A>T	c.(64-66)ctA>ctT	p.L22L	HPSE2_ENST00000370546.1_Silent_p.L22L|HPSE2_ENST00000370549.1_Silent_p.L22L|HPSE2_ENST00000404542.1_Silent_p.L22L	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	22					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CCCCCGGGGCTAGGCACGCGG	0.587																																					p.L22L		.											.	HPSE2	91	0			c.A66T						.						44.0	52.0	49.0					10																	100995494		2203	4300	6503	SO:0001819	synonymous_variant	60495	exon1			CGGGGCTAGGCAC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.66A>T	10.37:g.100995494T>A		103.0	0.0		102.0	49.0	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	ENST00000370552.3	37	CCDS7477.1																																																																																			.		0.587	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
HTR3D	200909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183756700	183756700	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:183756700C>A	ENST00000382489.3	+	8	1302	c.1302C>A	c.(1300-1302)ttC>ttA	p.F434L	HTR3D_ENST00000453435.1_Missense_Mutation_p.F213L|HTR3D_ENST00000334128.2_Missense_Mutation_p.F259L|HTR3D_ENST00000428798.2_Missense_Mutation_p.F384L	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	434					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	CCCTGCTCTTCCGCCTCTACC	0.592																																					p.F434L		.											.	HTR3D	90	0			c.C1302A						.						175.0	159.0	165.0					3																	183756700		2203	4300	6503	SO:0001583	missense	200909	exon8			GCTCTTCCGCCTC	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.1302C>A	3.37:g.183756700C>A	ENSP00000371929:p.Phe434Leu	95.0	0.0		85.0	23.0	NM_001163646	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	ENST00000382489.3	37	CCDS54685.1	.	.	.	.	.	.	.	.	.	.	.	19.70	3.876841	0.72180	.	.	ENSG00000186090	ENST00000334128;ENST00000428798;ENST00000382489;ENST00000453435	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	4.11	4.11	0.48088	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.64402	D	0.000004	D	0.84795	0.5551	M	0.69358	2.11	0.24484	N	0.994339	D;D;D;D	0.71674	0.998;0.984;0.968;0.984	D;P;P;D	0.68765	0.96;0.892;0.758;0.916	T	0.76772	-0.2836	10	0.72032	D	0.01	-30.7823	12.0322	0.53403	0.0:1.0:0.0:0.0	.	434;259;213;259	Q70Z44;Q70Z44-2;Q70Z44-3;F6WC43	5HT3D_HUMAN;.;.;.	L	259;384;434;213	ENSP00000334315:F259L;ENSP00000405409:F384L;ENSP00000371929:F434L;ENSP00000389268:F213L	ENSP00000334315:F259L	F	+	3	2	HTR3D	185239394	0.961000	0.32948	0.997000	0.53966	0.934000	0.57294	2.211000	0.42825	2.271000	0.75665	0.563000	0.77884	TTC	.		0.592	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
WDR37	22884	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	1094803	1094803	+	5'Flank	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:1094803C>T	ENST00000358220.1	+	0	0				IDI1_ENST00000381344.3_Splice_Site|IDI1_ENST00000491735.1_Splice_Site			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GTCCACAGTACCTGATCAGCC	0.756																																					.		.											.	IDI1	90	0			c.140+1G>A						.						12.0	12.0	12.0					10																	1094803		2186	4268	6454	SO:0001631	upstream_gene_variant	3422	exon2			ACAGTACCTGATC	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		10.37:g.1094803C>T	Exception_encountered	56.0	0.0		52.0	22.0	NM_004508	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Splice_Site	SNP	ENST00000358220.1	37	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	C	7.409	0.634434	0.14322	.	.	ENSG00000067064	ENST00000381344	.	.	.	0.91	0.91	0.19337	.	.	.	.	.	.	.	.	.	.	.	0.27152	N	0.961373	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.117	0.14840	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IDI1	1084803	0.001000	0.12720	0.004000	0.12327	0.061000	0.15899	1.312000	0.33574	0.780000	0.33566	0.430000	0.28490	.	.		0.756	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
IFNA6	3443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21350829	21350829	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:21350829A>T	ENST00000380210.1	-	1	548	c.58T>A	c.(58-60)Tgc>Agc	p.C20S		NM_021002.2	NP_066282.1	P05013	IFNA6_HUMAN	interferon, alpha 6	20					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(3)|lung(7)|skin(1)	11				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		TCCAGAGAGCAGCTTGACTTG	0.517																																					p.C20S		.											.	IFNA6	68	0			c.T58A						.						104.0	102.0	103.0					9																	21350829		2203	4300	6503	SO:0001583	missense	3443	exon1			GAGAGCAGCTTGA		CCDS6504.1	9p22	2010-12-10			ENSG00000120235	ENSG00000120235		"""Interferons"""	5427	protein-coding gene	gene with protein product		147566				1385305	Standard	NM_021002		Approved	IFN-alphaK	uc011lni.2	P05013	OTTHUMG00000019676	ENST00000380210.1:c.58T>A	9.37:g.21350829A>T	ENSP00000369558:p.Cys20Ser	87.0	0.0		69.0	23.0	NM_021002	Q5VYQ1	Missense_Mutation	SNP	ENST00000380210.1	37	CCDS6504.1	.	.	.	.	.	.	.	.	.	.	A	11.60	1.688300	0.29962	.	.	ENSG00000120235	ENST00000380210	T	0.03035	4.07	3.78	-0.727	0.11166	Four-helical cytokine-like, core (1);	0.536026	0.18939	N	0.126999	T	0.04998	0.0134	M	0.73598	2.24	0.09310	N	1	B	0.31009	0.303	B	0.31337	0.128	T	0.24835	-1.0149	10	0.49607	T	0.09	.	4.873	0.13642	0.5283:0.3635:0.1081:0.0	.	20	P05013	IFNA6_HUMAN	S	20	ENSP00000369558:C20S	ENSP00000369558:C20S	C	-	1	0	IFNA6	21340829	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-1.122000	0.03267	0.006000	0.14734	0.482000	0.46254	TGC	.		0.517	IFNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051905.1	NM_021002	
IL1RAPL2	26280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	X	105011034	105011034	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:105011034A>T	ENST00000372582.1	+	11	2197	c.1441A>T	c.(1441-1443)Aga>Tga	p.R481*	IL1RAPL2_ENST00000344799.4_Nonsense_Mutation_p.R481*	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	481	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTATATTCTCAGACGGGGATG	0.378																																					p.R481X		.											.	IL1RAPL2	194	0			c.A1441T						.						91.0	83.0	86.0					X																	105011034		2203	4300	6503	SO:0001587	stop_gained	26280	exon11			ATTCTCAGACGGG	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1441A>T	X.37:g.105011034A>T	ENSP00000361663:p.Arg481*	227.0	0.0		236.0	112.0	NM_017416	Q2M3U3|Q9NZN0	Nonsense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	A	36	5.709833	0.96821	.	.	ENSG00000189108	ENST00000372582;ENST00000344799;ENST00000538500	.	.	.	5.39	5.39	0.77823	.	0.082759	0.52532	D	0.000076	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5324	0.61629	1.0:0.0:0.0:0.0	.	.	.	.	X	481;481;86	.	ENSP00000344976:R481X	R	+	1	2	IL1RAPL2	104897690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.394000	0.66285	1.790000	0.52503	0.486000	0.48141	AGA	.		0.378	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
IL31RA	133396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	55178923	55178923	+	Missense_Mutation	SNP	A	A	T	rs541486912		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:55178923A>T	ENST00000447346.2	+	5	571	c.506A>T	c.(505-507)aAa>aTa	p.K169I	IL31RA_ENST00000490985.1_Missense_Mutation_p.K27I|IL31RA_ENST00000297015.3_Missense_Mutation_p.K27I|IL31RA_ENST00000396834.1_Missense_Mutation_p.K150I|IL31RA_ENST00000359040.5_Missense_Mutation_p.K169I|IL31RA_ENST00000396836.2_Missense_Mutation_p.K169I|IL31RA_ENST00000354961.4_Missense_Mutation_p.K150I	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	137	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TTGGGCATCAAACGAATGATT	0.373																																					p.K169I		.											.	IL31RA	91	0			c.A506T						.						103.0	100.0	101.0					5																	55178923		2203	4300	6503	SO:0001583	missense	133396	exon5			GCATCAAACGAAT	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.506A>T	5.37:g.55178923A>T	ENSP00000415900:p.Lys169Ile	122.0	0.0		114.0	54.0	NM_001242637	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	37	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392720	0.62066	.	.	ENSG00000164509	ENST00000396836;ENST00000396834;ENST00000447346;ENST00000359040;ENST00000297015;ENST00000490985;ENST00000354961	T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37	5.63	3.17	0.36434	Fibronectin, type III (4);Immunoglobulin-like fold (1);	2.131810	0.02452	N	0.085668	T	0.69251	0.3090	M	0.62723	1.935	0.09310	N	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.76575	0.987;0.983;0.964;0.977;0.988	T	0.24977	-1.0145	10	0.40728	T	0.16	-18.0797	5.6216	0.17459	0.7389:0.1726:0.0885:0.0	.	137;169;150;169;169	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2;Q8NI17-8	IL31R_HUMAN;.;.;.;.	I	169;150;169;169;27;27;150	ENSP00000380048:K169I;ENSP00000380046:K150I;ENSP00000415900:K169I;ENSP00000351935:K169I;ENSP00000297015:K27I;ENSP00000427533:K27I;ENSP00000347047:K150I	ENSP00000297015:K27I	K	+	2	0	IL31RA	55214680	0.006000	0.16342	0.024000	0.17045	0.202000	0.24057	1.426000	0.34870	0.387000	0.25024	0.528000	0.53228	AAA	.		0.373	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017	
ILDR1	286676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121712723	121712723	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:121712723T>A	ENST00000344209.5	-	7	999	c.873A>T	c.(871-873)aaA>aaT	p.K291N	ILDR1_ENST00000462014.1_Missense_Mutation_p.K259N|ILDR1_ENST00000273691.3_Missense_Mutation_p.K247N|ILDR1_ENST00000393631.1_Missense_Mutation_p.K202N|ILDR1_ENST00000460554.1_5'UTR	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	291					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		TCCGCAGTTCTTTCTCCAAAT	0.587																																					p.K291N		.											.	ILDR1	91	0			c.A873T						.						77.0	73.0	74.0					3																	121712723		2203	4300	6503	SO:0001583	missense	286676	exon7			CAGTTCTTTCTCC	BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.873A>T	3.37:g.121712723T>A	ENSP00000345667:p.Lys291Asn	25.0	0.0		30.0	17.0	NM_001199799	Q6ZP61|Q7Z578	Missense_Mutation	SNP	ENST00000344209.5	37	CCDS56271.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.327743	0.41197	.	.	ENSG00000145103	ENST00000273691;ENST00000344209;ENST00000383663;ENST00000393631;ENST00000462014	T;T;T;T	0.77750	-0.61;-0.6;-1.12;-0.2	5.14	-3.39	0.04868	.	0.343618	0.35838	N	0.002948	T	0.57681	0.2070	L	0.31120	0.905	0.36771	D	0.883805	B;B;B;B	0.18461	0.028;0.0;0.002;0.004	B;B;B;B	0.17098	0.017;0.001;0.005;0.005	T	0.24512	-1.0158	10	0.25751	T	0.34	-16.5813	6.981	0.24704	0.1409:0.5283:0.0:0.3308	.	202;291;247;259	Q86SU0-5;Q86SU0;Q86SU0-2;Q86SU0-6	.;ILDR1_HUMAN;.;.	N	247;291;174;202;259	ENSP00000273691:K247N;ENSP00000345667:K291N;ENSP00000377251:K202N;ENSP00000419414:K259N	ENSP00000273691:K247N	K	-	3	2	ILDR1	123195413	0.987000	0.35691	0.988000	0.46212	0.992000	0.81027	0.037000	0.13840	-0.538000	0.06281	-0.301000	0.09380	AAA	.		0.587	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355666.1	NM_175924	
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62516654	62516654	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:62516654A>T	ENST00000371158.2	+	31	4163	c.4049A>T	c.(4048-4050)gAa>gTa	p.E1350V	INADL_ENST00000545929.1_Missense_Mutation_p.E23V|INADL_ENST00000316485.6_Missense_Mutation_p.E1350V|INADL_ENST00000543708.1_Missense_Mutation_p.E134V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1350					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGCGGCACCGAACCTATTAGT	0.393																																					p.E1350V		.											.	INADL	94	0			c.A4049T						.						129.0	125.0	126.0					1																	62516654		2203	4300	6503	SO:0001583	missense	10207	exon31			GCACCGAACCTAT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.4049A>T	1.37:g.62516654A>T	ENSP00000360200:p.Glu1350Val	48.0	0.0		42.0	20.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	8.289	0.817214	0.16607	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000307297;ENST00000543708;ENST00000545929	T;T;T;T;T	0.50001	2.58;2.44;3.16;2.16;0.76	5.08	5.08	0.68730	.	0.370903	0.26688	N	0.023006	T	0.52853	0.1760	L	0.54323	1.7	0.20196	N	0.999921	D;B;P;B;B;B	0.57257	0.979;0.224;0.943;0.079;0.167;0.035	P;B;P;B;B;B	0.52957	0.714;0.035;0.489;0.033;0.15;0.046	T	0.49707	-0.8911	10	0.44086	T	0.13	.	11.4185	0.49967	1.0:0.0:0.0:0.0	.	23;134;809;1350;1350;1350	F5GY89;B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;.;INADL_HUMAN;.	V	1350;1350;1350;1350;134;134;23	ENSP00000360200:E1350V;ENSP00000326199:E1350V;ENSP00000307496:E134V;ENSP00000445790:E134V;ENSP00000440094:E23V	ENSP00000307496:E134V	E	+	2	0	INADL	62289242	0.646000	0.27295	0.095000	0.20976	0.139000	0.21198	2.682000	0.46934	2.260000	0.74910	0.533000	0.62120	GAA	.		0.393	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
ITGA10	8515	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	145532113	145532113	+	Splice_Site	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:145532113A>T	ENST00000369304.3	+	8	933		c.e8-1		ITGA10_ENST00000538811.1_Splice_Site|ITGA10_ENST00000539363.1_Splice_Site|ITGA10_ENST00000481236.1_Splice_Site	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTCTCTTCTCAGCACAGAAGG	0.537																																					.		.											.	ITGA10	231	0			c.759-2A>T						.						92.0	89.0	90.0					1																	145532113		2203	4300	6503	SO:0001630	splice_region_variant	8515	exon8			CTTCTCAGCACAG	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.759-1A>T	1.37:g.145532113A>T		26.0	0.0		24.0	11.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Splice_Site	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839483	0.71488	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3258	0.60459	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGA10	144243470	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.001000	0.88508	2.116000	0.64780	0.418000	0.28097	.	.		0.537	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	Intron
ITGA9	3680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	37574811	37574811	+	Missense_Mutation	SNP	G	G	T	rs530318185		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:37574811G>T	ENST00000264741.5	+	14	1636	c.1380G>T	c.(1378-1380)agG>agT	p.R460S	ITGA9_ENST00000422441.1_Missense_Mutation_p.R460S	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	460					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GCAGAGCAAGGCCTGTCATTA	0.537																																					p.R460S		.											.	ITGA9	715	0			c.G1380T						.						110.0	87.0	95.0					3																	37574811		2203	4300	6503	SO:0001583	missense	3680	exon14			AGCAAGGCCTGTC	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1380G>T	3.37:g.37574811G>T	ENSP00000264741:p.Arg460Ser	45.0	0.0		43.0	22.0	NM_002207	Q14638	Missense_Mutation	SNP	ENST00000264741.5	37	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072238	0.55646	.	.	ENSG00000144668	ENST00000422441;ENST00000264741	T;T	0.69685	-0.42;-0.42	6.07	-4.8	0.03190	Integrin alpha-2 (1);	0.000000	0.85682	D	0.000000	T	0.78755	0.4333	M	0.76574	2.34	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.81428	-0.0937	10	0.87932	D	0	.	18.7658	0.91871	0.2972:0.0:0.7028:0.0	.	460;460	Q13797;E9PDS3	ITA9_HUMAN;.	S	460	ENSP00000397258:R460S;ENSP00000264741:R460S	ENSP00000264741:R460S	R	+	3	2	ITGA9	37549815	0.989000	0.36119	0.805000	0.32314	0.243000	0.25628	0.364000	0.20325	-0.618000	0.05656	-0.345000	0.07892	AGG	.		0.537	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
ITIH6	347365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54783459	54783459	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:54783459G>A	ENST00000218436.6	-	8	3077	c.3048C>T	c.(3046-3048)tcC>tcT	p.S1016S		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1016					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CCACGAACTTGGATTCCACCA	0.532																																					p.S1016S		.											.	.	.	0			c.C3048T						.						83.0	67.0	73.0					X																	54783459		2203	4300	6503	SO:0001819	synonymous_variant	347365	exon8			GAACTTGGATTCC	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3048C>T	X.37:g.54783459G>A		37.0	0.0		47.0	22.0	NM_198510	A6NN03	Silent	SNP	ENST00000218436.6	37	CCDS14361.1																																																																																			.		0.532	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
KANSL2	54934	ucsc.edu;bcgsc.ca	37	12	49061538	49061538	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:49061538G>T	ENST00000420613.2	-	7	958	c.911C>A	c.(910-912)gCc>gAc	p.A304D	KANSL2_ENST00000357861.3_Missense_Mutation_p.A109D|SNORA2B_ENST00000384583.1_RNA|KANSL2_ENST00000553086.1_Missense_Mutation_p.A304D|KANSL2_ENST00000550347.1_Missense_Mutation_p.A487D	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	304					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											ATCCACAAAGGCCAAGCACCT	0.428																																					p.A304D		.											.	.	.	0			c.C911A						.						155.0	150.0	151.0					12																	49061538		1970	4158	6128	SO:0001583	missense	54934	exon7			ACAAAGGCCAAGC	AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.911C>A	12.37:g.49061538G>T	ENSP00000415436:p.Ala304Asp	32.0	0.0		23.0	4.0	NM_017822	Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	ENST00000420613.2	37	CCDS44869.1	.	.	.	.	.	.	.	.	.	.	G	19.05	3.752614	0.69533	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000547087;ENST00000553086;ENST00000357861	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.68	5.68	0.88126	.	0.052435	0.85682	D	0.000000	T	0.62744	0.2453	L	0.55481	1.735	0.58432	D	0.999994	D;P;D;P	0.63880	0.993;0.867;0.992;0.902	P;P;P;P	0.59948	0.823;0.553;0.866;0.498	T	0.60485	-0.7254	10	0.51188	T	0.08	-9.5896	18.9233	0.92534	0.0:0.0:1.0:0.0	.	487;304;109;304	F8VX10;Q9H9L4;Q9H9L4-2;F8VXI8	.;CL041_HUMAN;.;.	D	487;304;52;304;109	ENSP00000449747:A487D;ENSP00000415436:A304D;ENSP00000447608:A52D;ENSP00000448833:A304D;ENSP00000350527:A109D	ENSP00000350527:A109D	A	-	2	0	C12orf41	47347805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.574000	0.90763	2.838000	0.97847	0.563000	0.77884	GCC	.		0.428	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408841.1	NM_017822	
KCNH1	3756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	211093249	211093249	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:211093249T>A	ENST00000271751.4	-	7	1222	c.1195A>T	c.(1195-1197)Agc>Tgc	p.S399C	KCNH1_ENST00000367007.4_Missense_Mutation_p.S372C			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	399					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TCCCCAATGCTGTACCAGATG	0.532																																					p.S399C		.											.	KCNH1	94	0			c.A1195T						.						175.0	158.0	164.0					1																	211093249		2203	4300	6503	SO:0001583	missense	3756	exon7			CAATGCTGTACCA	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1195A>T	1.37:g.211093249T>A	ENSP00000271751:p.Ser399Cys	138.0	0.0		227.0	70.0	NM_172362	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.095697	0.76870	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98602	-5.02;-5.02	5.8	4.66	0.58398	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98096	0.9372	L	0.55834	1.745	0.80722	D	1	P;P	0.52577	0.954;0.954	P;P	0.61533	0.89;0.89	D	0.97804	1.0246	10	0.52906	T	0.07	.	12.4351	0.55595	0.0:0.0:0.1404:0.8596	.	372;399	Q14CL3;O95259	.;KCNH1_HUMAN	C	399;372	ENSP00000271751:S399C;ENSP00000355974:S372C	ENSP00000271751:S399C	S	-	1	0	KCNH1	209159872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.751000	0.85126	1.011000	0.39340	0.533000	0.62120	AGC	.		0.532	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
KCNH3	23416	broad.mit.edu;mdanderson.org	37	12	49943273	49943273	+	Silent	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:49943273C>T	ENST00000257981.6	+	9	1778	c.1518C>T	c.(1516-1518)cgC>cgT	p.R506R		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	506					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						TCATCCAGCGCATGTACGCCC	0.667																																					p.R506R		.											.	KCNH3	90	0			c.C1518T						.						78.0	67.0	71.0					12																	49943273		2203	4300	6503	SO:0001819	synonymous_variant	23416	exon9			CCAGCGCATGTAC	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1518C>T	12.37:g.49943273C>T		47.0	0.0		35.0	11.0	NM_012284	Q9UQ06	Silent	SNP	ENST00000257981.6	37	CCDS8786.1																																																																																			.		0.667	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404571.2	NM_012284	
KCNK10	54207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	88652001	88652001	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr14:88652001A>T	ENST00000340700.5	-	7	1946	c.1495T>A	c.(1495-1497)Tcc>Acc	p.S499T	KCNK10_ENST00000319231.5_Missense_Mutation_p.S504T|KCNK10_ENST00000312350.5_Missense_Mutation_p.S504T	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	499					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GCTGTGCTGGAGTTGTCTGAG	0.532																																					p.S504T		.											.	KCNK10	95	0			c.T1510A						.						167.0	159.0	162.0					14																	88652001		2203	4300	6503	SO:0001583	missense	54207	exon7			TGCTGGAGTTGTC	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1495T>A	14.37:g.88652001A>T	ENSP00000343104:p.Ser499Thr	219.0	1.0		254.0	122.0	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442146	0.63067	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.91295	-2.81;-2.82;-2.79	5.5	5.5	0.81552	.	1.070570	0.07007	N	0.824408	D	0.85080	0.5615	N	0.22421	0.69	0.35439	D	0.794706	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.08055	0.003;0.002;0.003	T	0.71540	-0.4562	10	0.15499	T	0.54	.	13.3629	0.60667	1.0:0.0:0.0:0.0	.	499;504;504	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	T	499;504;504	ENSP00000343104:S499T;ENSP00000310568:S504T;ENSP00000312811:S504T	ENSP00000310568:S504T	S	-	1	0	KCNK10	87721754	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.067000	0.71193	2.102000	0.63906	0.533000	0.62120	TCC	.		0.532	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
KCNQ3	3786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133192469	133192469	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:133192469G>T	ENST00000388996.4	-	4	1132	c.712C>A	c.(712-714)Ctg>Atg	p.L238M	KCNQ3_ENST00000519445.1_Missense_Mutation_p.L238M|KCNQ3_ENST00000521134.1_Missense_Mutation_p.L118M	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	238					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TCCATCCGCAGCATGCGCAGG	0.592																																					p.L238M		.											.	KCNQ3	138	0			c.C712A						.						97.0	87.0	91.0					8																	133192469		2203	4300	6503	SO:0001583	missense	3786	exon4			TCCGCAGCATGCG	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.712C>A	8.37:g.133192469G>T	ENSP00000373648:p.Leu238Met	35.0	0.0		57.0	9.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819329	0.71028	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.99158	-5.5;-5.5;-5.5	5.66	5.66	0.87406	Ion transport (1);	0.159984	0.43110	D	0.000615	D	0.98767	0.9585	L	0.54323	1.7	0.51482	D	0.999921	D;D	0.62365	0.991;0.991	P;P	0.62740	0.906;0.906	D	0.98928	1.0786	10	0.87932	D	0	-14.317	13.6735	0.62440	0.0:0.0:0.8457:0.1543	.	238;238	E7ET42;O43525	.;KCNQ3_HUMAN	M	238;118;238;227;117	ENSP00000373648:L238M;ENSP00000429799:L118M;ENSP00000428790:L238M	ENSP00000373648:L238M	L	-	1	2	KCNQ3	133261651	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.810000	0.55613	2.680000	0.91292	0.561000	0.74099	CTG	.		0.592	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
KIAA0556	23247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27751968	27751968	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:27751968T>A	ENST00000261588.4	+	15	2369	c.2350T>A	c.(2350-2352)Tgg>Agg	p.W784R		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	784						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GCCCCTGGCCTGGAAGGGCAG	0.622																																					p.W784R		.											.	KIAA0556	141	0			c.T2350A						.						65.0	68.0	67.0					16																	27751968		2196	4300	6496	SO:0001583	missense	23247	exon15			CTGGCCTGGAAGG	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.2350T>A	16.37:g.27751968T>A	ENSP00000261588:p.Trp784Arg	26.0	0.0		26.0	12.0	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	T	4.837	0.155672	0.09236	.	.	ENSG00000047578	ENST00000261588	T	0.09073	3.02	4.31	-4.77	0.03219	.	1.007080	0.07969	N	0.983612	T	0.06142	0.0159	L	0.44542	1.39	0.09310	N	1	B	0.33583	0.418	B	0.33339	0.162	T	0.39881	-0.9592	10	0.13853	T	0.58	-20.8096	7.0308	0.24967	0.0:0.4391:0.2613:0.2997	.	784	O60303	K0556_HUMAN	R	784	ENSP00000261588:W784R	ENSP00000261588:W784R	W	+	1	0	KIAA0556	27659469	0.004000	0.15560	0.000000	0.03702	0.147000	0.21601	-0.128000	0.10531	-1.101000	0.03027	-0.366000	0.07423	TGG	.		0.622	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
KIAA1109	84162	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123268771	123268771	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:123268771G>A	ENST00000264501.4	+	76	13339	c.12966G>A	c.(12964-12966)caG>caA	p.Q4322Q	KIAA1109_ENST00000388738.3_Silent_p.Q4322Q			Q2LD37	K1109_HUMAN	KIAA1109	4322					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCTGGGAGCAGCCAAGTCAGT	0.502																																					p.Q4322Q		.											.	KIAA1109	80	0			c.G12966A						.						86.0	90.0	89.0					4																	123268771		2071	4203	6274	SO:0001819	synonymous_variant	84162	exon74			GGAGCAGCCAAGT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12966G>A	4.37:g.123268771G>A		131.0	1.0		105.0	40.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	G	8.225	0.803316	0.16397	.	.	ENSG00000138688	ENST00000306802	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	T	0.70824	0.3268	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67833	-0.5568	4	.	.	.	.	13.9788	0.64291	0.0686:0.0:0.9314:0.0	.	.	.	.	N	698	.	.	S	+	2	0	KIAA1109	123488221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.437000	0.52863	2.937000	0.99478	0.650000	0.86243	AGC	.		0.502	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
KIAA1522	57648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	33235646	33235646	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:33235646A>T	ENST00000373480.1	+	6	792	c.689A>T	c.(688-690)gAg>gTg	p.E230V	KIAA1522_ENST00000401073.2_Missense_Mutation_p.E289V|KIAA1522_ENST00000373481.3_Missense_Mutation_p.E241V|KIAA1522_ENST00000294521.3_Intron	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	230										breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				GCTGAGACAGAGGCCATGCTG	0.701																																					p.E289V		.											.	KIAA1522	90	0			c.A866T						.						22.0	28.0	26.0					1																	33235646		2067	4203	6270	SO:0001583	missense	57648	exon6			AGACAGAGGCCAT	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.689A>T	1.37:g.33235646A>T	ENSP00000362579:p.Glu230Val	50.0	0.0		64.0	24.0	NM_020888	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548340	0.45383	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.31769	1.48;1.48;1.48	4.47	4.47	0.54385	.	0.091308	0.46145	D	0.000313	T	0.48021	0.1477	L	0.50333	1.59	0.37837	D	0.928911	D;D;D	0.71674	0.998;0.978;0.991	D;P;P	0.68943	0.961;0.725;0.852	T	0.56318	-0.7999	10	0.72032	D	0.01	-18.902	14.062	0.64806	1.0:0.0:0.0:0.0	.	241;230;289	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	V	289;241;230	ENSP00000383851:E289V;ENSP00000362580:E241V;ENSP00000362579:E230V	ENSP00000362579:E230V	E	+	2	0	KIAA1522	33008233	0.998000	0.40836	0.994000	0.49952	0.898000	0.52572	2.466000	0.45084	1.776000	0.52262	0.402000	0.26972	GAG	.		0.701	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
KIAA1614	57710	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	180904469	180904469	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:180904469T>A	ENST00000367588.4	+	5	1479	c.1424T>A	c.(1423-1425)gTg>gAg	p.V475E	KIAA1614_ENST00000367587.1_Missense_Mutation_p.V96E	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	475										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CAGCGCCAGGTGCTGAGCACC	0.736																																					p.V475E		.											.	KIAA1614	26	0			c.T1424A						.						5.0	8.0	7.0					1																	180904469		1895	4022	5917	SO:0001583	missense	57710	exon5			GCCAGGTGCTGAG	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.1424T>A	1.37:g.180904469T>A	ENSP00000356560:p.Val475Glu	31.0	0.0		47.0	22.0	NM_020950	Q5VZ45|Q9HCF8	Missense_Mutation	SNP	ENST00000367588.4	37	CCDS41442.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021172	0.75275	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.27890	2.18;1.64	4.68	-2.64	0.06114	.	0.826580	0.10512	N	0.666045	T	0.34221	0.0890	L	0.53249	1.67	0.26129	N	0.980448	D	0.54047	0.964	P	0.53006	0.715	T	0.44205	-0.9343	9	0.52906	T	0.07	-1.4174	6.1299	0.20199	0.0:0.1558:0.3911:0.4531	.	475	Q5VZ46	K1614_HUMAN	E	475;96	ENSP00000356560:V475E;ENSP00000356559:V96E	ENSP00000356559:V96E	V	+	2	0	KIAA1614	179171092	0.000000	0.05858	0.002000	0.10522	0.359000	0.29487	-0.593000	0.05740	-0.379000	0.07906	-0.473000	0.04963	GTG	.		0.736	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085151.1	XM_046531	
KIF18B	146909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	43010040	43010040	+	Splice_Site	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:43010040C>A	ENST00000593135.1	-	9	1336		c.e9+1		KIF18B_ENST00000339151.4_Splice_Site|KIF18B_ENST00000590129.1_Splice_Site|KIF18B_ENST00000587309.1_Splice_Site|KIF18B_ENST00000438933.2_Splice_Site	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				GTGGAACTCACTGTTCTGGTG	0.622																																					.		.											.	KIF18B	70	0			c.1238+1G>T						.						90.0	102.0	98.0					17																	43010040		1963	4131	6094	SO:0001630	splice_region_variant	146909	exon10			AACTCACTGTTCT		CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.1238+1G>T	17.37:g.43010040C>A		22.0	0.0		27.0	11.0	NM_001264573	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Splice_Site	SNP	ENST00000593135.1	37	CCDS45709.2	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659434	0.67586	.	.	ENSG00000186185	ENST00000438933;ENST00000339151;ENST00000376982	.	.	.	5.51	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4848	0.55866	0.0:0.8317:0.1683:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF18B	40365566	0.224000	0.23674	0.979000	0.43373	0.429000	0.31625	1.243000	0.32767	1.425000	0.47237	0.650000	0.86243	.	.		0.622	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000448724.1	NM_001080443	Intron
KIF20B	9585	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	91520384	91520384	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:91520384T>C	ENST00000371728.3	+	28	4847	c.4782T>C	c.(4780-4782)aaT>aaC	p.N1594N	KIF20B_ENST00000260753.4_Silent_p.N1554N|KIF20B_ENST00000394289.2_Silent_p.N1594N|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Silent_p.N1624N	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1594	Interaction with PIN1.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TTTCCAGAAATAAAATAGAGG	0.353																																					p.N1554N		.											.	KIF20B	93	0			c.T4662C						.						47.0	47.0	47.0					10																	91520384		2203	4300	6503	SO:0001819	synonymous_variant	9585	exon28			CAGAAATAAAATA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4782T>C	10.37:g.91520384T>C		88.0	1.0		108.0	54.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Silent	SNP	ENST00000371728.3	37																																																																																				.		0.353	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
KRT25	147183	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38907463	38907463	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:38907463A>T	ENST00000312150.4	-	4	845	c.785T>A	c.(784-786)cTt>cAt	p.L262H		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				CTGCTCTGCAAGGGCTTCGTA	0.567																																					p.L262H		.											.	KRT25	92	0			c.T785A						.						95.0	82.0	87.0					17																	38907463		2203	4300	6503	SO:0001583	missense	147183	exon4			TCTGCAAGGGCTT	AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.785T>A	17.37:g.38907463A>T	ENSP00000310573:p.Leu262His	89.0	1.0		74.0	36.0	NM_181534		Missense_Mutation	SNP	ENST00000312150.4	37	CCDS11373.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.416141	0.83449	.	.	ENSG00000204897	ENST00000312150	D	0.89746	-2.56	5.84	5.84	0.93424	Filament (1);	0.000000	0.51477	D	0.000089	D	0.95092	0.8410	M	0.86651	2.83	0.26635	N	0.972396	D	0.89917	1.0	D	0.79108	0.992	D	0.90766	0.4668	10	0.87932	D	0	.	16.2282	0.82315	1.0:0.0:0.0:0.0	.	262	Q7Z3Z0	K1C25_HUMAN	H	262	ENSP00000310573:L262H	ENSP00000310573:L262H	L	-	2	0	KRT25	36160989	0.964000	0.33143	0.538000	0.28064	0.777000	0.43975	8.959000	0.93110	2.227000	0.72691	0.533000	0.62120	CTT	.		0.567	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257218.1	NM_181534	
KRT31	3881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39550414	39550414	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:39550414T>A	ENST00000251645.2	-	7	1157	c.1105A>T	c.(1105-1107)Agc>Tgc	p.S369C		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	369	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				CAGGGATTGCTGGGCAGACTG	0.527																																					p.S369C		.											.	KRT31	90	0			c.A1105T						.						105.0	88.0	94.0					17																	39550414		2203	4300	6503	SO:0001583	missense	3881	exon7			GATTGCTGGGCAG	X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.1105A>T	17.37:g.39550414T>A	ENSP00000251645:p.Ser369Cys	44.0	0.0		53.0	27.0	NM_002277	Q9UE12	Missense_Mutation	SNP	ENST00000251645.2	37	CCDS11391.1	.	.	.	.	.	.	.	.	.	.	t	2.700	-0.271220	0.05716	.	.	ENSG00000094796	ENST00000251645	D	0.81908	-1.55	5.76	0.608	0.17569	.	0.509560	0.19860	N	0.104444	T	0.41213	0.1149	N	0.00408	-1.53	0.23492	N	0.997568	B	0.02656	0.0	B	0.01281	0.0	T	0.50065	-0.8871	10	0.02654	T	1	.	1.4325	0.02336	0.423:0.1442:0.085:0.3478	.	369	Q15323	K1H1_HUMAN	C	369	ENSP00000251645:S369C	ENSP00000251645:S369C	S	-	1	0	KRT31	36803940	1.000000	0.71417	0.959000	0.39883	0.881000	0.50899	0.680000	0.25306	0.074000	0.16767	-0.438000	0.05819	AGC	.		0.527	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	NM_002277	
KTN1	3895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	56122805	56122805	+	Silent	SNP	A	A	G	rs143735954		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr14:56122805A>G	ENST00000395314.3	+	29	2915	c.2847A>G	c.(2845-2847)ctA>ctG	p.L949L	KTN1_ENST00000395309.3_Silent_p.L949L|KTN1_ENST00000413890.2_Silent_p.L926L|KTN1_ENST00000416613.1_Silent_p.L949L|KTN1_ENST00000395311.1_Silent_p.L926L|KTN1_ENST00000554507.1_Silent_p.L244L|KTN1_ENST00000395308.1_Silent_p.L926L|KTN1_ENST00000438792.2_Silent_p.L949L	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	949					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						AAGCCATGCTAAAAGAGAGGG	0.308			T	RET	papillary thryoid																																p.L949L		.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1	1147	0			c.A2847G						.	A	,,,	0,4406		0,0,2203	66.0	69.0	68.0		2847,2778,2847,2847	1.9	0.2	14	dbSNP_134	68	3,8595	3.0+/-9.4	0,3,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KTN1	NM_001079521.1,NM_001079522.1,NM_004986.2,NM_182926.2	,,,	0,3,6499	GG,GA,AA		0.0349,0.0,0.0231	,,,	949/1358,926/1307,949/1301,949/1358	56122805	3,13001	2203	4299	6502	SO:0001819	synonymous_variant	3895	exon29			CATGCTAAAAGAG		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.2847A>G	14.37:g.56122805A>G		249.0	1.0		278.0	127.0	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Silent	SNP	ENST00000395314.3	37	CCDS41957.1																																																																																			A|1.000;G|0.000		0.308	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
LATS1	9113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	150005471	150005471	+	Nonsense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:150005471T>A	ENST00000543571.1	-	4	1301	c.754A>T	c.(754-756)Aga>Tga	p.R252*	LATS1_ENST00000392273.3_Nonsense_Mutation_p.R252*|LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Nonsense_Mutation_p.R252*	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GTCTGGCCTCTTGGAGGTGGT	0.507																																					p.R252X		.											LATS1,NS,carcinoma,+1	LATS1	992	0			c.A754T						.						161.0	151.0	155.0					6																	150005471		2203	4300	6503	SO:0001587	stop_gained	9113	exon4			GGCCTCTTGGAGG	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.754A>T	6.37:g.150005471T>A	ENSP00000437550:p.Arg252*	88.0	0.0		52.0	46.0	NM_001270519		Nonsense_Mutation	SNP	ENST00000543571.1	37	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388042	0.82902	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273;ENST00000458696	.	.	.	4.8	4.8	0.61643	.	0.000000	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2988	0.49294	0.0:0.0:0.1638:0.8362	.	.	.	.	X	252;252;252;198	.	.	R	-	1	2	LATS1	150047164	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.687000	0.46976	1.780000	0.52325	0.533000	0.62120	AGA	.		0.507	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
LYL1	4066	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	13211833	13211833	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:13211833G>A	ENST00000264824.4	-	2	513	c.153C>T	c.(151-153)tcC>tcT	p.S51S		NM_005583.4	NP_005574.2	P12980	LYL1_HUMAN	lymphoblastic leukemia associated hematopoiesis regulator 1	51					B cell differentiation (GO:0030183)|blood vessel maturation (GO:0001955)|definitive hemopoiesis (GO:0060216)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)	7			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			TGGGGGGCGAGGAGCCTCCTC	0.721			T	TRB@	T-ALL																																p.S51S		.		Dom	yes		19	19p13.2-p13.1	4066	lymphoblastic leukemia derived sequence 1		L	.	LYL1	658	0			c.C153T						.						5.0	7.0	6.0					19																	13211833		2051	4079	6130	SO:0001819	synonymous_variant	4066	exon2			GGGCGAGGAGCCT		CCDS12292.1	19p13.2	2014-01-20	2014-01-20			ENSG00000104903		"""Basic helix-loop-helix proteins"""	6734	protein-coding gene	gene with protein product		151440	"""lymphoblastic leukemia derived sequence 1"""			2752424	Standard	NM_005583		Approved	bHLHa18	uc002mwi.3	P12980		ENST00000264824.4:c.153C>T	19.37:g.13211833G>A		45.0	0.0		32.0	8.0	NM_005583	O76102	Silent	SNP	ENST00000264824.4	37	CCDS12292.1																																																																																			.		0.721	LYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452827.1	NM_005583	
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39929343	39929343	+	Silent	SNP	A	A	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:39929343A>C	ENST00000372915.3	+	93	21522	c.21435A>C	c.(21433-21435)ggA>ggC	p.G7145G	MACF1_ENST00000545844.1_Silent_p.G5187G|MACF1_ENST00000539005.1_Silent_p.G5057G|MACF1_ENST00000567887.1_Silent_p.G7283G|MACF1_ENST00000361689.2_Silent_p.G5187G|MACF1_ENST00000317713.7_Silent_p.G5187G|MACF1_ENST00000564288.1_Silent_p.G7246G|MACF1_ENST00000289893.4_Silent_p.G5689G			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7145	C-terminal tail. {ECO:0000250}.|GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGCAGATCGGAGAGAATAAAT	0.453																																					p.G5187G		.											.	MACF1	165	0			c.A15561C						.						121.0	113.0	116.0					1																	39929343		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon91			GATCGGAGAGAAT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21435A>C	1.37:g.39929343A>C		92.0	0.0		134.0	65.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	10.12	1.262924	0.23051	.	.	ENSG00000127603	ENST00000360115;ENST00000442046	.	.	.	5.71	1.95	0.26073	.	.	.	.	.	T	0.56863	0.2014	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52888	-0.8515	4	.	.	.	.	9.1486	0.36948	0.6087:0.3215:0.0697:0.0	.	.	.	.	A	294;88	.	.	E	+	2	0	MACF1	39701930	0.991000	0.36638	1.000000	0.80357	0.990000	0.78478	0.446000	0.21694	1.066000	0.40716	0.528000	0.53228	GAG	.		0.453	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
MAGEA8	4107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	149013280	149013280	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:149013280T>A	ENST00000542674.1	+	3	755	c.234T>A	c.(232-234)acT>acA	p.T78T	MAGEA8_ENST00000493910.1_3'UTR|MAGEA8_ENST00000286482.1_Silent_p.T78T|MAGEA8_ENST00000535454.1_Silent_p.T78T	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	78										NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					CCGACAGCACTCTGTGGAGCC	0.602																																					p.T78T		.											.	MAGEA8	130	0			c.T234A						.						67.0	61.0	63.0					X																	149013280		2203	4298	6501	SO:0001819	synonymous_variant	4107	exon3			CAGCACTCTGTGG		CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.234T>A	X.37:g.149013280T>A		56.0	0.0		62.0	27.0	NM_005364	Q9BUN9	Silent	SNP	ENST00000542674.1	37	CCDS14692.1																																																																																			.		0.602	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058728.1	NM_005364	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49433836	49433836	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:49433836C>T	ENST00000301067.7	-	31	7716	c.7717G>A	c.(7717-7719)Ggc>Agc	p.G2573S	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2573	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGAGGCTTGCCCAAGGTGGGG	0.642																																					p.G2573S		.											.	MLL2	612	0			c.G7717A						.						44.0	48.0	47.0					12																	49433836		1912	4120	6032	SO:0001583	missense	8085	exon31			GCTTGCCCAAGGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.7717G>A	12.37:g.49433836C>T	ENSP00000301067:p.Gly2573Ser	60.0	0.0		53.0	8.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292079	0.40594	.	.	ENSG00000167548	ENST00000301067	T	0.78924	-1.22	5.3	5.3	0.74995	.	0.000000	0.38164	N	0.001782	T	0.76730	0.4028	N	0.19112	0.55	0.40785	D	0.983209	D	0.69078	0.997	P	0.56042	0.79	T	0.81037	-0.1114	10	0.87932	D	0	.	16.2715	0.82624	0.0:1.0:0.0:0.0	.	2573	O14686	MLL2_HUMAN	S	2573	ENSP00000301067:G2573S	ENSP00000301067:G2573S	G	-	1	0	MLL2	47720103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.716000	0.37981	2.644000	0.89710	0.591000	0.81541	GGC	.		0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
MDM2	4193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	69233083	69233083	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:69233083A>C	ENST00000350057.5	+	9	855	c.855A>C	c.(853-855)gaA>gaC	p.E285D	MDM2_ENST00000356290.4_Missense_Mutation_p.E140D|MDM2_ENST00000348801.2_Missense_Mutation_p.E84D|MDM2_ENST00000478070.1_Missense_Mutation_p.K49T|MDM2_ENST00000360430.2_Missense_Mutation_p.E115D|MDM2_ENST00000545204.1_Intron|MDM2_ENST00000428863.2_Missense_Mutation_p.E89D|MDM2_ENST00000517852.1_Intron|MDM2_ENST00000393413.3_Missense_Mutation_p.E37D|MDM2_ENST00000299252.4_Missense_Mutation_p.E140D|MDM2_ENST00000544561.1_Intron|RP11-611O2.5_ENST00000553141.1_RNA|MDM2_ENST00000462284.1_Missense_Mutation_p.E316D|MDM2_ENST00000258149.5_Missense_Mutation_p.E255D|MDM2_ENST00000258148.7_Missense_Mutation_p.E261D|MDM2_ENST00000393410.1_Missense_Mutation_p.E62D|MDM2_ENST00000540827.1_Missense_Mutation_p.E115D|MDM2_ENST00000393412.3_Missense_Mutation_p.E37D			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	310	ARF-binding.|Asp/Glu-rich (acidic).|Interaction with MTBP. {ECO:0000250}.|Necessary for interaction with USP2.|Region II.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			CATGCAATGAAATGAATCCCC	0.428			A		"""sarcoma, glioma, colorectal, other"""																																p.E316D		.		Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	.	MDM2	1270	0			c.A948C						.						110.0	96.0	101.0					12																	69233083		1876	4121	5997	SO:0001583	missense	4193	exon11			CAATGAAATGAAT		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.855A>C	12.37:g.69233083A>C	ENSP00000266624:p.Glu285Asp	45.0	0.0		33.0	16.0	NM_002392	A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	ENST00000350057.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.54|14.54	2.564877|2.564877	0.45694|0.45694	.|.	.|.	ENSG00000135679|ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000258149;ENST00000356290;ENST00000540827;ENST00000428863;ENST00000393412;ENST00000311420;ENST00000258148;ENST00000543323;ENST00000523991;ENST00000393413;ENST00000350057;ENST00000393410;ENST00000299252;ENST00000360430;ENST00000348801|ENST00000478070	T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.55234|.	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53|.	5.5|5.5	0.481|0.481	0.16809|0.16809	Zinc finger, RanBP2-type (3);|.	0.138749|.	0.64402|.	D|.	0.000005|.	T|T	0.59689|0.59689	0.2212|0.2212	L|L	0.59436|0.59436	1.845|1.845	0.50813|0.50813	D|D	0.999892|0.999892	D;D;P;D;D;B;B;P;P|.	0.63880|.	0.981;0.981;0.915;0.993;0.968;0.299;0.346;0.633;0.95|.	P;P;P;D;P;B;B;B;P|.	0.63283|.	0.848;0.848;0.648;0.913;0.802;0.145;0.253;0.221;0.574|.	T|T	0.53940|0.53940	-0.8367|-0.8367	9|5	.|.	.|.	.|.	-21.3321|-21.3321	10.2776|10.2776	0.43519|0.43519	0.5744:0.0:0.4256:0.0|0.5744:0.0:0.4256:0.0	.|.	265;89;37;62;140;310;261;115;316|.	Q00987-9;Q00987-3;Q00987-4;Q9H4C5;Q00987-5;Q00987;G3XA89;Q00987-2;Q00987-11|.	.;.;.;.;.;MDM2_HUMAN;.;.;.|.	D|T	316;265;255;140;115;89;37;271;261;114;140;37;285;62;140;115;84|49	ENSP00000417281:E316D;ENSP00000258149:E255D;ENSP00000348637:E140D;ENSP00000440932:E115D;ENSP00000410694:E89D;ENSP00000377064:E37D;ENSP00000258148:E261D;ENSP00000377065:E37D;ENSP00000266624:E285D;ENSP00000377062:E62D;ENSP00000299252:E140D;ENSP00000353611:E115D;ENSP00000335096:E84D|.	.|.	E|K	+|+	3|2	2|0	MDM2|MDM2	67519350|67519350	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.719000|0.719000	0.41307|0.41307	1.193000|1.193000	0.32162|0.32162	-0.078000|-0.078000	0.12730|0.12730	0.528000|0.528000	0.53228|0.53228	GAA|AAA	.		0.428	MDM2-033	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000402665.1	NM_006880	
MPHOSPH9	10198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123702951	123702951	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:123702951T>A	ENST00000606320.1	-	6	1174	c.968A>T	c.(967-969)gAg>gTg	p.E323V	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.E171V|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.E293V|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.E171V			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	323						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		CTTACTTTGCTCATTTCCTTG	0.413																																					p.E171V		.											.	MPHOSPH9	514	0			c.A512T						.						283.0	240.0	255.0					12																	123702951		2203	4300	6503	SO:0001583	missense	10198	exon2			CTTTGCTCATTTC	X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.968A>T	12.37:g.123702951T>A	ENSP00000475489:p.Glu323Val	349.0	0.0		312.0	76.0	NM_022782	A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	ENST00000606320.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.65|14.65	2.598952|2.598952	0.46318|0.46318	.|.	.|.	ENSG00000051825|ENSG00000257076	ENST00000302349;ENST00000541076|ENST00000539336	T;T|.	0.42513|.	0.97;1.0|.	4.93|4.93	3.78|3.78	0.43462|0.43462	.|.	0.370404|.	0.25352|.	N|.	0.031291|.	T|.	0.54319|.	0.1851|.	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|.	0.42849|.	-0.9427|.	10|.	0.42905|.	T|.	0.14|.	-13.7252|-13.7252	12.6994|12.6994	0.57022|0.57022	0.0:0.0:0.1381:0.8619|0.0:0.0:0.1381:0.8619	.|.	171|.	Q99550|.	MPP9_HUMAN|.	V|C	171|180	ENSP00000303597:E171V;ENSP00000445859:E171V|.	ENSP00000303597:E171V|.	E|X	-|-	2|3	0|0	MPHOSPH9|RP11-546D6.2	122268904|122268904	0.944000|0.944000	0.32072|0.32072	0.005000|0.005000	0.12908|0.12908	0.043000|0.043000	0.13939|0.13939	2.949000|2.949000	0.49074|0.49074	0.309000|0.309000	0.22966|0.22966	-1.874000|-1.874000	0.00550|0.00550	GAG|TGA	.		0.413	MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2		
MTERF1	7978	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91503797	91503797	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:91503797T>A	ENST00000351870.3	-	3	404	c.311A>T	c.(310-312)gAg>gTg	p.E104V	MTERF_ENST00000481516.1_5'Flank|MTERF_ENST00000419292.1_Missense_Mutation_p.E84V|MTERF_ENST00000406735.2_Missense_Mutation_p.E84V	NM_006980.3	NP_008911.1	Q99551	MTEF1_HUMAN		104					DNA geometric change (GO:0032392)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of mitochondrial transcription (GO:0006393)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|skin(1)	14	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			CAGGTCCTGCTCATTGGTAAT	0.418																																					p.E104V		.											.	MTERF	90	0			c.A311T						.						153.0	138.0	143.0					7																	91503797		2203	4300	6503	SO:0001583	missense	7978	exon3			TCCTGCTCATTGG																												ENST00000351870.3:c.311A>T	7.37:g.91503797T>A	ENSP00000248643:p.Glu104Val	92.0	0.0		91.0	35.0	NM_006980	A4D1E3|Q32NF8|Q53H51|Q9BVR7	Missense_Mutation	SNP	ENST00000351870.3	37	CCDS5621.1	.	.	.	.	.	.	.	.	.	.	T	9.736	1.163574	0.21538	.	.	ENSG00000127989	ENST00000419292;ENST00000351870;ENST00000406735;ENST00000456229;ENST00000442961	T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8	4.51	4.51	0.55191	.	0.058358	0.64402	D	0.000003	T	0.24236	0.0587	L	0.54323	1.7	0.42130	D	0.991466	D	0.89917	1.0	D	0.91635	0.999	T	0.05517	-1.0880	10	0.12103	T	0.63	-9.0643	13.4852	0.61361	0.0:0.0:0.0:1.0	.	104	Q99551	MTERF_HUMAN	V	84;104;84;84;104	ENSP00000414116:E84V;ENSP00000248643:E104V;ENSP00000384986:E84V;ENSP00000402175:E84V;ENSP00000395097:E104V	ENSP00000248643:E104V	E	-	2	0	MTERF	91341733	1.000000	0.71417	1.000000	0.80357	0.096000	0.18686	5.062000	0.64326	1.969000	0.57287	0.482000	0.46254	GAG	.		0.418	MTERF-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342896.1		
MTSS1L	92154	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	70698128	70698128	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:70698128G>A	ENST00000338779.6	-	15	1970	c.1696C>T	c.(1696-1698)Cgc>Tgc	p.R566C	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	566					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						GAGGGTGTGCGGCGGATGGTG	0.766																																					p.R566C		.											.	MTSS1L	68	0			c.C1696T						.						13.0	16.0	15.0					16																	70698128		2167	4195	6362	SO:0001583	missense	92154	exon15			GTGTGCGGCGGAT		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1696C>T	16.37:g.70698128G>A	ENSP00000341171:p.Arg566Cys	30.0	0.0		41.0	21.0	NM_138383	A6NJI7|Q9BUA8	Missense_Mutation	SNP	ENST00000338779.6	37	CCDS32476.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385410	0.82792	.	.	ENSG00000132613	ENST00000338779	T	0.53857	0.6	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.73210	0.3558	M	0.77820	2.39	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.78414	-0.2213	10	0.72032	D	0.01	-21.8297	16.5688	0.84606	0.0:0.0:1.0:0.0	.	566	Q765P7	MTSSL_HUMAN	C	566	ENSP00000341171:R566C	ENSP00000341171:R566C	R	-	1	0	MTSS1L	69255629	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.338000	0.72963	1.964000	0.57103	0.462000	0.41574	CGC	.		0.766	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	NM_138383	
MXD1	4084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70165400	70165400	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:70165400C>T	ENST00000264444.2	+	6	910	c.650C>T	c.(649-651)gCg>gTg	p.A217V	MXD1_ENST00000540449.1_Missense_Mutation_p.A207V|MXD1_ENST00000465446.1_3'UTR	NM_001202513.1|NM_001202514.1|NM_002357.3	NP_001189442.1|NP_001189443.1|NP_002348.1	Q05195	MAD1_HUMAN	MAX dimerization protein 1	217					cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						AGTCACAAGGCGTGTCTTGGT	0.552																																					p.A217V		.											.	MXD1	226	0			c.C650T						.						91.0	90.0	90.0					2																	70165400		2203	4300	6503	SO:0001583	missense	4084	exon6			ACAAGGCGTGTCT		CCDS1896.1, CCDS56123.1	2p13-p12	2010-07-07		2005-02-11	ENSG00000059728	ENSG00000059728		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	6761	protein-coding gene	gene with protein product		600021		MAD		7829091	Standard	NM_002357		Approved	MAD1, bHLHc58	uc002sfy.3	Q05195	OTTHUMG00000129646	ENST00000264444.2:c.650C>T	2.37:g.70165400C>T	ENSP00000264444:p.Ala217Val	71.0	0.0		79.0	33.0	NM_002357	B2R6V8|B7ZLI6|D6W5G2|Q6FI41	Missense_Mutation	SNP	ENST00000264444.2	37	CCDS1896.1	.	.	.	.	.	.	.	.	.	.	C	8.024	0.760190	0.15846	.	.	ENSG00000059728	ENST00000264444;ENST00000540449	T;T	0.45668	0.89;0.9	5.75	4.84	0.62591	.	1.595380	0.02791	N	0.122042	T	0.27697	0.0681	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.21759	-1.0236	10	0.18276	T	0.48	.	9.9272	0.41501	0.0:0.8259:0.0:0.1741	.	207;216;217	B7ZLI6;B7ZLI7;Q05195	.;.;MAD1_HUMAN	V	217;207	ENSP00000264444:A217V;ENSP00000443935:A207V	ENSP00000264444:A217V	A	+	2	0	MXD1	70018904	0.004000	0.15560	0.002000	0.10522	0.119000	0.20118	1.215000	0.32431	1.478000	0.48253	0.650000	0.86243	GCG	.		0.552	MXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251845.3	NM_002357	
MYD88	4615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38181897	38181897	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:38181897T>A	ENST00000396334.3	+	3	705	c.521T>A	c.(520-522)tTc>tAc	p.F174Y	MYD88_ENST00000424893.1_Missense_Mutation_p.F129Y|MYD88_ENST00000443433.2_Intron|MYD88_ENST00000417037.2_Missense_Mutation_p.F174Y|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000495303.1_Intron	NM_002468.4	NP_002459.2	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	161	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)			breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CCTGAGCGTTTCGATGCCTTC	0.557			Mis		ABC-DLBCL																																p.F174Y		.		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	.	MYD88	901	0			c.T521A						.						97.0	75.0	82.0					3																	38181897		2203	4300	6503	SO:0001583	missense	4615	exon3			AGCGTTTCGATGC	U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000396334.3:c.521T>A	3.37:g.38181897T>A	ENSP00000379625:p.Phe174Tyr	58.0	0.0		84.0	38.0	NM_002468	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	ENST00000396334.3	37	CCDS2674.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.5|28.5	4.923047|4.923047	0.92319|0.92319	.|.	.|.	ENSG00000172936|ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158|ENST00000421571	T;T;T;T|.	0.12255|.	2.7;2.7;2.7;2.7|.	5.61|5.61	5.61|5.61	0.85477|0.85477	Toll/interleukin-1 receptor homology (TIR) domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.42765|0.42765	0.1217|0.1217	N|N	0.04787|0.04787	-0.16|-0.16	0.80722|0.80722	D|D	1|1	P;P;P|.	0.43909|.	0.821;0.592;0.592|.	P;P;B|.	0.51229|.	0.643;0.663;0.328|.	T|T	0.54390|0.54390	-0.8301|-0.8301	10|6	0.07990|0.87932	T|D	0.79|0	.|.	15.3005|15.3005	0.73945|0.73945	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	116;161;150|.	Q99836-2;Q99836;B4E3D6|.	.;MYD88_HUMAN;.|.	Y|T	174;174;129;173;150|153	ENSP00000401399:F174Y;ENSP00000379625:F174Y;ENSP00000389979:F129Y;ENSP00000391753:F173Y|.	ENSP00000379625:F174Y|ENSP00000409901:S153T	F|S	+|+	2|1	0|0	MYD88|MYD88	38156901|38156901	1.000000|1.000000	0.71417|0.71417	0.229000|0.229000	0.23960|0.23960	0.989000|0.989000	0.77384|0.77384	7.415000|7.415000	0.80131|0.80131	2.281000|2.281000	0.76405|0.76405	0.533000|0.533000	0.62120|0.62120	TTC|TCG	.		0.557	MYD88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253743.4	NM_002468	
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1843065	1843065	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:1843065G>C	ENST00000399161.2	-	21	3683	c.2936C>G	c.(2935-2937)cCc>cGc	p.P979R	MYT1L_ENST00000407844.1_5'UTR|MYT1L_ENST00000428368.2_Missense_Mutation_p.P977R|MYT1L_ENST00000471668.1_5'UTR	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	979					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGCCGCCAAGGGGCACCCGGA	0.657																																					p.P977R		.											.	MYT1L	95	0			c.C2930G						.						46.0	54.0	52.0					2																	1843065		2012	4141	6153	SO:0001583	missense	23040	exon21			GCCAAGGGGCACC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2936C>G	2.37:g.1843065G>C	ENSP00000382114:p.Pro979Arg	63.0	0.0		52.0	31.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	G	29.1	4.978293	0.92982	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000399157;ENST00000428368	T;T	0.66460	-0.19;-0.21	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.86573	0.5965	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88727	0.3234	10	0.87932	D	0	-28.8261	19.9772	0.97314	0.0:0.0:1.0:0.0	.	979;977	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	R	979;925;33;977	ENSP00000382114:P979R;ENSP00000396103:P977R	ENSP00000295067:P925R	P	-	2	0	MYT1L	1822072	1.000000	0.71417	0.942000	0.38095	0.844000	0.47949	9.787000	0.99055	2.724000	0.93272	0.563000	0.77884	CCC	.		0.657	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NCOA1	8648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24881562	24881562	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:24881562G>T	ENST00000406961.1	+	5	668	c.16G>T	c.(16-18)Gac>Tac	p.D6Y	NCOA1_ENST00000405141.1_Missense_Mutation_p.D6Y|NCOA1_ENST00000407230.1_5'UTR|NCOA1_ENST00000288599.5_Missense_Mutation_p.D6Y|NCOA1_ENST00000348332.3_Missense_Mutation_p.D6Y|NCOA1_ENST00000395856.3_Missense_Mutation_p.D6Y|NCOA1_ENST00000538539.1_Missense_Mutation_p.D6Y			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	6					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCCTCGGGGACAGTTCATC	0.453			T	PAX3	alveolar rhadomyosarcoma																																p.D6Y		.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	228	0			c.G16T						.						87.0	74.0	78.0					2																	24881562		2203	4300	6503	SO:0001583	missense	8648	exon3			CTCGGGGACAGTT	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.16G>T	2.37:g.24881562G>T	ENSP00000385216:p.Asp6Tyr	87.0	0.0		75.0	34.0	NM_147223	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	37	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589977	0.86851	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T	0.02236	4.39;4.38;4.38;4.39;4.38;4.39	5.41	5.41	0.78517	.	0.048436	0.85682	D	0.000000	T	0.06781	0.0173	L	0.40543	1.245	0.58432	D	0.999997	D;D;D	0.63880	0.986;0.969;0.993	P;P;P	0.61592	0.814;0.781;0.891	T	0.09314	-1.0680	10	0.72032	D	0.01	-17.6952	13.2849	0.60237	0.0759:0.0:0.9241:0.0	.	6;6;6	Q15788-3;Q15788;Q15788-2	.;NCOA1_HUMAN;.	Y	6	ENSP00000385216:D6Y;ENSP00000385097:D6Y;ENSP00000444039:D6Y;ENSP00000320940:D6Y;ENSP00000288599:D6Y;ENSP00000379197:D6Y	ENSP00000288599:D6Y	D	+	1	0	NCOA1	24735066	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.895000	0.75660	2.826000	0.97356	0.655000	0.94253	GAC	.		0.453	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
NETO1	81832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	70417483	70417483	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr18:70417483G>T	ENST00000327305.6	-	9	2012	c.1355C>A	c.(1354-1356)gCt>gAt	p.A452D	NETO1_ENST00000299430.2_Missense_Mutation_p.A451D|RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000583169.1_Missense_Mutation_p.A452D	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	452					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CAAGATAGAAGCATCTCTTGT	0.483																																					p.A452D		.											.	NETO1	94	0			c.C1355A						.						184.0	165.0	171.0					18																	70417483		2203	4300	6503	SO:0001583	missense	81832	exon9			ATAGAAGCATCTC	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1355C>A	18.37:g.70417483G>T	ENSP00000313088:p.Ala452Asp	170.0	0.0		202.0	117.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	37	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129102	0.56721	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.26373	1.74;1.74	5.76	4.86	0.63082	.	0.000000	0.64402	D	0.000014	T	0.29288	0.0729	L	0.56769	1.78	0.80722	D	1	B;B	0.12630	0.006;0.003	B;B	0.14578	0.011;0.003	T	0.07009	-1.0795	10	0.59425	D	0.04	-21.7302	16.2419	0.82418	0.0:0.0:0.8668:0.1332	.	451;452	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	D	452;451	ENSP00000313088:A452D;ENSP00000299430:A451D	ENSP00000299430:A451D	A	-	2	0	NETO1	68568463	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	6.093000	0.71422	2.725000	0.93324	0.460000	0.39030	GCT	.		0.483	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
NHS	4810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	17745541	17745541	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:17745541T>C	ENST00000380060.3	+	6	3590	c.3252T>C	c.(3250-3252)cgT>cgC	p.R1084R	NHS_ENST00000398097.3_Silent_p.R928R	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	1105					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					TCCACCACCGTCATCCACTGC	0.423																																					p.R1084R		.											.	NHS	197	0			c.T3252C						.						178.0	166.0	170.0					X																	17745541		2203	4300	6503	SO:0001819	synonymous_variant	4810	exon6			CCACCGTCATCCA		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.3252T>C	X.37:g.17745541T>C		143.0	0.0		143.0	75.0	NM_198270	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Silent	SNP	ENST00000380060.3	37	CCDS14181.1																																																																																			.		0.423	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
NOTCH4	4855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32170085	32170085	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:32170085C>A	ENST00000375023.3	-	21	3661	c.3523G>T	c.(3523-3525)Gcc>Tcc	p.A1175S		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1175					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CACCCCTTGGCTCCGGGTTTC	0.652																																					p.A1175S		.											.	NOTCH4	1321	0			c.G3523T						.						22.0	24.0	23.0					6																	32170085		1509	2707	4216	SO:0001583	missense	4855	exon21			CCTTGGCTCCGGG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3523G>T	6.37:g.32170085C>A	ENSP00000364163:p.Ala1175Ser	42.0	0.0		60.0	21.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	7.254	0.603913	0.14002	.	.	ENSG00000204301	ENST00000375023	D	0.91843	-2.92	4.77	3.9	0.45041	Notch domain (3);	0.153666	0.30383	N	0.009745	T	0.76307	0.3969	N	0.17082	0.46	0.09310	N	1	B	0.29955	0.263	P	0.45099	0.469	T	0.69131	-0.5226	10	0.06757	T	0.87	.	7.1342	0.25519	0.0:0.8014:0.0:0.1986	.	1175	Q99466	NOTC4_HUMAN	S	1175	ENSP00000364163:A1175S	ENSP00000364163:A1175S	A	-	1	0	NOTCH4	32278063	0.001000	0.12720	0.013000	0.15412	0.143000	0.21401	0.379000	0.20585	1.229000	0.43630	0.561000	0.74099	GCC	.		0.652	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
NOX1	27035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100104832	100104832	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:100104832G>C	ENST00000372966.3	-	10	1430	c.1225C>G	c.(1225-1227)Ccc>Gcc	p.P409A	NOX1_ENST00000372964.1_Intron|NOX1_ENST00000372960.4_Missense_Mutation_p.P372A|NOX1_ENST00000217885.5_Missense_Mutation_p.P409A	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	409	Interaction with NOXO1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						GAAGCAAAGGGGGTGACCCCA	0.458																																					p.P409A		.											.	NOX1	131	0			c.C1225G						.						93.0	80.0	85.0					X																	100104832		2203	4300	6503	SO:0001583	missense	27035	exon10			CAAAGGGGGTGAC	AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1225C>G	X.37:g.100104832G>C	ENSP00000362057:p.Pro409Ala	241.0	0.0		293.0	163.0	NM_013955	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	ENST00000372966.3	37	CCDS14474.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.16|18.16	3.563168|3.563168	0.65538|0.65538	.|.	.|.	ENSG00000007952|ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960;ENST00000372957|ENST00000427768	D;D;D|.	0.99527|.	-6.09;-2.35;-6.09|.	3.73|3.73	3.73|3.73	0.42828|0.42828	Ferric reductase, NAD binding (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.87026|0.87026	0.6075|0.6075	H|H	0.96889|0.96889	3.9|3.9	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.998;1.0;1.0|.	D|D	0.91391|0.91391	0.5135|0.5135	10|6	0.87932|.	D|.	0|.	.|.	14.0605|14.0605	0.64797|0.64797	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	372;409;409|.	A6NGA6;Q9Y5S8-3;Q9Y5S8|.	.;.;NOX1_HUMAN|.	A|R	409;409;372;98|93	ENSP00000362057:P409A;ENSP00000217885:P409A;ENSP00000362051:P372A|.	ENSP00000217885:P409A|.	P|P	-|-	1|2	0|0	NOX1|NOX1	99991488|99991488	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.971000|0.971000	0.66376|0.66376	6.744000|6.744000	0.74854|0.74854	1.822000|1.822000	0.53115|0.53115	0.600000|0.600000	0.82982|0.82982	CCC|CCC	.		0.458	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1	NM_007052	
NOX3	50508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155774563	155774563	+	Silent	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:155774563G>A	ENST00000159060.2	-	4	417	c.315C>T	c.(313-315)gtC>gtT	p.V105V		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	105	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TCCCATAGGCGACCAGTTTGT	0.368																																					p.V105V		.											.	NOX3	91	0			c.C315T						.						261.0	270.0	267.0					6																	155774563		2203	4300	6503	SO:0001819	synonymous_variant	50508	exon4			ATAGGCGACCAGT	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.315C>T	6.37:g.155774563G>A		174.0	0.0		63.0	57.0	NM_015718	Q9HBJ9	Silent	SNP	ENST00000159060.2	37	CCDS5250.1																																																																																			.		0.368	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
NR0B2	8431	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27240140	27240140	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:27240140G>T	ENST00000254227.3	-	1	317	c.292C>A	c.(292-294)Ctt>Att	p.L98I		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	98	Ligand-binding. {ECO:0000250}.				cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		GCCAACCCAAGCAGGAAGAGG	0.637																																					p.L98I		.											.	NR0B2	186	0			c.C292A						.						16.0	20.0	19.0					1																	27240140		2192	4292	6484	SO:0001583	missense	8431	exon1			ACCCAAGCAGGAA	AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.292C>A	1.37:g.27240140G>T	ENSP00000254227:p.Leu98Ile	55.0	1.0		59.0	38.0	NM_021969	F1D8P5|Q5QP36	Missense_Mutation	SNP	ENST00000254227.3	37	CCDS291.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.789745	0.50102	.	.	ENSG00000131910	ENST00000254227	D	0.97850	-4.57	5.48	3.54	0.40534	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.067623	0.64402	N	0.000011	D	0.97250	0.9101	M	0.80746	2.51	0.53005	D	0.999962	P	0.35628	0.513	B	0.39706	0.307	D	0.95823	0.8851	10	0.62326	D	0.03	-28.6225	14.4706	0.67514	0.0:0.0:0.7091:0.2909	.	98	Q15466	NR0B2_HUMAN	I	98	ENSP00000254227:L98I	ENSP00000254227:L98I	L	-	1	0	NR0B2	27112727	1.000000	0.71417	0.934000	0.37439	0.995000	0.86356	3.731000	0.55013	0.603000	0.29913	0.561000	0.74099	CTT	.		0.637	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012185.1		
NR4A2	4929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	157186238	157186238	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:157186238T>A	ENST00000339562.4	-	3	823	c.461A>T	c.(460-462)cAg>cTg	p.Q154L	NR4A2_ENST00000426264.1_Missense_Mutation_p.Q91L|NR4A2_ENST00000409108.2_Missense_Mutation_p.Q154L|NR4A2_ENST00000539077.1_Missense_Mutation_p.Q165L|NR4A2_ENST00000429376.1_Missense_Mutation_p.Q91L|NR4A2_ENST00000409572.1_Missense_Mutation_p.Q154L	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	154	Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						CACGTAGTTCTGGTGGAAGTT	0.632																																					p.Q154L		.											.	NR4A2	189	0			c.A461T						.						94.0	108.0	103.0					2																	157186238		2203	4300	6503	SO:0001583	missense	4929	exon3			TAGTTCTGGTGGA	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.461A>T	2.37:g.157186238T>A	ENSP00000344479:p.Gln154Leu	75.0	0.0		88.0	39.0	NM_006186	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	T	14.68	2.609046	0.46527	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000429376;ENST00000424077;ENST00000421709	D;D;D;D;D;D;T;D	0.92397	-2.81;-2.86;-2.81;-2.82;-3.03;-2.96;-1.25;-2.45	5.87	5.87	0.94306	.	1.981290	0.01704	N	0.027368	D	0.92067	0.7486	L	0.55481	1.735	0.58432	D	0.999993	B	0.17268	0.021	B	0.20955	0.032	T	0.70890	-0.4749	10	0.62326	D	0.03	.	12.496	0.55929	0.0:0.0:0.1774:0.8226	.	154	P43354	NR4A2_HUMAN	L	154;91;154;165;154;91;154;91	ENSP00000344479:Q154L;ENSP00000389986:Q91L;ENSP00000386747:Q154L;ENSP00000444925:Q165L;ENSP00000386993:Q154L;ENSP00000410952:Q91L;ENSP00000406808:Q154L;ENSP00000388120:Q91L	ENSP00000344479:Q154L	Q	-	2	0	NR4A2	156894484	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.097000	0.71452	2.242000	0.73789	0.533000	0.62120	CAG	.		0.632	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228528927	228528927	+	Silent	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:228528927C>A	ENST00000422127.1	+	73	17873	c.17829C>A	c.(17827-17829)gtC>gtA	p.V5943V	OBSCN_ENST00000284548.11_Silent_p.V5943V|OBSCN_ENST00000366707.4_Silent_p.V3577V|OBSCN_ENST00000570156.2_Silent_p.V6900V|OBSCN_ENST00000366709.4_Silent_p.V3062V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5943	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCGATACCGTCAGCTACGTGT	0.657																																					p.V6900V		.											.	OBSCN	403	0			c.C20700A						.						32.0	35.0	34.0					1																	228528927		2062	4202	6264	SO:0001819	synonymous_variant	84033	exon84			TACCGTCAGCTAC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17829C>A	1.37:g.228528927C>A		38.0	0.0		72.0	17.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.404978	0.25378	.	.	ENSG00000154358	ENST00000441106	.	.	.	5.71	4.79	0.61399	.	.	.	.	.	T	0.60235	0.2253	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58463	-0.7632	4	.	.	.	.	9.4968	0.38993	0.1439:0.7853:0.0:0.0708	.	.	.	.	K	560	.	.	Q	+	1	0	OBSCN	226595550	0.999000	0.42202	1.000000	0.80357	0.058000	0.15608	0.655000	0.24933	1.405000	0.46838	-0.182000	0.12963	CAG	.		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OPN4	94233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	88415951	88415951	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:88415951A>G	ENST00000241891.5	+	2	351	c.184A>G	c.(184-186)Acg>Gcg	p.T62A	OPN4_ENST00000372071.2_Missense_Mutation_p.T62A	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	62					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CCCCCTCCCCACGGTTGATGT	0.567																																					p.T62A		.											.	OPN4	69	0			c.A184G						.						119.0	109.0	112.0					10																	88415951		2203	4300	6503	SO:0001583	missense	94233	exon2			CTCCCCACGGTTG	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.184A>G	10.37:g.88415951A>G	ENSP00000241891:p.Thr62Ala	105.0	0.0		104.0	43.0	NM_033282	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	37	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.470896	0.84533	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.36699	1.24;1.24;1.24	5.46	5.46	0.80206	.	.	.	.	.	T	0.60919	0.2306	M	0.81497	2.545	0.51482	D	0.999928	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.87578	0.917;0.917;0.998	T	0.60777	-0.7196	9	0.28530	T	0.3	.	14.7117	0.69238	1.0:0.0:0.0:0.0	.	62;62;62	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	A	62	ENSP00000361141:T62A;ENSP00000241891:T62A;ENSP00000393132:T62A	ENSP00000241891:T62A	T	+	1	0	OPN4	88405931	1.000000	0.71417	0.965000	0.40720	0.924000	0.55760	8.994000	0.93529	2.083000	0.62718	0.459000	0.35465	ACG	.		0.567	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
OR52R1	119695	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4824853	4824853	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr11:4824853G>T	ENST00000356069.2	-	1	757	c.758C>A	c.(757-759)gCt>gAt	p.A253D	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.A332D	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GATATAAAGAGCCAAGATGAC	0.468																																					p.A253D		.											.	OR52R1	69	0			c.C758A						.						101.0	102.0	102.0					11																	4824853		2201	4298	6499	SO:0001583	missense	119695	exon1			TAAAGAGCCAAGA	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.758C>A	11.37:g.4824853G>T	ENSP00000348368:p.Ala253Asp	50.0	0.0		58.0	13.0	NM_001005177	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	G	14.79	2.642014	0.47153	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00174	8.62;8.62	5.57	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.133360	0.33610	N	0.004722	T	0.00384	0.0012	M	0.79805	2.47	0.09310	N	1	P	0.50369	0.934	P	0.53760	0.734	T	0.37314	-0.9711	10	0.56958	D	0.05	.	8.8168	0.35000	0.2327:0.0:0.7673:0.0	.	253	Q8NGF1	O52R1_HUMAN	D	253;332	ENSP00000348368:A253D;ENSP00000369742:A332D	ENSP00000348368:A253D	A	-	2	0	OR52R1	4781429	0.000000	0.05858	0.200000	0.23457	0.819000	0.46315	0.040000	0.13905	1.593000	0.50029	0.650000	0.86243	GCT	.		0.468	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
OR6C2	341416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55846722	55846722	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:55846722A>T	ENST00000322678.1	+	1	725	c.725A>T	c.(724-726)cAc>cTc	p.H242L	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	242					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						TGTTCATCCCACATGATTGTG	0.408																																					p.H242L		.											.	OR6C2	70	0			c.A725T						.						135.0	129.0	131.0					12																	55846722		2203	4300	6503	SO:0001583	missense	341416	exon1			CATCCCACATGAT	AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.725A>T	12.37:g.55846722A>T	ENSP00000323606:p.His242Leu	175.0	0.0		134.0	47.0	NM_054105		Missense_Mutation	SNP	ENST00000322678.1	37	CCDS31824.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150028	0.78001	.	.	ENSG00000179695	ENST00000322678	T	0.00307	8.17	5.42	4.26	0.50523	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000006	T	0.01421	0.0046	H	0.99464	4.58	0.40357	D	0.979195	D	0.76494	0.999	D	0.85130	0.997	T	0.03587	-1.1022	10	0.87932	D	0	.	11.6003	0.50999	0.8506:0.1494:0.0:0.0	.	242	Q9NZP2	OR6C2_HUMAN	L	242	ENSP00000323606:H242L	ENSP00000323606:H242L	H	+	2	0	OR6C2	54132989	1.000000	0.71417	0.997000	0.53966	0.838000	0.47535	6.487000	0.73633	1.048000	0.40298	0.496000	0.49642	CAC	.		0.408	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406676.1	NM_054105	
OR9A4	130075	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	141618728	141618728	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:141618728G>T	ENST00000548136.1	+	1	112	c.53G>T	c.(52-54)gGc>gTc	p.G18V	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					GGCTTCCCTGGCTCTGAAGAA	0.378																																					p.G18V		.											.	OR9A4	91	0			c.G53T						.						239.0	244.0	242.0					7																	141618728		2132	4271	6403	SO:0001583	missense	130075	exon1			TCCCTGGCTCTGA		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.53G>T	7.37:g.141618728G>T	ENSP00000448789:p.Gly18Val	145.0	1.0		125.0	43.0	NM_001001656	B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	37	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	.	3.667	-0.068286	0.07228	.	.	ENSG00000258083	ENST00000548136	T	0.00433	7.43	3.88	3.88	0.44766	.	.	.	.	.	T	0.00328	0.0010	L	0.41236	1.265	0.54753	D	0.999989	B	0.28900	0.227	B	0.30716	0.119	T	0.75399	-0.3331	9	0.62326	D	0.03	-10.2718	9.0494	0.36367	0.0:0.0:0.7804:0.2196	.	18	Q8NGU2	OR9A4_HUMAN	V	18	ENSP00000448789:G18V	ENSP00000386148:G18V	G	+	2	0	OR9A4	141265197	0.000000	0.05858	0.999000	0.59377	0.060000	0.15804	0.653000	0.24902	2.160000	0.67779	0.643000	0.83706	GGC	.		0.378	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656	
OSBPL7	114881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45890656	45890656	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:45890656T>C	ENST00000007414.3	-	16	1904	c.1713A>G	c.(1711-1713)cgA>cgG	p.R571R	OSBPL7_ENST00000392507.3_Silent_p.R571R	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	571					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						AGCGGAAGCCTCGGTCAGGCC	0.627																																					p.R571R		.											.	OSBPL7	68	0			c.A1713G						.						67.0	63.0	65.0					17																	45890656		2203	4300	6503	SO:0001819	synonymous_variant	114881	exon16			GAAGCCTCGGTCA	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.1713A>G	17.37:g.45890656T>C		26.0	0.0		30.0	13.0	NM_145798	D3DTT6|Q6PIV6	Silent	SNP	ENST00000007414.3	37	CCDS11515.1																																																																																			.		0.627	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
OTOP1	133060	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	4228502	4228502	+	Silent	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:4228502A>T	ENST00000296358.4	-	1	114	c.90T>A	c.(88-90)ccT>ccA	p.P30P		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	30					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGGACGAGGGAGGCGAGCAGG	0.756																																					p.P30P		.											.	OTOP1	92	0			c.T90A						.						2.0	2.0	2.0					4																	4228502		1485	3042	4527	SO:0001819	synonymous_variant	133060	exon1			CGAGGGAGGCGAG	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.90T>A	4.37:g.4228502A>T		8.0	0.0		15.0	11.0	NM_177998	A1L476	Silent	SNP	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.756	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
OXCT1	5019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	41739504	41739504	+	Silent	SNP	C	C	G	rs560172270	byFrequency	TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:41739504C>G	ENST00000196371.5	-	16	1669	c.1509G>C	c.(1507-1509)ggG>ggC	p.G503G	OXCT1_ENST00000510634.1_Silent_p.G106G|OXCT1_ENST00000509987.1_Silent_p.G317G|OXCT1_ENST00000512084.1_Silent_p.G106G	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	503					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	CAAAATCACACCCAGTACTCT	0.423																																					p.G503G		.											.	OXCT1	133	0			c.G1509C						.						143.0	129.0	134.0					5																	41739504		2203	4300	6503	SO:0001819	synonymous_variant	5019	exon16			ATCACACCCAGTA	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1509G>C	5.37:g.41739504C>G		123.0	0.0		128.0	52.0	NM_000436	B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	CCDS3937.1																																																																																			.		0.423	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
P2RX6	9127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	21369505	21369505	+	Silent	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr22:21369505A>T	ENST00000413302.2	+	1	190	c.42A>T	c.(40-42)ccA>ccT	p.P14P	TUBA3FP_ENST00000422086.1_RNA|P2RX6_ENST00000401443.1_Silent_p.P14P|P2RX6_ENST00000591411.1_Intron|P2RX6_ENST00000443995.3_De_novo_Start_OutOfFrame|P2RX6_ENST00000402329.3_Silent_p.P4P|P2RX6_ENST00000336296.2_Silent_p.P4P			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6	14					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										TGGGCTCCCCAGGGGCTACGA	0.632																																					p.P14P		.											.	.	.	0			c.A42T						.						46.0	56.0	53.0					22																	21369505		2203	4300	6503	SO:0001819	synonymous_variant	9127	exon1			CTCCCCAGGGGCT		CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689	ENST00000413302.2:c.42A>T	22.37:g.21369505A>T		35.0	0.0		40.0	18.0	NM_001159554	F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	Silent	SNP	ENST00000413302.2	37	CCDS13788.2																																																																																			.		0.632	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319625.2	NM_005446	
PAK4	10298	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	39664257	39664257	+	Silent	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:39664257G>T	ENST00000593690.1	+	6	1132	c.705G>T	c.(703-705)ggG>ggT	p.G235G	PAK4_ENST00000358301.3_Silent_p.G235G|PAK4_ENST00000599386.1_Silent_p.G82G|PAK4_ENST00000599470.1_Silent_p.G82G|PAK4_ENST00000435673.2_Silent_p.G235G|PAK4_ENST00000360442.3_Silent_p.G235G|PAK4_ENST00000321944.4_Silent_p.G145G	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	235	Linker.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			CATCAGCGGGGGGCCTGGCCA	0.687																																					p.G235G		.											.	PAK4	957	0			c.G705T						.						11.0	14.0	13.0					19																	39664257		2125	4190	6315	SO:0001819	synonymous_variant	10298	exon4			AGCGGGGGGCCTG	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.705G>T	19.37:g.39664257G>T		24.0	0.0		28.0	17.0	NM_001014832	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Silent	SNP	ENST00000593690.1	37	CCDS12528.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.444567	0.01089	.	.	ENSG00000130669	ENST00000542377	.	.	.	4.27	-0.766	0.11020	.	0.988715	0.08243	N	0.975814	T	0.42653	0.1212	.	.	.	0.33285	D	0.56281	.	.	.	.	.	.	T	0.56189	-0.8020	6	0.66056	D	0.02	.	2.581	0.04818	0.25:0.0:0.3491:0.4009	.	.	.	.	V	11	.	ENSP00000443258:G11V	G	+	2	0	PAK4	44356097	0.000000	0.05858	0.062000	0.19696	0.007000	0.05969	-0.008000	0.12788	0.066000	0.16515	-0.268000	0.10319	GGG	.		0.687	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463823.1		
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140209357	140209357	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:140209357A>T	ENST00000529310.1	+	1	1795	c.1681A>T	c.(1681-1683)Aac>Tac	p.N561Y	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	561	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAGAACGACAACGCGCCGGC	0.687																																					p.N561Y		.											.	PCDHA6	92	0			c.A1681T						.						70.0	76.0	74.0					5																	140209357		2202	4298	6500	SO:0001583	missense	56142	exon1			AACGACAACGCGC	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1681A>T	5.37:g.140209357A>T	ENSP00000433378:p.Asn561Tyr	51.0	0.0		56.0	26.0	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.031176	0.35797	.	.	ENSG00000081842	ENST00000529310	T	0.53423	0.62	3.83	2.61	0.31194	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.39687	U	0.001288	T	0.75376	0.3841	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.99;0.996	T	0.79531	-0.1765	10	0.87932	D	0	.	10.3547	0.43956	0.8344:0.1656:0.0:0.0	.	561;561	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	Y	561	ENSP00000433378:N561Y	ENSP00000433378:N561Y	N	+	1	0	PCDHA6	140189541	1.000000	0.71417	1.000000	0.80357	0.133000	0.20885	2.455000	0.44988	0.605000	0.29947	0.254000	0.18369	AAC	.		0.687	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHB6	56130	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140531345	140531345	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:140531345T>A	ENST00000231136.1	+	1	1507	c.1507T>A	c.(1507-1509)Tcc>Acc	p.S503T	PCDHB6_ENST00000543635.1_Missense_Mutation_p.S367T	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCCCTGGTCTCCATCAACGC	0.662																																					p.S503T		.											.	PCDHB6	91	0			c.T1507A						.						78.0	84.0	82.0					5																	140531345		2202	4297	6499	SO:0001583	missense	56130	exon1			CTGGTCTCCATCA	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.1507T>A	5.37:g.140531345T>A	ENSP00000231136:p.Ser503Thr	36.0	0.0		42.0	14.0	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.149925	0.57151	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	T;T	0.50001	0.76;0.76	4.07	4.07	0.47477	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.64494	0.2603	L	0.58810	1.83	0.31071	N	0.713014	D	0.89917	1.0	D	0.91635	0.999	T	0.67703	-0.5602	9	0.87932	D	0	.	13.4001	0.60879	0.0:0.0:0.0:1.0	.	503	Q9Y5E3	PCDB6_HUMAN	T	367;503;288	ENSP00000438466:S367T;ENSP00000231136:S503T	ENSP00000231136:S503T	S	+	1	0	PCDHB6	140511529	0.000000	0.05858	0.971000	0.41717	0.527000	0.34593	0.418000	0.21230	1.617000	0.50277	0.454000	0.30748	TCC	.		0.662	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PDE6A	5145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	149314265	149314265	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:149314265T>C	ENST00000255266.5	-	2	610	c.491A>G	c.(490-492)gAc>gGc	p.D164G		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	164	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GTCCACAAAGTCACAGAAATG	0.473																																					p.D164G		.											.	PDE6A	92	0			c.A491G						.						112.0	97.0	102.0					5																	149314265		2203	4300	6503	SO:0001583	missense	5145	exon2			ACAAAGTCACAGA		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.491A>G	5.37:g.149314265T>C	ENSP00000255266:p.Asp164Gly	66.0	0.0		68.0	30.0	NM_000440	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268470	0.40095	.	.	ENSG00000132915	ENST00000255266	T	0.67171	-0.25	5.99	5.99	0.97316	GAF (2);	0.109283	0.64402	D	0.000012	T	0.60431	0.2268	L	0.43757	1.38	0.38794	D	0.955057	B	0.14012	0.009	B	0.23852	0.049	T	0.57458	-0.7808	10	0.27785	T	0.31	.	14.4463	0.67352	0.0:0.0:0.0:1.0	.	164	P16499	PDE6A_HUMAN	G	164	ENSP00000255266:D164G	ENSP00000255266:D164G	D	-	2	0	PDE6A	149294458	0.946000	0.32159	1.000000	0.80357	0.970000	0.65996	0.982000	0.29539	2.291000	0.77112	0.533000	0.62120	GAC	.		0.473	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
PHF20	51230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34451299	34451299	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr20:34451299G>A	ENST00000374012.3	+	6	914	c.785G>A	c.(784-786)aGa>aAa	p.R262K	PHF20_ENST00000481202.1_3'UTR|PHF20_ENST00000439301.1_Silent_p.Q240Q			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	262					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AAACGAGGCAGACCCCCTTCC	0.448																																					p.R262K		.											.	PHF20	515	0			c.G785A						.						102.0	112.0	108.0					20																	34451299		2201	4299	6500	SO:0001583	missense	51230	exon6			GAGGCAGACCCCC	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.785G>A	20.37:g.34451299G>A	ENSP00000363124:p.Arg262Lys	76.0	0.0		78.0	31.0	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	G	32	5.179483	0.94846	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	T;T;T	0.63744	0.88;-0.06;-0.05	5.83	5.83	0.93111	AT hook, DNA-binding motif (1);	0.312796	0.34853	N	0.003622	T	0.70168	0.3193	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.87578	0.994;0.992;0.998	T	0.62807	-0.6776	10	0.18276	T	0.48	.	20.1218	0.97964	0.0:0.0:1.0:0.0	.	262;262;262	Q566Q2;Q9BVI0;Q66K49	.;PHF20_HUMAN;.	K	262	ENSP00000363124:R262K;ENSP00000341900:R262K;ENSP00000363112:R262K	ENSP00000341900:R262K	R	+	2	0	PHF20	33914713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.763000	0.94921	0.561000	0.74099	AGA	.		0.448	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
PI3	5266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43804641	43804641	+	Silent	SNP	T	T	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr20:43804641T>G	ENST00000243924.3	+	2	266	c.219T>G	c.(217-219)ccT>ccG	p.P73P		NM_002638.3	NP_002629.1	P19957	ELAF_HUMAN	peptidase inhibitor 3, skin-derived	73	WAP. {ECO:0000255|PROSITE- ProRule:PRU00722}.				copulation (GO:0007620)|negative regulation of endopeptidase activity (GO:0010951)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(1)|lung(5)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				CCACTAAGCCTGGCTCCTGCC	0.483																																					p.P73P		.											.	PI3	514	0			c.T219G						.						133.0	115.0	121.0					20																	43804641		2203	4300	6503	SO:0001819	synonymous_variant	5266	exon2			TAAGCCTGGCTCC	D13156	CCDS13344.1	20q13.12	2013-01-21	2008-10-03		ENSG00000124102	ENSG00000124102		"""WAP four-disulfide core domain containing"""	8947	protein-coding gene	gene with protein product	"""skin-derived antileukoproteinase"", ""trappin-2"""	182257	"""protease inhibitor 3, skin-derived (SKALP)"""			8287685, 12206714	Standard	NM_002638		Approved	ESI, SKALP, ELAFIN, WAP3, WFDC14, cementoin	uc002xng.3	P19957	OTTHUMG00000032567	ENST00000243924.3:c.219T>G	20.37:g.43804641T>G		69.0	0.0		89.0	48.0	NM_002638	E1P618|Q6FG74	Silent	SNP	ENST00000243924.3	37	CCDS13344.1																																																																																			.		0.483	PI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079418.3	NM_002638	
GSAP	54103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	76982269	76982269	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:76982269A>C	ENST00000257626.7	-	18	1561	c.1483T>G	c.(1483-1485)Tgg>Ggg	p.W495G		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	495					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										ACTGTATTCCAAGTGAGCACT	0.393																																					p.W495G		.											.	PION	514	0			c.T1483G						.						217.0	184.0	195.0					7																	76982269		2203	4300	6503	SO:0001583	missense	54103	exon18			TATTCCAAGTGAG		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1483T>G	7.37:g.76982269A>C	ENSP00000257626:p.Trp495Gly	113.0	0.0		92.0	41.0	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	CCDS34672.2	.	.	.	.	.	.	.	.	.	.	A	18.39	3.614033	0.66672	.	.	ENSG00000186088	ENST00000257626	T	0.18338	2.22	6.06	6.06	0.98353	.	0.187170	0.36234	U	0.002708	T	0.40322	0.1112	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.983;0.998	T	0.10613	-1.0622	10	0.46703	T	0.11	.	14.1235	0.65205	1.0:0.0:0.0:0.0	.	495;495	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	G	495	ENSP00000257626:W495G	ENSP00000257626:W495G	W	-	1	0	PION	76820205	0.998000	0.40836	0.946000	0.38457	0.997000	0.91878	5.176000	0.65026	2.319000	0.78375	0.533000	0.62120	TGG	.		0.393	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
PIP4K2A	5305	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	22829005	22829005	+	Splice_Site	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:22829005T>A	ENST00000376573.4	-	9	1265		c.e9-2		PIP4K2A_ENST00000323883.7_Splice_Site|PIP4K2A_ENST00000545335.1_Splice_Site	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha						megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						TAGGCGAGTCTGCAGAGACAG	0.502																																					.		.											.	PIP4K2A	665	0			c.1037-2A>T						.						112.0	103.0	106.0					10																	22829005		2203	4300	6503	SO:0001630	splice_region_variant	5305	exon10			CGAGTCTGCAGAG	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.1037-2A>T	10.37:g.22829005T>A		36.0	0.0		46.0	22.0	NM_005028	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Splice_Site	SNP	ENST00000376573.4	37	CCDS7141.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.027360	0.35797	.	.	ENSG00000150867	ENST00000376573;ENST00000323883;ENST00000545335	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3351	0.83056	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PIP4K2A	22869011	1.000000	0.71417	0.995000	0.50966	0.118000	0.20060	7.443000	0.80521	2.262000	0.75019	0.528000	0.53228	.	.		0.502	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047193.1	NM_005028	Intron
PLB1	151056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	28824137	28824137	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:28824137G>A	ENST00000327757.5	+	37	2589	c.2545G>A	c.(2545-2547)Gac>Aac	p.D849N	PLB1_ENST00000422425.2_Missense_Mutation_p.D838N|PLB1_ENST00000541605.1_5'Flank	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	849	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TTTCCATGAAGACTGGAAGGT	0.448																																					p.D849N		.											.	PLB1	141	0			c.G2545A						.						121.0	117.0	119.0					2																	28824137		2203	4300	6503	SO:0001583	missense	151056	exon37			CATGAAGACTGGA		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2545G>A	2.37:g.28824137G>A	ENSP00000330442:p.Asp849Asn	79.0	0.0		78.0	37.0	NM_153021	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983258	0.53827	.	.	ENSG00000163803	ENST00000327757;ENST00000422425	T;T	0.14144	2.53;2.53	5.85	3.98	0.46160	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);	0.171126	0.41294	D	0.000913	T	0.44180	0.1281	M	0.88775	2.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.54200	-0.8329	10	0.66056	D	0.02	-21.6499	15.2965	0.73913	0.0:0.2661:0.7339:0.0	.	838;849	Q6P1J6-3;Q6P1J6	.;PLB1_HUMAN	N	849;838	ENSP00000330442:D849N;ENSP00000416440:D838N	ENSP00000330442:D849N	D	+	1	0	PLB1	28677641	1.000000	0.71417	0.714000	0.30535	0.391000	0.30476	3.259000	0.51515	0.749000	0.32854	0.561000	0.74099	GAC	.		0.448	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
PLCB1	23236	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	8608977	8608977	+	Missense_Mutation	SNP	A	A	T	rs199888561		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr20:8608977A>T	ENST00000338037.6	+	4	310	c.283A>T	c.(283-285)Atc>Ttc	p.I95F	PLCB1_ENST00000378641.3_Missense_Mutation_p.I95F|PLCB1_ENST00000378637.2_Missense_Mutation_p.I95F	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	95					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TGTGGGGAACATCGGGCGCCT	0.448																																					p.P95S		.											.	PLCB1	297	0			c.C283T						.						98.0	95.0	96.0					20																	8608977		2203	4300	6503	SO:0001583	missense	23236	exon4			GGGAACATCGGGC	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.283A>T	20.37:g.8608977A>T	ENSP00000338185:p.Ile95Phe	83.0	1.0		120.0	59.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.856688	0.51376	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000404098;ENST00000441163;ENST00000535719	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	6.17	6.17	0.99709	.	0.406008	0.27549	N	0.018861	T	0.19967	0.0480	N	0.02011	-0.69	0.38990	D	0.959139	B;B;B	0.18461	0.0;0.001;0.028	B;B;B	0.16722	0.002;0.002;0.016	T	0.12837	-1.0532	10	0.62326	D	0.03	.	10.9624	0.47393	0.8604:0.0:0.0:0.1396	.	95;95;94	Q9NQ66;Q9NQ66-2;B1AK73	PLCB1_HUMAN;.;.	F	95;95;95;94;15;15	ENSP00000367908:I95F;ENSP00000338185:I95F;ENSP00000367904:I95F;ENSP00000384001:I94F	ENSP00000338185:I95F	I	+	1	0	PLCB1	8556977	1.000000	0.71417	0.999000	0.59377	0.862000	0.49288	1.559000	0.36320	2.371000	0.80710	0.533000	0.62120	ATC	A|0.999;G|0.001		0.448	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
PLEKHG4	25894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67320230	67320230	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:67320230T>C	ENST00000360461.5	+	14	5031	c.2496T>C	c.(2494-2496)gaT>gaC	p.D832D	PLEKHG4_ENST00000450733.1_Silent_p.D751D|PLEKHG4_ENST00000379344.3_Silent_p.D832D|PLEKHG4_ENST00000427155.2_Silent_p.D832D	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	832	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CTCGCTCCGATGCCCTGATGT	0.567																																					p.D832D		.											.	PLEKHG4	92	0			c.T2496C						.						158.0	120.0	133.0					16																	67320230		2198	4300	6498	SO:0001819	synonymous_variant	25894	exon15			CTCCGATGCCCTG	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2496T>C	16.37:g.67320230T>C		45.0	0.0		63.0	27.0	NM_001129728	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Silent	SNP	ENST00000360461.5	37	CCDS32466.1																																																																																			.		0.567	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
PMP22	5376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	15162456	15162456	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:15162456A>G	ENST00000395938.2	-	3	327	c.133T>C	c.(133-135)Tct>Cct	p.S45P	PMP22_ENST00000426385.3_Missense_Mutation_p.S45P|RP11-849N15.1_ENST00000579159.1_RNA|PMP22_ENST00000312280.3_Missense_Mutation_p.S45P|PMP22_ENST00000395936.1_Missense_Mutation_p.S45P|PMP22_ENST00000494511.1_Intron	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	45					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		CCTGAGGAAGAGGTGCTACAG	0.507																																					p.S45P		.											.	PMP22	90	0			c.T133C						.						223.0	169.0	187.0					17																	15162456		2203	4300	6503	SO:0001583	missense	5376	exon2			AGGAAGAGGTGCT	D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.133T>C	17.37:g.15162456A>G	ENSP00000379269:p.Ser45Pro	74.0	0.0		51.0	46.0	NM_153322	Q8WV01	Missense_Mutation	SNP	ENST00000395938.2	37	CCDS11168.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.714517	0.30413	.	.	ENSG00000109099	ENST00000395938;ENST00000312280;ENST00000426385;ENST00000395936	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	4.75	1.34	0.21922	.	1.156650	0.06258	N	0.693442	D	0.82545	0.5060	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.67868	-0.5559	10	0.54805	T	0.06	-6.3579	2.8351	0.05512	0.6142:0.0:0.1993:0.1865	.	45	Q01453	PMP22_HUMAN	P	45	ENSP00000379269:S45P;ENSP00000308937:S45P;ENSP00000409824:S45P;ENSP00000379268:S45P	ENSP00000308937:S45P	S	-	1	0	PMP22	15103181	0.001000	0.12720	0.002000	0.10522	0.550000	0.35303	0.756000	0.26419	0.391000	0.25143	0.460000	0.39030	TCT	.		0.507	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130378.1	NM_000304	
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121264699	121264699	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:121264699T>A	ENST00000264233.5	-	1	154	c.26A>T	c.(25-27)aAa>aTa	p.K9I		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	9					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		ACGCCGCCGTTTCCCACTCCG	0.642								DNA polymerases (catalytic subunits)																													p.K9I	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ	664	0			c.A26T						.						31.0	31.0	31.0					3																	121264699		2203	4300	6503	SO:0001583	missense	10721	exon1			CGCCGTTTCCCAC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.26A>T	3.37:g.121264699T>A	ENSP00000264233:p.Lys9Ile	37.0	0.0		40.0	15.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	T	19.54	3.847607	0.71603	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	T	0.54071	0.59	5.16	5.16	0.70880	.	0.180887	0.38217	N	0.001769	T	0.51719	0.1691	L	0.27053	0.805	0.30114	N	0.806267	D	0.63880	0.993	P	0.57371	0.819	T	0.55392	-0.8148	10	0.72032	D	0.01	.	8.9585	0.35832	0.0:0.0837:0.0:0.9163	.	9	O75417	DPOLQ_HUMAN	I	9;144	ENSP00000264233:K9I	ENSP00000264233:K9I	K	-	2	0	POLQ	122747389	0.998000	0.40836	0.999000	0.59377	0.992000	0.81027	2.542000	0.45744	2.291000	0.77112	0.533000	0.62120	AAA	.		0.642	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
POU3F4	5456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	82764109	82764109	+	Silent	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:82764109G>T	ENST00000373200.2	+	1	841	c.777G>T	c.(775-777)gcG>gcT	p.A259A	RP3-326L13.2_ENST00000607095.1_RNA|RP3-326L13.3_ENST00000607789.1_lincRNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	259	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						TGGAGGAGGCGGATTCGTCCA	0.577																																					p.A259A		.											.	POU3F4	131	0			c.G777T						.						42.0	37.0	39.0					X																	82764109		2203	4300	6503	SO:0001819	synonymous_variant	5456	exon1			GGAGGCGGATTCG	X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.777G>T	X.37:g.82764109G>T		114.0	0.0		127.0	54.0	NM_000307	B2RC71|Q5H9G9|Q99410	Silent	SNP	ENST00000373200.2	37	CCDS14450.1																																																																																			.		0.577	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
PTK2B	2185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	27315905	27315905	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:27315905A>T	ENST00000397501.1	+	36	3717	c.2909A>T	c.(2908-2910)gAg>gTg	p.E970V	PTK2B_ENST00000346049.5_Missense_Mutation_p.E970V|PTK2B_ENST00000420218.2_Missense_Mutation_p.E928V|PTK2B_ENST00000338238.4_Missense_Mutation_p.E928V|PTK2B_ENST00000517339.1_Missense_Mutation_p.E928V|PTK2B_ENST00000544172.1_Missense_Mutation_p.E970V	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	970	Focal adhesion targeting (FAT).|Interaction with TGFB1I1. {ECO:0000250}.		E -> K (in dbSNP:rs56263944). {ECO:0000269|PubMed:17344846}.		activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	TCCCTAAGTGAGGAGTGCAAG	0.582																																					p.E970V		.											.	PTK2B	1378	0			c.A2909T						.						85.0	57.0	67.0					8																	27315905		2203	4300	6503	SO:0001583	missense	2185	exon36			TAAGTGAGGAGTG	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.2909A>T	8.37:g.27315905A>T	ENSP00000380638:p.Glu970Val	43.0	0.0		16.0	15.0	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	37	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.398527	0.83120	.	.	ENSG00000120899	ENST00000397501;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339	T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39	4.91	4.91	0.64330	Focal adhesion kinase, targeting (FAT) domain (3);	0.050900	0.85682	D	0.000000	T	0.52092	0.1713	L	0.60455	1.87	0.80722	D	1	D;D	0.65815	0.995;0.988	P;D	0.63113	0.843;0.911	T	0.53989	-0.8360	10	0.59425	D	0.04	.	12.5376	0.56150	1.0:0.0:0.0:0.0	.	928;970	Q14289-2;Q14289	.;FAK2_HUMAN	V	970;928;970;970;928;928	ENSP00000380638:E970V;ENSP00000342242:E928V;ENSP00000440926:E970V;ENSP00000332816:E970V;ENSP00000391995:E928V;ENSP00000427931:E928V	ENSP00000342242:E928V	E	+	2	0	PTK2B	27371822	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.242000	0.58714	2.048000	0.60808	0.460000	0.39030	GAG	.		0.582	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
RAB18	22931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27793366	27793366	+	Splice_Site	SNP	G	G	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:27793366G>C	ENST00000356940.6	+	1	170	c.68G>C	c.(67-69)aGc>aCc	p.S23T	RAB18_ENST00000535776.1_Splice_Site_p.S23T|RAB18_ENST00000465772.1_3'UTR|RAB18_ENST00000375802.3_Splice_Site_p.S23T	NM_001256410.1|NM_001256415.1|NM_021252.4	NP_001243339.1|NP_001243344.1|NP_067075.1	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family	23					brain development (GO:0007420)|endoplasmic reticulum tubular network organization (GO:0071786)|eye development (GO:0001654)|GTP catabolic process (GO:0006184)|lipid particle organization (GO:0034389)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(1)|lung(1)	3						GGCAAGTCCAGGTGAGGCGGA	0.667																																					p.S23T		.											.	RAB18	227	0			c.G68C						.						78.0	74.0	75.0					10																	27793366		2184	4274	6458	SO:0001630	splice_region_variant	22931	exon1			AGTCCAGGTGAGG	AJ277145	CCDS7155.1, CCDS58073.1, CCDS73080.1, CCDS73081.1	10p12	2011-03-07			ENSG00000099246	ENSG00000099246		"""RAB, member RAS oncogene"""	14244	protein-coding gene	gene with protein product		602207				10648831	Standard	NM_021252		Approved		uc001itw.4	Q9NP72	OTTHUMG00000017861	ENST00000356940.6:c.68+1G>C	10.37:g.27793366G>C		44.0	0.0		55.0	31.0	NM_001256411	B3KMC7|B7Z333|D3DRW1|Q53FX8|Q56UN9|Q6FIH1	Missense_Mutation	SNP	ENST00000356940.6	37	CCDS7155.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847570	0.91277	.	.	ENSG00000099246	ENST00000356940;ENST00000535776;ENST00000540268;ENST00000375802	T;T;T	0.79247	-0.06;-1.25;-0.06	5.54	4.63	0.57726	RNA polymerase sigma factor 54, interaction (1);Small GTP-binding protein domain (1);	.	.	.	.	D	0.88362	0.6416	M	0.83012	2.62	0.43283	D	0.995251	D;D;D;D	0.76494	0.987;0.998;0.998;0.999	P;D;D;D	0.78314	0.9;0.944;0.991;0.965	D	0.89814	0.3984	9	0.62326	D	0.03	.	15.1112	0.72359	0.0:0.1423:0.8577:0.0	.	23;23;23;23	B7Z333;B7Z4P9;Q56UN9;Q9NP72	.;.;.;RAB18_HUMAN	T	23	ENSP00000349415:S23T;ENSP00000439321:S23T;ENSP00000364960:S23T	ENSP00000349415:S23T	S	+	2	0	RAB18	27833372	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.959000	0.76031	1.328000	0.45358	0.561000	0.74099	AGC	.		0.667	RAB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047326.2	NM_021252	Missense_Mutation
RAPGEF5	9771	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	22259519	22259519	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:22259519T>A	ENST00000405243.1	-	9	1045	c.962A>T	c.(961-963)cAg>cTg	p.Q321L	RAPGEF5_ENST00000344041.6_Missense_Mutation_p.Q168L|RAPGEF5_ENST00000475788.1_5'UTR			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	0					nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						TTTGTCCGTCTGCAAAAACTG	0.448																																					p.Q168L		.											.	RAPGEF5	206	0			c.A503T						.						131.0	123.0	125.0					7																	22259519		1840	4094	5934	SO:0001583	missense	9771	exon9			TCCGTCTGCAAAA	D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000405243.1:c.962A>T	7.37:g.22259519T>A	ENSP00000384870:p.Gln321Leu	161.0	0.0		153.0	76.0	NM_012294	A4D140|Q8IXU5	Missense_Mutation	SNP	ENST00000405243.1	37		.	.	.	.	.	.	.	.	.	.	T	15.18	2.756724	0.49362	.	.	ENSG00000136237	ENST00000344041;ENST00000420196;ENST00000405243	D;D;D	0.86030	-2.06;-2.06;-2.06	5.69	5.69	0.88448	.	1.329770	0.04923	N	0.455320	T	0.81969	0.4935	L	0.44542	1.39	0.44000	D	0.996702	B	0.31680	0.335	B	0.25140	0.058	T	0.65434	-0.6169	10	0.42905	T	0.14	.	11.8726	0.52529	0.0:0.0:0.1457:0.8543	.	168	A8MQ07	.	L	168;49;321	ENSP00000343656:Q168L;ENSP00000395729:Q49L;ENSP00000384870:Q321L	ENSP00000343656:Q168L	Q	-	2	0	RAPGEF5	22226044	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	3.068000	0.50018	2.173000	0.68751	0.459000	0.35465	CAG	.		0.448	RAPGEF5-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000326591.1	NM_012294	
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	109693862	109693862	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:109693862A>G	ENST00000465301.2	+	3	263	c.17A>G	c.(16-18)cAt>cGt	p.H6R	RGAG1_ENST00000540313.1_Missense_Mutation_p.H6R	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	6										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATACCCTTACATTCACTGCGA	0.453											OREG0019909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H6R		.											.	RGAG1	132	0			c.A17G						.						155.0	146.0	149.0					X																	109693862		2203	4300	6503	SO:0001583	missense	57529	exon3			CCTTACATTCACT	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.17A>G	X.37:g.109693862A>G	ENSP00000419786:p.His6Arg	61.0	0.0	1421	65.0	29.0	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	A	0.390	-0.923925	0.02377	.	.	ENSG00000243978	ENST00000520821;ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.60424	0.19;0.19	4.16	1.77	0.24775	.	0.899723	0.09155	N	0.841030	T	0.38746	0.1052	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.14578	0.011	T	0.24621	-1.0155	9	.	.	.	0.8516	5.1088	0.14798	0.7527:0.0:0.2473:0.0	.	6	Q8NET4	RGAG1_HUMAN	R	6	ENSP00000419786:H6R;ENSP00000441452:H6R	.	H	+	2	0	RGAG1	109580518	0.028000	0.19301	0.074000	0.20217	0.023000	0.10783	0.069000	0.14552	0.245000	0.21373	-0.314000	0.08810	CAT	.		0.453	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
RHBDL3	162494	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	30621329	30621329	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:30621329A>G	ENST00000269051.4	+	5	550	c.536A>G	c.(535-537)tAc>tGc	p.Y179C	RHBDL3_ENST00000538145.1_Missense_Mutation_p.Y171C|RHBDL3_ENST00000536287.1_Missense_Mutation_p.Y81C	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	179						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				TTTTTCCTCTACAATGGGGTG	0.502																																					p.Y179C		.											.	RHBDL3	91	0			c.A536G						.						226.0	185.0	199.0					17																	30621329		2203	4300	6503	SO:0001583	missense	162494	exon5			TCCTCTACAATGG	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.536A>G	17.37:g.30621329A>G	ENSP00000269051:p.Tyr179Cys	112.0	0.0		118.0	55.0	NM_138328	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	ENST00000269051.4	37	CCDS32613.1	.	.	.	.	.	.	.	.	.	.	A	14.56	2.571743	0.45798	.	.	ENSG00000141314	ENST00000431505;ENST00000269051;ENST00000538145;ENST00000536287	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.26846	0.0657	L	0.44542	1.39	0.80722	D	1	D;B;B	0.89917	1.0;0.022;0.022	D;B;B	0.87578	0.998;0.008;0.008	T	0.00382	-1.1775	10	0.37606	T	0.19	-18.623	16.8222	0.85835	1.0:0.0:0.0:0.0	.	179;171;179	E9PD28;Q495Y5;P58872	.;.;RHBL3_HUMAN	C	179;179;171;81	ENSP00000394849:Y179C;ENSP00000269051:Y179C;ENSP00000442092:Y171C;ENSP00000466508:Y81C	ENSP00000269051:Y179C	Y	+	2	0	RHBDL3	27645442	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.161000	0.77505	2.371000	0.80710	0.533000	0.62120	TAC	.		0.502	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1	NM_138328	
RIMS1	22999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	73102430	73102430	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:73102430T>A	ENST00000521978.1	+	31	4536	c.4536T>A	c.(4534-4536)gcT>gcA	p.A1512A	RIMS1_ENST00000264839.7_Silent_p.A1361A|RIMS1_ENST00000523963.1_Silent_p.A637A|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000517960.1_Silent_p.A1295A|RIMS1_ENST00000538414.1_Silent_p.A318A|RIMS1_ENST00000491071.2_Silent_p.A1335A|RIMS1_ENST00000348717.5_Silent_p.A1295A|RIMS1_ENST00000518273.1_Silent_p.A1191A|RIMS1_ENST00000517827.1_Silent_p.A646A|RIMS1_ENST00000520567.1_Silent_p.A1162A|RIMS1_ENST00000401910.3_Silent_p.A832A|RIMS1_ENST00000522291.1_Silent_p.A1111A|RIMS1_ENST00000414192.2_Silent_p.A39A|RIMS1_ENST00000425662.2_Silent_p.A580A	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1512					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GACTGGGAGCTGACAGTCAAT	0.413																																					p.A1512A		.											.	RIMS1	144	0			c.T4536A						.						97.0	91.0	93.0					6																	73102430		1854	4104	5958	SO:0001819	synonymous_variant	22999	exon31			GGGAGCTGACAGT	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4536T>A	6.37:g.73102430T>A		126.0	0.0		72.0	64.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.08|12.08	1.832091|1.832091	0.32421|0.32421	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000517433	.|.	.|.	.|.	5.5|5.5	-11.0|-11.0	0.00169|0.00169	.|.	.|.	.|.	.|.	.|.	T|.	0.16896|.	0.0406|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41466|.	-0.9507|.	4|.	.|.	.|.	.|.	-9.6235|-9.6235	3.0007|3.0007	0.06012|0.06012	0.1311:0.1159:0.4052:0.3478|0.1311:0.1159:0.4052:0.3478	.|.	.|.	.|.	.|.	Q|R	430|858	.|.	.|.	L|X	+|+	2|1	0|0	RIMS1|RIMS1	73159151|73159151	0.734000|0.734000	0.28142|0.28142	0.660000|0.660000	0.29694|0.29694	0.990000|0.990000	0.78478|0.78478	-0.127000|-0.127000	0.10547|0.10547	-2.107000|-2.107000	0.00840|0.00840	-0.353000|-0.353000	0.07706|0.07706	CTG|TGA	.		0.413	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
RNF40	9810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30779293	30779293	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:30779293G>A	ENST00000324685.6	+	12	1943	c.1508G>A	c.(1507-1509)cGa>cAa	p.R503Q	RNF40_ENST00000563683.1_Missense_Mutation_p.R463Q|RNF40_ENST00000357890.5_Missense_Mutation_p.R403Q|RNF40_ENST00000402121.3_Missense_Mutation_p.R195Q	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	503					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GACGCCCAGCGATACAAGCGG	0.527																																					p.R503Q		.											.	RNF40	226	0			c.G1508A						.						105.0	104.0	104.0					16																	30779293		2197	4300	6497	SO:0001583	missense	9810	exon12			CCCAGCGATACAA	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1508G>A	16.37:g.30779293G>A	ENSP00000325677:p.Arg503Gln	51.0	0.0		49.0	17.0	NM_014771	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	37	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	G	33	5.242085	0.95272	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.38077	1.16;1.16;1.16	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.65059	0.2655	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.72338	0.977;0.975;0.963;0.951	T	0.67503	-0.5654	10	0.59425	D	0.04	-10.2864	18.742	0.91777	0.0:0.0:1.0:0.0	.	195;403;503;503	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	Q	503;403;195	ENSP00000325677:R503Q;ENSP00000350563:R403Q;ENSP00000384942:R195Q	ENSP00000325677:R503Q	R	+	2	0	RNF40	30686794	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.444000	0.97578	2.728000	0.93425	0.655000	0.94253	CGA	.		0.527	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771	
DST	667	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	56468122	56468122	+	Nonsense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:56468122T>A	ENST00000361203.3	-	38	10412	c.10405A>T	c.(10405-10407)Aga>Tga	p.R3469*	DST_ENST00000370769.4_Nonsense_Mutation_p.R3469*|DST_ENST00000312431.6_Nonsense_Mutation_p.R3469*|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Nonsense_Mutation_p.R3647*|DST_ENST00000446842.2_Nonsense_Mutation_p.R3143*|DST_ENST00000244364.6_Intron|DST_ENST00000370788.2_Intron			Q03001	DYST_HUMAN	dystonin	3469					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACATGGCCTCTGGGAAAGTCA	0.413																																					.		.											.	.	.	0			.						.						39.0	39.0	39.0					6																	56468122		876	1991	2867	SO:0001587	stop_gained	100873774	.			GGCCTCTGGGAAA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.10405A>T	6.37:g.56468122T>A	ENSP00000354508:p.Arg3469*	95.0	0.0		134.0	38.0	.	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	RNA	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	T	49	16.021832	0.99852	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203	.	.	.	5.37	1.38	0.22167	.	0.866347	0.09925	N	0.738017	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	6.1074	0.20081	0.0:0.2232:0.1267:0.6502	.	.	.	.	X	3647;3469;3143;3469;3469	.	ENSP00000307959:R3469X	R	-	1	2	DST	56576081	0.922000	0.31269	0.397000	0.26308	0.778000	0.44026	0.921000	0.28718	0.058000	0.16222	0.482000	0.46254	AGA	.		0.413	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
ROBO1	6091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	78737868	78737868	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:78737868G>T	ENST00000464233.1	-	9	1213	c.1100C>A	c.(1099-1101)aCt>aAt	p.T367N	ROBO1_ENST00000436010.2_Missense_Mutation_p.T328N|ROBO1_ENST00000467549.1_Missense_Mutation_p.T331N|ROBO1_ENST00000495273.1_Missense_Mutation_p.T331N	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	367	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AAAAGTTACAGTCCGTCCCAA	0.418																																					p.T367N		.											.	ROBO1	67	0			c.C1100A						.						64.0	60.0	62.0					3																	78737868		1870	4104	5974	SO:0001583	missense	6091	exon9			GTTACAGTCCGTC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1100C>A	3.37:g.78737868G>T	ENSP00000420321:p.Thr367Asn	57.0	0.0		51.0	16.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175468	0.78564	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.75260	-0.92;-0.92;1.58;1.58	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.095949	0.64402	D	0.000001	T	0.79534	0.4462	N	0.25332	0.735	0.80722	D	1	D;D;D;D;D	0.89917	0.988;1.0;1.0;1.0;0.985	D;D;D;D;D	0.83275	0.911;0.996;0.995;0.996;0.964	T	0.77582	-0.2534	9	.	.	.	.	19.115	0.93334	0.0:0.0:1.0:0.0	.	331;367;331;331;328	Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	N	328;331;367;331;331;367	ENSP00000406043:T328N;ENSP00000420321:T367N;ENSP00000420637:T331N;ENSP00000417992:T331N	.	T	-	2	0	ROBO1	78820558	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	7.465000	0.80898	2.522000	0.85027	0.585000	0.79938	ACT	.		0.418	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RRAGA	10670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	19050112	19050112	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:19050112C>T	ENST00000380527.1	+	1	741	c.455C>T	c.(454-456)tCt>tTt	p.S152F		NM_006570.4	NP_006561.1			Ras-related GTP binding A											endometrium(1)|large_intestine(1)|lung(1)	3						AGGCGTCTGTCTCGCCCGCTG	0.527																																					p.S152F		.											.	RRAGA	90	0			c.C455T						.						64.0	62.0	63.0					9																	19050112		2203	4300	6503	SO:0001583	missense	10670	exon1			GTCTGTCTCGCCC	BC006433	CCDS6488.1	9p21.3	2008-02-05			ENSG00000155876	ENSG00000155876			16963	protein-coding gene	gene with protein product		612194				7499430, 8995684	Standard	NM_006570		Approved	RAGA, FIP-1	uc003znj.3	Q7L523	OTTHUMG00000019621	ENST00000380527.1:c.455C>T	9.37:g.19050112C>T	ENSP00000369899:p.Ser152Phe	62.0	0.0		52.0	18.0	NM_006570		Missense_Mutation	SNP	ENST00000380527.1	37	CCDS6488.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405538	0.62288	.	.	ENSG00000155876	ENST00000380527	T	0.66995	-0.24	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.71609	0.3360	M	0.82132	2.575	0.80722	D	1	P	0.34815	0.47	B	0.41036	0.346	T	0.68006	-0.5523	10	0.18710	T	0.47	-4.4958	16.1608	0.81704	0.0:1.0:0.0:0.0	.	152	Q7L523	RRAGA_HUMAN	F	152	ENSP00000369899:S152F	ENSP00000369899:S152F	S	+	2	0	RRAGA	19040112	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.212000	0.77941	2.770000	0.95276	0.655000	0.94253	TCT	.		0.527	RRAGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051824.1	NM_006570	
RTL1	388015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	101350239	101350239	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr14:101350239T>A	ENST00000534062.1	-	1	945	c.887A>T	c.(886-888)cAg>cTg	p.Q296L	MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	296					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GCGGCCGCCCTGCCTGATGGT	0.607																																					p.Q296L		.											.	RTL1	46	0			c.A887T						.						53.0	53.0	53.0					14																	101350239		692	1591	2283	SO:0001583	missense	388015	exon1			CCGCCCTGCCTGA		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.887A>T	14.37:g.101350239T>A	ENSP00000435342:p.Gln296Leu	34.0	0.0		33.0	16.0	NM_001134888	E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	37	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.063277	0.55432	.	.	ENSG00000254656	ENST00000534062	T	0.38722	1.12	3.57	3.57	0.40892	.	.	.	.	.	T	0.60586	0.2280	M	0.70595	2.14	0.38640	D	0.951584	D	0.76494	0.999	D	0.91635	0.999	T	0.67007	-0.5779	9	0.87932	D	0	.	10.7447	0.46172	0.0:0.0:0.0:1.0	.	296	E9PKS8	.	L	296	ENSP00000435342:Q296L	ENSP00000435342:Q296L	Q	-	2	0	RTL1	100419992	1.000000	0.71417	0.925000	0.36789	0.276000	0.26787	4.532000	0.60608	1.853000	0.53794	0.459000	0.35465	CAG	.		0.607	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
RUFY3	22902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71659507	71659507	+	IGR	SNP	G	G	A	rs372273317		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:71659507G>A	ENST00000226328.4	+	0	4233				RUFY3_ENST00000381006.3_Missense_Mutation_p.R448H|RUFY3_ENST00000502653.1_Missense_Mutation_p.R395H	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3						negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			TCCAGATTGCGCCAGGCTGAG	0.478																																					p.R448H		.											.	RUFY3	90	0			c.G1343A						.	G	HIS/ARG	0,4406		0,0,2203	46.0	46.0	46.0		1343	5.0	1.0	4		46	1,8599	1.2+/-3.3	0,1,4299	no	missense	RUFY3	NM_001037442.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	448/621	71659507	1,13005	2203	4300	6503	SO:0001628	intergenic_variant	22902	exon13			GATTGCGCCAGGC	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910		4.37:g.71659507G>A		155.0	0.0		195.0	41.0	NM_001037442	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	37	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.587493	0.28268	0.0	1.16E-4	ENSG00000018189	ENST00000381006;ENST00000502653	T;T	0.08720	3.07;3.06	5.88	5.01	0.66863	.	0.350601	0.29653	N	0.011551	T	0.08670	0.0215	.	.	.	0.80722	D	1	B	0.16396	0.017	B	0.08055	0.003	T	0.08330	-1.0727	9	0.54805	T	0.06	1.3898	11.3509	0.49587	0.1501:0.0:0.8499:0.0	.	448	Q7L099-3	.	H	448;395	ENSP00000370394:R448H;ENSP00000425400:R395H	ENSP00000370394:R448H	R	+	2	0	RUFY3	71878371	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.211000	0.58507	1.422000	0.47177	0.655000	0.94253	CGC	.		0.478	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
RUNX2	860	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	45296466	45296466	+	Start_Codon_SNP	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:45296466G>T	ENST00000371438.1	+	1	361	c.3G>T	c.(1-3)atG>atT	p.M1I	SUPT3H_ENST00000306867.5_Intron|RUNX2_ENST00000352853.5_Missense_Mutation_p.M69I|SUPT3H_ENST00000371460.1_Intron|RUNX2_ENST00000371436.6_Start_Codon_SNP_p.M1I|SUPT3H_ENST00000371459.1_Intron|RUNX2_ENST00000465038.2_Start_Codon_SNP_p.M1I|SUPT3H_ENST00000459689.1_Intron|RUNX2_ENST00000541979.1_Missense_Mutation_p.M69I|RUNX2_ENST00000576263.1_Start_Codon_SNP_p.M1I|RUNX2_ENST00000483243.1_3'UTR	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	1					BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GAGGGACTATGGCATCAAACA	0.378																																					p.M1I		.											.	RUNX2	417	0			c.G3T						.						125.0	120.0	121.0					6																	45296466		1880	4114	5994	SO:0001582	initiator_codon_variant	860	exon2			GACTATGGCATCA	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.3G>T	6.37:g.45296466G>T	ENSP00000360493:p.Met1Ile	105.0	1.0		156.0	92.0	NM_001024630	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	G	9.994	1.231495	0.22626	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436	D;D;D;D;D	0.97505	-4.4;-4.25;-4.29;-4.4;-4.41	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	.	.	.	0.80722	D	1	P;P	0.41159	0.656;0.74	P;P	0.51777	0.679;0.577	D	0.98408	1.0571	9	0.87932	D	0	-5.2304	19.6732	0.95918	0.0:0.0:1.0:0.0	.	69;1	F6RGB9;Q13950	.;RUNX2_HUMAN	I	1;69;69;1;1	ENSP00000420707:M1I;ENSP00000319087:M69I;ENSP00000446290:M69I;ENSP00000360493:M1I;ENSP00000360491:M1I	ENSP00000319087:M69I	M	+	3	0	RUNX2	45404444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.230000	0.95299	2.657000	0.90304	0.591000	0.81541	ATG	.		0.378	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	Missense_Mutation
SALL1	6299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	51174758	51174758	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:51174758C>T	ENST00000251020.4	-	2	1408	c.1375G>A	c.(1375-1377)Ggg>Agg	p.G459R	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.G362R|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	459					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G459W(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CTGTCACTCCCAAAGACCTTC	0.502																																					p.G459R	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1	98	1	Substitution - Missense(1)	lung(1)	c.G1375A						.						104.0	96.0	99.0					16																	51174758		2198	4300	6498	SO:0001583	missense	6299	exon2			CACTCCCAAAGAC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1375G>A	16.37:g.51174758C>T	ENSP00000251020:p.Gly459Arg	57.0	0.0		52.0	26.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.018854	0.75275	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06933	3.24;3.24	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.33147	0.0853	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.06250	-1.0837	10	0.33940	T	0.23	.	18.685	0.91560	0.0:1.0:0.0:0.0	.	459	Q9NSC2	SALL1_HUMAN	R	459;362;423	ENSP00000251020:G459R;ENSP00000407914:G362R	ENSP00000251020:G459R	G	-	1	0	SALL1	49732259	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.814000	0.86154	2.386000	0.81285	0.563000	0.77884	GGG	.		0.502	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SEC31B	25956	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	102269083	102269083	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:102269083T>C	ENST00000370345.3	-	4	486	c.389A>G	c.(388-390)aAt>aGt	p.N130S	SEC31B_ENST00000370329.5_Missense_Mutation_p.N130S|NDUFB8_ENST00000531258.1_Intron|NDUFB8_ENST00000557395.1_Intron|SEC31B_ENST00000535773.1_Intron|SEC31B_ENST00000451524.1_Missense_Mutation_p.N130S	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	130					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CTGGAAAGGATTCAAGTCGAG	0.493											OREG0020441	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N130S		.											.	SEC31B	91	0			c.A389G						.						162.0	170.0	168.0					10																	102269083		2203	4300	6503	SO:0001583	missense	25956	exon4			AAAGGATTCAAGT	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.389A>G	10.37:g.102269083T>C	ENSP00000359370:p.Asn130Ser	70.0	0.0	1365	70.0	22.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.798740	0.90538	.	.	ENSG00000075826	ENST00000370345;ENST00000451524;ENST00000370329	T;T;T	0.54279	0.58;0.58;0.58	5.9	5.9	0.94986	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	N	0.20530	0.585	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.99;1.0	D;D;D;D	0.85130	0.946;0.994;0.946;0.997	T	0.65529	-0.6146	10	0.87932	D	0	-17.0889	15.5056	0.75739	0.0:0.0:0.0:1.0	.	130;130;130;130	B4DGE3;Q9NQW1-5;E9PKR7;Q9NQW1	.;.;.;SC31B_HUMAN	S	130	ENSP00000359370:N130S;ENSP00000391178:N130S;ENSP00000359354:N130S	ENSP00000359354:N130S	N	-	2	0	SEC31B	102259073	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	6.197000	0.72100	2.254000	0.74563	0.460000	0.39030	AAT	.		0.493	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
SHANK1	50944	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51169670	51169670	+	Silent	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:51169670T>C	ENST00000293441.1	-	22	5565	c.5547A>G	c.(5545-5547)ccA>ccG	p.P1849P	SHANK1_ENST00000391814.1_Silent_p.P1857P|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000391813.1_Silent_p.P1236P|SHANK1_ENST00000359082.3_Silent_p.P1840P	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1849	Poly-Pro.				adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CGGGCAGAGGTGGTGGCGGTG	0.667																																					p.P1849P		.											.	SHANK1	153	0			c.A5547G						.						15.0	17.0	16.0					19																	51169670		2201	4297	6498	SO:0001819	synonymous_variant	50944	exon22			CAGAGGTGGTGGC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5547A>G	19.37:g.51169670T>C		56.0	0.0		53.0	27.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	CCDS12799.1																																																																																			.		0.667	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
SIRPB1	10326	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	1551748	1551748	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr20:1551748T>C	ENST00000381605.4	-	4	851	c.787A>G	c.(787-789)Agg>Ggg	p.R263G	SIRPB1_ENST00000381603.3_Intron|SIRPB1_ENST00000262929.5_Intron|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	263	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TTCTCTGCCCTCATGGGCTGT	0.542																																					p.R263G		.											.	SIRPB1	91	0			c.A787G						.						77.0	71.0	73.0					20																	1551748		2203	4300	6503	SO:0001583	missense	10326	exon4			CTGCCCTCATGGG	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.787A>G	20.37:g.1551748T>C	ENSP00000371018:p.Arg263Gly	77.0	1.0		101.0	48.0	NM_006065	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	37	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	2.165	-0.391150	0.04932	.	.	ENSG00000101307	ENST00000381605	T	0.02837	4.14	0.968	-0.239	0.13050	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	2.439520	0.01773	N	0.031273	T	0.03564	0.0102	L	0.51422	1.61	0.09310	N	1	B	0.17268	0.021	B	0.15484	0.013	T	0.45323	-0.9269	10	0.22109	T	0.4	.	2.9099	0.05733	0.0:0.3221:0.0:0.6779	.	263	O00241	SIRB1_HUMAN	G	263	ENSP00000371018:R263G	ENSP00000371018:R263G	R	-	1	2	SIRPB1	1499748	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	-3.114000	0.00598	-0.104000	0.12154	0.260000	0.18958	AGG	.		0.542	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
SLAMF7	57823	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160720138	160720138	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:160720138C>A	ENST00000368043.3	+	4	731	c.694C>A	c.(694-696)Ctg>Atg	p.L232M	SLAMF7_ENST00000368042.3_Missense_Mutation_p.L125M|SLAMF7_ENST00000458602.2_Intron|SLAMF7_ENST00000458104.2_Intron|SLAMF7_ENST00000359331.4_Missense_Mutation_p.L232M|SLAMF7_ENST00000441662.2_Intron|SLAMF7_ENST00000444090.2_Intron	NM_001282595.1|NM_021181.3	NP_001269524.1|NP_067004.3	Q9NQ25	SLAF7_HUMAN	SLAM family member 7	232					cell adhesion (GO:0007155)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of natural killer cell activation (GO:0032814)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(4)	24	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CCTGTGTCTCCTGTTGGTGCC	0.502																																					p.L232M		.											.	SLAMF7	93	0			c.C694A						.						279.0	259.0	266.0					1																	160720138		2203	4300	6503	SO:0001583	missense	57823	exon4			TGTCTCCTGTTGG	AB027233	CCDS1209.1, CCDS60321.1, CCDS60322.1, CCDS60323.1, CCDS60324.1, CCDS60325.1, CCDS72956.1, CCDS72957.1	1q23.1-q24.1	2013-01-11			ENSG00000026751	ENSG00000026751		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	21394	protein-coding gene	gene with protein product		606625				11802771, 11220635	Standard	XM_005245386		Approved	CRACC, 19A, CS1, CD319	uc001fwq.3	Q9NQ25	OTTHUMG00000024008	ENST00000368043.3:c.694C>A	1.37:g.160720138C>A	ENSP00000357022:p.Leu232Met	208.0	1.0		183.0	72.0	NM_021181	A8K3U1|B4DPU4|B4DPY3|B4DWA3|Q8N6Y8|Q8ND32|Q9NY08|Q9NY23	Missense_Mutation	SNP	ENST00000368043.3	37	CCDS1209.1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374329	0.42105	.	.	ENSG00000026751	ENST00000368043;ENST00000368042;ENST00000359331	T;T;T	0.44482	0.92;0.92;0.92	4.95	2.96	0.34315	.	3.027540	0.00948	N	0.002932	T	0.49064	0.1535	M	0.62723	1.935	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;0.978;0.998	D;D;P;D	0.77557	0.99;0.976;0.504;0.927	T	0.32188	-0.9916	10	0.42905	T	0.14	0.5	8.6824	0.34216	0.166:0.672:0.162:0.0	.	138;125;232;232	B4DW98;Q9NQ25-2;A8K3U1;Q9NQ25	.;.;.;SLAF7_HUMAN	M	232;125;232	ENSP00000357022:L232M;ENSP00000357021:L125M;ENSP00000352281:L232M	ENSP00000352281:L232M	L	+	1	2	SLAMF7	158986762	0.016000	0.18221	0.081000	0.20488	0.009000	0.06853	0.036000	0.13819	2.274000	0.75844	0.650000	0.86243	CTG	.		0.502	SLAMF7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060464.1	NM_021181	
SLC10A4	201780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	48490859	48490859	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:48490859A>T	ENST00000273861.4	+	3	1436	c.1217A>T	c.(1216-1218)tAt>tTt	p.Y406F	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	406						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						GATATTTCTTATAAAAAACTA	0.353																																					p.Y406F		.											.	SLC10A4	90	0			c.A1217T						.						44.0	48.0	47.0					4																	48490859		2199	4298	6497	SO:0001583	missense	201780	exon3			TTTCTTATAAAAA	BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.1217A>T	4.37:g.48490859A>T	ENSP00000273861:p.Tyr406Phe	60.0	0.0		76.0	34.0	NM_152679	Q8WUZ2	Missense_Mutation	SNP	ENST00000273861.4	37	CCDS3482.1	.	.	.	.	.	.	.	.	.	.	A	12.54	1.968072	0.34754	.	.	ENSG00000145248	ENST00000273861	T	0.09911	2.93	6.17	6.17	0.99709	.	0.970544	0.08587	N	0.923648	T	0.12135	0.0295	L	0.43701	1.375	0.45172	D	0.998184	B	0.30664	0.289	B	0.23716	0.048	T	0.10567	-1.0624	10	0.42905	T	0.14	-14.744	11.8437	0.52371	0.8695:0.0:0.0:0.1305	.	406	Q96EP9	NTCP4_HUMAN	F	406	ENSP00000273861:Y406F	ENSP00000273861:Y406F	Y	+	2	0	SLC10A4	48185616	1.000000	0.71417	0.986000	0.45419	0.221000	0.24807	6.982000	0.76173	2.371000	0.80710	0.533000	0.62120	TAT	.		0.353	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219926.3	NM_152679	
SLC12A8	84561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	124826958	124826958	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:124826958T>C	ENST00000393469.4	-	9	1121	c.1072A>G	c.(1072-1074)Aaa>Gaa	p.K358E	SLC12A8_ENST00000430155.2_Missense_Mutation_p.K159E|SLC12A8_ENST00000469902.1_Missense_Mutation_p.K358E|SLC12A8_ENST00000465475.1_5'UTR|SLC12A8_ENST00000423114.2_Missense_Mutation_p.K387E|SLC12A8_ENST00000314584.7_Missense_Mutation_p.K111E	NM_001195483.1	NP_001182412	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	358					potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(2)|kidney(2)|lung(12)	16						ACGGGTGTTTTGTTTGGCCCC	0.468																																					p.K358E		.											.	SLC12A8	22	0			c.A1072G						.						38.0	39.0	39.0					3																	124826958		1941	4141	6082	SO:0001583	missense	84561	exon10			GTGTTTTGTTTGG		CCDS43143.1	3q21.2	2013-07-18	2013-07-18		ENSG00000221955	ENSG00000221955		"""Solute carriers"""	15595	protein-coding gene	gene with protein product	"""solute carrier family 12 (sodium/potassium/chloride transporters), member 8"", ""cation-chloride cotransporter 9"""	611316				11863360	Standard	NM_024628		Approved	CCC9	uc003ehv.4	A0AV02	OTTHUMG00000159483	ENST00000393469.4:c.1072A>G	3.37:g.124826958T>C	ENSP00000377112:p.Lys358Glu	48.0	0.0		49.0	14.0	NM_024628	C9JJJ2|Q68D04|Q6I9Z2|Q6P4C0|Q7Z3A6|Q86WK0|Q8NFX9|Q8WUI3|Q96RF9|Q9H5P9	Missense_Mutation	SNP	ENST00000393469.4	37	CCDS43143.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271132	0.80469	.	.	ENSG00000221955	ENST00000430155;ENST00000393469;ENST00000423114;ENST00000469902;ENST00000314584	D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14	4.9	4.9	0.64082	Amino acid permease domain (1);	.	.	.	.	D	0.98321	0.9443	L	0.43923	1.385	0.48452	D	0.999653	D;D;D;D	0.76494	0.999;0.97;0.975;0.997	D;P;P;D	0.74348	0.983;0.73;0.875;0.94	D	0.98498	1.0613	9	0.59425	D	0.04	.	11.6463	0.51263	0.0:0.0:0.1482:0.8518	.	111;387;358;159	A0AV02-4;A0AV02-2;A0AV02;A0AV02-3	.;.;S12A8_HUMAN;.	E	159;358;387;358;111	ENSP00000415713:K159E;ENSP00000377112:K358E;ENSP00000404243:K387E;ENSP00000418783:K358E;ENSP00000323632:K111E	ENSP00000323632:K111E	K	-	1	0	SLC12A8	126309648	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.927000	0.56499	2.172000	0.68678	0.533000	0.62120	AAA	.		0.468	SLC12A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355711.4	NM_024628	
SLC36A2	153201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150701730	150701730	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:150701730T>A	ENST00000335244.4	-	9	1186	c.1057A>T	c.(1057-1059)Acc>Tcc	p.T353S	SLC36A2_ENST00000521967.1_Missense_Mutation_p.T353S|SLC36A2_ENST00000450886.1_Missense_Mutation_p.T77S	NM_181776.2	NP_861441.2	Q495M3	S36A2_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 2	353					amino acid transport (GO:0006865)|ion transport (GO:0006811)|proline transmembrane transport (GO:0035524)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen:amino acid symporter activity (GO:0005280)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(14)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Cycloserine(DB00260)	AGGGCATAGGTGCACAGGATG	0.562																																					p.T353S		.											.	SLC36A2	91	0			c.A1057T						.						139.0	124.0	129.0					5																	150701730		2203	4300	6503	SO:0001583	missense	153201	exon9			CATAGGTGCACAG	AY162214	CCDS4315.1	5q33.1	2013-05-22			ENSG00000186335	ENSG00000186335		"""Solute carriers"""	18762	protein-coding gene	gene with protein product		608331				11959859	Standard	NM_181776		Approved	PAT2, tramdorin, TRAMD1	uc003lty.3	Q495M3	OTTHUMG00000130129	ENST00000335244.4:c.1057A>T	5.37:g.150701730T>A	ENSP00000334223:p.Thr353Ser	49.0	0.0		63.0	26.0	NM_181776	Q495M4|Q495M6|Q6ZWK5|Q7Z6B5	Missense_Mutation	SNP	ENST00000335244.4	37	CCDS4315.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685269	0.47991	.	.	ENSG00000186335	ENST00000335244;ENST00000450886;ENST00000521967	T;T;T	0.02067	4.47;4.47;4.47	4.76	2.2	0.27929	.	0.265519	0.42172	N	0.000756	T	0.02230	0.0069	L	0.31294	0.92	0.42132	D	0.991476	B;B	0.27823	0.09;0.19	B;B	0.34590	0.186;0.186	T	0.55598	-0.8116	10	0.14656	T	0.56	-36.0228	9.9267	0.41496	0.2718:0.0:0.0:0.7282	.	353;353	E5RJJ5;Q495M3	.;S36A2_HUMAN	S	353;77;353	ENSP00000334223:T353S;ENSP00000399479:T77S;ENSP00000430535:T353S	ENSP00000334223:T353S	T	-	1	0	SLC36A2	150681923	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.757000	0.55212	0.343000	0.23821	0.460000	0.39030	ACC	.		0.562	SLC36A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252437.1		
SLC41A3	54946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	125769824	125769824	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:125769824T>A	ENST00000315891.6	-	3	581	c.343A>T	c.(343-345)Aac>Tac	p.N115Y	SLC41A3_ENST00000360370.4_Missense_Mutation_p.N115Y|SLC41A3_ENST00000508835.1_5'UTR|SLC41A3_ENST00000514023.1_Intron|SLC41A3_ENST00000346785.5_Intron|SLC41A3_ENST00000383598.2_Missense_Mutation_p.N89Y	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		ATCTCCAGGTTCCCCTTCAGG	0.572																																					p.N115Y		.											.	SLC41A3	90	0			c.A343T						.						98.0	72.0	81.0					3																	125769824		2203	4300	6503	SO:0001583	missense	54946	exon3			CCAGGTTCCCCTT		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.343A>T	3.37:g.125769824T>A	ENSP00000326070:p.Asn115Tyr	30.0	0.0		25.0	15.0	NM_017836	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	ENST00000315891.6	37	CCDS33843.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.575764	0.86645	.	.	ENSG00000114544	ENST00000360370;ENST00000383598;ENST00000458524;ENST00000315891;ENST00000514677;ENST00000513723;ENST00000512470;ENST00000510651;ENST00000507280;ENST00000514891;ENST00000504035;ENST00000509064	T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.18	5.18	0.71444	MgtE magnesium transporter, integral membrane (1);	0.000000	0.85682	D	0.000000	T	0.71660	0.3366	M	0.86805	2.84	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	T	0.77424	-0.2593	10	0.87932	D	0	-16.3959	12.9765	0.58540	0.0:0.0:0.0:1.0	.	115;115;115;89	A8MQ22;E7ENY4;Q96GZ6;Q96GZ6-7	.;.;S41A3_HUMAN;.	Y	115;89;106;115;115;167;115;115;115;115;115;115	ENSP00000353533:N115Y;ENSP00000373092:N89Y;ENSP00000326070:N115Y;ENSP00000422828:N115Y;ENSP00000425373:N167Y;ENSP00000421008:N115Y;ENSP00000423524:N115Y;ENSP00000422531:N115Y;ENSP00000423154:N115Y;ENSP00000421940:N115Y;ENSP00000424882:N115Y	ENSP00000326070:N115Y	N	-	1	0	SLC41A3	127252514	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	7.627000	0.83176	1.949000	0.56562	0.383000	0.25322	AAC	.		0.572	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
SMAD3	4088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	67477190	67477190	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr15:67477190A>G	ENST00000327367.4	+	7	1307	c.997A>G	c.(997-999)Aag>Gag	p.K333E	SMAD3_ENST00000540846.2_Missense_Mutation_p.K228E|SMAD3_ENST00000439724.3_Missense_Mutation_p.K289E|SMAD3_ENST00000537194.2_Missense_Mutation_p.K138E	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	333	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CACCGTCTGCAAGATCCCACC	0.597																																					p.K333E		.											.	SMAD3	904	0			c.A997G						.						70.0	63.0	65.0					15																	67477190		2201	4299	6500	SO:0001583	missense	4088	exon7			GTCTGCAAGATCC	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.997A>G	15.37:g.67477190A>G	ENSP00000332973:p.Lys333Glu	57.0	0.0		43.0	24.0	NM_005902	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	ENST00000327367.4	37	CCDS10222.1	.	.	.	.	.	.	.	.	.	.	A	33	5.253541	0.95336	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.99311	-5.73;-5.73;-5.73;-5.73	5.19	5.19	0.71726	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99591	0.9852	H	0.96833	3.89	0.80722	D	1	D;D	0.69078	0.994;0.997	D;D	0.65874	0.917;0.939	D	0.97747	1.0212	10	0.87932	D	0	.	15.0667	0.72002	1.0:0.0:0.0:0.0	.	289;333	B7Z4Z5;P84022	.;SMAD3_HUMAN	E	333;333;228;289;138	ENSP00000332973:K333E;ENSP00000437757:K228E;ENSP00000401133:K289E;ENSP00000445348:K138E	ENSP00000332973:K333E	K	+	1	0	SMAD3	65264244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.118000	0.94355	1.954000	0.56735	0.528000	0.53228	AAG	.		0.597	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256967.2	NM_005902	
SPAG17	200162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	118623785	118623785	+	Silent	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:118623785A>G	ENST00000336338.5	-	15	2213	c.2148T>C	c.(2146-2148)gaT>gaC	p.D716D		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	716						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GCTGTCTATTATCAGGGACTG	0.433																																					p.D716D		.											.	SPAG17	158	0			c.T2148C						.						184.0	169.0	174.0					1																	118623785		2203	4300	6503	SO:0001819	synonymous_variant	200162	exon15			TCTATTATCAGGG		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2148T>C	1.37:g.118623785A>G		152.0	0.0		150.0	66.0	NM_206996	Q8NAZ1|Q9NT21	Silent	SNP	ENST00000336338.5	37	CCDS899.1																																																																																			.		0.433	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
RP11-383M4.6	0	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	84547809	84547809	+	lincRNA	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:84547809C>T	ENST00000585776.1	-	0	1039				RP11-383M4.2_ENST00000427387.1_lincRNA|SPATA31D4_ENST00000341875.4_RNA																							ATATGAAGCCCATATTAAATC	0.433																																					p.P911P		.											.	.	.	0			c.C2733T						.						6.0	6.0	6.0					9																	84547809		659	1506	2165			389761	exon4			GAAGCCCATATTA																													9.37:g.84547809C>T		173.0	0.0		172.0	56.0	NM_001145197		Silent	SNP	ENST00000585776.1	37																																																																																				.		0.433	RP11-383M4.6-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000453562.1		
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158589013	158589013	+	Splice_Site	SNP	T	T	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:158589013T>G	ENST00000368147.4	-	45	6709	c.6529A>C	c.(6529-6531)Agg>Cgg	p.R2177R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2177					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ATAGCACACCTGGTTTCCAGG	0.483																																					p.R2177R		.											.	SPTA1	142	0			c.A6529C						.						223.0	216.0	218.0					1																	158589013		1997	4165	6162	SO:0001630	splice_region_variant	6708	exon45			CACACCTGGTTTC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6530+1A>C	1.37:g.158589013T>G		108.0	0.0		107.0	39.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																			.		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	Silent
STAC	6769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	36485045	36485045	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:36485045C>G	ENST00000273183.3	+	2	601	c.301C>G	c.(301-303)Ctg>Gtg	p.L101V	STAC_ENST00000457375.2_Missense_Mutation_p.L101V|STAC_ENST00000476388.1_3'UTR	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	101					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CAGGGCTGGTCTGCATCCAGG	0.562																																					p.L101V		.											.	STAC	94	0			c.C301G						.						117.0	108.0	111.0					3																	36485045		2203	4300	6503	SO:0001583	missense	6769	exon2			GCTGGTCTGCATC	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.301C>G	3.37:g.36485045C>G	ENSP00000273183:p.Leu101Val	36.0	0.0		41.0	23.0	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	C	5.778	0.327917	0.10956	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000544687;ENST00000434649	T;T;T	0.75589	-0.95;0.88;0.74	4.63	3.67	0.42095	.	0.210227	0.32918	N	0.005500	T	0.57489	0.2057	N	0.25647	0.755	0.25769	N	0.984857	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.28490	-1.0042	10	0.07990	T	0.79	.	13.4428	0.61123	0.0:0.7236:0.2764:0.0	.	101;101	E9PEA7;Q99469	.;STAC_HUMAN	V	101;101;33;90	ENSP00000273183:L101V;ENSP00000393713:L101V;ENSP00000398403:L90V	ENSP00000273183:L101V	L	+	1	2	STAC	36460049	0.868000	0.29978	0.999000	0.59377	0.509000	0.34042	2.765000	0.47621	2.505000	0.84491	0.557000	0.71058	CTG	.		0.562	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52558211	52558211	+	Silent	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:52558211C>T	ENST00000321725.6	+	68	7714	c.7638C>T	c.(7636-7638)acC>acT	p.T2546T		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2546					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCAGCGACACCTTTTGTGAAC	0.577																																					p.T2546T		.											.	STAB1	139	0			c.C7638T						.						211.0	192.0	198.0					3																	52558211		2203	4300	6503	SO:0001819	synonymous_variant	23166	exon68			CGACACCTTTTGT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.7638C>T	3.37:g.52558211C>T		62.0	0.0		86.0	48.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	1.405	-0.577116	0.03854	.	.	ENSG00000010327	ENST00000469989	.	.	.	5.67	1.09	0.20402	.	.	.	.	.	T	0.26122	0.0637	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24548	-1.0157	4	.	.	.	.	5.3108	0.15829	0.1333:0.5589:0.0:0.3078	.	.	.	.	F	153	.	.	L	+	1	0	STAB1	52533251	0.006000	0.16342	0.002000	0.10522	0.314000	0.28054	0.226000	0.17776	-0.016000	0.14127	0.561000	0.74099	CTT	.		0.577	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
SUGP2	10147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19136956	19136956	+	Silent	SNP	T	T	A	rs144099788		TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:19136956T>A	ENST00000601879.1	-	3	498	c.201A>T	c.(199-201)ggA>ggT	p.G67G	SUGP2_ENST00000456085.2_5'UTR|SUGP2_ENST00000452918.2_Silent_p.G67G|SUGP2_ENST00000337018.6_Silent_p.G67G|SUGP2_ENST00000600377.1_Silent_p.G81G|SUGP2_ENST00000598202.1_5'UTR			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	67					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GAGCTACAGATCCACTGAGGG	0.483																																					p.G67G		.											.	SUGP2	91	0			c.A201T						.						54.0	45.0	48.0					19																	19136956		2203	4300	6503	SO:0001819	synonymous_variant	10147	exon3			TACAGATCCACTG	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.201A>T	19.37:g.19136956T>A		27.0	0.0		23.0	8.0	NM_014884	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Silent	SNP	ENST00000601879.1	37	CCDS12392.1																																																																																			T|1.000;C|0.000		0.483	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464627.1	NM_001017392	
SULF1	23213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	70541750	70541750	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:70541750A>T	ENST00000260128.4	+	19	2837	c.2120A>T	c.(2119-2121)cAg>cTg	p.Q707L	SULF1_ENST00000419716.3_Missense_Mutation_p.Q707L|SULF1_ENST00000458141.2_Missense_Mutation_p.Q707L|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000402687.4_Missense_Mutation_p.Q707L	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	707					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GAGGCTGCTCAGGAAGTAGAT	0.463																																					p.Q707L		.											.	SULF1	518	0			c.A2120T						.						68.0	64.0	65.0					8																	70541750		2203	4300	6503	SO:0001583	missense	23213	exon19			CTGCTCAGGAAGT	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2120A>T	8.37:g.70541750A>T	ENSP00000260128:p.Gln707Leu	117.0	0.0		224.0	54.0	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.619752	0.28801	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	4.75	4.75	0.60458	Alkaline-phosphatase-like, core domain (1);	0.399171	0.28647	N	0.014618	T	0.21509	0.0518	L	0.46157	1.445	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.02860	-1.1101	10	0.54805	T	0.06	.	14.4268	0.67220	1.0:0.0:0.0:0.0	.	707	Q8IWU6	SULF1_HUMAN	L	707	ENSP00000403040:Q707L;ENSP00000260128:Q707L;ENSP00000385704:Q707L;ENSP00000390315:Q707L	ENSP00000260128:Q707L	Q	+	2	0	SULF1	70704304	1.000000	0.71417	0.617000	0.29091	0.028000	0.11728	6.815000	0.75242	1.977000	0.57605	0.533000	0.62120	CAG	.		0.463	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
SYT9	143425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7437386	7437386	+	Silent	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr11:7437386A>G	ENST00000318881.6	+	4	1395	c.1158A>G	c.(1156-1158)ggA>ggG	p.G386G		NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	386	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ACATAACAGGAGCATCAGGTG	0.408																																					p.G386G		.											.	SYT9	155	0			c.A1158G						.						109.0	101.0	104.0					11																	7437386		2201	4296	6497	SO:0001819	synonymous_variant	143425	exon4			AACAGGAGCATCA	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.1158A>G	11.37:g.7437386A>G		67.0	0.0		52.0	14.0	NM_175733		Silent	SNP	ENST00000318881.6	37	CCDS7778.1																																																																																			.		0.408	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
TBX18	9096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	85446945	85446945	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:85446945T>A	ENST00000369663.5	-	8	1619	c.1282A>T	c.(1282-1284)Aac>Tac	p.N428Y	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	428					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CTGTATCGGTTGAGGGTGAGG	0.607																																					p.N428Y		.											.	TBX18	73	0			c.A1282T						.						111.0	100.0	104.0					6																	85446945		2203	4300	6503	SO:0001583	missense	9096	exon8			ATCGGTTGAGGGT	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1282A>T	6.37:g.85446945T>A	ENSP00000358677:p.Asn428Tyr	100.0	0.0		72.0	66.0	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	ENST00000369663.5	37	CCDS34495.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.142488	0.37825	.	.	ENSG00000112837	ENST00000369663	D	0.87029	-2.2	5.18	5.18	0.71444	.	.	.	.	.	T	0.71221	0.3314	N	0.24115	0.695	0.50039	D	0.999848	P	0.46656	0.882	P	0.47891	0.56	T	0.76066	-0.3095	9	0.02654	T	1	.	15.0095	0.71539	0.0:0.0:0.0:1.0	.	428	O95935	TBX18_HUMAN	Y	428	ENSP00000358677:N428Y	ENSP00000358677:N428Y	N	-	1	0	TBX18	85503664	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	5.433000	0.66520	1.950000	0.56595	0.477000	0.44152	AAC	.		0.607	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
TERF1	7013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	73939235	73939235	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:73939235A>T	ENST00000276603.5	+	6	858	c.835A>T	c.(835-837)Agt>Tgt	p.S279C	TERF1_ENST00000276602.6_Missense_Mutation_p.S279C	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	279	Interaction with RLIM.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			AGATAAACCTAGTGGTAATGA	0.323																																					p.S279C		.											.	TERF1	228	0			c.A835T						.						79.0	77.0	78.0					8																	73939235		2203	4300	6503	SO:0001583	missense	7013	exon6			AAACCTAGTGGTA	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.835A>T	8.37:g.73939235A>T	ENSP00000276603:p.Ser279Cys	24.0	0.0		42.0	10.0	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Missense_Mutation	SNP	ENST00000276603.5	37	CCDS6211.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.969069	0.74131	.	.	ENSG00000147601	ENST00000276603;ENST00000276602;ENST00000517390	.	.	.	4.25	1.81	0.25067	.	1.157320	0.06254	N	0.692565	T	0.19565	0.0470	N	0.08118	0	0.09310	N	1	P;P	0.47106	0.733;0.89	P;B	0.45276	0.475;0.145	T	0.16630	-1.0396	9	0.59425	D	0.04	.	5.4624	0.16624	0.7697:0.0:0.2303:0.0	.	279;279	P54274-2;P54274	.;TERF1_HUMAN	C	279;279;175	.	ENSP00000276602:S279C	S	+	1	0	TERF1	74101789	0.000000	0.05858	0.025000	0.17156	0.981000	0.71138	-0.038000	0.12144	0.692000	0.31613	0.528000	0.53228	AGT	.		0.323	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
TGM6	343641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2384055	2384055	+	Silent	SNP	C	C	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr20:2384055C>G	ENST00000202625.2	+	8	1063	c.1002C>G	c.(1000-1002)gtC>gtG	p.V334V	TGM6_ENST00000381423.1_Silent_p.V334V	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	334					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	ATTTCCATGTCTGGAATGAGA	0.582																																					p.V334V		.											.	TGM6	94	0			c.C1002G						.						44.0	39.0	41.0					20																	2384055		2203	4300	6503	SO:0001819	synonymous_variant	343641	exon8			CCATGTCTGGAAT	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1002C>G	20.37:g.2384055C>G		60.0	0.0		72.0	35.0	NM_198994	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	ENST00000202625.2	37	CCDS13025.1																																																																																			.		0.582	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
TGM7	116179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43574767	43574767	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr15:43574767T>A	ENST00000452443.2	-	8	1060	c.1056A>T	c.(1054-1056)ccA>ccT	p.P352P		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	352					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CGTTGTATCCTGGTGGGAGAT	0.557																																					p.P352P		.											.	TGM7	92	0			c.A1056T						.						85.0	72.0	76.0					15																	43574767		2202	4299	6501	SO:0001819	synonymous_variant	116179	exon8			GTATCCTGGTGGG	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.1056A>T	15.37:g.43574767T>A		41.0	0.0		41.0	23.0	NM_052955		Silent	SNP	ENST00000452443.2	37	CCDS32213.1																																																																																			.		0.557	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
THAP4	51078	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242542471	242542471	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:242542471G>A	ENST00000407315.1	-	4	1855	c.1424C>T	c.(1423-1425)aCg>aTg	p.T475M	THAP4_ENST00000497486.1_5'Flank|THAP4_ENST00000402136.1_Missense_Mutation_p.T63M|THAP4_ENST00000402545.1_Missense_Mutation_p.T63M	NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	475							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		CGGCTTGCGCGTGTCCGGGTG	0.602																																					p.T475M		.											.	.	.	0			c.C1424T						.						114.0	93.0	100.0					2																	242542471		2203	4296	6499	SO:0001583	missense	51078	exon4			TTGCGCGTGTCCG	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.1424C>T	2.37:g.242542471G>A	ENSP00000385006:p.Thr475Met	31.0	0.0		23.0	13.0	NM_015963	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Missense_Mutation	SNP	ENST00000407315.1	37	CCDS2551.1	.	.	.	.	.	.	.	.	.	.	g	19.51	3.840828	0.71488	.	.	ENSG00000176946	ENST00000402136;ENST00000407315;ENST00000402545;ENST00000512346	D	0.96300	-3.97	5.51	5.51	0.81932	Domain of unknown function DUF1794 (1);Calycin-like (1);	0.251457	0.27397	N	0.019555	D	0.97838	0.9290	M	0.68593	2.085	0.53005	D	0.999963	D;D	0.89917	1.0;1.0	D;P	0.76575	0.988;0.741	D	0.98481	1.0605	10	0.72032	D	0.01	-27.3523	19.4119	0.94677	0.0:0.0:1.0:0.0	.	475;63	Q8WY91;Q8WY91-2	THAP4_HUMAN;.	M	63;475;63;150	ENSP00000385006:T475M	ENSP00000385931:T63M	T	-	2	0	THAP4	242191144	1.000000	0.71417	0.879000	0.34478	0.835000	0.47333	5.173000	0.65010	2.592000	0.87571	0.591000	0.81541	ACG	.		0.602	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257267.3	NM_015963	
THEMIS	387357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	128134158	128134158	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:128134158A>G	ENST00000368248.2	-	4	1776	c.1628T>C	c.(1627-1629)aTg>aCg	p.M543T	THEMIS_ENST00000368250.1_Missense_Mutation_p.M464T|THEMIS_ENST00000543064.1_Missense_Mutation_p.M543T|THEMIS_ENST00000537166.1_Missense_Mutation_p.M508T	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	543					negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						ATATCTCCGCATCATGTAATA	0.443																																					p.M543T		.											.	THEMIS	94	0			c.T1628C						.						102.0	102.0	102.0					6																	128134158		2203	4300	6503	SO:0001583	missense	387357	exon4			CTCCGCATCATGT	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1628T>C	6.37:g.128134158A>G	ENSP00000357231:p.Met543Thr	77.0	0.0		35.0	31.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.189073	0.38707	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.18174	2.23;2.26;2.24;2.24	5.9	5.9	0.94986	.	0.385434	0.30538	N	0.009419	T	0.09555	0.0235	L	0.47716	1.5	0.39745	D	0.971807	B;B	0.32467	0.372;0.094	B;B	0.26864	0.074;0.026	T	0.02868	-1.1100	10	0.72032	D	0.01	-7.6567	16.3245	0.82970	1.0:0.0:0.0:0.0	.	543;543	F5H1J9;Q8N1K5	.;THMS1_HUMAN	T	464;543;543;508	ENSP00000357233:M464T;ENSP00000439594:M543T;ENSP00000357231:M543T;ENSP00000439863:M508T	ENSP00000357231:M543T	M	-	2	0	THEMIS	128175851	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.425000	0.80255	2.254000	0.74563	0.460000	0.39030	ATG	.		0.443	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
TMEM163	81615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135260482	135260482	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:135260482A>G	ENST00000281924.6	-	5	609	c.545T>C	c.(544-546)cTc>cCc	p.L182P		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	182						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		CACTTCTGGGAGCAGCCTAGT	0.527																																					p.L182P		.											.	TMEM163	90	0			c.T545C						.						131.0	106.0	115.0					2																	135260482		2203	4300	6503	SO:0001583	missense	81615	exon5			TCTGGGAGCAGCC		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.545T>C	2.37:g.135260482A>G	ENSP00000281924:p.Leu182Pro	96.0	0.0		94.0	39.0	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Missense_Mutation	SNP	ENST00000281924.6	37	CCDS2172.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.085387	0.36758	.	.	ENSG00000152128	ENST00000281924	T	0.61980	0.06	6.06	6.06	0.98353	.	0.068202	0.64402	D	0.000013	T	0.53384	0.1793	L	0.36672	1.1	0.80722	D	1	B	0.24186	0.099	B	0.22753	0.041	T	0.48103	-0.9064	10	0.28530	T	0.3	.	15.5919	0.76537	1.0:0.0:0.0:0.0	.	182	Q8TC26	TM163_HUMAN	P	182	ENSP00000281924:L182P	ENSP00000281924:L182P	L	-	2	0	TMEM163	134976952	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.137000	0.71710	2.324000	0.78689	0.533000	0.62120	CTC	.		0.527	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
TMEM63B	55362	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	44116103	44116103	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:44116103A>G	ENST00000259746.9	+	13	1285	c.1102A>G	c.(1102-1104)Aat>Gat	p.N368D	TMEM63B_ENST00000323267.6_Missense_Mutation_p.N368D			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	368					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CACCTTCCACAATGAGACTAT	0.577																																					p.N368D		.											.	TMEM63B	92	0			c.A1102G						.						119.0	104.0	109.0					6																	44116103		2203	4300	6503	SO:0001583	missense	55362	exon13			TTCCACAATGAGA	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1102A>G	6.37:g.44116103A>G	ENSP00000259746:p.Asn368Asp	25.0	0.0		63.0	12.0	NM_018426	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	ENST00000259746.9	37	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	A	6.188	0.402775	0.11696	.	.	ENSG00000137216	ENST00000259746;ENST00000323267	T;T	0.39406	1.08;1.08	4.61	4.61	0.57282	Domain of unknown function DUF221 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.08582	0.0213	N	0.05510	-0.035	0.45284	D	0.998281	B;B	0.19583	0.008;0.037	B;B	0.20384	0.029;0.024	T	0.13737	-1.0498	10	0.02654	T	1	.	13.644	0.62270	1.0:0.0:0.0:0.0	.	368;368	Q5T3F8;Q5T3F8-2	TM63B_HUMAN;.	D	368	ENSP00000259746:N368D;ENSP00000327154:N368D	ENSP00000259746:N368D	N	+	1	0	TMEM63B	44224081	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.429000	0.59901	2.072000	0.62099	0.460000	0.39030	AAT	.		0.577	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	
TNN	63923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175046732	175046732	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:175046732G>A	ENST00000239462.4	+	2	291	c.178G>A	c.(178-180)Gct>Act	p.A60T		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	60					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TCAGGTTGACGCTGACCCTCA	0.592																																					p.A60T		.											.	TNN	138	0			c.G178A						.						82.0	56.0	65.0					1																	175046732		2203	4300	6503	SO:0001583	missense	63923	exon2			GTTGACGCTGACC	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.178G>A	1.37:g.175046732G>A	ENSP00000239462:p.Ala60Thr	77.0	0.0		96.0	49.0	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547875	0.27652	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.26810	1.71	5.51	0.199	0.15175	.	0.578666	0.18353	N	0.143817	T	0.11793	0.0287	N	0.24115	0.695	0.09310	N	1	B;B	0.20550	0.005;0.046	B;B	0.14578	0.003;0.011	T	0.18085	-1.0348	10	0.30078	T	0.28	.	1.382	0.02232	0.2969:0.2373:0.3445:0.1213	.	60;60	B3KXB6;Q9UQP3	.;TENN_HUMAN	T	60	ENSP00000239462:A60T	ENSP00000239462:A60T	A	+	1	0	TNN	173313355	0.001000	0.12720	0.150000	0.22450	0.782000	0.44232	0.213000	0.17521	-0.216000	0.10048	-0.175000	0.13238	GCT	.		0.592	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TOP1MT	116447	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144408432	144408432	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:144408432T>C	ENST00000329245.4	-	4	477	c.443A>G	c.(442-444)aAg>aGg	p.K148R	TOP1MT_ENST00000519148.1_Missense_Mutation_p.K50R|TOP1MT_ENST00000521193.1_Missense_Mutation_p.K50R|TOP1MT_ENST00000523676.1_Missense_Mutation_p.K50R	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	148					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GGCTGCGGCCTTGTCCACAAA	0.577																																					p.K148R		.											.	TOP1MT	91	0			c.A443G						.						148.0	127.0	134.0					8																	144408432		2203	4300	6503	SO:0001583	missense	116447	exon4			GCGGCCTTGTCCA	AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.443A>G	8.37:g.144408432T>C	ENSP00000328835:p.Lys148Arg	68.0	0.0		163.0	9.0	NM_052963	B7ZAR5|E7ES89|Q86ST4|Q86V82	Missense_Mutation	SNP	ENST00000329245.4	37	CCDS6400.1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.870449	0.33069	.	.	ENSG00000184428	ENST00000329245;ENST00000521193;ENST00000519148;ENST00000523676;ENST00000522041;ENST00000519591;ENST00000518007	T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49	3.36	-0.293	0.12835	DNA topoisomerase I, domain 1 (1);DNA topoisomerase I, DNA binding, eukaryotic-type (2);	0.138563	0.31697	N	0.007213	T	0.19565	0.0470	L	0.34521	1.04	0.30357	N	0.784224	B	0.20459	0.045	B	0.26693	0.072	T	0.12451	-1.0547	10	0.33141	T	0.24	-7.9517	6.7769	0.23624	0.0:0.2847:0.0:0.7153	.	148	Q969P6	TOP1M_HUMAN	R	148;50;50;50;50;50;117	ENSP00000328835:K148R;ENSP00000428369:K50R;ENSP00000429169:K50R;ENSP00000429181:K50R;ENSP00000427998:K50R;ENSP00000429177:K50R;ENSP00000430209:K117R	ENSP00000328835:K148R	K	-	2	0	TOP1MT	144479807	0.001000	0.12720	0.020000	0.16555	0.808000	0.45660	0.470000	0.22084	-0.275000	0.09219	0.334000	0.21626	AAG	.		0.577	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963	
TRAP1	10131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3716009	3716009	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr16:3716009C>T	ENST00000246957.5	-	12	1434	c.1346G>A	c.(1345-1347)cGg>cAg	p.R449Q	TRAP1_ENST00000573872.1_5'Flank|TRAP1_ENST00000538171.1_Missense_Mutation_p.R396Q|TRAP1_ENST00000575671.1_Missense_Mutation_p.R240Q	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	449					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				AATGCCCTCCCGCATGAACAG	0.502																																					p.R449Q		.											.	TRAP1	226	0			c.G1346A						.						103.0	98.0	100.0					16																	3716009		2197	4300	6497	SO:0001583	missense	10131	exon12			CCCTCCCGCATGA	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1346G>A	16.37:g.3716009C>T	ENSP00000246957:p.Arg449Gln	88.0	0.0		95.0	41.0	NM_016292	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	ENST00000246957.5	37	CCDS10508.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.968459	0.92855	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	T;T	0.09817	2.94;2.94	5.78	5.78	0.91487	Ribosomal protein S5 domain 2-type fold (1);	0.103312	0.64402	D	0.000006	T	0.33673	0.0871	M	0.69823	2.125	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.66084	0.902;0.941	T	0.01298	-1.1392	10	0.87932	D	0	-41.7894	18.9999	0.92829	0.0:1.0:0.0:0.0	.	396;449	F5H897;Q12931	.;TRAP1_HUMAN	Q	449;396	ENSP00000246957:R449Q;ENSP00000442070:R396Q	ENSP00000246957:R449Q	R	-	2	0	TRAP1	3656010	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	7.261000	0.78400	2.744000	0.94065	0.563000	0.77884	CGG	.		0.502	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	
TRIM31	11074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30080321	30080321	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:30080321A>G	ENST00000376734.3	-	2	387	c.262T>C	c.(262-264)Tcc>Ccc	p.S88P	TRIM31_ENST00000485864.1_5'Flank|TRIM31-AS1_ENST00000440874.1_RNA|TRIM31_ENST00000540829.1_Missense_Mutation_p.S88P	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	88					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						TTCCTTTTGGACTGCACCTCA	0.493																																					p.S88P		.											.	TRIM31	658	0			c.T262C						.						136.0	129.0	132.0					6																	30080321		1511	2708	4219	SO:0001583	missense	11074	exon2			TTTTGGACTGCAC	AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.262T>C	6.37:g.30080321A>G	ENSP00000365924:p.Ser88Pro	85.0	0.0		126.0	35.0	NM_007028	A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	ENST00000376734.3	37	CCDS34374.1	.	.	.	.	.	.	.	.	.	.	A	4.948	0.176188	0.09443	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.57595	0.39;0.39	3.55	-1.12	0.09808	Zinc finger, RING/FYVE/PHD-type (1);	0.797101	0.10257	N	0.696386	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35798	-0.9774	10	0.20046	T	0.44	.	7.8249	0.29309	0.1057:0.4531:0.4412:0.0	.	88	Q9BZY9	TRI31_HUMAN	P	88	ENSP00000365924:S88P;ENSP00000444311:S88P	ENSP00000365918:S88P	S	-	1	0	TRIM31	30188300	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.313000	0.08103	-0.049000	0.13379	-0.384000	0.06662	TCC	.		0.493	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076081.2		
TRIM49	57093	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	89531677	89531677	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr11:89531677C>T	ENST00000329758.1	-	8	1308	c.980G>A	c.(979-981)aGt>aAt	p.S327N	TRIM49_ENST00000532501.2_Missense_Mutation_p.S250N	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TGCAAGAAAACTTCTAGGTGT	0.423																																					p.S327N		.											.	TRIM49	84	0			c.G980A						.						13.0	17.0	15.0					11																	89531677		2019	4182	6201	SO:0001583	missense	57093	exon8			AGAAAACTTCTAG	AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.980G>A	11.37:g.89531677C>T	ENSP00000327604:p.Ser327Asn	96.0	0.0		74.0	17.0	NM_020358	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	ENST00000329758.1	37	CCDS8287.1	.	.	.	.	.	.	.	.	.	.	C	1.463	-0.561816	0.03939	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.08008	3.14	0.539	-0.656	0.11436	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05410	0.0143	L	0.28504	0.86	0.09310	N	1	B	0.14438	0.01	B	0.17098	0.017	T	0.44574	-0.9319	7	.	.	.	.	.	.	.	.	327	P0CI25	TRI49_HUMAN	N	327;250	ENSP00000327604:S327N	.	S	-	2	0	TRIM49	89171325	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.022000	0.03611	-0.288000	0.09051	0.194000	0.17425	AGT	.		0.423	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395435.1	NM_020358	
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77435310	77435310	+	Silent	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr9:77435310G>T	ENST00000360774.1	-	9	1281	c.1044C>A	c.(1042-1044)atC>atA	p.I348I	TRPM6_ENST00000376864.4_Silent_p.I348I|TRPM6_ENST00000449912.2_Silent_p.I343I|TRPM6_ENST00000376872.3_Silent_p.I348I|TRPM6_ENST00000361255.3_Silent_p.I343I|TRPM6_ENST00000376871.3_Silent_p.I348I|TRPM6_ENST00000483186.1_5'UTR|TRPM6_ENST00000451710.3_Silent_p.I348I	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	348					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GAATCATGCAGATGATCTCCT	0.438																																					p.I348I		.											.	TRPM6	335	0			c.C1044A						.						131.0	121.0	125.0					9																	77435310		2203	4300	6503	SO:0001819	synonymous_variant	140803	exon9			CATGCAGATGATC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1044C>A	9.37:g.77435310G>T		32.0	0.0		52.0	18.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	CCDS6647.1																																																																																			.		0.438	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
TSPYL6	388951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	54482488	54482488	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:54482488T>A	ENST00000317802.7	-	1	921	c.801A>T	c.(799-801)agA>agT	p.R267S	ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000606865.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	267					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						CATCTTGGCCTCTAATCATGG	0.478																																					p.R267S		.											.	TSPYL6	90	0			c.A801T						.						86.0	85.0	86.0					2																	54482488		2139	4283	6422	SO:0001583	missense	388951	exon1			TTGGCCTCTAATC	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.801A>T	2.37:g.54482488T>A	ENSP00000417919:p.Arg267Ser	74.0	0.0		95.0	49.0	NM_001003937	Q6NUJ3	Missense_Mutation	SNP	ENST00000317802.7	37	CCDS42682.1	.	.	.	.	.	.	.	.	.	.	T	1.266	-0.614551	0.03663	.	.	ENSG00000178021	ENST00000317802	T	0.24538	1.85	1.34	0.106	0.14540	.	.	.	.	.	T	0.09024	0.0223	N	0.01431	-0.87	0.09310	N	1	B	0.25719	0.132	B	0.40009	0.316	T	0.45160	-0.9280	9	0.02654	T	1	.	3.231	0.06749	0.0:0.2559:0.0:0.7441	.	267	Q8N831	TSYL6_HUMAN	S	267	ENSP00000417919:R267S	ENSP00000417919:R267S	R	-	3	2	TSPYL6	54335992	0.674000	0.27549	0.003000	0.11579	0.055000	0.15305	-0.791000	0.04599	0.022000	0.15160	0.383000	0.25322	AGA	.		0.478	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
TUBB8	347688	broad.mit.edu;mdanderson.org	37	10	93652	93652	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr10:93652T>A	ENST00000309812.4	-	4	742	c.680A>T	c.(679-681)cAc>cTc	p.H227L	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.H155L	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	227					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		AGACACCAGGTGGTTCAGGTC	0.542																																					p.H227L	Pancreas(192;2041 3010 9013 18103)	.											.	TUBB8	69	0			c.A680T						.						29.0	29.0	29.0					10																	93652		1997	3871	5868	SO:0001583	missense	347688	exon4			ACCAGGTGGTTCA	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.680A>T	10.37:g.93652T>A	ENSP00000311042:p.His227Leu	20.0	0.0		24.0	9.0	NM_177987	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	T	8.937	0.964786	0.18583	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.68479	-0.33	.	.	.	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	U	0.000004	T	0.78541	0.4299	M	0.92219	3.285	0.37532	D	0.917942	P;D	0.59357	0.932;0.985	P;P	0.58520	0.84;0.817	T	0.77281	-0.2646	9	0.87932	D	0	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	190;227	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	L	155;193;190;227	ENSP00000403895:H155L	ENSP00000272035:H193L	H	-	2	0	RP11-631M21.2	83652	1.000000	0.71417	0.187000	0.23214	0.189000	0.23516	5.418000	0.66429	0.103000	0.17682	0.102000	0.15555	CAC	.		0.542	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
TUBGCP5	114791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	22848918	22848918	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr15:22848918A>T	ENST00000283645.4	+	10	1095	c.965A>T	c.(964-966)cAg>cTg	p.Q322L	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.Q322L|TUBGCP5_ENST00000559846.1_3'UTR	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	322					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		GCATATGGCCAGGTTGTGTTT	0.433																																					p.Q322L		.											.	TUBGCP5	91	0			c.A965T						.						160.0	144.0	149.0					15																	22848918		2203	4300	6503	SO:0001583	missense	114791	exon10			ATGGCCAGGTTGT	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.965A>T	15.37:g.22848918A>T	ENSP00000283645:p.Gln322Leu	62.0	0.0		52.0	27.0	NM_052903	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	ENST00000283645.4	37	CCDS10008.1	.	.	.	.	.	.	.	.	.	.	.	28.1	4.886321	0.91814	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.06933	3.24;3.24	5.55	5.55	0.83447	.	0.111333	0.64402	D	0.000007	T	0.21267	0.0512	L	0.51422	1.61	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.71414	0.973;0.973	T	0.04229	-1.0967	10	0.16420	T	0.52	-16.3728	15.9885	0.80179	1.0:0.0:0.0:0.0	.	322;322	Q96RT8;E9PB12	GCP5_HUMAN;.	L	322	ENSP00000283645:Q322L;ENSP00000409217:Q322L	ENSP00000283645:Q322L	Q	+	2	0	TUBGCP5	20400359	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.749000	0.91619	2.234000	0.73211	0.533000	0.62120	CAG	.		0.433	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2	NM_052903	
UGGT1	56886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	128870806	128870806	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr2:128870806A>T	ENST00000259253.6	+	6	717	c.670A>T	c.(670-672)Aat>Tat	p.N224Y	UGGT1_ENST00000375990.3_Missense_Mutation_p.N200Y	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	224					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGGCAAAATCAATTATGTATT	0.333																																					p.N224Y		.											.	UGGT1	91	0			c.A670T						.						58.0	61.0	60.0					2																	128870806		2203	4300	6503	SO:0001583	missense	56886	exon6			AAAATCAATTATG	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.670A>T	2.37:g.128870806A>T	ENSP00000259253:p.Asn224Tyr	275.0	0.0		247.0	93.0	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	15.38	2.815604	0.50527	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.08546	3.08;3.08	5.58	4.4	0.53042	.	0.150932	0.64402	D	0.000015	T	0.14787	0.0357	M	0.63843	1.955	0.33916	D	0.640318	P;B	0.42296	0.775;0.001	P;B	0.45474	0.482;0.001	T	0.12993	-1.0526	10	0.59425	D	0.04	.	12.6435	0.56721	0.8616:0.1384:0.0:0.0	.	200;224	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	Y	200;224	ENSP00000365158:N200Y;ENSP00000259253:N224Y	ENSP00000259253:N224Y	N	+	1	0	UGGT1	128587276	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	5.040000	0.64191	0.909000	0.36697	0.477000	0.44152	AAT	.		0.333	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
UGT2B4	7363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	70346460	70346460	+	Silent	SNP	C	C	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr4:70346460C>G	ENST00000305107.6	-	6	1525	c.1479G>C	c.(1477-1479)gtG>gtC	p.V493V	UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000512583.1_3'UTR|AC108078.1_ENST00000583573.1_RNA|UGT2B4_ENST00000381096.3_Silent_p.V357V	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	493					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	GGAACCCAGTCACATCCAAAG	0.478																																					p.V493V		.											.	UGT2B4	92	0			c.G1479C						.						148.0	142.0	144.0					4																	70346460		2203	4300	6503	SO:0001819	synonymous_variant	7363	exon6			CCCAGTCACATCC	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1479G>C	4.37:g.70346460C>G		117.0	0.0		107.0	55.0	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	ENST00000305107.6	37	CCDS43234.1																																																																																			.		0.478	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
ULK2	9706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19698995	19698995	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:19698995G>T	ENST00000395544.4	-	20	2540	c.2041C>A	c.(2041-2043)Cct>Act	p.P681T	ULK2_ENST00000580130.1_5'Flank|ULK2_ENST00000361658.2_Missense_Mutation_p.P681T	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	681					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					CGACATATAGGAGTCTTTCCT	0.338																																					p.P681T		.											.	ULK2	334	0			c.C2041A						.						220.0	220.0	220.0					17																	19698995		2203	4300	6503	SO:0001583	missense	9706	exon20			ATATAGGAGTCTT	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2041C>A	17.37:g.19698995G>T	ENSP00000378914:p.Pro681Thr	204.0	0.0		116.0	109.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	G	4.929	0.172615	0.09391	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.39997	1.05;1.05	5.57	3.5	0.40072	.	0.339495	0.34555	N	0.003862	T	0.23649	0.0572	N	0.17674	0.51	0.29435	N	0.859549	B	0.02656	0.0	B	0.04013	0.001	T	0.15378	-1.0439	10	0.21014	T	0.42	-2.7807	7.0504	0.25069	0.0843:0.0:0.5004:0.4153	.	681	Q8IYT8	ULK2_HUMAN	T	681	ENSP00000354877:P681T;ENSP00000378914:P681T	ENSP00000354877:P681T	P	-	1	0	ULK2	19639587	0.885000	0.30320	0.447000	0.26932	0.021000	0.10359	0.596000	0.24044	0.642000	0.30620	0.655000	0.94253	CCT	.		0.338	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
UNC13A	23025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	17716933	17716933	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:17716933G>T	ENST00000519716.2	-	44	5041	c.5042C>A	c.(5041-5043)gCc>gAc	p.A1681D	UNC13A_ENST00000551649.1_Missense_Mutation_p.A1700D|UNC13A_ENST00000550896.1_Missense_Mutation_p.A1654D|UNC13A_ENST00000252773.7_Missense_Mutation_p.A1681D|UNC13A_ENST00000428389.2_Missense_Mutation_p.A1769D|UNC13A_ENST00000552293.1_Missense_Mutation_p.A1675D	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1681					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GAACTCCTTGGCCACCTCGTC	0.726																																					p.A1681D		.											.	UNC13A	25	0			c.C5042A						.						10.0	10.0	10.0					19																	17716933		1933	4095	6028	SO:0001583	missense	23025	exon42			TCCTTGGCCACCT	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.5042C>A	19.37:g.17716933G>T	ENSP00000429562:p.Ala1681Asp	76.0	0.0		53.0	16.0	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.317132	0.81469	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;D;D;D	0.95001	-3.5;-3.58;-3.49;-3.16;-3.03;-3.42	2.98	1.9	0.25705	.	0.067783	0.64402	U	0.000020	D	0.96565	0.8879	M	0.84683	2.71	0.51767	D	0.999938	D	0.71674	0.998	D	0.69307	0.963	D	0.95718	0.8764	10	0.87932	D	0	-3.6154	9.7149	0.40268	0.0:0.215:0.785:0.0	.	1681	Q9UPW8	UN13A_HUMAN	D	1681;1769;1681;1700;1675;1654	ENSP00000429562:A1681D;ENSP00000400409:A1769D;ENSP00000252773:A1681D;ENSP00000447236:A1700D;ENSP00000447572:A1675D;ENSP00000446831:A1654D	ENSP00000252773:A1681D	A	-	2	0	UNC13A	17577933	1.000000	0.71417	0.998000	0.56505	0.761000	0.43186	7.394000	0.79862	0.580000	0.29522	0.306000	0.20318	GCC	.		0.726	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
UNC45B	146862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33504605	33504605	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:33504605T>A	ENST00000268876.5	+	17	2334	c.2237T>A	c.(2236-2238)cTg>cAg	p.L746Q	UNC45B_ENST00000433649.1_Missense_Mutation_p.L744Q|UNC45B_ENST00000591048.1_Missense_Mutation_p.L665Q|UNC45B_ENST00000394570.2_Missense_Mutation_p.L744Q|UNC45B_ENST00000378449.1_Missense_Mutation_p.L665Q	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	746					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CTCACCAACCTGTCTGGGCGG	0.532																																					p.L746Q		.											.	UNC45B	157	0			c.T2237A						.						37.0	28.0	31.0					17																	33504605		2197	4284	6481	SO:0001583	missense	146862	exon17			CCAACCTGTCTGG	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.2237T>A	17.37:g.33504605T>A	ENSP00000268876:p.Leu746Gln	31.0	0.0		47.0	24.0	NM_173167	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.782779	0.90282	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T	0.62498	0.02;1.0;0.02	5.3	5.3	0.74995	Armadillo-like helical (1);Armadillo-type fold (1);	0.160460	0.42548	D	0.000684	D	0.82930	0.5144	M	0.93106	3.38	0.53005	D	0.999969	D;D;D	0.89917	0.982;1.0;1.0	P;D;D	0.71656	0.875;0.973;0.974	D	0.87285	0.2295	10	0.87932	D	0	-13.9521	14.5819	0.68298	0.0:0.0:0.0:1.0	.	665;744;746	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	Q	746;746;744;665	ENSP00000268876:L746Q;ENSP00000412840:L744Q;ENSP00000367710:L665Q	ENSP00000268876:L746Q	L	+	2	0	UNC45B	30528718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.756000	0.85195	2.225000	0.72522	0.460000	0.39030	CTG	.		0.532	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
UNK	85451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73805856	73805856	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr17:73805856C>A	ENST00000589666.1	+	2	230	c.120C>A	c.(118-120)ttC>ttA	p.F40L	UNK_ENST00000293218.3_Missense_Mutation_p.F116L	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	40							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGAAAGAATTCCGCACAGAGC	0.602																																					p.F40L		.											.	UNK	68	0			c.C120A						.						17.0	20.0	19.0					17																	73805856		2120	4255	6375	SO:0001583	missense	85451	exon2			AGAATTCCGCACA	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.120C>A	17.37:g.73805856C>A	ENSP00000464893:p.Phe40Leu	45.0	0.0		54.0	21.0	NM_001080419		Missense_Mutation	SNP	ENST00000589666.1	37	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280902	0.80692	.	.	ENSG00000132478	ENST00000293218	.	.	.	5.12	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.78786	0.4338	M	0.85630	2.765	0.58432	D	0.999999	D	0.63880	0.993	D	0.68192	0.956	T	0.82291	-0.0530	9	0.87932	D	0	-9.9919	12.3658	0.55228	0.0:0.8562:0.0:0.1438	.	40	Q9C0B0	UNK_HUMAN	L	116	.	ENSP00000293218:F116L	F	+	3	2	UNK	71317451	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.003000	0.29809	2.377000	0.81083	0.561000	0.74099	TTC	.		0.602	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
VAV1	7409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6773000	6773000	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:6773000A>T	ENST00000602142.1	+	1	264	c.182A>T	c.(181-183)aAc>aTc	p.N61I	VAV1_ENST00000596764.1_Missense_Mutation_p.N61I|VAV1_ENST00000304076.2_Missense_Mutation_p.N61I|VAV1_ENST00000539284.1_5'UTR	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	61	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.|Leu-rich.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CGTGAGGTCAACCTGCGCCCC	0.652																																					p.N61I		.											.	VAV1	1276	0			c.A182T						.						127.0	96.0	107.0					19																	6773000		2203	4300	6503	SO:0001583	missense	7409	exon1			AGGTCAACCTGCG		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.182A>T	19.37:g.6773000A>T	ENSP00000472929:p.Asn61Ile	78.0	0.0		67.0	29.0	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	a	25.2	4.610302	0.87258	.	.	ENSG00000141968	ENST00000304076	T	0.62105	0.05	4.32	4.32	0.51571	Calponin homology domain (5);	0.000000	0.64402	U	0.000003	T	0.78317	0.4264	M	0.84219	2.685	0.80722	D	1	D;D	0.65815	0.995;0.992	D;D	0.74023	0.963;0.982	T	0.80434	-0.1384	10	0.54805	T	0.06	.	11.4548	0.50176	1.0:0.0:0.0:0.0	.	61;61	B2R8B5;P15498	.;VAV_HUMAN	I	61	ENSP00000302269:N61I	ENSP00000302269:N61I	N	+	2	0	VAV1	6724000	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.542000	0.73869	1.590000	0.49995	0.255000	0.18592	AAC	.		0.652	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82816442	82816442	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr5:82816442A>T	ENST00000265077.3	+	7	2882	c.2317A>T	c.(2317-2319)Act>Tct	p.T773S	VCAN_ENST00000342785.4_Missense_Mutation_p.T773S|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.T725S|VCAN_ENST00000343200.5_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	773	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CTTTACAGCAACTCCAGGTAC	0.383																																					p.T773S		.											.	VCAN	238	0			c.A2317T						.						67.0	65.0	66.0					5																	82816442		2203	4300	6503	SO:0001583	missense	1462	exon7			ACAGCAACTCCAG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2317A>T	5.37:g.82816442A>T	ENSP00000265077:p.Thr773Ser	45.0	0.0		53.0	27.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	9.190	1.025765	0.19512	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.20598	2.06;2.06;2.06	5.0	-2.59	0.06209	.	0.935039	0.08961	N	0.868753	T	0.10078	0.0247	N	0.19112	0.55	0.09310	N	1	B;B	0.27498	0.081;0.18	B;B	0.23419	0.046;0.03	T	0.38457	-0.9660	10	0.17832	T	0.49	.	5.7186	0.17974	0.2775:0.4503:0.2722:0.0	.	773;773	P13611-3;P13611	.;CSPG2_HUMAN	S	773;773;725	ENSP00000265077:T773S;ENSP00000342768:T773S;ENSP00000425959:T725S	ENSP00000265077:T773S	T	+	1	0	VCAN	82852198	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.179000	0.09768	-0.320000	0.08640	-0.456000	0.05471	ACT	.		0.383	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VPS37D	155382	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	73085576	73085576	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr7:73085576C>T	ENST00000324941.4	+	4	760	c.626C>T	c.(625-627)gCa>gTa	p.A209V	VPS37D_ENST00000451519.1_Missense_Mutation_p.A124V	NM_001077621.1	NP_001071089.1			vacuolar protein sorting 37 homolog D (S. cerevisiae)											central_nervous_system(1)|ovary(1)	2		Lung NSC(55;0.0908)|all_lung(88;0.198)				GGGCCACCAGCAGTGCCCCGG	0.766																																					p.A209V		.											.	VPS37D	68	0			c.C626T						.						3.0	4.0	4.0					7																	73085576		1334	3199	4533	SO:0001583	missense	155382	exon4			CACCAGCAGTGCC	AY081952	CCDS43596.1	7q11.23	2007-07-27	2006-04-04	2005-08-18	ENSG00000176428	ENSG00000176428			18287	protein-coding gene	gene with protein product		610039	"""Williams Beuren syndrome chromosome region 24"", ""vacuolar protein sorting 37D (yeast)"""	WBSCR24		15218037	Standard	NM_001077621		Approved	MGC35352	uc003tyr.3	Q86XT2	OTTHUMG00000157227	ENST00000324941.4:c.626C>T	7.37:g.73085576C>T	ENSP00000320416:p.Ala209Val	36.0	0.0		40.0	17.0	NM_001077621		Missense_Mutation	SNP	ENST00000324941.4	37	CCDS43596.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.479765	0.63849	.	.	ENSG00000176428	ENST00000324941;ENST00000451519	T;T	0.58506	0.33;1.34	4.07	4.07	0.47477	.	0.463838	0.18854	N	0.129318	T	0.43433	0.1247	N	0.08118	0	0.34193	D	0.672291	D	0.58268	0.982	P	0.51657	0.676	T	0.46624	-0.9178	10	0.15499	T	0.54	.	11.6008	0.51001	0.0:1.0:0.0:0.0	.	209	Q86XT2	VP37D_HUMAN	V	209;124	ENSP00000320416:A209V;ENSP00000413337:A124V	ENSP00000320416:A209V	A	+	2	0	VPS37D	72723512	0.815000	0.29118	0.999000	0.59377	0.977000	0.68977	2.187000	0.42602	2.086000	0.62901	0.561000	0.74099	GCA	.		0.766	VPS37D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348064.1	NM_152560	
VPS72	6944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151156881	151156881	+	Silent	SNP	T	T	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr1:151156881T>A	ENST00000354473.4	-	4	510	c.474A>T	c.(472-474)cgA>cgT	p.R158R	VPS72_ENST00000496809.1_5'UTR			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	158					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGGCCCCTTTCGCCGTCTTG	0.562																																					p.R158R	Pancreas(109;1131 2287 3209 24201)	.											.	VPS72	154	0			c.A474T						.						96.0	100.0	99.0					1																	151156881		2203	4300	6503	SO:0001819	synonymous_variant	6944	exon4			CCCCTTTCGCCGT	D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.474A>T	1.37:g.151156881T>A		55.0	0.0		77.0	36.0	NM_001271087	A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Silent	SNP	ENST00000354473.4	37	CCDS59201.1																																																																																			.		0.562	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000034394.3	NM_005997	
VTA1	51534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	142468439	142468439	+	Silent	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:142468439A>G	ENST00000367630.4	+	1	73	c.15A>G	c.(13-15)gcA>gcG	p.A5A	VTA1_ENST00000452973.2_5'UTR|VTA1_ENST00000367621.1_5'UTR	NM_016485.3	NP_057569.2	Q9NP79	VTA1_HUMAN	vesicle (multivesicular body) trafficking 1	5	Interaction with CHMP5.|Interaction with IST1.				endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		CCGCGCTTGCACCGCTGCCCC	0.617											OREG0017699	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A5A		.											.	VTA1	90	0			c.A15G						.						78.0	71.0	74.0					6																	142468439		2203	4300	6503	SO:0001819	synonymous_variant	51534	exon1			GCTTGCACCGCTG	AF060225	CCDS5197.1, CCDS69214.1, CCDS75531.1	6q24.1	2013-08-05	2013-08-05	2007-04-03	ENSG00000009844	ENSG00000009844			20954	protein-coding gene	gene with protein product		610902	"""chromosome 6 open reading frame 55"", ""Vps20-associated 1 homolog (S. cerevisiae)"""	C6orf55		11489251, 15644320	Standard	NM_001286372		Approved	HSPC228, My012	uc003qiw.3	Q9NP79	OTTHUMG00000015707	ENST00000367630.4:c.15A>G	6.37:g.142468439A>G		35.0	0.0	1671	22.0	18.0	NM_016485	B4DW55|E1P594|E7ETQ7|Q5TGM1|Q6IAE8|Q9H0R2|Q9H3K9|Q9P0Q0	Silent	SNP	ENST00000367630.4	37	CCDS5197.1																																																																																			.		0.617	VTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042483.2	NM_016485	
ZC2HC1A	51101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	79590890	79590890	+	Silent	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr8:79590890A>G	ENST00000263849.4	+	3	288	c.186A>G	c.(184-186)ccA>ccG	p.P62P	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	62							metal ion binding (GO:0046872)										CTGATATTCCAACAGTAAAAC	0.348																																					p.P62P		.											.	.	.	0			c.A186G						.						113.0	118.0	116.0					8																	79590890		2203	4300	6503	SO:0001819	synonymous_variant	51101	exon3			TATTCCAACAGTA		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.186A>G	8.37:g.79590890A>G		99.0	0.0		146.0	61.0	NM_016010	Q9Y372	Silent	SNP	ENST00000263849.4	37	CCDS6223.1																																																																																			.		0.348	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
ZCRB1	85437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	42711634	42711634	+	Silent	SNP	A	A	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr12:42711634A>G	ENST00000266529.3	-	4	363	c.180T>C	c.(178-180)gaT>gaC	p.D60D	PPHLN1_ENST00000549190.1_Intron|ZCRB1_ENST00000552673.1_Silent_p.D19D	NM_033114.3	NP_149105.3	Q8TBF4	ZCRB1_HUMAN	zinc finger CCHC-type and RNA binding motif 1	60	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)	8	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0689)		CAGAGTCTTTATCCAAAAATA	0.363																																					p.D60D		.											.	ZCRB1	91	0			c.T180C						.						117.0	120.0	119.0					12																	42711634		2203	4299	6502	SO:0001819	synonymous_variant	85437	exon4			GTCTTTATCCAAA	BC022543	CCDS8740.1	12q12	2013-02-12				ENSG00000139168		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	29620	protein-coding gene	gene with protein product	"""U11/U12 snRNP 31K"""	610750				15146077, 16959469	Standard	NM_033114		Approved	MADP-1, MADP1, RBM36, ZCCHC19, SNRNP31	uc001rmz.3	Q8TBF4	OTTHUMG00000169382	ENST00000266529.3:c.180T>C	12.37:g.42711634A>G		133.0	0.0		98.0	62.0	NM_033114	Q6PJX0|Q96TA6	Silent	SNP	ENST00000266529.3	37	CCDS8740.1																																																																																			.		0.363	ZCRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403813.1	NM_033114	
ZKSCAN7	55888	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	44612664	44612665	+	Frame_Shift_Ins	INS	-	-	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr3:44612664_44612665insA	ENST00000273320.3	+	6	2491_2492	c.2062_2063insA	c.(2062-2064)gaafs	p.E688fs	ZKSCAN7_ENST00000341840.3_Intron|ZKSCAN7_ENST00000426540.1_Frame_Shift_Ins_p.E688fs|RP11-944L7.4_ENST00000457331.1_RNA|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000431636.1_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	688					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E688G(1)									CCATACTGGGGAAAAACCCTAT	0.426																																					p.E688fs		.											.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.2062_2063insA						.																																			SO:0001589	frameshift_variant	55888	exon6			ACTGGGGAAAAAC	L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.2067dupA	3.37:g.44612669_44612669dupA	ENSP00000273320:p.Glu688fs	65.0	0.0		56.0	21.0	NM_018651	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Frame_Shift_Ins	INS	ENST00000273320.3	37	CCDS2715.1																																																																																			.		0.426	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256752.4	NM_018651	
ZNF185	7739	hgsc.bcm.edu;mdanderson.org	37	X	152110314	152110314	+	Intron	SNP	C	C	A			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chrX:152110314C>A	ENST00000370268.4	+	16	1245				ZNF185_ENST00000539731.1_Intron|ZNF185_ENST00000318504.7_Intron|ZNF185_ENST00000449285.2_Intron|ZNF185_ENST00000370270.2_Intron|ZNF185_ENST00000454925.1_Missense_Mutation_p.A21D|ZNF185_ENST00000535861.1_Intron|ZNF185_ENST00000318529.8_Intron|ZNF185_ENST00000324823.6_Intron			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)							actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CCCGTGCCGGCCGCCAGAGGT	0.687																																					p.A21D		.											.	ZNF185	133	0			c.C62A						.																																			SO:0001627	intron_variant	7739	exon1			TGCCGGCCGCCAG	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1209-3497C>A	X.37:g.152110314C>A		91.0	0.0		108.0	46.0	NM_001178115	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	ENST00000370268.4	37	CCDS48184.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578695	0.46006	.	.	ENSG00000147394	ENST00000454925	.	.	.	3.38	1.54	0.23209	.	.	.	.	.	T	0.15262	0.0368	N	0.08118	0	0.21147	N	0.999771	.	.	.	.	.	.	T	0.24297	-1.0164	5	.	.	.	.	3.9207	0.09242	0.0:0.6085:0.2463:0.1453	.	.	.	.	T	24	.	.	P	+	1	0	ZNF185	151860970	0.056000	0.20664	0.024000	0.17045	0.031000	0.12232	0.752000	0.26362	0.276000	0.22118	0.523000	0.50628	CCG	.		0.687	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
ZNF391	346157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27368962	27368962	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr6:27368962C>G	ENST00000244576.4	+	3	1358	c.813C>G	c.(811-813)caC>caG	p.H271Q	RP1-153G14.4_ENST00000607727.1_lincRNA	NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						AGAGAACACACACTGGGGAGA	0.453																																					p.H271Q		.											.	ZNF391	69	0			c.C813G						.						64.0	72.0	69.0					6																	27368962		2194	4296	6490	SO:0001583	missense	346157	exon3			AACACACACTGGG	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.813C>G	6.37:g.27368962C>G	ENSP00000244576:p.His271Gln	86.0	0.0		118.0	38.0	NM_001076781	B4DH77	Missense_Mutation	SNP	ENST00000244576.4	37	CCDS43429.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292190	0.59976	.	.	ENSG00000124613	ENST00000244576	T	0.66995	-0.24	4.0	0.541	0.17168	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.73528	0.3598	M	0.87038	2.855	0.30623	N	0.758269	D	0.89917	1.0	D	0.91635	0.999	T	0.66110	-0.6005	9	0.87932	D	0	.	8.3667	0.32391	0.0:0.6513:0.0:0.3487	.	271	Q9UJN7	ZN391_HUMAN	Q	271	ENSP00000244576:H271Q	ENSP00000244576:H271Q	H	+	3	2	ZNF391	27476941	1.000000	0.71417	0.006000	0.13384	0.976000	0.68499	2.237000	0.43061	0.177000	0.19895	0.557000	0.71058	CAC	.		0.453	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040145.2	NM_001076781	
ZNF665	79788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53668959	53668959	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M4-01A-11D-A32G-10	TCGA-RC-A6M4-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	559b7362-9b75-4be3-b8bc-5f3e28b71cd8	eb1e50b4-ccfb-4b5d-8180-a19d2e42b2a2	g.chr19:53668959A>T	ENST00000600412.1	-	2	704	c.589T>A	c.(589-591)Tac>Aac	p.Y197N	ZNF665_ENST00000396424.3_Missense_Mutation_p.Y262N|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	197					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TTACACTTGTAAGGTTTCTCT	0.383																																					p.Y262N		.											.	ZNF665	70	0			c.T784A						.						110.0	120.0	116.0					19																	53668959		2203	4300	6503	SO:0001583	missense	79788	exon4			ACTTGTAAGGTTT		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.589T>A	19.37:g.53668959A>T	ENSP00000469154:p.Tyr197Asn	67.0	0.0		85.0	27.0	NM_024733	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	37		.	.	.	.	.	.	.	.	.	.	A	13.78	2.338054	0.41398	.	.	ENSG00000197497	ENST00000396424	T	0.25749	1.78	2.31	1.24	0.21308	.	.	.	.	.	T	0.45816	0.1361	M	0.76433	2.335	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.20706	-1.0267	9	0.87932	D	0	.	6.4488	0.21892	0.8656:0.0:0.1344:0.0	.	262	Q9H7R5-2	.	N	262	ENSP00000379702:Y262N	ENSP00000379702:Y262N	Y	-	1	0	ZNF665	58360771	0.000000	0.05858	0.117000	0.21633	0.731000	0.41821	0.715000	0.25822	0.136000	0.18733	0.358000	0.22013	TAC	.		0.383	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
