#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADH4	127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100052694	100052694	+	Silent	SNP	C	C	G			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr4:100052694C>G	ENST00000265512.7	-	6	878	c.804G>C	c.(802-804)gtG>gtC	p.V268V	ADH4_ENST00000423445.1_Silent_p.V287V|ADH4_ENST00000508393.1_Silent_p.V287V|ADH4_ENST00000505590.1_Silent_p.V287V|RP11-696N14.1_ENST00000500358.2_RNA	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	268					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		GGGCAAAATCCACACCTCCCT	0.418																																					p.V268V		.											.	ADH4	228	0			c.G804C						.						123.0	121.0	122.0					4																	100052694		2203	4300	6503	SO:0001819	synonymous_variant	127	exon6			AAAATCCACACCT	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.804G>C	4.37:g.100052694C>G		86.0	0.0		98.0	10.0	NM_000670	A8K470|B4DIE7|C9J4A9|Q8TCD7	Silent	SNP	ENST00000265512.7	37	CCDS34032.1																																																																																			.		0.418	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	
B4GALT2	8704	ucsc.edu;bcgsc.ca	37	1	44451245	44451245	+	Missense_Mutation	SNP	G	G	A	rs200368860		TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr1:44451245G>A	ENST00000356836.6	+	6	1710	c.920G>A	c.(919-921)cGc>cAc	p.R307H	B4GALT2_ENST00000481924.1_3'UTR|B4GALT2_ENST00000372324.1_Missense_Mutation_p.R307H|B4GALT2_ENST00000309519.7_Missense_Mutation_p.R336H|B4GALT2_ENST00000434555.2_Missense_Mutation_p.R241H	NM_001005417.2|NM_030587.2	NP_001005417.1|NP_085076.2	O60909	B4GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2	307					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			N-Acetyl-D-glucosamine(DB00141)	GGCCGCTACCGCATGATCAAG	0.587																																					p.R336H		.											.	B4GALT2	92	0			c.G1007A						.						163.0	139.0	147.0					1																	44451245		2203	4300	6503	SO:0001583	missense	8704	exon6			GCTACCGCATGAT	AF038660	CCDS506.1, CCDS55596.1	1p34-p33	2013-02-19			ENSG00000117411	ENSG00000117411		"""Beta 4-glycosyltransferases"""	925	protein-coding gene	gene with protein product		604013				9405390, 9597550	Standard	NM_003780		Approved	beta4Gal-T2	uc010okl.2	O60909	OTTHUMG00000008296	ENST00000356836.6:c.920G>A	1.37:g.44451245G>A	ENSP00000349293:p.Arg307His	38.0	0.0		39.0	4.0	NM_030587	B3KTP0|B4DE14|D3DPY6|D3DPY7|O60511|Q4V9L9|Q5T4X5|Q5T4Y5|Q9BUP6|Q9NSY7	Missense_Mutation	SNP	ENST00000356836.6	37	CCDS506.1	.	.	.	.	.	.	.	.	.	.	G	33	5.272561	0.95429	.	.	ENSG00000117411	ENST00000372324;ENST00000434555;ENST00000356836;ENST00000309519	T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.87430	0.6175	L	0.48362	1.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.992;0.993	D	0.87827	0.2642	10	0.62326	D	0.03	-19.2669	19.3135	0.94202	0.0:0.0:1.0:0.0	.	336;241;307	B4DE14;O60909-2;O60909	.;.;B4GT2_HUMAN	H	307;241;307;336	ENSP00000361399:R307H;ENSP00000407468:R241H;ENSP00000349293:R307H;ENSP00000310696:R336H	ENSP00000310696:R336H	R	+	2	0	B4GALT2	44223832	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.747000	0.68689	2.568000	0.86640	0.411000	0.27672	CGC	.		0.587	B4GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022840.1	NM_003780	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32768519	32768519	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr2:32768519C>T	ENST00000421745.2	+	62	12637	c.12503C>T	c.(12502-12504)cCg>cTg	p.P4168L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4168					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTTCGTCTTCCGGGCTATGCG	0.473																																					p.P4168L	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.C12503T						.						222.0	192.0	202.0					2																	32768519		2203	4300	6503	SO:0001583	missense	57448	exon62			GTCTTCCGGGCTA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12503C>T	2.37:g.32768519C>T	ENSP00000393596:p.Pro4168Leu	90.0	0.0		90.0	12.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	33	5.203441	0.95033	.	.	ENSG00000115760	ENST00000421745	T	0.78595	-1.19	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.87378	0.6162	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88034	0.2777	10	0.87932	D	0	.	19.4789	0.95000	0.0:1.0:0.0:0.0	.	4168	Q9NR09	BIRC6_HUMAN	L	4168	ENSP00000393596:P4168L	ENSP00000393596:P4168L	P	+	2	0	BIRC6	32622023	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.975000	0.70475	2.598000	0.87819	0.650000	0.86243	CCG	.		0.473	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
CBLL1	79872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107399297	107399297	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr7:107399297A>G	ENST00000440859.3	+	6	1617	c.1150A>G	c.(1150-1152)Ata>Gta	p.I384V	CBLL1_ENST00000222597.2_Missense_Mutation_p.I383V	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase	384	Pro-rich.				negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						TCCACCACCAATAACCCCTCC	0.532																																					p.I384V		.											.	CBLL1	229	0			c.A1150G						.						208.0	209.0	209.0					7																	107399297		2203	4300	6503	SO:0001583	missense	79872	exon6			CCACCAATAACCC	AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.1150A>G	7.37:g.107399297A>G	ENSP00000401277:p.Ile384Val	92.0	0.0		89.0	21.0	NM_024814	B7ZM03|Q8TAJ4|Q9H5S6	Missense_Mutation	SNP	ENST00000440859.3	37	CCDS5747.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.617284	0.28801	.	.	ENSG00000105879	ENST00000440859;ENST00000535365;ENST00000222597	T;T	0.30981	1.51;1.51	4.96	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.23210	0.0561	L	0.38531	1.155	0.80722	D	1	B;B	0.23128	0.08;0.08	B;B	0.26614	0.071;0.071	T	0.04053	-1.0981	10	0.18710	T	0.47	-2.8001	10.6908	0.45870	0.924:0.0:0.076:0.0	.	383;384	B7ZM03;Q75N03	.;HAKAI_HUMAN	V	384;263;383	ENSP00000401277:I384V;ENSP00000222597:I383V	ENSP00000222597:I383V	I	+	1	0	CBLL1	107186533	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.822000	0.75277	0.853000	0.35312	0.402000	0.26972	ATA	.		0.532	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337156.2	NM_024814	
CDAN1	146059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	43021296	43021296	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr15:43021296T>C	ENST00000356231.3	-	19	2593	c.2570A>G	c.(2569-2571)aAc>aGc	p.N857S		NM_138477.2	NP_612486.2	Q8IWY9	CDAN1_HUMAN	codanin 1	857					chromatin assembly (GO:0031497)|chromatin organization (GO:0006325)|negative regulation of DNA replication (GO:0008156)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	24		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GGGCGGCTGGTTGTGGAAAAA	0.587																																					p.N857S		.											.	CDAN1	92	0			c.A2570G						.						74.0	77.0	76.0					15																	43021296		2203	4299	6502	SO:0001583	missense	146059	exon19			GGCTGGTTGTGGA	AF525398	CCDS32209.1	15q15.2	2012-04-25	2012-04-25			ENSG00000140326			1713	protein-coding gene	gene with protein product		607465	"""congenital dyserythropoietic anemia, type I"""			8634422, 12434312	Standard	XM_005254177		Approved	CDA-I, CDAI	uc001zql.3	Q8IWY9		ENST00000356231.3:c.2570A>G	15.37:g.43021296T>C	ENSP00000348564:p.Asn857Ser	55.0	0.0		69.0	6.0	NM_138477	Q6NYD0|Q7Z7L5|Q969N3	Missense_Mutation	SNP	ENST00000356231.3	37	CCDS32209.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628326	0.87560	.	.	ENSG00000140326	ENST00000356231;ENST00000267892	T	0.76060	-0.99	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.79246	0.4413	L	0.42686	1.345	0.58432	D	0.999997	D;D	0.69078	0.997;0.974	P;P	0.60789	0.879;0.736	T	0.79107	-0.1939	10	0.41790	T	0.15	-17.1404	15.0056	0.71510	0.0:0.0:0.0:1.0	.	857;855	Q8IWY9;C9K0H8	CDAN1_HUMAN;.	S	857;855	ENSP00000348564:N857S	ENSP00000267892:N855S	N	-	2	0	CDAN1	40808588	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.646000	0.83445	1.947000	0.56498	0.379000	0.24179	AAC	.		0.587	CDAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431103.1	XM_085300	
COL14A1	7373	broad.mit.edu;bcgsc.ca	37	8	121238908	121238908	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr8:121238908C>T	ENST00000297848.3	+	16	2177	c.1907C>T	c.(1906-1908)aCg>aTg	p.T636M	COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.T636M|COL14A1_ENST00000247781.3_Missense_Mutation_p.T541M	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GATGAGGTGACGACAGACAGT	0.483																																					p.T636M		.											.	COL14A1	543	0			c.C1907T						.						95.0	86.0	89.0					8																	121238908		2203	4300	6503	SO:0001583	missense	7373	exon16			AGGTGACGACAGA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1907C>T	8.37:g.121238908C>T	ENSP00000297848:p.Thr636Met	56.0	0.0		73.0	6.0	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568018	0.45798	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.63	3.62	0.41486	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.549752	0.18638	N	0.135373	T	0.61060	0.2317	M	0.82517	2.595	0.80722	D	1	B;B	0.22851	0.076;0.036	B;B	0.19946	0.027;0.015	T	0.59783	-0.7389	10	0.59425	D	0.04	.	12.8014	0.57588	0.4222:0.5778:0.0:0.0	.	636;636	Q05707-2;Q05707	.;COEA1_HUMAN	M	636;636;541;449	ENSP00000311809:T636M;ENSP00000297848:T636M;ENSP00000247781:T541M;ENSP00000409461:T449M	ENSP00000247781:T541M	T	+	2	0	COL14A1	121308089	0.997000	0.39634	1.000000	0.80357	0.989000	0.77384	1.518000	0.35877	0.512000	0.28257	0.557000	0.71058	ACG	.		0.483	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
FAM155A	728215	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	108518523	108518523	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr13:108518523C>G	ENST00000375915.2	-	1	560	c.422G>C	c.(421-423)gGc>gCc	p.G141A		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	141	Poly-Gly.					integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CTTGCCGCCGCCGCCGCCGCC	0.701																																					p.G141A		.											.	FAM155A	23	0			c.G422C						.						6.0	10.0	9.0					13																	108518523		1737	3638	5375	SO:0001583	missense	728215	exon1			CCGCCGCCGCCGC	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.422G>C	13.37:g.108518523C>G	ENSP00000365080:p.Gly141Ala	50.0	0.0		65.0	15.0	NM_001080396	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	C	4.495	0.091725	0.08632	.	.	ENSG00000204442	ENST00000375915	.	.	.	3.47	2.59	0.31030	.	0.358947	0.20540	N	0.090335	T	0.26846	0.0657	L	0.41492	1.28	0.24195	N	0.995532	B	0.26483	0.15	B	0.17722	0.019	T	0.25745	-1.0123	9	0.05620	T	0.96	.	10.3731	0.44066	0.0:0.6119:0.3881:0.0	.	141	B1AL88	F155A_HUMAN	A	141	.	ENSP00000365080:G141A	G	-	2	0	FAM155A	107316524	1.000000	0.71417	0.997000	0.53966	0.083000	0.17756	1.425000	0.34859	0.385000	0.24970	0.655000	0.94253	GGC	.		0.701	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
FNDC1	84624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	159646689	159646689	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr6:159646689G>A	ENST00000297267.9	+	8	1207	c.1007G>A	c.(1006-1008)cGt>cAt	p.R336H	FNDC1_ENST00000480856.1_3'UTR|FNDC1_ENST00000340366.6_Missense_Mutation_p.R336H	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	336	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TTTGCAGTCCGTATTTCACAG	0.438																																					p.R336H		.											.	FNDC1	138	0			c.G1007A						.						159.0	161.0	160.0					6																	159646689		1926	4130	6056	SO:0001583	missense	84624	exon8			CAGTCCGTATTTC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1007G>A	6.37:g.159646689G>A	ENSP00000297267:p.Arg336His	80.0	0.0		78.0	18.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015182	0.75161	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.58358	0.34;0.34	5.75	5.75	0.90469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.108020	0.64402	D	0.000011	T	0.63141	0.2486	M	0.74881	2.28	0.34265	D	0.680406	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.989	T	0.69610	-0.5099	10	0.62326	D	0.03	-17.9844	10.9433	0.47285	0.1131:0.0:0.8869:0.0	.	336;336	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	H	336	ENSP00000297267:R336H;ENSP00000342460:R336H	ENSP00000297267:R336H	R	+	2	0	FNDC1	159566677	1.000000	0.71417	0.239000	0.24122	0.981000	0.71138	5.286000	0.65639	2.718000	0.92993	0.591000	0.81541	CGT	.		0.438	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
GADL1	339896	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	30903143	30903143	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr3:30903143T>A	ENST00000282538.5	-	2	302	c.152A>T	c.(151-153)gAg>gTg	p.E51V	GADL1_ENST00000454381.3_Missense_Mutation_p.E51V	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	51					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						CCTACAGGCCTCTTCAACAAA	0.388																																					p.E51V		.											.	GADL1	90	0			c.A152T						.						167.0	138.0	147.0					3																	30903143		692	1591	2283	SO:0001583	missense	339896	exon2			CAGGCCTCTTCAA	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.152A>T	3.37:g.30903143T>A	ENSP00000282538:p.Glu51Val	265.0	0.0		244.0	18.0	NM_207359		Missense_Mutation	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347265	0.61183	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	T;T	0.39229	2.79;1.09	5.42	5.42	0.78866	Pyridoxal phosphate-dependent transferase, major domain (1);	.	.	.	.	T	0.32912	0.0845	N	0.24115	0.695	0.42295	D	0.992157	B	0.26635	0.155	B	0.26517	0.07	T	0.18053	-1.0349	9	0.66056	D	0.02	.	15.1216	0.72447	0.0:0.0:0.0:1.0	.	51	Q6ZQY3	GADL1_HUMAN	V	51	ENSP00000282538:E51V;ENSP00000427059:E51V	ENSP00000282538:E51V	E	-	2	0	GADL1	30878147	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.498000	0.73679	2.048000	0.60808	0.454000	0.30748	GAG	.		0.388	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	
GRID2	2895	broad.mit.edu;bcgsc.ca	37	4	94032016	94032016	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr4:94032016G>A	ENST00000282020.4	+	4	905	c.647G>A	c.(646-648)aGa>aAa	p.R216K	GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_Missense_Mutation_p.R121K	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	216					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GACACCATGAGAATAGAAGAA	0.408																																					p.R216K		.											.	GRID2	159	0			c.G647A						.						153.0	150.0	151.0					4																	94032016		2203	4300	6503	SO:0001583	missense	2895	exon4			CCATGAGAATAGA	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.647G>A	4.37:g.94032016G>A	ENSP00000282020:p.Arg216Lys	150.0	1.0		129.0	12.0	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.119942	0.56613	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.85861	-2.04;-2.04	5.5	5.5	0.81552	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.86752	0.6008	N	0.25890	0.77	0.51767	D	0.999937	P;P;D	0.57257	0.92;0.92;0.979	D;D;D	0.71414	0.946;0.946;0.973	T	0.80995	-0.1133	10	0.09590	T	0.72	.	19.7485	0.96259	0.0:0.0:1.0:0.0	.	121;216;157	E9PH24;O43424;B4DYB9	.;GRID2_HUMAN;.	K	216;121	ENSP00000282020:R216K;ENSP00000421257:R121K	ENSP00000282020:R216K	R	+	2	0	GRID2	94251039	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.347000	0.97059	2.742000	0.94016	0.655000	0.94253	AGA	.		0.408	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
LGALS2	3957	hgsc.bcm.edu;broad.mit.edu	37	22	37966624	37966626	+	In_Frame_Del	DEL	GTT	GTT	-	rs144405269	byFrequency	TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	GTT	GTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr22:37966624_37966626delGTT	ENST00000215886.4	-	3	380_382	c.206_208delAAC	c.(205-210)caacgg>cgg	p.Q69del		NM_006498.2	NP_006489.1	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2	69	Beta-galactoside binding. {ECO:0000255}.|Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)|galactoside binding (GO:0016936)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)	11	Melanoma(58;0.0574)					TGATCTTCCCGTTGTTCTTGCCC	0.576																																					p.69_70del	GBM(193;1840 2185 13711 20676 24505)	.											.	LGALS2	154	0			c.206_208del						.																																			SO:0001651	inframe_deletion	3957	exon3			CTTCCCGTTGTTC		CCDS13950.1	22q13.1	2011-08-04	2007-02-01		ENSG00000100079	ENSG00000100079		"""Lectins, galactoside-binding"""	6562	protein-coding gene	gene with protein product	"""galectin 2"""	150571				1988031, 15356130	Standard	NM_006498		Approved	HL14	uc003ata.3	P05162	OTTHUMG00000150590	ENST00000215886.4:c.206_208delAAC	22.37:g.37966627_37966629delGTT	ENSP00000215886:p.Gln69del	125.0	0.0		137.0	11.0	NM_006498	Q6FGY4	In_Frame_Del	DEL	ENST00000215886.4	37	CCDS13950.1																																																																																			.		0.576	LGALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318991.1	NM_006498	
LONRF1	91694	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	12600698	12600698	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr8:12600698A>C	ENST00000398246.3	-	2	884	c.815T>G	c.(814-816)cTt>cGt	p.L272R	LONRF1_ENST00000533751.1_5'UTR|LONRF1_ENST00000530693.1_5'UTR	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	272							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		AAGTTGAAAAAGAACTGCATT	0.338																																					p.L272R		.											.	LONRF1	91	0			c.T815G						.						62.0	60.0	61.0					8																	12600698		1799	4056	5855	SO:0001583	missense	91694	exon2			TGAAAAAGAACTG	AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.815T>G	8.37:g.12600698A>C	ENSP00000381298:p.Leu272Arg	216.0	0.0		222.0	20.0	NM_152271	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	ENST00000398246.3	37	CCDS5987.2	.	.	.	.	.	.	.	.	.	.	A	17.36	3.368794	0.61624	.	.	ENSG00000154359	ENST00000398246	T	0.38887	1.11	5.04	5.04	0.67666	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.663946	0.12572	U	0.457252	T	0.39064	0.1064	L	0.34521	1.04	0.80722	D	1	D	0.54047	0.964	P	0.47044	0.535	T	0.12319	-1.0552	10	0.48119	T	0.1	-7.0354	10.7218	0.46044	0.9241:0.0:0.0759:0.0	.	272	Q17RB8	LONF1_HUMAN	R	272	ENSP00000381298:L272R	ENSP00000381298:L272R	L	-	2	0	LONRF1	12645069	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.737000	0.47393	2.202000	0.70862	0.533000	0.62120	CTT	.		0.338	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251693.2	NM_152271	
LRRK1	79705	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	101608980	101608980	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr15:101608980G>A	ENST00000388948.3	+	34	6334	c.5975G>A	c.(5974-5976)aGg>aAg	p.R1992K	LRRK1_ENST00000532145.1_3'UTR|LRRK1_ENST00000284395.5_Missense_Mutation_p.R1989K|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGGGGCGCCAGGGAGTTCGAC	0.562																																					p.R1992K		.											.	LRRK1	602	0			c.G5975A						.						74.0	88.0	83.0					15																	101608980		2034	4171	6205	SO:0001583	missense	79705	exon34			GCGCCAGGGAGTT	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5975G>A	15.37:g.101608980G>A	ENSP00000373600:p.Arg1992Lys	96.0	0.0		112.0	8.0	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146675	0.57151	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.72615	-0.64;-0.67	5.83	3.97	0.46021	.	0.250821	0.38720	N	0.001581	T	0.62563	0.2438	L	0.54323	1.7	0.23101	N	0.9983	B	0.06786	0.001	B	0.06405	0.002	T	0.53634	-0.8411	10	0.39692	T	0.17	.	8.6962	0.34298	0.2843:0.0:0.7157:0.0	.	1992	Q38SD2	LRRK1_HUMAN	K	1992;1989	ENSP00000373600:R1992K;ENSP00000284395:R1989K	ENSP00000284395:R1989K	R	+	2	0	LRRK1	99426503	0.738000	0.28186	0.988000	0.46212	0.994000	0.84299	0.574000	0.23714	0.818000	0.34468	0.655000	0.94253	AGG	.		0.562	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
MKI67	4288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	129903267	129903267	+	Frame_Shift_Del	DEL	C	C	-			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr10:129903267delC	ENST00000368654.3	-	13	7212	c.6837delG	c.(6835-6837)atgfs	p.M2279fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.M1919fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2279	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TAAATGCTTTCATGTCTTTCT	0.483																																					p.M2279fs		.											.	MKI67	519	0			c.6837delG						.						257.0	236.0	243.0					10																	129903267		2203	4300	6503	SO:0001589	frameshift_variant	4288	exon13			TGCTTTCATGTCT	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6837delG	10.37:g.129903267delC	ENSP00000357643:p.Met2279fs	201.0	0.0		205.0	23.0	NM_002417	Q5VWH2	Frame_Shift_Del	DEL	ENST00000368654.3	37	CCDS7659.1																																																																																			.		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
MRC1	4360	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	18122743	18122743	+	Silent	SNP	C	C	T			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr10:18122743C>T	ENST00000239761.3	+	4	856	c.753C>T	c.(751-753)aaC>aaT	p.N251N		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	251	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						AACAACAGAACGCTGAGCTCC	0.438																																					p.N251N	GBM(115;1153 1594 28187 28781 35884)	.											.	MRC1	68	0			c.C753T						.						80.0	77.0	78.0					10																	18122743		1600	3556	5156	SO:0001819	synonymous_variant	4360	exon4			ACAGAACGCTGAG	J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.753C>T	10.37:g.18122743C>T		181.0	0.0		189.0	18.0	NM_002438	A5PKW3|Q5VSJ2|Q5VSK2	Silent	SNP	ENST00000239761.3	37	CCDS7123.1																																																																																			.		0.438	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047057.1	NM_002438	
MYH11	4629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	15815347	15815347	+	Silent	SNP	G	G	T	rs144823441		TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr16:15815347G>T	ENST00000300036.5	-	32	4619	c.4510C>A	c.(4510-4512)Cgg>Agg	p.R1504R	NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396354.1_Intron|MYH11_ENST00000396324.3_Silent_p.R1511R|NDE1_ENST00000396355.1_Intron|MYH11_ENST00000576790.2_Silent_p.R1504R|MYH11_ENST00000452625.2_Silent_p.R1511R	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1504					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TTGTTGGTCCGCTCGAGTTCC	0.562			T	CBFB	AML																																p.R1511R		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	666	0			c.C4531A						.						115.0	102.0	106.0					16																	15815347		2197	4300	6497	SO:0001819	synonymous_variant	4629	exon33			TGGTCCGCTCGAG	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.4510C>A	16.37:g.15815347G>T		175.0	0.0		182.0	31.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																			G|1.000;A|0.000		0.562	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2017578	2017578	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr8:2017578A>T	ENST00000262113.4	+	8	896	c.755A>T	c.(754-756)gAc>gTc	p.D252V	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	252					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TTCCGGGGAGACGAGGAACCA	0.517																																					p.D252V		.											.	MYOM2	95	0			c.A755T						.						177.0	173.0	174.0					8																	2017578		2203	4300	6503	SO:0001583	missense	9172	exon8			GGGGAGACGAGGA		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.755A>T	8.37:g.2017578A>T	ENSP00000262113:p.Asp252Val	272.0	0.0		271.0	33.0	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	A	3.952	-0.012131	0.07727	.	.	ENSG00000036448	ENST00000262113	T	0.53423	0.62	5.4	5.4	0.78164	.	1.010530	0.07916	N	0.975015	T	0.44993	0.1320	L	0.44542	1.39	0.41865	D	0.990245	B	0.14805	0.011	B	0.10450	0.005	T	0.27571	-1.0070	10	0.72032	D	0.01	.	11.4081	0.49911	0.927:0.0:0.073:0.0	.	252	P54296	MYOM2_HUMAN	V	252	ENSP00000262113:D252V	ENSP00000262113:D252V	D	+	2	0	MYOM2	2004985	0.939000	0.31865	0.052000	0.19188	0.084000	0.17831	2.313000	0.43735	2.043000	0.60533	0.533000	0.62120	GAC	.		0.517	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
NFE2L3	9603	broad.mit.edu;ucsc.edu	37	7	26224602	26224602	+	Silent	SNP	T	T	C			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr7:26224602T>C	ENST00000056233.3	+	4	1543	c.1284T>C	c.(1282-1284)aaT>aaC	p.N428N		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	428					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						CAAGTCACAATAATACCTCTG	0.398																																					p.N428N		.											.	NFE2L3	94	0			c.T1284C						.						114.0	119.0	117.0					7																	26224602		2203	4300	6503	SO:0001819	synonymous_variant	9603	exon4			TCACAATAATACC	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1284T>C	7.37:g.26224602T>C		84.0	1.0		89.0	14.0	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	ENST00000056233.3	37	CCDS5396.1																																																																																			.		0.398	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
NUP50	10762	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	45580526	45580526	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr22:45580526A>G	ENST00000347635.4	+	8	1863	c.1397A>G	c.(1396-1398)aAg>aGg	p.K466R	NUP50_ENST00000396096.2_Missense_Mutation_p.K438R|NUP50_ENST00000425733.2_Missense_Mutation_p.K216R|NUP50_ENST00000407019.2_Missense_Mutation_p.K438R	NM_007172.3	NP_009103.2	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa	466	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intracellular transport (GO:0046907)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTGGAGAAAAAGGATGCCTGA	0.458																																					p.K466R		.											.	NUP50	68	0			c.A1397G						.						41.0	41.0	41.0					22																	45580526		2203	4300	6503	SO:0001583	missense	10762	exon8			AGAAAAAGGATGC	AF107840	CCDS14062.1, CCDS14063.1	22q13.3	2007-01-22	2002-08-29		ENSG00000093000	ENSG00000093000			8065	protein-coding gene	gene with protein product		604646	"""nucleoporin 50kD"""	NPAP60L		10449902	Standard	XM_005261312		Approved		uc003bfr.3	Q9UKX7	OTTHUMG00000151265	ENST00000347635.4:c.1397A>G	22.37:g.45580526A>G	ENSP00000345895:p.Lys466Arg	155.0	0.0		118.0	7.0	NM_007172	B1AHA4|B2RB15|O75644|Q8N6V5|Q9NPM9|Q9NPR6|Q9P1K5	Missense_Mutation	SNP	ENST00000347635.4	37	CCDS14062.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.110274	0.37242	.	.	ENSG00000093000	ENST00000347635;ENST00000407019;ENST00000425733;ENST00000396096	.	.	.	5.22	1.93	0.25924	Pleckstrin homology-type (1);Ran binding protein 1 (1);	0.093789	0.64402	N	0.000001	T	0.53899	0.1825	L	0.53780	1.695	0.47819	D	0.999523	B	0.06786	0.001	B	0.22880	0.042	T	0.43556	-0.9384	9	0.37606	T	0.19	-17.884	9.2235	0.37390	0.7909:0.0:0.2091:0.0	.	466	Q9UKX7	NUP50_HUMAN	R	466;438;216;438	.	ENSP00000345895:K466R	K	+	2	0	NUP50	43959190	1.000000	0.71417	0.227000	0.23927	0.733000	0.41908	5.978000	0.70501	0.073000	0.16731	-0.274000	0.10170	AAG	.		0.458	NUP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321993.2		
PCSK4	54760	hgsc.bcm.edu;broad.mit.edu	37	19	1487019	1487019	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr19:1487019C>T	ENST00000300954.5	-	8	962	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	PCSK4_ENST00000587784.1_5'Flank|CTB-25B13.6_ENST00000585643.1_RNA	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4											cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCAGGCCGCCGTTGCCCGAG	0.711																																					p.G301S		.											.	PCSK4	90	0			c.G901A						.						66.0	56.0	60.0					19																	1487019		2203	4299	6502	SO:0001583	missense	54760	exon8			GGCCGCCGTTGCC	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.901G>A	19.37:g.1487019C>T	ENSP00000300954:p.Gly301Ser	50.0	0.0		69.0	4.0	NM_017573		Missense_Mutation	SNP	ENST00000300954.5	37	CCDS12069.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152669	0.78001	.	.	ENSG00000115257	ENST00000300954;ENST00000441747	T	0.80909	-1.43	3.08	3.08	0.35506	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.50627	U	0.000114	D	0.87378	0.6162	M	0.68728	2.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88684	0.3204	10	0.87932	D	0	.	13.0304	0.58839	0.0:1.0:0.0:0.0	.	301;113	Q6UW60;B3KQ28	PCSK4_HUMAN;.	S	301;113	ENSP00000300954:G301S	ENSP00000300954:G301S	G	-	1	0	PCSK4	1438019	1.000000	0.71417	0.999000	0.59377	0.462000	0.32619	5.804000	0.69135	1.434000	0.47414	0.491000	0.48974	GGC	.		0.711	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449703.1	NM_017573	
SALL1	6299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	51173735	51173735	+	Missense_Mutation	SNP	C	C	T	rs200755920		TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr16:51173735C>T	ENST00000251020.4	-	2	2431	c.2398G>A	c.(2398-2400)Gac>Aac	p.D800N	SALL1_ENST00000440970.1_Missense_Mutation_p.D703N|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	800					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAGTAGCTGTCGGGGACTGGG	0.507													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19268	0.0		0.0	False		,,,				2504	0.0				p.D800N	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1	98	0			c.G2398A						.						103.0	109.0	107.0					16																	51173735		2198	4300	6498	SO:0001583	missense	6299	exon2			AGCTGTCGGGGAC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2398G>A	16.37:g.51173735C>T	ENSP00000251020:p.Asp800Asn	144.0	0.0		133.0	10.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.62	2.590920	0.46214	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06687	3.27;3.28	5.34	5.34	0.76211	.	0.240013	0.48767	D	0.000161	T	0.08358	0.0208	L	0.43152	1.355	0.80722	D	1	P	0.42337	0.776	B	0.29942	0.109	T	0.26087	-1.0113	10	0.33940	T	0.23	.	19.0945	0.93244	0.0:1.0:0.0:0.0	.	800	Q9NSC2	SALL1_HUMAN	N	800;703;764	ENSP00000251020:D800N;ENSP00000407914:D703N	ENSP00000251020:D800N	D	-	1	0	SALL1	49731236	1.000000	0.71417	0.799000	0.32177	0.005000	0.04900	7.818000	0.86416	2.511000	0.84671	0.454000	0.30748	GAC	C|0.999;T|0.000		0.507	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
SGCZ	137868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	13948007	13948007	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr8:13948007G>T	ENST00000382080.1	-	8	1599	c.884C>A	c.(883-885)cCa>cAa	p.P295Q	SGCZ_ENST00000421524.2_Missense_Mutation_p.P248Q	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	282					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		TACTCCTGCTGGAGAAAGGTA	0.498																																					p.P295Q		.											.	SGCZ	93	0			c.C884A						.						175.0	159.0	164.0					8																	13948007		2203	4300	6503	SO:0001583	missense	137868	exon8			CCTGCTGGAGAAA	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.884C>A	8.37:g.13948007G>T	ENSP00000371512:p.Pro295Gln	66.0	0.0		66.0	5.0	NM_139167	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808692	0.50421	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.93953	-3.32;-3.32	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93936	0.8059	L	0.35414	1.06	0.50467	D	0.999871	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89947	0.4077	10	0.08381	T	0.77	.	18.7556	0.91832	0.0:0.0:1.0:0.0	.	248;295	Q08AT0;Q96LD1-2	.;.	Q	295;248	ENSP00000371512:P295Q;ENSP00000405224:P248Q	ENSP00000371512:P295Q	P	-	2	0	SGCZ	13992378	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.179000	0.71974	2.760000	0.94817	0.655000	0.94253	CCA	.		0.498	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	61607465	61607465	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr2:61607465G>A	ENST00000398571.2	-	7	929	c.853C>T	c.(853-855)Cga>Tga	p.R285*		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	285					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R285*(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GCACTCTGTCGTAACTCCTGA	0.368																																					p.R285X		.											.	USP34	579	1	Substitution - Nonsense(1)	urinary_tract(1)	c.C853T						.						106.0	92.0	96.0					2																	61607465		1891	4119	6010	SO:0001587	stop_gained	9736	exon7			TCTGTCGTAACTC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.853C>T	2.37:g.61607465G>A	ENSP00000381577:p.Arg285*	132.0	0.0		84.0	12.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Nonsense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	29.4	4.999830	0.93227	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	.	.	.	5.2	-0.0234	0.13943	.	0.117422	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0792	0.42379	0.0763:0.0:0.3927:0.5309	.	.	.	.	X	133;133;285	.	ENSP00000263989:R133X	R	-	1	2	USP34	61460969	1.000000	0.71417	0.999000	0.59377	0.908000	0.53690	1.038000	0.30254	0.171000	0.19730	0.557000	0.71058	CGA	.		0.368	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
ZFR2	23217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	3806099	3806099	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr19:3806099G>A	ENST00000262961.4	-	19	2678	c.2668C>T	c.(2668-2670)Cgg>Tgg	p.R890W		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	890	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TGGGTCTGCCGGAAGGCCAGC	0.706																																					p.R890W		.											.	ZFR2	70	0			c.C2668T						.						8.0	11.0	10.0					19																	3806099		1968	4122	6090	SO:0001583	missense	23217	exon19			TCTGCCGGAAGGC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.2668C>T	19.37:g.3806099G>A	ENSP00000262961:p.Arg890Trp	69.0	0.0		88.0	10.0	NM_015174		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315727	0.40996	.	.	ENSG00000105278	ENST00000262961	T	0.42131	0.98	3.42	0.39	0.16275	DZF (2);	0.000000	0.64402	U	0.000010	T	0.62768	0.2455	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63655	-0.6588	10	0.87932	D	0	-27.2308	8.1182	0.30955	0.0:0.0:0.4064:0.5936	.	890	Q9UPR6	ZFR2_HUMAN	W	890	ENSP00000262961:R890W	ENSP00000262961:R890W	R	-	1	2	ZFR2	3757099	1.000000	0.71417	0.998000	0.56505	0.136000	0.21042	0.971000	0.29396	0.229000	0.21039	0.643000	0.83706	CGG	.		0.706	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
ZNF700	90592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12059950	12059950	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr19:12059950T>C	ENST00000254321.5	+	4	1254	c.1111T>C	c.(1111-1113)Ttt>Ctt	p.F371L	ZNF700_ENST00000482090.1_Missense_Mutation_p.F353L|ZNF763_ENST00000590798.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	371					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						TGGGAAAGGCTTTTATTCTGC	0.363																																					p.F374L		.											.	ZNF700	90	0			c.T1120C						.						58.0	62.0	61.0					19																	12059950		2203	4299	6502	SO:0001583	missense	90592	exon4			AAAGGCTTTTATT	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1111T>C	19.37:g.12059950T>C	ENSP00000254321:p.Phe371Leu	69.0	0.0		68.0	9.0	NM_001271848	B9EGU4	Missense_Mutation	SNP	ENST00000254321.5	37	CCDS32915.1	.	.	.	.	.	.	.	.	.	.	t	15.68	2.904734	0.52333	.	.	ENSG00000196757	ENST00000254321	T	0.46063	0.88	0.672	0.672	0.17935	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64427	0.2597	M	0.89601	3.045	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.50021	-0.8876	9	0.66056	D	0.02	.	5.5733	0.17208	0.0:0.0:0.0:1.0	.	371	Q9H0M5	ZN700_HUMAN	L	371	ENSP00000254321:F371L	ENSP00000254321:F371L	F	+	1	0	ZNF700	11920950	0.560000	0.26570	0.003000	0.11579	0.526000	0.34562	1.795000	0.38784	0.524000	0.28502	0.254000	0.18369	TTT	.		0.363	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344126.2	NM_144566	
ZNF853	54753	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	6660769	6660769	+	Missense_Mutation	SNP	C	C	A	rs373055119		TCGA-RC-A6M5-01A-11D-A32G-10	TCGA-RC-A6M5-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5bc57f84-c45f-45a1-9a62-0e2972598fa7	76a1244e-bd30-4dbb-95ee-857b135bb56e	g.chr7:6660769C>A	ENST00000457543.3	+	3	705	c.147C>A	c.(145-147)agC>agA	p.S49R		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	49							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						GCGGTGGGAGCGAGAGTCAGG	0.607																																					p.S49R		.											.	.	.	0			c.C147A						.						19.0	22.0	21.0					7																	6660769		692	1591	2283	SO:0001583	missense	54753	exon3			TGGGAGCGAGAGT	AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.147C>A	7.37:g.6660769C>A	ENSP00000455585:p.Ser49Arg	42.0	0.0		45.0	5.0	NM_017560		Missense_Mutation	SNP	ENST00000457543.3	37	CCDS59048.1																																																																																			.		0.607	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324169.2	NM_017560	
