#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	18888005	18888005	+	Frame_Shift_Del	DEL	G	G	-			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr9:18888005delG	ENST00000380548.4	+	24	4765	c.4426delG	c.(4426-4428)gggfs	p.G1476fs	ADAMTSL1_ENST00000380545.5_Frame_Shift_Del_p.G177fs	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1476	Ig-like C2-type 4.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GAATGAGGCAGGGGTGCTCAT	0.493																																					p.G1476fs		.											.	ADAMTSL1	230	0			c.4426delG						.						75.0	70.0	71.0					9																	18888005		1936	4146	6082	SO:0001589	frameshift_variant	92949	exon24			GAGGCAGGGGTGC	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4426delG	9.37:g.18888005delG	ENSP00000369921:p.Gly1476fs	109.0	0.0		96.0	16.0	NM_001040272	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Frame_Shift_Del	DEL	ENST00000380548.4	37	CCDS47954.1																																																																																			.		0.493	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
ADH1B	125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100232814	100232814	+	Splice_Site	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:100232814C>T	ENST00000305046.8	-	7	896		c.e7-1		ADH1B_ENST00000394887.3_Splice_Site			P00325	ADH1B_HUMAN	alcohol dehydrogenase 1B (class I), beta polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	33				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	GGGAAGCCATCTGGAATAAAG	0.443																																					.		.											.	ADH1B	136	0			c.829-1G>A						.						182.0	168.0	173.0					4																	100232814		2203	4300	6503	SO:0001630	splice_region_variant	125	exon8			AGCCATCTGGAAT	AF153821	CCDS34033.1, CCDS68761.1	4q23	2008-02-05	2007-11-06		ENSG00000196616	ENSG00000196616	1.1.1.1	"""Alcohol dehydrogenases"""	250	protein-coding gene	gene with protein product		103720		ADH2		3006456	Standard	NM_000668		Approved		uc003hus.4	P00325	OTTHUMG00000161413	ENST00000305046.8:c.829-1G>A	4.37:g.100232814C>T		65.0	0.0		59.0	7.0	NM_000668	A8MYN5|B4DRS9|B4DVC3|Q13711|Q4ZGI9|Q96KI7	Splice_Site	SNP	ENST00000305046.8	37	CCDS34033.1	.	.	.	.	.	.	.	.	.	.	.	27.3	4.816068	0.90790	.	.	ENSG00000196616	ENST00000305046;ENST00000394887;ENST00000412614	.	.	.	3.66	3.66	0.41972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3228	0.74135	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADH1B	100451837	1.000000	0.71417	0.172000	0.22920	0.940000	0.58332	4.674000	0.61612	1.722000	0.51474	0.561000	0.74099	.	.		0.443	ADH1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364853.1	NM_000668	Intron
ADNP2	22850	broad.mit.edu;bcgsc.ca	37	18	77896513	77896513	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr18:77896513A>G	ENST00000262198.4	+	4	3672	c.3217A>G	c.(3217-3219)Ata>Gta	p.I1073V		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	1073					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		TAAAAAGGAAATAGAACTGTT	0.308																																					p.I1073V		.											.	ADNP2	140	0			c.A3217G						.						53.0	58.0	56.0					18																	77896513		2198	4295	6493	SO:0001583	missense	22850	exon4			AAGGAAATAGAAC	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.3217A>G	18.37:g.77896513A>G	ENSP00000262198:p.Ile1073Val	65.0	0.0		62.0	4.0	NM_014913	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	ENST00000262198.4	37	CCDS32853.1	.	.	.	.	.	.	.	.	.	.	A	8.209	0.799960	0.16397	.	.	ENSG00000101544	ENST00000262198	D	0.91843	-2.92	4.75	-0.523	0.11924	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.327747	0.29572	N	0.011762	T	0.80204	0.4580	N	0.21194	0.64	0.34208	D	0.673997	B	0.06786	0.001	B	0.09377	0.004	T	0.64419	-0.6412	9	.	.	.	-11.4353	2.4686	0.04559	0.3939:0.35:0.1426:0.1136	.	1073	Q6IQ32	ADNP2_HUMAN	V	1073	ENSP00000262198:I1073V	.	I	+	1	0	ADNP2	75997504	0.179000	0.23135	0.970000	0.41538	0.776000	0.43924	-0.211000	0.09332	-0.222000	0.09958	-0.488000	0.04728	ATA	.		0.308	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418979.1	NM_014913	
AFTPH	54812	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	64779926	64779926	+	Missense_Mutation	SNP	T	T	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:64779926T>G	ENST00000422803.1	+	2	1632	c.1318T>G	c.(1318-1320)Tct>Gct	p.S440A	AFTPH_ENST00000409183.1_Missense_Mutation_p.S71A|AFTPH_ENST00000238855.7_Missense_Mutation_p.S440A|AFTPH_ENST00000409933.1_Missense_Mutation_p.S440A|AFTPH_ENST00000238856.4_Missense_Mutation_p.S440A			Q6ULP2	AFTIN_HUMAN	aftiphilin	440					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						TGACTTTGGCTCTGCCAGTGG	0.378																																					p.S440A		.											.	AFTPH	70	0			c.T1318G						.						188.0	181.0	183.0					2																	64779926		2203	4300	6503	SO:0001583	missense	54812	exon2			TTTGGCTCTGCCA	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.1318T>G	2.37:g.64779926T>G	ENSP00000397726:p.Ser440Ala	69.0	0.0		67.0	5.0	NM_017657	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	37		.	.	.	.	.	.	.	.	.	.	A	3.296	-0.143865	0.06627	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.42513	1.91;1.91;1.97;1.97;0.97	5.76	5.76	0.90799	.	0.058741	0.64402	D	0.000005	T	0.29423	0.0733	N	0.19112	0.55	0.20489	N	0.999898	B;B;B;B	0.13145	0.007;0.007;0.0;0.0	B;B;B;B	0.16289	0.015;0.015;0.003;0.001	T	0.21008	-1.0258	10	0.51188	T	0.08	-6.8951	11.0548	0.47911	0.7531:0.0:0.0:0.2469	.	440;440;440;440	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	A	440;440;440;440;71	ENSP00000238856:S440A;ENSP00000397726:S440A;ENSP00000238855:S440A;ENSP00000387071:S440A;ENSP00000386913:S71A	ENSP00000238855:S440A	S	+	1	0	AFTPH	64633430	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.013000	0.40942	1.115000	0.41800	-0.265000	0.10407	TCT	.		0.378	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657	
ALS2CR11	151254	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	202436741	202436741	+	Silent	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:202436741T>C	ENST00000286195.3	-	8	800	c.756A>G	c.(754-756)ttA>ttG	p.L252L	ALS2CR11_ENST00000439802.1_Silent_p.L252L|ALS2CR11_ENST00000450242.1_Silent_p.L252L|ALS2CR11_ENST00000439140.1_Silent_p.L252L	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	252										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						GAAGAGGTTTTAACTGAAAAA	0.328																																					p.L252L		.											.	ALS2CR11	155	0			c.A756G						.						94.0	92.0	92.0					2																	202436741		2203	4300	6503	SO:0001819	synonymous_variant	151254	exon8			AGGTTTTAACTGA	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.756A>G	2.37:g.202436741T>C		36.0	0.0		54.0	14.0	NM_001168217	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Silent	SNP	ENST00000286195.3	37	CCDS2349.1																																																																																			.		0.328	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256296.2	NM_152525	
ANK2	287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	114275909	114275909	+	Silent	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:114275909A>G	ENST00000357077.4	+	38	6188	c.6135A>G	c.(6133-6135)acA>acG	p.T2045T	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Silent_p.T2012T|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2045					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTCAGAAAACAGAGAATCAGA	0.453																																					p.T2045T		.											.	ANK2	583	0			c.A6135G						.						61.0	71.0	68.0					4																	114275909		2203	4300	6503	SO:0001819	synonymous_variant	287	exon38			GAAAACAGAGAAT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6135A>G	4.37:g.114275909A>G		154.0	0.0		151.0	40.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1																																																																																			.		0.453	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANKRD32	84250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	94022288	94022288	+	Silent	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:94022288A>G	ENST00000265140.5	+	16	2405	c.1986A>G	c.(1984-1986)tcA>tcG	p.S662S		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	662						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		ACTTTTCTTCACAGGAATTAG	0.363																																					p.S662S		.											.	ANKRD32	92	0			c.A1986G						.						168.0	169.0	169.0					5																	94022288		2203	4300	6503	SO:0001819	synonymous_variant	84250	exon16			TTCTTCACAGGAA	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1986A>G	5.37:g.94022288A>G		34.0	0.0		67.0	14.0	NM_032290	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Silent	SNP	ENST00000265140.5	37	CCDS4071.2																																																																																			.		0.363	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
ASPRV1	151516	hgsc.bcm.edu;broad.mit.edu	37	2	70188307	70188356	+	Frame_Shift_Del	DEL	AGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGG	AGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGG	-	rs139245310|rs142181991		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	AGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGG	AGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:70188307_70188356delAGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGG	ENST00000320256.4	-	1	1041_1090	c.465_514delCCAGGACCAGGGAGACTATGGGACTGTGAAAGAGGCCCTCCTGAAGGCCT	c.(463-516)ccccaggaccagggagactatgggactgtgaaagaggccctcctgaaggcctttfs	p.QDQGDYGTVKEALLKAF156fs	PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						GGGACCCCAAAGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGGGGACTGAGCC	0.552																																					p.155_172del		.											.	ASPRV1	69	0			c.465_514del						.																																			SO:0001589	frameshift_variant	151516	exon1			CCCCAAAGGCCTT	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.465_514delCCAGGACCAGGGAGACTATGGGACTGTGAAAGAGGCCCTCCTGAAGGCCT	2.37:g.70188307_70188356delAGGCCTTCAGGAGGGCCTCTTTCACAGTCCCATAGTCTCCCTGGTCCTGG	ENSP00000315383:p.Gln156fs	65.0	0.0		70.0	7.0	NM_152792		Frame_Shift_Del	DEL	ENST00000320256.4	37	CCDS1897.1																																																																																			.		0.552	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
ATG4C	84938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	63294791	63294791	+	Missense_Mutation	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:63294791G>T	ENST00000317868.4	+	7	1084	c.877G>T	c.(877-879)Gtt>Ttt	p.V293F	ATG4C_ENST00000371120.3_Missense_Mutation_p.V293F	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	293					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)		ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						TATTATTCTAGTTCCTGTTAG	0.338																																					p.V293F		.											.	ATG4C	91	0			c.G877T						.						78.0	81.0	80.0					1																	63294791		2203	4300	6503	SO:0001583	missense	84938	exon7			ATTCTAGTTCCTG	AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.877G>T	1.37:g.63294791G>T	ENSP00000322159:p.Val293Phe	107.0	0.0		116.0	27.0	NM_178221	A6NLR8|D3DQ58|Q96K04	Missense_Mutation	SNP	ENST00000317868.4	37	CCDS623.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010711	0.54361	.	.	ENSG00000125703	ENST00000317868;ENST00000371120;ENST00000540025;ENST00000414558	T;T	0.50548	0.74;0.74	5.69	4.75	0.60458	.	0.169554	0.52532	D	0.000074	T	0.35068	0.0919	M	0.67625	2.065	0.52501	D	0.999957	B	0.31931	0.347	B	0.40677	0.337	T	0.36212	-0.9757	10	0.42905	T	0.14	-17.2154	7.5205	0.27624	0.1492:0.0:0.7162:0.1346	.	293	Q96DT6	ATG4C_HUMAN	F	293;293;293;37	ENSP00000322159:V293F;ENSP00000360161:V293F	ENSP00000322159:V293F	V	+	1	0	ATG4C	63067379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.394000	0.44450	1.334000	0.45468	0.655000	0.94253	GTT	.		0.338	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2	NM_032852	
C3orf27	23434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	128292489	128292489	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr3:128292489G>A	ENST00000356020.2	-	3	1050	c.84C>T	c.(82-84)cgC>cgT	p.R28R		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	28										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		GTCCCTGGAGGCGGGAGACGC	0.607																																					p.R28R		.											.	C3orf27	90	0			c.C84T						.						29.0	30.0	29.0					3																	128292489		2203	4297	6500	SO:0001819	synonymous_variant	23434	exon3			CTGGAGGCGGGAG	AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.84C>T	3.37:g.128292489G>A		126.0	0.0		115.0	24.0	NM_007354		Silent	SNP	ENST00000356020.2	37	CCDS3050.1																																																																																			.		0.607	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356924.1	NM_007354	
CCDC125	202243	hgsc.bcm.edu;bcgsc.ca	37	5	68595919	68595919	+	Missense_Mutation	SNP	G	G	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:68595919G>C	ENST00000396496.2	-	8	843	c.736C>G	c.(736-738)Ctt>Gtt	p.L246V	CCDC125_ENST00000511257.1_Missense_Mutation_p.L121V|CCDC125_ENST00000460090.1_5'UTR|CCDC125_ENST00000396499.1_Missense_Mutation_p.L246V|CCDC125_ENST00000383374.2_Missense_Mutation_p.L245V			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	246						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TTGATATCAAGCATGGCGAGG	0.443																																					p.L246V		.											.	CCDC125	90	0			c.C736G						.						242.0	222.0	229.0					5																	68595919		2203	4300	6503	SO:0001583	missense	202243	exon7			TATCAAGCATGGC	AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.736C>G	5.37:g.68595919G>C	ENSP00000379754:p.Leu246Val	71.0	0.0		110.0	6.0	NM_176816	Q86Z19	Missense_Mutation	SNP	ENST00000396496.2	37	CCDS4000.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780943	0.70222	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374;ENST00000511257	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.79975	0.4539	M	0.77103	2.36	0.45183	D	0.998191	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.82583	-0.0385	10	0.72032	D	0.01	-0.1671	17.3807	0.87404	0.0:0.0:1.0:0.0	.	121;246	Q86Z20-2;Q86Z20	.;CC125_HUMAN	V	246;246;245;121	ENSP00000379754:L246V;ENSP00000379756:L246V;ENSP00000372865:L245V;ENSP00000426795:L121V	ENSP00000372865:L245V	L	-	1	0	CCDC125	68631675	1.000000	0.71417	0.998000	0.56505	0.798000	0.45092	6.815000	0.75242	2.486000	0.83907	0.591000	0.81541	CTT	.		0.443	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254027.4	NM_176816	
CCR6	1235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167550515	167550515	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:167550515G>A	ENST00000341935.5	+	3	1349	c.797G>A	c.(796-798)tGt>tAt	p.C266Y	CCR6_ENST00000349984.4_Missense_Mutation_p.C266Y|RP11-517H2.6_ENST00000609590.1_RNA|CCR6_ENST00000400926.2_Missense_Mutation_p.C266Y	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	266					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		TTTCTGGCTTGTCAGATTCCT	0.438																																					p.C266Y		.											.	CCR6	227	0			c.G797A						.						161.0	159.0	159.0					6																	167550515		2203	4300	6503	SO:0001583	missense	1235	exon3			TGGCTTGTCAGAT	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.797G>A	6.37:g.167550515G>A	ENSP00000343952:p.Cys266Tyr	58.0	0.0		77.0	16.0	NM_004367	E1P5C6|P78553|Q92846	Missense_Mutation	SNP	ENST00000341935.5	37	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647476	0.47258	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.54279	0.58;0.58;0.58	4.79	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	U	0.000000	T	0.62073	0.2398	H	0.96175	3.78	0.80722	D	1	P	0.40211	0.707	P	0.49421	0.61	T	0.70389	-0.4885	10	0.11794	T	0.64	.	13.1531	0.59500	0.0:0.0:0.8397:0.1603	.	266	P51684	CCR6_HUMAN	Y	266	ENSP00000383715:C266Y;ENSP00000343952:C266Y;ENSP00000339393:C266Y	ENSP00000343952:C266Y	C	+	2	0	CCR6	167470505	1.000000	0.71417	0.876000	0.34364	0.613000	0.37349	6.894000	0.75655	2.345000	0.79718	0.655000	0.94253	TGT	.		0.438	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1		
CD200R1	131450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112648003	112648003	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr3:112648003G>A	ENST00000440122.2	-	4	608	c.554C>T	c.(553-555)tCa>tTa	p.S185L	CD200R1_ENST00000490004.1_Missense_Mutation_p.S162L|CD200R1_ENST00000308611.3_Intron|CD200R1_ENST00000295863.4_Intron|CD200R1_ENST00000471858.1_Intron	NM_138939.2	NP_620385.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	0	Ig-like C2-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						CAAATCTGGTGATGTGAAATA	0.393																																					p.S185L		.											.	CD200R1	93	0			c.C554T						.						76.0	72.0	73.0					3																	112648003		2203	4300	6503	SO:0001583	missense	131450	exon4			TCTGGTGATGTGA	AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000440122.2:c.554C>T	3.37:g.112648003G>A	ENSP00000405733:p.Ser185Leu	72.0	0.0		80.0	11.0	NM_138939	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	ENST00000440122.2	37	CCDS46889.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360691	0.24598	.	.	ENSG00000163606	ENST00000440122;ENST00000490004	T;T	0.26067	1.76;1.81	4.77	0.0763	0.14402	.	.	.	.	.	T	0.17109	0.0411	.	.	.	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.001;0.002	T	0.25606	-1.0127	8	0.87932	D	0	.	5.0056	0.14286	0.3404:0.0:0.4207:0.2389	.	162;185	Q8TD46-3;Q8TD46-2	.;.	L	185;162	ENSP00000405733:S185L;ENSP00000418801:S162L	ENSP00000405733:S185L	S	-	2	0	CD200R1	114130693	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.289000	0.18957	-0.138000	0.11434	-0.259000	0.10710	TCA	.		0.393	CD200R1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354468.1	NM_138806	
CD69	969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	9906144	9906144	+	Missense_Mutation	SNP	T	T	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:9906144T>G	ENST00000228434.3	-	5	613	c.533A>C	c.(532-534)aAc>aCc	p.N178T		NM_001781.2	NP_001772.1	Q07108	CD69_HUMAN	CD69 molecule	178	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular response to drug (GO:0035690)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10						GACCTCTGTGTTTTTCAGAAA	0.318																																					p.N178T		.											.	CD69	90	0			c.A533C						.						58.0	57.0	58.0					12																	9906144		2203	4300	6503	SO:0001583	missense	969	exon5			TCTGTGTTTTTCA	Z22576	CCDS8604.1	12p13	2011-08-30	2006-03-28		ENSG00000110848	ENSG00000110848		"""C-type lectin domain containing"", ""CD molecules"""	1694	protein-coding gene	gene with protein product		107273	"""CD69 antigen (p60, early T-cell activation antigen)"""			1612643	Standard	NM_001781		Approved	CLEC2C	uc001qwk.3	Q07108	OTTHUMG00000168481	ENST00000228434.3:c.533A>C	12.37:g.9906144T>G	ENSP00000228434:p.Asn178Thr	97.0	0.0		123.0	15.0	NM_001781		Missense_Mutation	SNP	ENST00000228434.3	37	CCDS8604.1	.	.	.	.	.	.	.	.	.	.	T	10.05	1.244243	0.22796	.	.	ENSG00000110848	ENST00000228434	T	0.18810	2.19	5.13	1.1	0.20463	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.750716	0.12665	N	0.449289	T	0.15089	0.0364	L	0.46567	1.45	0.09310	N	0.999999	B	0.12630	0.006	B	0.13407	0.009	T	0.27905	-1.0060	9	.	.	.	-6.4483	3.6254	0.08111	0.0:0.4853:0.1904:0.3243	.	178	Q07108	CD69_HUMAN	T	178	ENSP00000228434:N178T	.	N	-	2	0	CD69	9797411	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.033000	0.12246	0.362000	0.24319	-0.248000	0.11899	AAC	.		0.318	CD69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399876.1		
CHST1	8534	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	45671573	45671573	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:45671573G>A	ENST00000308064.2	-	4	1571	c.901C>T	c.(901-903)Cgc>Tgc	p.R301C	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	301					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		TCCTCGTAGCGCACCAACATG	0.632																																					p.R301C		.											.	CHST1	95	0			c.C901T						.						81.0	73.0	76.0					11																	45671573		2203	4299	6502	SO:0001583	missense	8534	exon4			CGTAGCGCACCAA	U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.901C>T	11.37:g.45671573G>A	ENSP00000309270:p.Arg301Cys	61.0	1.0		49.0	13.0	NM_003654	D3DQP2	Missense_Mutation	SNP	ENST00000308064.2	37	CCDS7913.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383293	0.61845	.	.	ENSG00000175264	ENST00000308064	D	0.84070	-1.8	4.89	4.89	0.63831	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.92378	0.7581	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93642	0.6965	10	0.87932	D	0	-21.8379	11.933	0.52857	0.0:0.0:0.6953:0.3047	.	301	O43916	CHST1_HUMAN	C	301	ENSP00000309270:R301C	ENSP00000309270:R301C	R	-	1	0	CHST1	45628149	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.503000	0.53340	2.252000	0.74401	0.462000	0.41574	CGC	.		0.632	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390127.1	NM_003654	
CLSTN3	9746	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	7295867	7295867	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:7295867A>G	ENST00000266546.6	+	12	2257	c.1807A>G	c.(1807-1809)Acg>Gcg	p.T603A	CLSTN3_ENST00000537408.1_Missense_Mutation_p.T615A	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	603					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GCGCTTTGCCACGCCCGGCGT	0.607																																					p.T603A		.											.	CLSTN3	153	0			c.A1807G						.						103.0	94.0	97.0					12																	7295867		2203	4300	6503	SO:0001583	missense	9746	exon12			TTTGCCACGCCCG	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1807A>G	12.37:g.7295867A>G	ENSP00000266546:p.Thr603Ala	36.0	0.0		30.0	12.0	NM_014718	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	ENST00000266546.6	37	CCDS8575.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.752892	0.89753	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.35048	1.33;1.33	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	0.984;1.0	D;D	0.91635	0.956;0.999	T	0.66826	-0.5825	10	0.54805	T	0.06	-14.9912	15.0982	0.72253	1.0:0.0:0.0:0.0	.	615;603	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	A	603;615	ENSP00000266546:T603A;ENSP00000440679:T615A	ENSP00000266546:T603A	T	+	1	0	CLSTN3	7187134	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.710000	0.91388	1.964000	0.57103	0.379000	0.24179	ACG	.		0.607	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398560.2	NM_014718	
CNTN1	1272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	41422971	41422971	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:41422971G>A	ENST00000551295.2	+	23	3047	c.2930G>A	c.(2929-2931)cGc>cAc	p.R977H	CNTN1_ENST00000348761.2_Missense_Mutation_p.R966H|CNTN1_ENST00000347616.1_Missense_Mutation_p.R977H	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	977	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.R977H(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GTGGAGGTTCGCGCGCACAGT	0.448																																					p.R977H		.											.	CNTN1	1149	1	Substitution - Missense(1)	kidney(1)	c.G2930A						.						229.0	213.0	218.0					12																	41422971		2203	4300	6503	SO:0001583	missense	1272	exon23			AGGTTCGCGCGCA	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2930G>A	12.37:g.41422971G>A	ENSP00000447006:p.Arg977His	95.0	0.0		114.0	33.0	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990461	0.74589	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.46063	0.88;0.88;0.88	5.18	5.18	0.71444	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	M	0.78456	2.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.71027	-0.4711	10	0.66056	D	0.02	.	19.0769	0.93167	0.0:0.0:1.0:0.0	.	966;977	Q12860-2;Q12860	.;CNTN1_HUMAN	H	977;977;966	ENSP00000447006:R977H;ENSP00000325660:R977H;ENSP00000261160:R966H	ENSP00000325660:R977H	R	+	2	0	CNTN1	39709238	1.000000	0.71417	0.996000	0.52242	0.298000	0.27526	8.779000	0.91792	2.588000	0.87417	0.591000	0.81541	CGC	.		0.448	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
CNTROB	116840	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7851880	7851898	+	Frame_Shift_Del	DEL	GGGGGGCTCTGCCTGCTGA	GGGGGGCTCTGCCTGCTGA	-	rs541448932		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	GGGGGGCTCTGCCTGCTGA	GGGGGGCTCTGCCTGCTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr17:7851880_7851898delGGGGGGCTCTGCCTGCTGA	ENST00000563694.1	+	17	3381_3399	c.2456_2474delGGGGGGCTCTGCCTGCTGA	c.(2455-2475)tggggggctctgcctgctgagfs	p.WGALPAE819fs	CNTROB_ENST00000380262.3_Frame_Shift_Del_p.WGALPAE819fs|CNTROB_ENST00000380255.3_3'UTR|CNTROB_ENST00000565740.1_Frame_Shift_Del_p.WGALPAE819fs	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	819	Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				GCTCGGGGCTGGGGGGCTCTGCCTGCTGAGGATCTCCTG	0.575																																					p.819_825del		.											.	CNTROB	153	0			c.2456_2474del						.																																			SO:0001589	frameshift_variant	116840	exon17			GGGGCTGGGGGGC	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.2456_2474delGGGGGGCTCTGCCTGCTGA	17.37:g.7851880_7851898delGGGGGGCTCTGCCTGCTGA	ENSP00000456335:p.Trp819fs	150.0	0.0		91.0	20.0	NM_001037144	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Frame_Shift_Del	DEL	ENST00000563694.1	37	CCDS11126.1																																																																																			.		0.575	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
COL5A1	1289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	137713941	137713941	+	Splice_Site	SNP	A	A	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr9:137713941A>T	ENST00000371817.3	+	59	4968		c.e59-1			NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGTCCTTTTCAGGGTATCACT	0.632																																					.		.											.	COL5A1	524	0			c.4555-2A>T						.						103.0	96.0	99.0					9																	137713941		2203	4300	6503	SO:0001630	splice_region_variant	1289	exon59			CTTTTCAGGGTAT	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4555-1A>T	9.37:g.137713941A>T		25.0	0.0		28.0	9.0	NM_000093	Q15094|Q5SUX4	Splice_Site	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.914326	0.72983	.	.	ENSG00000130635	ENST00000371817;ENST00000355306	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8131	0.63274	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL5A1	136853762	1.000000	0.71417	0.883000	0.34634	0.913000	0.54294	9.171000	0.94802	1.739000	0.51704	0.448000	0.29417	.	.		0.632	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	Intron
CPA6	57094	hgsc.bcm.edu;bcgsc.ca	37	8	68658304	68658304	+	Missense_Mutation	SNP	A	A	G	rs147067921		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr8:68658304A>G	ENST00000297770.4	-	1	276	c.61T>C	c.(61-63)Ttt>Ctt	p.F21L	CPA6_ENST00000518549.1_Missense_Mutation_p.F21L|CPA6_ENST00000297769.4_5'UTR	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	21						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			ATCTTCAAAAAGAGCCAGCAA	0.502																																					p.F21L		.											.	CPA6	92	0			c.T61C						.						49.0	48.0	49.0					8																	68658304		2203	4300	6503	SO:0001583	missense	57094	exon1			TCAAAAAGAGCCA	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.61T>C	8.37:g.68658304A>G	ENSP00000297770:p.Phe21Leu	126.0	0.0		225.0	13.0	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	A	6.770	0.511021	0.12883	.	.	ENSG00000165078	ENST00000297770;ENST00000518549	T;T	0.34072	1.38;1.38	5.62	-1.87	0.07737	.	0.549980	0.17929	N	0.157246	T	0.13372	0.0324	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.40627	-0.9553	10	0.02654	T	1	.	10.1243	0.42641	0.4579:0.0:0.5421:0.0	.	21;21	Q8N4T0-2;Q8N4T0	.;CBPA6_HUMAN	L	21	ENSP00000297770:F21L;ENSP00000431112:F21L	ENSP00000297770:F21L	F	-	1	0	CPA6	68820858	0.953000	0.32496	0.987000	0.45799	0.997000	0.91878	-0.102000	0.10956	-0.311000	0.08754	0.533000	0.62120	TTT	A|1.000;T|0.000		0.502	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0	CTNNB1	24361	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	3.37:g.41266136T>C	ENSP00000344456:p.Ser45Pro	129.0	0.0		159.0	60.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTR9	9646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10785358	10785358	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:10785358G>A	ENST00000361367.2	+	9	1552	c.1126G>A	c.(1126-1128)Gaa>Aaa	p.E376K		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	376					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TAATAATTACGAAACTATGAA	0.348																																					p.E376K		.											.	CTR9	92	0			c.G1126A						.						77.0	83.0	81.0					11																	10785358		2201	4294	6495	SO:0001583	missense	9646	exon9			AATTACGAAACTA	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.1126G>A	11.37:g.10785358G>A	ENSP00000355013:p.Glu376Lys	55.0	0.0		64.0	8.0	NM_014633	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769608	0.90020	.	.	ENSG00000198730	ENST00000361367	T	0.52057	0.68	5.62	4.71	0.59529	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.70842	0.3270	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	T	0.76846	-0.2808	10	0.56958	D	0.05	-28.0406	15.0528	0.71888	0.0687:0.0:0.9313:0.0	.	376	Q6PD62	CTR9_HUMAN	K	376	ENSP00000355013:E376K	ENSP00000355013:E376K	E	+	1	0	CTR9	10741934	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.674000	0.98633	1.513000	0.48852	0.655000	0.94253	GAA	.		0.348	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
CYB5D2	124936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4058038	4058038	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr17:4058038G>A	ENST00000301391.3	+	3	962	c.462G>A	c.(460-462)gcG>gcA	p.A154A	CYB5D2_ENST00000575251.1_Silent_p.A42A|CYB5D2_ENST00000573984.1_Silent_p.A42A|CYB5D2_ENST00000575411.2_3'UTR	NM_144611.3	NP_653212.1	Q8WUJ1	NEUFC_HUMAN	cytochrome b5 domain containing 2	154					nervous system development (GO:0007399)	extracellular region (GO:0005576)	heme binding (GO:0020037)			breast(1)|large_intestine(3)|liver(2)|ovary(1)	7						TAGAAGCTGCGATCACCAGAG	0.612																																					p.A154A		.											.	CYB5D2	155	0			c.G462A						.						60.0	57.0	58.0					17																	4058038		2203	4300	6503	SO:0001819	synonymous_variant	124936	exon3			AGCTGCGATCACC	AK172844	CCDS11044.1, CCDS58501.1	17p13.2	2006-03-10							28471	protein-coding gene	gene with protein product							Standard	NM_144611		Approved	MGC32124	uc002fxm.4	Q8WUJ1		ENST00000301391.3:c.462G>A	17.37:g.4058038G>A		148.0	0.0		110.0	43.0	NM_144611	B2R7R6|D3DTJ9|I3L1K2	Silent	SNP	ENST00000301391.3	37	CCDS11044.1																																																																																			.		0.612	CYB5D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438698.1	NM_144611	
DCAF12	25853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34089528	34089528	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr9:34089528A>G	ENST00000361264.4	-	8	1426	c.1085T>C	c.(1084-1086)cTg>cCg	p.L362P	RP11-537H15.3_ENST00000448245.1_RNA	NM_015397.3	NP_056212.1	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	362					protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						ATAGAACAGCAGGGAGCCCTG	0.512																																					p.L362P		.											.	DCAF12	90	0			c.T1085C						.						87.0	79.0	81.0					9																	34089528		2203	4300	6503	SO:0001583	missense	25853	exon8			AACAGCAGGGAGC	AB067479	CCDS6549.1	9p11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000198876	ENSG00000198876		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	19911	protein-coding gene	gene with protein product	"""cancer/testis antigen 102"""		"""KIAA1892"", ""WD repeat domain 40A"""	KIAA1892, WDR40A		11572484, 9110174	Standard	NM_015397		Approved	DKFZP434O125, MGC1058, CT102, TCC52	uc003ztt.2	Q5T6F0	OTTHUMG00000019806	ENST00000361264.4:c.1085T>C	9.37:g.34089528A>G	ENSP00000355114:p.Leu362Pro	45.0	0.0		52.0	23.0	NM_015397	A8KA70|D3DRL6|Q5T6E9|Q5T6F1|Q6P3V0|Q7L4F8|Q96PZ5|Q9NXA9|Q9UFJ1	Missense_Mutation	SNP	ENST00000361264.4	37	CCDS6549.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.415234	0.83449	.	.	ENSG00000198876	ENST00000361264	T	0.68624	-0.34	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.81983	0.4938	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84951	0.0871	10	0.87932	D	0	-1.9753	14.2564	0.66055	1.0:0.0:0.0:0.0	.	362	Q5T6F0	DCA12_HUMAN	P	362	ENSP00000355114:L362P	ENSP00000355114:L362P	L	-	2	0	DCAF12	34079528	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.518000	0.90559	1.853000	0.53794	0.533000	0.62120	CTG	.		0.512	DCAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052133.2	NM_015397	
DEPDC5	9681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32234735	32234735	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr22:32234735C>T	ENST00000382112.3	+	26	2462	c.2392C>T	c.(2392-2394)Ctc>Ttc	p.L798F	DEPDC5_ENST00000400246.1_Missense_Mutation_p.L807F|DEPDC5_ENST00000400248.2_Missense_Mutation_p.L798F|DEPDC5_ENST00000535622.1_Missense_Mutation_p.L729F|DEPDC5_ENST00000382111.2_Missense_Mutation_p.L807F|DEPDC5_ENST00000382105.2_Missense_Mutation_p.L729F|RNU6-201P_ENST00000517100.1_RNA|DEPDC5_ENST00000266091.3_Missense_Mutation_p.L807F|DEPDC5_ENST00000400249.2_Missense_Mutation_p.L798F	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	807					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTGCCAACGTCTCATGCAGGG	0.512																																					p.L807F		.											.	DEPDC5	519	0			c.C2419T						.						137.0	141.0	140.0					22																	32234735		1988	4163	6151	SO:0001583	missense	9681	exon27			CAACGTCTCATGC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2392C>T	22.37:g.32234735C>T	ENSP00000371546:p.Leu798Phe	87.0	0.0		58.0	20.0	NM_001242896	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.629521|4.629521	0.87660|0.87660	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248|ENST00000433147	T;T;T;T;T;T;T;T|.	0.22945|.	1.93;1.93;1.93;1.93;1.93;1.93;1.93;1.93|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76076|0.76076	0.3937|0.3937	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;0.999|.	D;D;D;D;D;D|.	0.91635|.	0.998;0.999;0.997;0.999;0.999;0.997|.	T|T	0.74472|0.74472	-0.3654|-0.3654	10|5	0.62326|.	D|.	0.03|.	.|.	18.7211|18.7211	0.91694|0.91694	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	128;807;729;807;798;798|.	B4DSS1;B9EGN9;B4DH93;O75140-4;A8MPX9;O75140|.	.;.;.;.;.;DEPD5_HUMAN|.	F|F	729;807;798;729;807;729;798;807;798|204	ENSP00000440210:L729F;ENSP00000266091:L807F;ENSP00000383108:L798F;ENSP00000383105:L807F;ENSP00000371539:L729F;ENSP00000371546:L798F;ENSP00000371545:L807F;ENSP00000383107:L798F|.	ENSP00000266091:L807F|.	L|S	+|+	1|2	0|0	DEPDC5|DEPDC5	30564735|30564735	0.975000|0.975000	0.34042|0.34042	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	2.349000|2.349000	0.44054|0.44054	2.663000|2.663000	0.90544|0.90544	0.655000|0.655000	0.94253|0.94253	CTC|TCT	.		0.512	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
DHX15	1665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	24531241	24531241	+	Silent	SNP	T	T	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:24531241T>A	ENST00000336812.4	-	13	2409	c.2253A>T	c.(2251-2253)acA>acT	p.T751T	DHX15_ENST00000508032.1_5'UTR	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	751					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				GCTTGATATCTGTACATGTCC	0.393																																					p.T751T		.											.	DHX15	91	0			c.A2253T						.						150.0	133.0	139.0					4																	24531241		2203	4300	6503	SO:0001819	synonymous_variant	1665	exon13			GATATCTGTACAT	AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.2253A>T	4.37:g.24531241T>A		94.0	0.0		120.0	10.0	NM_001358	Q9NQT7	Silent	SNP	ENST00000336812.4	37	CCDS33966.1																																																																																			.		0.393	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38159367	38159367	+	Missense_Mutation	SNP	G	G	A	rs370658013		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr3:38159367G>A	ENST00000308059.6	+	33	4577	c.4556G>A	c.(4555-4557)cGg>cAg	p.R1519Q	DLEC1_ENST00000452631.2_Missense_Mutation_p.R1522Q|DLEC1_ENST00000346219.3_Missense_Mutation_p.R1519Q					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CACTACTTCCGGCTTATGGTC	0.602											OREG0015476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1519Q		.											.	DLEC1	161	0			c.G4556A						.	G	GLN/ARG,GLN/ARG	1,4115		0,1,2057	118.0	122.0	121.0		4556,4556	2.0	0.9	3		121	0,8428		0,0,4214	no	missense,missense	DLEC1	NM_007337.2,NM_007335.2	43,43	0,1,6271	AA,AG,GG		0.0,0.0243,0.0080	benign,benign	1519/1779,1519/1756	38159367	1,12543	2058	4214	6272	SO:0001583	missense	9940	exon33			ACTTCCGGCTTAT	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.4556G>A	3.37:g.38159367G>A	ENSP00000308597:p.Arg1519Gln	84.0	0.0	876	80.0	19.0	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738746	0.49045	2.43E-4	0.0	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.08282	3.15;3.11;3.37	4.79	1.96	0.26148	.	0.251014	0.31167	U	0.008124	T	0.06188	0.0160	L	0.38531	1.155	0.31254	N	0.693756	B;B;B;B;B	0.33238	0.403;0.403;0.319;0.403;0.403	B;B;B;B;B	0.29598	0.059;0.059;0.018;0.104;0.059	T	0.23048	-1.0199	10	0.27082	T	0.32	-6.2763	9.2735	0.37686	0.3006:0.0:0.6994:0.0	.	1522;1519;1519;1519;1519	F8W6T4;B1B5Y4;B7ZW06;Q9Y238-3;Q9Y238	.;.;.;.;DLEC1_HUMAN	Q	1519;1519;1522	ENSP00000308597:R1519Q;ENSP00000315914:R1519Q;ENSP00000410427:R1522Q	ENSP00000308597:R1519Q	R	+	2	0	DLEC1	38134371	1.000000	0.71417	0.893000	0.35052	0.978000	0.69477	0.820000	0.27323	0.093000	0.17368	0.650000	0.86243	CGG	.		0.602	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
EFCAB13	124989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	45452306	45452306	+	Missense_Mutation	SNP	C	C	T	rs144496511		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr17:45452306C>T	ENST00000331493.2	+	12	1757	c.1346C>T	c.(1345-1347)aCg>aTg	p.T449M	EFCAB13_ENST00000517484.1_Missense_Mutation_p.T353M	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	449						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.T449M(1)									GTTTCGTCTACGGAAAAAACT	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		16716	0.001		0.0	False		,,,				2504	0.0				p.T449M		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.C1346T						.						41.0	41.0	41.0					17																	45452306		2203	4300	6503	SO:0001583	missense	124989	exon12			CGTCTACGGAAAA	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1346C>T	17.37:g.45452306C>T	ENSP00000332111:p.Thr449Met	149.0	0.0		184.0	8.0	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	7.202	0.593759	0.13875	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	T;T	0.66099	0.19;-0.19	3.56	0.00927	0.14078	.	1.291600	0.05091	N	0.485211	T	0.28665	0.0710	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.29862	0.003;0.259;0.007	B;B;B	0.14578	0.001;0.011;0.003	T	0.11155	-1.0599	9	.	.	.	-3.0787	4.0261	0.09688	0.4444:0.195:0.0:0.3605	.	401;449;353	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	M	449;353;401	ENSP00000332111:T449M;ENSP00000430048:T353M	.	T	+	2	0	C17orf57	42807305	0.917000	0.31117	0.103000	0.21229	0.041000	0.13682	1.059000	0.30517	-0.044000	0.13491	-1.522000	0.00932	ACG	C|0.999;T|0.001		0.358	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38409153	38409153	+	Silent	SNP	C	C	T	rs375160813		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:38409153C>T	ENST00000354891.3	+	10	1642	c.1296C>T	c.(1294-1296)caC>caT	p.H432H	EGFLAM_ENST00000322350.5_Silent_p.H432H|EGFLAM_ENST00000336740.6_Silent_p.H198H|EGFLAM_ENST00000397202.2_Intron	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	432	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGAACGAACACGGGAGGGGGG	0.488																																					p.H432H	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.C1296T						.	C	,,	1,4405		0,1,2202	81.0	77.0	78.0		1296,1296,594	-5.8	0.0	5		78	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	EGFLAM	NM_001205301.1,NM_152403.3,NM_182798.2	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	432/1018,432/1010,198/776	38409153	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	133584	exon10			CGAACACGGGAGG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1296C>T	5.37:g.38409153C>T		66.0	0.0		67.0	14.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																			.		0.488	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
FAM171A1	221061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15255230	15255230	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr10:15255230G>A	ENST00000378116.4	-	8	2363	c.2357C>T	c.(2356-2358)aCg>aTg	p.T786M	FAM171A1_ENST00000477161.1_5'Flank	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	786						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CACGAGCTGCGTGTAGGCCGT	0.612																																					p.T786M		.											.	FAM171A1	138	0			c.C2357T						.						77.0	56.0	63.0					10																	15255230		2203	4300	6503	SO:0001583	missense	221061	exon8			AGCTGCGTGTAGG	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.2357C>T	10.37:g.15255230G>A	ENSP00000367356:p.Thr786Met	136.0	0.0		101.0	11.0	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	ENST00000378116.4	37	CCDS31154.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339990	0.81911	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.35421	1.31	5.25	5.25	0.73442	.	0.053602	0.64402	D	0.000001	T	0.59689	0.2212	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.61073	-0.7136	10	0.72032	D	0.01	-24.5632	19.0487	0.93032	0.0:0.0:1.0:0.0	.	786	Q5VUB5	F1711_HUMAN	M	786;785	ENSP00000367356:T786M	ENSP00000367356:T786M	T	-	2	0	FAM171A1	15295236	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.002000	0.93572	2.724000	0.93272	0.563000	0.77884	ACG	.		0.612	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	126241701	126241701	+	Missense_Mutation	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:126241701G>T	ENST00000394329.3	+	1	4148	c.4135G>T	c.(4135-4137)Gac>Tac	p.D1379Y		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1379	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAAAAAACTGGACTTTGAAAC	0.373																																					p.D1379Y		.											.	FAT4	108	0			c.G4135T						.						109.0	104.0	105.0					4																	126241701		1821	4083	5904	SO:0001583	missense	79633	exon1			AAACTGGACTTTG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4135G>T	4.37:g.126241701G>T	ENSP00000377862:p.Asp1379Tyr	97.0	0.0		93.0	21.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414218	0.62511	.	.	ENSG00000196159	ENST00000394329	T	0.65549	-0.16	4.87	4.87	0.63330	Cadherin (4);Cadherin-like (1);	0.000000	0.36101	U	0.002792	D	0.85177	0.5637	H	0.94542	3.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89552	0.3800	10	0.87932	D	0	.	18.1883	0.89799	0.0:0.0:1.0:0.0	.	1379	Q6V0I7	FAT4_HUMAN	Y	1379	ENSP00000377862:D1379Y	ENSP00000377862:D1379Y	D	+	1	0	FAT4	126461151	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.454000	0.97621	2.535000	0.85469	0.655000	0.94253	GAC	.		0.373	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu	37	4	126373179	126373179	+	Missense_Mutation	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:126373179T>C	ENST00000394329.3	+	9	11021	c.11008T>C	c.(11008-11010)Tcc>Ccc	p.S3670P	FAT4_ENST00000335110.5_Missense_Mutation_p.S1968P	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3670					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGATCTGAATTCCCAGCCAAG	0.498																																					p.S3670P		.											.	FAT4	108	0			c.T11008C						.						130.0	125.0	127.0					4																	126373179		2203	4300	6503	SO:0001583	missense	79633	exon9			CTGAATTCCCAGC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11008T>C	4.37:g.126373179T>C	ENSP00000377862:p.Ser3670Pro	43.0	0.0		51.0	5.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	18.00	3.525506	0.64860	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.56611	0.45;0.45	5.77	-4.24	0.03777	.	0.000000	0.33272	U	0.005097	T	0.46483	0.1395	L	0.33485	1.01	0.46586	D	0.999111	D;D;P	0.54047	0.963;0.964;0.912	P;P;P	0.49226	0.603;0.522;0.603	T	0.53493	-0.8431	10	0.45353	T	0.12	.	18.1344	0.89614	0.0:0.0:0.6636:0.3364	.	1968;3670;3670	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	P	3670;1968	ENSP00000377862:S3670P;ENSP00000335169:S1968P	ENSP00000335169:S1968P	S	+	1	0	FAT4	126592629	1.000000	0.71417	0.023000	0.16930	0.983000	0.72400	1.299000	0.33424	-0.506000	0.06558	0.459000	0.35465	TCC	.		0.498	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FCRL5	83416	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	157516904	157516904	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:157516904C>T	ENST00000361835.3	-	3	293	c.136G>A	c.(136-138)Gga>Aga	p.G46R	FCRL5_ENST00000368188.2_Missense_Mutation_p.G46R|FCRL5_ENST00000368189.3_Missense_Mutation_p.G46R|FCRL5_ENST00000368190.3_Missense_Mutation_p.G46R|FCRL5_ENST00000368191.3_Intron|FCRL5_ENST00000356953.4_Missense_Mutation_p.G46R	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	46	Ig-like C2-type 1.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AAGCGAAATCCCTTGCAAGTG	0.473																																					p.G46R		.											.	FCRL5	156	0			c.G136A						.						153.0	142.0	146.0					1																	157516904		2203	4300	6503	SO:0001583	missense	83416	exon3			GAAATCCCTTGCA	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.136G>A	1.37:g.157516904C>T	ENSP00000354691:p.Gly46Arg	51.0	0.0		87.0	5.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	37	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607894	0.46527	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368189;ENST00000368188	T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66	5.01	3.1	0.35709	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06872	0.0175	M	0.77486	2.375	0.09310	N	1	B;B;B;B	0.28850	0.182;0.11;0.225;0.11	B;B;B;B	0.33121	0.139;0.158;0.07;0.158	T	0.38178	-0.9673	9	0.20519	T	0.43	.	8.0389	0.30511	0.0:0.8062:0.0:0.1938	.	46;46;46;46	Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;FCRL5_HUMAN	R	46	ENSP00000354691:G46R;ENSP00000349434:G46R;ENSP00000357173:G46R;ENSP00000357172:G46R;ENSP00000357171:G46R	ENSP00000349434:G46R	G	-	1	0	FCRL5	155783528	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.145000	0.16157	0.496000	0.27904	0.650000	0.86243	GGA	.		0.473	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
FLG	2312	hgsc.bcm.edu;bcgsc.ca	37	1	152279556	152279556	+	Silent	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:152279556G>T	ENST00000368799.1	-	3	7841	c.7806C>A	c.(7804-7806)ggC>ggA	p.G2602G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2602	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGTGTCTGGAGCCATCTCTTA	0.547									Ichthyosis																												p.G2602G		.											.	FLG	106	0			c.C7806A						.						46.0	52.0	50.0					1																	152279556		2199	4280	6479	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCTGGAGCCATCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7806C>A	1.37:g.152279556G>T		202.0	0.0		257.0	61.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FCRL6	343413	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159778188	159778188	+	Silent	SNP	A	A	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:159778188A>C	ENST00000368106.3	+	3	274	c.273A>C	c.(271-273)ccA>ccC	p.P91P	FCRL6_ENST00000392235.3_Silent_p.P91P|FCRL6_ENST00000339348.5_Silent_p.P91P|FCRL6_ENST00000321935.6_Silent_p.P98P	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	91	Ig-like C2-type 1.					external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					TGTATATTCCACAGACATTCA	0.532																																					p.P91P		.											.	FCRL6	93	0			c.A273C						.						52.0	45.0	48.0					1																	159778188		2203	4300	6503	SO:0001819	synonymous_variant	343413	exon3			TATTCCACAGACA	AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.273A>C	1.37:g.159778188A>C		300.0	2.0		312.0	139.0	NM_001004310	A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Silent	SNP	ENST00000368106.3	37	CCDS30912.1																																																																																			.		0.532	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276853.1	NM_001004310	
FOXI1	2299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169535273	169535273	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:169535273G>A	ENST00000306268.6	+	2	856	c.795G>A	c.(793-795)gaG>gaA	p.E265E	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	265					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTCCCCAGAGAAGCGGCCCT	0.642									Pendred syndrome																												p.E265E		.											.	FOXI1	229	0			c.G795A						.						49.0	57.0	54.0					5																	169535273		2203	4300	6503	SO:0001819	synonymous_variant	2299	exon2	Familial Cancer Database	Goiter-Deafness syndrome	CCCAGAGAAGCGG	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.795G>A	5.37:g.169535273G>A		110.0	0.0		161.0	19.0	NM_012188	Q14518|Q66SR7|Q8N6L8	Silent	SNP	ENST00000306268.6	37	CCDS4372.1																																																																																			.		0.642	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	79158773	79158773	+	Splice_Site	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:79158773T>C	ENST00000325942.6	+	3	656		c.e3+2		FRAS1_ENST00000264899.6_Splice_Site|FRAS1_ENST00000264895.6_Splice_Site	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1						cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TTTGAGAAGGTACGGTATCCT	0.413																																					.		.											.	FRAS1	68	0			c.216+2T>C						.						61.0	59.0	59.0					4																	79158773		1936	4129	6065	SO:0001630	splice_region_variant	80144	exon3			AGAAGGTACGGTA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.216+2T>C	4.37:g.79158773T>C		52.0	0.0		42.0	7.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Splice_Site	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.922368	0.73213	.	.	ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899;ENST00000380674	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6174	0.68558	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRAS1	79377797	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	5.436000	0.66538	2.156000	0.67533	0.383000	0.25322	.	.		0.413	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		Intron
GLUD2	2747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	120182071	120182071	+	Missense_Mutation	SNP	C	C	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chrX:120182071C>G	ENST00000328078.1	+	1	610	c.533C>G	c.(532-534)cCg>cGg	p.P178R		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	178					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GTTGATGTGCCGTTTGGGGGT	0.453																																					p.P178R		.											.	GLUD2	131	0			c.C533G						.						118.0	91.0	100.0					X																	120182071		2203	4300	6503	SO:0001583	missense	2747	exon1			ATGTGCCGTTTGG	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.533C>G	X.37:g.120182071C>G	ENSP00000327589:p.Pro178Arg	34.0	0.0		46.0	27.0	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	C	6.585	0.476351	0.12521	.	.	ENSG00000182890	ENST00000328078	D	0.97620	-4.46	1.62	0.69	0.18039	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.000000	0.85682	D	0.000000	D	0.98544	0.9514	H	0.97315	3.98	0.54753	D	0.999989	D	0.89917	1.0	D	0.77557	0.99	D	0.96416	0.9308	10	0.87932	D	0	.	4.7803	0.13199	0.3626:0.6374:0.0:0.0	.	178	P49448	DHE4_HUMAN	R	178	ENSP00000327589:P178R	ENSP00000327589:P178R	P	+	2	0	GLUD2	120009752	0.986000	0.35501	0.370000	0.25965	0.080000	0.17528	1.818000	0.39012	0.175000	0.19841	0.472000	0.43445	CCG	.		0.453	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
GPR137	56834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64055851	64055851	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:64055851G>A	ENST00000313074.3	+	5	928	c.823G>A	c.(823-825)Gta>Ata	p.V275I	GPR137_ENST00000377702.4_Missense_Mutation_p.V225I|GPR137_ENST00000411458.1_Missense_Mutation_p.V333I|GPR137_ENST00000438980.2_Missense_Mutation_p.V275I|KCNK4_ENST00000538767.1_5'Flank|GPR137_ENST00000539851.1_Missense_Mutation_p.V275I	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	275						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						AGGCTACCTGGTATTTGGCCT	0.632																																					p.V333I		.											.	GPR137	68	0			c.G997A						.						150.0	144.0	146.0					11																	64055851		2201	4297	6498	SO:0001583	missense	56834	exon7			TACCTGGTATTTG	AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.823G>A	11.37:g.64055851G>A	ENSP00000321698:p.Val275Ile	50.0	0.0		31.0	7.0	NM_001170726	B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Missense_Mutation	SNP	ENST00000313074.3	37	CCDS8066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.005876|4.005876	0.74932|0.74932	.|.	.|.	ENSG00000173264|ENSG00000173264	ENST00000536282|ENST00000411458;ENST00000539851;ENST00000377702;ENST00000438980;ENST00000313074	.|T;T;T;T	.|0.53640	.|0.61;0.68;0.66;0.64	5.0|5.0	4.08|4.08	0.47627|0.47627	.|.	.|0.164267	.|0.41605	.|D	.|0.000845	T|T	0.33614|0.33614	0.0869|0.0869	L|L	0.33339|0.33339	1.005|1.005	0.35581|0.35581	D|D	0.806303|0.806303	.|B;P;B;P;B	.|0.35745	.|0.172;0.518;0.244;0.518;0.172	.|B;B;B;B;B	.|0.32533	.|0.058;0.147;0.061;0.147;0.058	T|T	0.44190|0.44190	-0.9344|-0.9344	5|10	.|0.44086	.|T	.|0.13	-11.0226|-11.0226	9.556|9.556	0.39339|0.39339	0.0985:0.0:0.9015:0.0|0.0985:0.0:0.9015:0.0	.|.	.|275;333;275;275;225	.|B7Z7M1;B4DTG7;Q96N19-2;Q96N19;Q96N19-3	.|.;.;.;G137A_HUMAN;.	D|I	6|333;275;225;275;275	.|ENSP00000411827:V333I;ENSP00000442792:V275I;ENSP00000415698:V275I;ENSP00000321698:V275I	.|ENSP00000321698:V275I	G|V	+|+	2|1	0|0	GPR137|GPR137	63812427|63812427	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.903000|0.903000	0.53119|0.53119	7.397000|7.397000	0.79903|0.79903	1.093000|1.093000	0.41377|0.41377	0.462000|0.462000	0.41574|0.41574	GGT|GTA	.		0.632	GPR137-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396412.1	NM_020155	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89979611	89979611	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:89979611C>T	ENST00000405460.2	+	28	5969	c.5873C>T	c.(5872-5874)tCt>tTt	p.S1958F		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1958					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCCAGTGGTTCTTTGGGAGCT	0.438																																					p.S1958F		.											.	GPR98	103	0			c.C5873T						.						135.0	129.0	131.0					5																	89979611		1897	4131	6028	SO:0001583	missense	84059	exon28			GTGGTTCTTTGGG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5873C>T	5.37:g.89979611C>T	ENSP00000384582:p.Ser1958Phe	103.0	0.0		110.0	39.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425410	0.43020	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.27104	1.69	5.7	4.81	0.61882	.	0.149175	0.64402	D	0.000009	T	0.36331	0.0963	L	0.54323	1.7	0.80722	D	1	P	0.40875	0.731	P	0.49708	0.62	T	0.07028	-1.0794	10	0.62326	D	0.03	.	12.9991	0.58666	0.0:0.6071:0.3929:0.0	.	1958	Q8WXG9	GPR98_HUMAN	F	1958	ENSP00000384582:S1958F	ENSP00000296619:S1958F	S	+	2	0	GPR98	90015367	1.000000	0.71417	0.130000	0.21974	0.079000	0.17450	5.723000	0.68492	2.697000	0.92050	0.585000	0.79938	TCT	.		0.438	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
IFNA10	3446	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	21206860	21206860	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr9:21206860G>A	ENST00000357374.2	-	1	282	c.237C>T	c.(235-237)gtC>gtT	p.V79V		NM_002171.1	NP_002162.1	P01566	IFN10_HUMAN	interferon, alpha 10	79					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(1)|large_intestine(3)|liver(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		TCTCATGGAGGACAGAGATGG	0.488																																					p.V79V		.											.	IFNA10	90	0			c.C237T						.						54.0	59.0	57.0					9																	21206860		2201	4297	6498	SO:0001819	synonymous_variant	3446	exon1			ATGGAGGACAGAG		CCDS6499.1	9p22	2010-08-24			ENSG00000186803	ENSG00000186803		"""Interferons"""	5418	protein-coding gene	gene with protein product		147577				1385305	Standard	NM_002171		Approved	IFN-alphaC	uc003zoq.1	P01566	OTTHUMG00000019658	ENST00000357374.2:c.237C>T	9.37:g.21206860G>A		151.0	0.0		154.0	14.0	NM_002171	Q5VV13	Silent	SNP	ENST00000357374.2	37	CCDS6499.1																																																																																			.		0.488	IFNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051887.1	NM_002171	
KHDC1L	100129128	broad.mit.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	73935081	73935082	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:73935081_73935082GG>TT	ENST00000370388.3	-	1	93_94	c.50_51CC>AA	c.(49-51)cCC>cAA	p.P17Q	RP11-257K9.8_ENST00000423730.3_Missense_Mutation_p.P120K|KHDC1L_ENST00000471312.1_5'UTR	NM_001126063.2	NP_001119535.1	Q5JSQ8	KHDCL_HUMAN	KH homology domain containing 1-like	17										breast(1)|endometrium(1)|kidney(1)|lung(3)|skin(1)	7						GAAAGTTTTCGGGCAGGGTCCA	0.545																																					p.P17P|p.P17H		.											.	KHDC1L	1	0			c.C51A|c.C50A						.																																			SO:0001583	missense	100129128	exon1			GTTTTCGGGCAGG|TTTTCGGGCAGGG	BC004267	CCDS47450.1	6q13	2014-05-15			ENSG00000256980	ENSG00000256980			37274	protein-coding gene	gene with protein product							Standard	NM_001126063		Approved	RP11-257K9.7	uc003pgm.4	Q5JSQ8	OTTHUMG00000132474	ENST00000370388.3:c.50_51delinsTT	6.37:g.73935081_73935082delinsTT	ENSP00000359415:p.Pro17Gln	81.0|82.0	0.0		86.0	27.0	NM_001126063	E1P535	Silent|Missense_Mutation	SNP	ENST00000370388.3	37	CCDS47450.1																																																																																			.		0.545	KHDC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255640.1	NM_001126063	
KIAA1244	57221	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	138619874	138619874	+	Silent	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:138619874C>T	ENST00000251691.4	+	22	3946	c.3780C>T	c.(3778-3780)ttC>ttT	p.F1260F		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TCCGACCTTTCGAGCGCATTA	0.488																																					p.F1260F		.											.	KIAA1244	228	0			c.C3780T						.						119.0	99.0	105.0					6																	138619874		2203	4300	6503	SO:0001819	synonymous_variant	57221	exon22			ACCTTTCGAGCGC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3780C>T	6.37:g.138619874C>T		72.0	0.0		95.0	8.0	NM_020340		Silent	SNP	ENST00000251691.4	37	CCDS5189.2																																																																																			.		0.488	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
KIF11	3832	broad.mit.edu;bcgsc.ca	37	10	94376541	94376541	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr10:94376541G>A	ENST00000260731.3	+	9	1170	c.1080G>A	c.(1078-1080)ttG>ttA	p.L360L		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	360					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)			breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGAACATATTGAATAAGCCTG	0.323																																					p.L360L	Colon(47;212 1003 2764 4062 8431)	.											.	KIF11	227	0			c.G1080A						.						93.0	96.0	95.0					10																	94376541		2203	4295	6498	SO:0001819	synonymous_variant	3832	exon9			CATATTGAATAAG	X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.1080G>A	10.37:g.94376541G>A		49.0	0.0		60.0	5.0	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Silent	SNP	ENST00000260731.3	37	CCDS7422.1																																																																																			.		0.323	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
LCE1E	353135	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152760020	152760020	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:152760020A>G	ENST00000368770.3	+	2	298	c.245A>G	c.(244-246)cAc>cGc	p.H82R	LCE1E_ENST00000368771.1_Missense_Mutation_p.H82R	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	82	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACCACAGGCACCACAGGTCC	0.697																																					p.H82R		.											.	LCE1E	90	0			c.A245G						.						38.0	48.0	45.0					1																	152760020		2198	4299	6497	SO:0001583	missense	353135	exon2			ACAGGCACCACAG	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.245A>G	1.37:g.152760020A>G	ENSP00000357759:p.His82Arg	142.0	1.0		176.0	82.0	NM_178353	D3DV30	Missense_Mutation	SNP	ENST00000368770.3	37	CCDS1024.1	.	.	.	.	.	.	.	.	.	.	G	1.264	-0.615038	0.03663	.	.	ENSG00000186226	ENST00000368771;ENST00000368770	T;T	0.03242	4.0;4.0	4.06	-3.91	0.04168	.	1.035500	0.07789	N	0.954589	T	0.00440	0.0014	N	0.01297	-0.9	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49418	-0.8942	10	0.87932	D	0	.	6.5476	0.22414	0.374:0.404:0.2221:0.0	.	82	Q5T753	LCE1E_HUMAN	R	82	ENSP00000357760:H82R;ENSP00000357759:H82R	ENSP00000357759:H82R	H	+	2	0	LCE1E	151026644	0.002000	0.14202	0.872000	0.34217	0.012000	0.07955	-0.779000	0.04659	-1.006000	0.03412	-1.173000	0.01734	CAC	.		0.697	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
LCMT2	9836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43621087	43621087	+	Missense_Mutation	SNP	C	C	A	rs556701152		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr15:43621087C>A	ENST00000305641.5	-	1	1716	c.1601G>T	c.(1600-1602)cGg>cTg	p.R534L	ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000389651.4_5'Flank|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000544735.1_Missense_Mutation_p.R113L|LCMT2_ENST00000567039.1_3'UTR	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	534					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	GTGAGAATGCCGGGCTTCAGG	0.557																																					p.R534L		.											.	LCMT2	90	0			c.G1601T						.						112.0	112.0	112.0					15																	43621087		2201	4299	6500	SO:0001583	missense	9836	exon1			GAATGCCGGGCTT	AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.1601G>T	15.37:g.43621087C>A	ENSP00000307214:p.Arg534Leu	22.0	0.0		36.0	8.0	NM_014793	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859832	0.71834	.	.	ENSG00000168806	ENST00000305641;ENST00000544735	T;T	0.78481	-1.18;-1.18	5.61	4.69	0.59074	Kelch-type beta propeller (1);	0.142736	0.47093	D	0.000246	D	0.83027	0.5165	M	0.66939	2.045	0.45899	D	0.99874	D	0.89917	1.0	D	0.97110	1.0	T	0.80977	-0.1141	10	0.02654	T	1	0.3354	12.3058	0.54902	0.0:0.9181:0.0:0.0819	.	534	O60294	LCMT2_HUMAN	L	534;113	ENSP00000307214:R534L;ENSP00000442022:R113L	ENSP00000307214:R534L	R	-	2	0	LCMT2	41408379	0.997000	0.39634	0.735000	0.30896	0.994000	0.84299	5.834000	0.69361	1.385000	0.46445	0.655000	0.94253	CGG	.		0.557	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1	NM_014793	
LCP2	3937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169689689	169689689	+	Missense_Mutation	SNP	T	T	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:169689689T>G	ENST00000046794.5	-	13	1491	c.876A>C	c.(874-876)gaA>gaC	p.E292D	LCP2_ENST00000521416.1_Missense_Mutation_p.E87D	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	292					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TTTCATGTCTTTCCGTGGTCG	0.512																																					p.E292D		.											.	LCP2	23	0			c.A876C						.						75.0	75.0	75.0					5																	169689689		1942	4146	6088	SO:0001583	missense	3937	exon13			ATGTCTTTCCGTG		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.876A>C	5.37:g.169689689T>G	ENSP00000046794:p.Glu292Asp	119.0	0.0		152.0	52.0	NM_005565	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	T	7.203	0.593898	0.13875	.	.	ENSG00000043462	ENST00000046794;ENST00000521416;ENST00000520344	T;T	0.43688	0.95;0.94	5.44	-0.394	0.12434	.	0.323813	0.32970	N	0.005421	T	0.22244	0.0536	L	0.28192	0.835	0.22199	N	0.9993	B;B;B	0.11235	0.004;0.004;0.002	B;B;B	0.09377	0.004;0.002;0.002	T	0.12630	-1.0540	9	.	.	.	-9.7914	5.1887	0.15197	0.0:0.1767:0.3794:0.4439	.	87;292;292	E7ESF6;A8KA25;Q13094	.;.;LCP2_HUMAN	D	292;87;59	ENSP00000046794:E292D;ENSP00000428871:E87D	.	E	-	3	2	LCP2	169622267	0.870000	0.30015	0.070000	0.20053	0.484000	0.33280	-0.501000	0.06398	-0.302000	0.08869	0.533000	0.62120	GAA	.		0.512	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
LDOC1L	84247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	44893693	44893693	+	Splice_Site	SNP	T	T	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr22:44893693T>A	ENST00000341255.3	-	2	255		c.e2-2			NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like											breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		CTCTGGGCCCTGGAGGATTAA	0.657																																					.		.											.	LDOC1L	69	0			.						.																																			SO:0001630	splice_region_variant	84247	.			GGGCCCTGGAGGA	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.255-2A>T	22.37:g.44893693T>A		38.0	0.0		48.0	7.0	.	Q6ZTR1	Splice_Site	SNP	ENST00000341255.3	37	CCDS33662.1																																																																																			.		0.657	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	Intron
LHFPL5	222662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35773531	35773531	+	Missense_Mutation	SNP	G	G	A	rs370902662		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:35773531G>A	ENST00000373853.1	+	1	462	c.84G>A	c.(82-84)atG>atA	p.M28I	LHFPL5_ENST00000360215.1_Missense_Mutation_p.M28I			Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	28					auditory receptor cell stereocilium organization (GO:0060088)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transport (GO:0006811)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)				endometrium(4)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|urinary_tract(1)	20						TGGGCGTGATGTGGGGTACCC	0.607																																					p.M28I		.											.	LHFPL5	91	0			c.G84A						.	G	ILE/MET	1,4405	2.1+/-5.4	0,1,2202	202.0	176.0	185.0		84	4.5	1.0	6		185	0,8600		0,0,4300	no	missense	LHFPL5	NM_182548.3	10	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	28/220	35773531	1,13005	2203	4300	6503	SO:0001583	missense	222662	exon1			CGTGATGTGGGGT	BC028630	CCDS4812.1	6p21.31	2014-01-28				ENSG00000197753			21253	protein-coding gene	gene with protein product		609427	"""deafness, autosomal recessive 67"""	DFNB67		16459341	Standard	NM_182548		Approved	MGC33835, dJ510O8.8, Tmhs	uc003olg.1	Q8TAF8		ENST00000373853.1:c.84G>A	6.37:g.35773531G>A	ENSP00000362960:p.Met28Ile	95.0	0.0		136.0	43.0	NM_182548	B3KX66	Missense_Mutation	SNP	ENST00000373853.1	37	CCDS4812.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146510	0.57044	2.27E-4	0.0	ENSG00000197753	ENST00000373853;ENST00000360215	T;T	0.69806	-0.43;-0.43	5.33	4.47	0.54385	.	0.154695	0.64402	D	0.000013	T	0.35393	0.0930	L	0.27053	0.805	0.41178	D	0.986217	B	0.26002	0.139	B	0.25405	0.06	T	0.26573	-1.0099	10	0.33940	T	0.23	-20.5523	11.0421	0.47838	0.071:0.129:0.8:0.0	.	28	Q8TAF8	TMHS_HUMAN	I	28	ENSP00000362960:M28I;ENSP00000353346:M28I	ENSP00000353346:M28I	M	+	3	0	LHFPL5	35881509	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	4.506000	0.60428	1.252000	0.44001	-0.284000	0.09977	ATG	.		0.607	LHFPL5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040323.1	NM_182548	
LRSAM1	90678	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	130242226	130242226	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr9:130242226C>T	ENST00000323301.4	+	13	1616	c.1012C>T	c.(1012-1014)Cgg>Tgg	p.R338W	LRSAM1_ENST00000373322.1_Missense_Mutation_p.R338W|LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000300417.6_Missense_Mutation_p.R338W|LRSAM1_ENST00000373324.4_Missense_Mutation_p.R338W	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	338					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						CATTTCCAGCCGGATCCAGAA	0.657																																					p.R338W		.											.	LRSAM1	90	0			c.C1012T						.						64.0	68.0	66.0					9																	130242226		2203	4300	6503	SO:0001583	missense	90678	exon14			TCCAGCCGGATCC	AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1012C>T	9.37:g.130242226C>T	ENSP00000322937:p.Arg338Trp	166.0	0.0		144.0	12.0	NM_001005373	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	ENST00000323301.4	37	CCDS6873.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410992	0.83340	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.86	4.96	0.65561	.	0.049793	0.85682	N	0.000000	T	0.61912	0.2385	M	0.67953	2.075	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	T	0.62714	-0.6796	10	0.44086	T	0.13	-43.5527	14.2533	0.66035	0.15:0.85:0.0:0.0	.	338;338	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	W	338	ENSP00000300417:R338W;ENSP00000362421:R338W;ENSP00000322937:R338W;ENSP00000362419:R338W	ENSP00000300417:R338W	R	+	1	2	LRSAM1	129282047	0.995000	0.38212	0.925000	0.36789	0.985000	0.73830	3.379000	0.52440	1.473000	0.48159	0.655000	0.94253	CGG	.		0.657	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054164.1	NM_138361	
MBTPS1	8720	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	84118684	84118684	+	Missense_Mutation	SNP	C	C	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr16:84118684C>G	ENST00000343411.3	-	10	1685	c.1190G>C	c.(1189-1191)gGc>gCc	p.G397A	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	397	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						ACCCCGCACGCCAGCACCATA	0.557											OREG0023982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G397A		.											.	MBTPS1	92	0			c.G1190C						.						75.0	67.0	70.0					16																	84118684		2200	4300	6500	SO:0001583	missense	8720	exon10			CGCACGCCAGCAC	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1190G>C	16.37:g.84118684C>G	ENSP00000344223:p.Gly397Ala	200.0	0.0	1226	123.0	11.0	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	ENST00000343411.3	37	CCDS10941.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063823	0.36373	.	.	ENSG00000140943	ENST00000343411	D	0.86432	-2.12	5.48	5.48	0.80851	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.82779	0.5111	L	0.31845	0.965	0.80722	D	1	B	0.12013	0.005	B	0.24006	0.05	T	0.76528	-0.2926	10	0.21014	T	0.42	-18.8898	19.3469	0.94367	0.0:1.0:0.0:0.0	.	397	Q14703	MBTP1_HUMAN	A	397	ENSP00000344223:G397A	ENSP00000344223:G397A	G	-	2	0	MBTPS1	82676185	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	7.818000	0.86416	2.560000	0.86352	0.561000	0.74099	GGC	.		0.557	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
MCHR1	2847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41075734	41075734	+	Silent	SNP	G	G	T	rs201514957		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr22:41075734G>T	ENST00000249016.4	+	1	981	c.285G>T	c.(283-285)tcG>tcT	p.S95S	MCHR1_ENST00000381433.2_Silent_p.S95S|MCHR1_ENST00000498400.1_Intron	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	95					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						ACCTCACTTCGGCAGGTGAGT	0.597																																					p.S95S		.											.	MCHR1	90	0			c.G285T						.						58.0	63.0	61.0					22																	41075734		2202	4300	6502	SO:0001819	synonymous_variant	2847	exon1			CACTTCGGCAGGT		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.285G>T	22.37:g.41075734G>T		65.0	0.0		63.0	21.0	NM_005297	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Silent	SNP	ENST00000249016.4	37	CCDS14004.1																																																																																			.		0.597	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
MSTN	2660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	190922105	190922105	+	Missense_Mutation	SNP	G	G	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:190922105G>C	ENST00000260950.4	-	3	1139	c.1007C>G	c.(1006-1008)gCa>gGa	p.A336G	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	336					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			GCAAGGGCCTGCTGAACCTCT	0.378																																					p.A336G		.											.	MSTN	650	0			c.C1007G						.						74.0	76.0	75.0					2																	190922105		2203	4299	6502	SO:0001583	missense	2660	exon3			GGGCCTGCTGAAC	AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.1007C>G	2.37:g.190922105G>C	ENSP00000260950:p.Ala336Gly	55.0	0.0		79.0	18.0	NM_005259	A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	ENST00000260950.4	37	CCDS2303.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340725	0.41498	.	.	ENSG00000138379	ENST00000260950	T	0.70282	-0.47	5.79	4.92	0.64577	Transforming growth factor-beta, C-terminal (3);	0.047099	0.85682	D	0.000000	T	0.60209	0.2251	N	0.25094	0.71	0.80722	D	1	B	0.14805	0.011	B	0.21917	0.037	T	0.58836	-0.7566	10	0.87932	D	0	-10.0534	14.8547	0.70326	0.0689:0.0:0.9311:0.0	.	336	O14793	GDF8_HUMAN	G	336	ENSP00000260950:A336G	ENSP00000260950:A336G	A	-	2	0	MSTN	190630350	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.937000	0.87672	1.447000	0.47661	0.585000	0.79938	GCA	.		0.378	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255917.2	NM_005259	
MTMR9	66036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	11167038	11167038	+	Missense_Mutation	SNP	A	A	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr8:11167038A>T	ENST00000221086.3	+	6	1285	c.812A>T	c.(811-813)tAt>tTt	p.Y271F	MTMR9_ENST00000526292.1_Missense_Mutation_p.Y186F	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	271	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		TTTAAAAGGTATCACATTCTT	0.358																																					p.Y271F		.											.	MTMR9	226	0			c.A812T						.						65.0	66.0	66.0					8																	11167038		2203	4300	6503	SO:0001583	missense	66036	exon6			AAAGGTATCACAT	AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.812A>T	8.37:g.11167038A>T	ENSP00000221086:p.Tyr271Phe	45.0	0.0		44.0	15.0	NM_015458	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	ENST00000221086.3	37	CCDS5979.1	.	.	.	.	.	.	.	.	.	.	A	4.479	0.088867	0.08583	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.89810	-2.57;-2.57	5.65	4.45	0.53987	Myotubularin phosphatase domain (1);	0.387780	0.31092	N	0.008272	T	0.77039	0.4072	N	0.11201	0.11	0.35294	D	0.782445	B	0.02656	0.0	B	0.06405	0.002	T	0.76860	-0.2803	10	0.41790	T	0.15	.	9.7397	0.40411	0.6896:0.0:0.0:0.3104	.	271	Q96QG7	MTMR9_HUMAN	F	271;186	ENSP00000221086:Y271F;ENSP00000433239:Y186F	ENSP00000221086:Y271F	Y	+	2	0	MTMR9	11204448	0.973000	0.33851	0.996000	0.52242	0.659000	0.38960	1.766000	0.38491	2.153000	0.67306	0.477000	0.44152	TAT	.		0.358	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	3239233	3239233	+	Missense_Mutation	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chrX:3239233G>T	ENST00000217939.6	-	5	4647	c.4493C>A	c.(4492-4494)aCa>aAa	p.T1498K		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1498						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CATGAGAATTGTGGATGGGGA	0.478																																					p.T1498K		.											.	MXRA5	136	0			c.C4493A						.						136.0	117.0	124.0					X																	3239233		2203	4300	6503	SO:0001583	missense	25878	exon5			AGAATTGTGGATG	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.4493C>A	X.37:g.3239233G>T	ENSP00000217939:p.Thr1498Lys	75.0	0.0		106.0	5.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	g	11.50	1.656847	0.29425	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.62364	0.03	3.18	2.27	0.28462	.	0.619297	0.13141	U	0.410657	T	0.43233	0.1238	L	0.32530	0.975	0.09310	N	1	P	0.39480	0.675	B	0.32465	0.146	T	0.16660	-1.0395	10	0.27082	T	0.32	.	7.8392	0.29389	0.1419:0.0:0.8581:0.0	.	1498	Q9NR99	MXRA5_HUMAN	K	1498	ENSP00000217939:T1498K	ENSP00000217939:T1498K	T	-	2	0	MXRA5	3249233	0.016000	0.18221	0.009000	0.14445	0.003000	0.03518	0.445000	0.21677	1.366000	0.46076	0.418000	0.28097	ACA	.		0.478	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MYO5A	4644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52652277	52652277	+	Splice_Site	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr15:52652277T>C	ENST00000399231.3	-	25	3554	c.3311A>G	c.(3310-3312)cAt>cGt	p.H1104R	MYO5A_ENST00000399233.2_Splice_Site_p.H1104R|MYO5A_ENST00000553916.1_Splice_Site_p.H1104R|MYO5A_ENST00000356338.6_Splice_Site_p.H1104R|MYO5A_ENST00000358212.6_Splice_Site_p.H1104R	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1104					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CTTAGGCACATGCTGCAAGGC	0.423																																					p.H1104R		.											.	MYO5A	93	0			c.A3311G						.						95.0	91.0	93.0					15																	52652277		1988	4169	6157	SO:0001630	splice_region_variant	4644	exon25			GGCACATGCTGCA		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3310-1A>G	15.37:g.52652277T>C		54.0	0.0		51.0	13.0	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	T	9.242	1.038428	0.19669	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	5.78	4.63	0.57726	.	0.678176	0.15560	N	0.255957	T	0.07593	0.0191	N	0.08118	0	0.23559	N	0.997419	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38045	-0.9679	10	0.18276	T	0.48	.	5.4466	0.16539	0.0:0.145:0.1557:0.6993	.	1104;1104	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	R	1104;638;1104;1104;1104;734;1104	ENSP00000382177:H1104R;ENSP00000382179:H1104R;ENSP00000348693:H1104R;ENSP00000350945:H1104R;ENSP00000451109:H1104R	ENSP00000348693:H1104R	H	-	2	0	MYO5A	50439569	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	2.473000	0.45145	0.982000	0.38575	0.533000	0.62120	CAT	.		0.423	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	Missense_Mutation
MYOM1	8736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	3134722	3134722	+	Silent	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr18:3134722C>A	ENST00000356443.4	-	16	2643	c.2310G>T	c.(2308-2310)ggG>ggT	p.G770G	MYOM1_ENST00000261606.7_Silent_p.G770G|MYOM1_ENST00000400569.3_Silent_p.G770G	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	770	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CTATGTAGTACCCGACCAGCT	0.562																																					p.G770G		.											.	MYOM1	94	0			c.G2310T						.						89.0	89.0	89.0					18																	3134722		1940	4135	6075	SO:0001819	synonymous_variant	8736	exon16			GTAGTACCCGACC	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.2310G>T	18.37:g.3134722C>A		90.0	0.0		196.0	86.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	CCDS45824.1																																																																																			.		0.562	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
NCAPD3	23310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134027961	134027961	+	Splice_Site	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:134027961G>A	ENST00000534548.2	-	31	4100	c.4036C>T	c.(4036-4038)Ccc>Tcc	p.P1346S		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1346					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AGGGACATGGGCCTGTGGAGA	0.582																																					p.P1346S		.											.	NCAPD3	229	0			c.C4036T						.						83.0	85.0	85.0					11																	134027961		2201	4297	6498	SO:0001630	splice_region_variant	23310	exon31			ACATGGGCCTGTG	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.4035-1C>T	11.37:g.134027961G>A		37.0	0.0		42.0	12.0	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	G	4.218	0.039356	0.08148	.	.	ENSG00000151503	ENST00000534548	T	0.29917	1.55	5.72	2.58	0.30949	.	0.898757	0.09706	N	0.766365	T	0.28001	0.0690	L	0.56769	1.78	0.25110	N	0.990724	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.33523	-0.9865	10	0.56958	D	0.05	-0.6254	3.9509	0.09369	0.0778:0.2444:0.4269:0.2508	.	1346;406	P42695;Q96FA6	CNDD3_HUMAN;.	S	1346	ENSP00000433681:P1346S	ENSP00000433681:P1346S	P	-	1	0	NCAPD3	133533171	0.109000	0.22037	0.153000	0.22517	0.005000	0.04900	0.242000	0.18087	0.238000	0.21222	-0.314000	0.08810	CCC	.		0.582	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	Missense_Mutation
NCAPH	23397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97017638	97017638	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:97017638A>G	ENST00000240423.4	+	7	833	c.790A>G	c.(790-792)Act>Gct	p.T264A	NCAPH_ENST00000427946.1_Missense_Mutation_p.T128A|NCAPH_ENST00000455200.1_Missense_Mutation_p.T253A	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	264					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				GTTTCTGTCCACTCTCCACTG	0.493																																					p.T264A		.											.	NCAPH	228	0			c.A790G						.						134.0	112.0	120.0					2																	97017638		2203	4300	6503	SO:0001583	missense	23397	exon7			CTGTCCACTCTCC	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.790A>G	2.37:g.97017638A>G	ENSP00000240423:p.Thr264Ala	72.0	0.0		74.0	19.0	NM_015341	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	37	CCDS2021.1	.	.	.	.	.	.	.	.	.	.	A	11.80	1.745670	0.30955	.	.	ENSG00000121152	ENST00000240423;ENST00000427946;ENST00000435975;ENST00000456906;ENST00000455200	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.89	5.89	0.94794	.	0.160977	0.56097	D	0.000034	T	0.48059	0.1479	M	0.65975	2.015	0.19300	N	0.999975	P;P;P;P	0.36483	0.549;0.549;0.555;0.549	B;B;B;B	0.42625	0.393;0.393;0.257;0.393	T	0.46541	-0.9184	10	0.30078	T	0.28	-19.0346	14.2643	0.66107	1.0:0.0:0.0:0.0	.	240;253;253;264	B4DRG7;E9PHA2;C9J470;Q15003	.;.;.;CND2_HUMAN	A	264;128;253;145;253	ENSP00000240423:T264A;ENSP00000400774:T128A;ENSP00000405237:T253A;ENSP00000401227:T145A;ENSP00000407308:T253A	ENSP00000240423:T264A	T	+	1	0	NCAPH	96381365	0.837000	0.29446	0.886000	0.34754	0.080000	0.17528	3.483000	0.53194	2.254000	0.74563	0.459000	0.35465	ACT	.		0.493	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
NID1	4811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	236193033	236193033	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:236193033G>A	ENST00000264187.6	-	7	1637	c.1555C>T	c.(1555-1557)Cag>Tag	p.Q519*	NID1_ENST00000366595.3_Nonsense_Mutation_p.Q519*	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	519	Nidogen G2 beta-barrel. {ECO:0000255|PROSITE-ProRule:PRU00348}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	ACCTCAGCCTGGCGAGTGAAC	0.612																																					p.Q519X		.											.	NID1	154	0			c.C1555T						.						42.0	40.0	40.0					1																	236193033		2203	4300	6503	SO:0001587	stop_gained	4811	exon7			CAGCCTGGCGAGT	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1555C>T	1.37:g.236193033G>A	ENSP00000264187:p.Gln519*	75.0	0.0		61.0	26.0	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Nonsense_Mutation	SNP	ENST00000264187.6	37	CCDS1608.1	.	.	.	.	.	.	.	.	.	.	G	39	7.698402	0.98441	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	.	.	.	5.29	4.36	0.52297	.	0.231851	0.46758	D	0.000272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	13.0934	0.59178	0.0:0.0:0.7079:0.2921	.	.	.	.	X	519	.	ENSP00000264187:Q519X	Q	-	1	0	NID1	234259656	1.000000	0.71417	0.987000	0.45799	0.974000	0.67602	4.847000	0.62867	1.417000	0.47077	0.563000	0.77884	CAG	.		0.612	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
NLRP14	338323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7063785	7063785	+	Silent	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:7063785A>G	ENST00000299481.4	+	4	874	c.528A>G	c.(526-528)ccA>ccG	p.P176P		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	176					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GTGCACAGCCACAGATCGTGG	0.488																																					p.P176P		.											.	NLRP14	295	0			c.A528G						.						101.0	106.0	104.0					11																	7063785		2201	4296	6497	SO:0001819	synonymous_variant	338323	exon4			ACAGCCACAGATC	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.528A>G	11.37:g.7063785A>G		125.0	0.0		100.0	24.0	NM_176822	Q7RTR6	Silent	SNP	ENST00000299481.4	37	CCDS7776.1																																																																																			.		0.488	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
HABP2	3026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	115349517	115349517	+	IGR	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr10:115349517C>T	ENST00000351270.3	+	0	3009				NRAP_ENST00000369360.3_Missense_Mutation_p.G1639S|NRAP_ENST00000369358.4_Missense_Mutation_p.G1674S|NRAP_ENST00000360478.3_Missense_Mutation_p.G1631S|NRAP_ENST00000359988.3_Missense_Mutation_p.G1666S	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2						cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	GGGGTCCAGCCAACACCTCTG	0.552																																					p.G1666S		.											.	NRAP	522	0			c.G4996A						.						74.0	71.0	72.0					10																	115349517		2203	4300	6503	SO:0001628	intergenic_variant	4892	exon41			TCCAGCCAACACC		CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073		10.37:g.115349517C>T		44.0	0.0		64.0	7.0	NM_001261463	A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	ENST00000351270.3	37	CCDS7577.1	.	.	.	.	.	.	.	.	.	.	C	36	5.805647	0.96967	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478;ENST00000369350	T;T;T;T	0.27720	1.83;1.83;1.78;1.65	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.58652	0.2137	M	0.70275	2.135	0.80722	D	1	B;D;D;D	0.89917	0.248;1.0;1.0;1.0	B;D;D;D	0.97110	0.206;1.0;1.0;1.0	T	0.56547	-0.7961	10	0.59425	D	0.04	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	788;1666;1631;1666	B1ANW7;A0AVL2;Q86VF7-4;Q86VF7	.;.;.;NRAP_HUMAN	S	1674;1639;1666;1631;788	ENSP00000358365:G1674S;ENSP00000358367:G1639S;ENSP00000353078:G1666S;ENSP00000353666:G1631S	ENSP00000353078:G1666S	G	-	1	0	NRAP	115339507	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GGC	.		0.552	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050428.1	NM_004132	
NRP2	8828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	206581088	206581088	+	Silent	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:206581088C>A	ENST00000357785.5	+	3	454	c.423C>A	c.(421-423)atC>atA	p.I141I	NRP2_ENST00000272849.3_Silent_p.I141I|NRP2_ENST00000540841.1_Silent_p.I141I|NRP2_ENST00000412873.2_Silent_p.I141I|NRP2_ENST00000540178.1_Silent_p.I141I|NRP2_ENST00000357118.4_Silent_p.I141I|NRP2_ENST00000355117.4_Silent_p.I141I|NRP2_ENST00000417189.1_Silent_p.I141I|NRP2_ENST00000360409.3_Silent_p.I141I			Q99435	NELL2_HUMAN	neuropilin 2	0	Laminin G-like.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						GCTACGAGATCTTCAAGACAG	0.622																																					p.I141I		.											.	NRP2	93	0			c.C423A						.						65.0	66.0	66.0					2																	206581088		2203	4300	6503	SO:0001819	synonymous_variant	8828	exon3			CGAGATCTTCAAG	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.423C>A	2.37:g.206581088C>A		66.0	0.0		54.0	16.0	NM_201279	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	ENST00000357785.5	37	CCDS46496.1																																																																																			.		0.622	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1		
NUBPL	80224	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	32030678	32030678	+	Silent	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr14:32030678T>C	ENST00000281081.7	+	1	78	c.33T>C	c.(31-33)ggT>ggC	p.G11G	CTD-2213F21.3_ENST00000548096.1_RNA|CTD-2213F21.4_ENST00000547093.1_RNA	NM_001201573.1|NM_001201574.1|NM_025152.2	NP_001188502.1|NP_001188503.1|NP_079428.2	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	11					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrion morphogenesis (GO:0070584)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)|prostate(1)|skin(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		TGCTTTTTGGTGGGGTGTCGC	0.687																																					p.G11G		.											.	NUBPL	226	0			c.T33C						.						27.0	30.0	29.0					14																	32030678		1901	4115	6016	SO:0001819	synonymous_variant	80224	exon1			TTTTGGTGGGGTG	AK022722	CCDS41940.1	14q12	2012-10-12	2005-01-07	2005-01-07	ENSG00000151413	ENSG00000151413		"""Mitochondrial respiratory chain complex assembly factors"""	20278	protein-coding gene	gene with protein product	"""iron-sulfur protein required for NADH dehydrogenase"""	613621	"""chromosome 14 open reading frame 127"""	C14orf127			Standard	NM_025152		Approved	FLJ12660, IND1, huInd1	uc001wrk.4	Q8TB37	OTTHUMG00000170521	ENST00000281081.7:c.33T>C	14.37:g.32030678T>C		41.0	0.0		31.0	6.0	NM_025152	B4DHZ1|Q86TZ4|Q9H9M2	Silent	SNP	ENST00000281081.7	37	CCDS41940.1																																																																																			.		0.687	NUBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409519.1	NM_025152	
OR4A5	81318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	51411561	51411561	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:51411561G>A	ENST00000319760.6	-	1	887	c.835C>T	c.(835-837)Ctg>Ttg	p.L279L		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AAAGGACTCAGCATGTGTGTG	0.318																																					p.L279L		.											.	OR4A5	92	0			c.C835T						.						43.0	44.0	44.0					11																	51411561		2201	4295	6496	SO:0001819	synonymous_variant	81318	exon1			GACTCAGCATGTG	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.835C>T	11.37:g.51411561G>A		88.0	0.0		81.0	15.0	NM_001005272	Q6IF84	Silent	SNP	ENST00000319760.6	37	CCDS31497.1																																																																																			.		0.318	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
OR4K17	390436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20585954	20585954	+	Missense_Mutation	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr14:20585954C>A	ENST00000315543.4	+	1	389	c.389C>A	c.(388-390)aCt>aAt	p.T130N		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GGGTGCTTCACTCAGATATTT	0.428																																					p.T130N		.											.	OR4K17	71	0			c.C389A						.						117.0	114.0	115.0					14																	20585954		2203	4300	6503	SO:0001583	missense	390436	exon1			GCTTCACTCAGAT		CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.389C>A	14.37:g.20585954C>A	ENSP00000319197:p.Thr130Asn	85.0	0.0		92.0	18.0	NM_001004715	Q6IF12	Missense_Mutation	SNP	ENST00000315543.4	37	CCDS32030.1	.	.	.	.	.	.	.	.	.	.	.	11.60	1.687495	0.29962	.	.	ENSG00000176230	ENST00000315543	T	0.03004	4.08	2.86	1.95	0.26073	GPCR, rhodopsin-like superfamily (1);	0.229512	0.21909	U	0.067323	T	0.13841	0.0335	M	0.92649	3.33	0.09310	N	1	D	0.54601	0.967	P	0.54460	0.753	T	0.04029	-1.0983	10	0.72032	D	0.01	.	5.6902	0.17825	0.0:0.6643:0.2068:0.1289	.	102	Q8NGC6	OR4KH_HUMAN	N	130	ENSP00000319197:T130N	ENSP00000319197:T130N	T	+	2	0	OR4K17	19655794	0.000000	0.05858	0.993000	0.49108	0.615000	0.37417	-0.626000	0.05527	1.579000	0.49836	0.404000	0.27445	ACT	.		0.428	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410346.1		
OR8B4	283162	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124294034	124294034	+	Missense_Mutation	SNP	A	A	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:124294034A>T	ENST00000356130.3	-	1	755	c.734T>A	c.(733-735)aTt>aAt	p.I245N		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGCAACAGCAATTATGTGGGA	0.458																																					p.I245N		.											.	OR8B4	69	0			c.T734A						.						84.0	83.0	83.0					11																	124294034		2201	4299	6500	SO:0001583	missense	283162	exon1			ACAGCAATTATGT	AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.734T>A	11.37:g.124294034A>T	ENSP00000348449:p.Ile245Asn	68.0	1.0		55.0	13.0	NM_001005196	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	37	CCDS31710.1	.	.	.	.	.	.	.	.	.	.	a	10.84	1.463482	0.26248	.	.	ENSG00000198657	ENST00000356130	T	0.39997	1.05	4.08	-2.18	0.07037	GPCR, rhodopsin-like superfamily (1);	0.800541	0.11059	N	0.604131	T	0.63177	0.2489	M	0.91406	3.205	0.09310	N	1	P	0.50528	0.936	P	0.57152	0.814	T	0.60515	-0.7248	10	0.87932	D	0	.	11.3466	0.49565	0.5245:0.0:0.4755:0.0	.	245	Q96RC9	OR8B4_HUMAN	N	245	ENSP00000348449:I245N	ENSP00000348449:I245N	I	-	2	0	OR8B4	123799244	0.000000	0.05858	0.000000	0.03702	0.261000	0.26267	-0.478000	0.06575	-0.424000	0.07382	0.533000	0.62120	ATT	.		0.458	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
PALM	5064	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	746557	746557	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr19:746557A>G	ENST00000338448.5	+	9	953	c.907A>G	c.(907-909)Atg>Gtg	p.M303V	PALM_ENST00000593172.1_3'UTR|PALM_ENST00000264560.7_Missense_Mutation_p.M259V	NM_002579.2	NP_002570.2	O75781	PALM_HUMAN	paralemmin	303					cellular component movement (GO:0006928)|cellular response to electrical stimulus (GO:0071257)|cytoskeleton organization (GO:0007010)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of filopodium assembly (GO:0051491)|protein targeting to plasma membrane (GO:0072661)|regulation of cell shape (GO:0008360)|synapse maturation (GO:0060074)	apicolateral plasma membrane (GO:0016327)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasmic membrane-bounded vesicle (GO:0016023)|dendrite membrane (GO:0032590)|dendritic spine membrane (GO:0032591)|filopodium membrane (GO:0031527)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		AATGATCTTCATGGGTTACCA	0.657																																					p.M303V		.											.	PALM	68	0			c.A907G						.						39.0	35.0	37.0					19																	746557		2203	4300	6503	SO:0001583	missense	5064	exon9			ATCTTCATGGGTT	Y16270	CCDS32857.1, CCDS32858.1	19p13.3	2008-07-17				ENSG00000099864			8594	protein-coding gene	gene with protein product		608134				9615234, 9813098	Standard	XM_005259565		Approved	KIAA0270	uc002lpm.1	O75781		ENST00000338448.5:c.907A>G	19.37:g.746557A>G	ENSP00000341911:p.Met303Val	83.0	0.0		55.0	22.0	NM_002579	O43359|O95673|Q92559|Q9UPJ4|Q9UQS2|Q9UQS3	Missense_Mutation	SNP	ENST00000338448.5	37	CCDS32857.1	.	.	.	.	.	.	.	.	.	.	A	19.97	3.924688	0.73213	.	.	ENSG00000099864	ENST00000338448;ENST00000264560;ENST00000538247	T;T	0.26067	1.76;1.76	4.92	3.9	0.45041	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	M	0.82630	2.6	0.42471	D	0.992821	D;D	0.76494	0.999;0.999	D;D	0.87578	0.997;0.998	T	0.55648	-0.8108	10	0.72032	D	0.01	-47.5939	9.2388	0.37484	0.9137:0.0:0.0863:0.0	.	259;303	O75781-2;O75781	.;PALM_HUMAN	V	303;259;168	ENSP00000341911:M303V;ENSP00000264560:M259V	ENSP00000264560:M259V	M	+	1	0	PALM	697557	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	7.091000	0.76923	1.839000	0.53478	0.379000	0.24179	ATG	.		0.657	PALM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457592.1	NM_002579	
PCDH18	54510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	138450819	138450819	+	Missense_Mutation	SNP	G	G	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:138450819G>C	ENST00000344876.4	-	1	2810	c.2424C>G	c.(2422-2424)atC>atG	p.I808M	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.I808M|PCDH18_ENST00000507846.1_Missense_Mutation_p.I588M|PCDH18_ENST00000510305.1_Missense_Mutation_p.I19M	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	808					brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GGTTTGATGAGATTGTCACCA	0.468																																					p.I808M		.											.	PCDH18	185	0			c.C2424G						.						135.0	116.0	122.0					4																	138450819		2203	4300	6503	SO:0001583	missense	54510	exon1			TGATGAGATTGTC	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.2424C>G	4.37:g.138450819G>C	ENSP00000355082:p.Ile808Met	74.0	0.0		71.0	17.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	37	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932626	0.52866	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846;ENST00000510305	T;T;T;T	0.55930	0.62;0.62;0.49;1.19	5.53	5.53	0.82687	.	0.000000	0.44097	D	0.000487	T	0.66317	0.2777	L	0.57536	1.79	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	P;D;P	0.65443	0.896;0.935;0.896	T	0.62604	-0.6819	10	0.38643	T	0.18	.	14.4949	0.67680	0.0:0.0:0.8534:0.1466	.	588;808;808	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	M	808;808;588;19	ENSP00000355082:I808M;ENSP00000390688:I808M;ENSP00000425903:I588M;ENSP00000424269:I19M	ENSP00000355082:I808M	I	-	3	3	PCDH18	138670269	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.815000	0.48018	2.871000	0.98454	0.655000	0.94253	ATC	.		0.468	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
PCDHGA4	56111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140737153	140737153	+	Missense_Mutation	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:140737153G>T	ENST00000571252.1	+	1	2386	c.2386G>T	c.(2386-2388)Gat>Tat	p.D796Y	PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	796					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATAACTCAGGATTTACTTGA	0.438																																					p.D796Y		.											.	.	.	0			c.G2386T						.						53.0	59.0	57.0					5																	140737153		2156	4282	6438	SO:0001583	missense	56111	exon1			ACTCAGGATTTAC	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.2386G>T	5.37:g.140737153G>T	ENSP00000458570:p.Asp796Tyr	136.0	0.0		167.0	58.0	NM_018917	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	37	CCDS58979.1																																																																																			.		0.438	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
PDCD11	22984	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105183390	105183390	+	Missense_Mutation	SNP	A	A	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr10:105183390A>T	ENST00000369797.3	+	19	2832	c.2738A>T	c.(2737-2739)gAc>gTc	p.D913V		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	913					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CTTCACCAGGACTTGGTGAAT	0.453																																					p.D913V		.											.	PDCD11	275	0			c.A2738T						.						117.0	108.0	111.0					10																	105183390		2203	4300	6503	SO:0001583	missense	22984	exon19			ACCAGGACTTGGT	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.2738A>T	10.37:g.105183390A>T	ENSP00000358812:p.Asp913Val	63.0	1.0		63.0	8.0	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	ENST00000369797.3	37	CCDS31276.1	.	.	.	.	.	.	.	.	.	.	A	13.97	2.397148	0.42512	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.10192	2.9	5.83	5.83	0.93111	.	0.399872	0.32386	N	0.006166	T	0.10078	0.0247	L	0.44542	1.39	0.38427	D	0.94633	B	0.29716	0.255	B	0.22601	0.04	T	0.12889	-1.0530	10	0.39692	T	0.17	-6.6684	11.0856	0.48084	0.8451:0.1549:0.0:0.0	.	913	Q14690	RRP5_HUMAN	V	913	ENSP00000358812:D913V	ENSP00000358812:D913V	D	+	2	0	PDCD11	105173380	0.907000	0.30839	0.459000	0.27081	0.989000	0.77384	3.580000	0.53907	2.231000	0.72958	0.459000	0.35465	GAC	.		0.453	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
PIKFYVE	200576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	209218741	209218741	+	Silent	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:209218741A>G	ENST00000264380.4	+	40	6122	c.5964A>G	c.(5962-5964)ctA>ctG	p.L1988L		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1988	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						ACAACCCTCTATATATTCGTT	0.413																																					p.L1988L		.											.	PIKFYVE	583	0			c.A5964G						.						157.0	159.0	158.0					2																	209218741		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon40			CCCTCTATATATT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5964A>G	2.37:g.209218741A>G		99.0	0.0		95.0	22.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																			.		0.413	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PLA2G4E	123745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42298317	42298317	+	Silent	SNP	G	G	A	rs189566576	byFrequency	TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr15:42298317G>A	ENST00000399518.3	-	4	882	c.396C>T	c.(394-396)aaC>aaT	p.N132N	PLA2G4E_ENST00000413860.2_Silent_p.N103N|CTD-2382E5.2_ENST00000552704.1_RNA	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	114	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		ACTCTAGCACGTTCTAGGGGA	0.507													G|||	18	0.00359425	0.0129	0.0014	5008	,	,		21548	0.0		0.0	False		,,,				2504	0.0				p.N132N		.											.	.	.	0			c.C396T						.	G		53,4113		0,53,2030	120.0	121.0	120.0		396	-7.2	0.6	15		120	2,8450		0,2,4224	no	coding-synonymous	PLA2G4E	NM_001206670.1		0,55,6254	AA,AG,GG		0.0237,1.2722,0.4359		132/869	42298317	55,12563	2083	4226	6309	SO:0001819	synonymous_variant	123745	exon4			TAGCACGTTCTAG		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.396C>T	15.37:g.42298317G>A		137.0	0.0		96.0	31.0	NM_001206670	Q6ZSC0	Silent	SNP	ENST00000399518.3	37	CCDS55962.1																																																																																			G|0.997;A|0.003		0.507	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
PLEKHA6	22874	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	204192627	204192627	+	Missense_Mutation	SNP	C	C	A	rs201146402		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:204192627C>A	ENST00000272203.3	-	22	3434	c.3118G>T	c.(3118-3120)Gcc>Tcc	p.A1040S	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.A1060S	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	1040										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTGCTGTCGGCGCCCCGTGGG	0.592																																					p.A1040S		.											.	PLEKHA6	654	0			c.G3118T						.						24.0	23.0	23.0					1																	204192627		2039	3973	6012	SO:0001583	missense	22874	exon22			TGTCGGCGCCCCG	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.3118G>T	1.37:g.204192627C>A	ENSP00000272203:p.Ala1040Ser	157.0	0.0		161.0	15.0	NM_014935	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692303	0.48202	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.10573	2.86;3.32	4.59	1.68	0.24146	.	0.511281	0.18767	N	0.131713	T	0.06600	0.0169	N	0.22421	0.69	0.31554	N	0.658433	B	0.32862	0.387	B	0.29862	0.108	T	0.16808	-1.0390	10	0.46703	T	0.11	-7.6857	7.5934	0.28033	0.0:0.6528:0.0:0.3472	.	1040	Q9Y2H5	PKHA6_HUMAN	S	1040;1060	ENSP00000272203:A1040S;ENSP00000402046:A1060S	ENSP00000272203:A1040S	A	-	1	0	PLEKHA6	202459250	0.992000	0.36948	0.999000	0.59377	0.986000	0.74619	0.119000	0.15626	0.141000	0.18875	0.455000	0.32223	GCC	.		0.592	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
POC5	134359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74973679	74973679	+	Missense_Mutation	SNP	T	T	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:74973679T>G	ENST00000428202.2	-	11	1693	c.1504A>C	c.(1504-1506)Att>Ctt	p.I502L	POC5_ENST00000446329.2_Missense_Mutation_p.I477L|POC5_ENST00000514838.2_Missense_Mutation_p.I474L|POC5_ENST00000510798.1_Intron|POC5_ENST00000380475.2_Intron	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	502					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CTGCTGCTAATTCTATTTTTT	0.418																																					p.I502L		.											.	POC5	45	0			c.A1504C						.						131.0	117.0	121.0					5																	74973679		1842	4097	5939	SO:0001583	missense	134359	exon11			TGCTAATTCTATT	AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.1504A>C	5.37:g.74973679T>G	ENSP00000410216:p.Ile502Leu	64.0	0.0		104.0	29.0	NM_001099271	B4DJG7|Q494X7|Q494X9|Q6P085	Missense_Mutation	SNP	ENST00000428202.2	37	CCDS47236.1	.	.	.	.	.	.	.	.	.	.	T	12.62	1.991437	0.35131	.	.	ENSG00000152359	ENST00000428202;ENST00000514838;ENST00000446329	T;T;T	0.32023	1.88;1.47;1.87	5.92	0.828	0.18841	.	0.511853	0.23444	N	0.048106	T	0.27313	0.0670	M	0.71581	2.175	0.34221	D	0.675475	B;B	0.33940	0.433;0.433	B;B	0.29598	0.104;0.104	T	0.32981	-0.9886	10	0.23891	T	0.37	-13.1806	10.4271	0.44385	0.0:0.3387:0.0:0.6613	.	502;477	Q8NA72;Q8NA72-3	POC5_HUMAN;.	L	502;474;477	ENSP00000410216:I502L;ENSP00000420971:I474L;ENSP00000399481:I477L	ENSP00000410216:I502L	I	-	1	0	POC5	75009435	0.981000	0.34729	0.097000	0.21041	0.297000	0.27493	0.497000	0.22514	-0.070000	0.12908	-0.924000	0.02725	ATT	.		0.418	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369124.1	NM_152408	
POM121L2	94026	broad.mit.edu;bcgsc.ca	37	6	27278073	27278073	+	Missense_Mutation	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:27278073G>T	ENST00000444565.1	-	1	1876	c.1877C>A	c.(1876-1878)aCc>aAc	p.T626N	POM121L2_ENST00000377451.2_Missense_Mutation_p.T562N	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	626										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GGCTAGGGTGGTGGACATGAC	0.493																																					p.T626N		.											.	.	.	0			c.C1877A						.						46.0	42.0	43.0					6																	27278073		692	1591	2283	SO:0001583	missense	94026	exon1			AGGGTGGTGGACA	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1877C>A	6.37:g.27278073G>T	ENSP00000392726:p.Thr626Asn	83.0	0.0		127.0	7.0	NM_033482	C9J1I7	Missense_Mutation	SNP	ENST00000444565.1	37	CCDS59497.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860874	0.32884	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.16196	2.36;2.36	3.96	2.12	0.27331	.	0.425083	0.17432	N	0.174440	T	0.06645	0.0170	L	0.47716	1.5	0.09310	N	1	P	0.41784	0.762	B	0.44278	0.445	T	0.22068	-1.0227	10	0.34782	T	0.22	.	5.278	0.15661	0.1067:0.0:0.6948:0.1985	.	626	C9J1I7	.	N	562;626	ENSP00000366671:T562N;ENSP00000392726:T626N	ENSP00000366671:T562N	T	-	2	0	POM121L2	27386052	0.022000	0.18835	0.001000	0.08648	0.047000	0.14425	1.861000	0.39438	0.600000	0.29862	0.484000	0.47621	ACC	.		0.493	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81747020	81747020	+	Missense_Mutation	SNP	A	A	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:81747020A>T	ENST00000549396.1	-	17	2032	c.1872T>A	c.(1870-1872)gaT>gaA	p.D624E	PPFIA2_ENST00000407050.4_Missense_Mutation_p.D550E|PPFIA2_ENST00000548586.1_Missense_Mutation_p.D624E|PPFIA2_ENST00000333447.7_Missense_Mutation_p.D606E|PPFIA2_ENST00000549325.1_Missense_Mutation_p.D606E|PPFIA2_ENST00000541570.2_Missense_Mutation_p.D191E|PPFIA2_ENST00000550359.2_Missense_Mutation_p.D471E|PPFIA2_ENST00000550584.2_Missense_Mutation_p.D624E|PPFIA2_ENST00000443686.3_Missense_Mutation_p.D525E|PPFIA2_ENST00000552948.1_Missense_Mutation_p.D624E|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000545296.2_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	624	Poly-Asp.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TGTCATCATCATCAATATCAG	0.433																																					p.D624E		.											.	PPFIA2	231	0			c.T1872A						.						170.0	162.0	164.0					12																	81747020		1906	4140	6046	SO:0001583	missense	8499	exon16			ATCATCATCAATA	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1872T>A	12.37:g.81747020A>T	ENSP00000450337:p.Asp624Glu	74.0	0.0		117.0	40.0	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	A	14.68	2.607943	0.46527	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058	T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	5.44	3.09	0.35607	.	0.000000	0.85682	D	0.000000	T	0.47192	0.1432	L	0.41415	1.275	0.80722	D	1	D	0.58970	0.984	D	0.68192	0.956	T	0.32214	-0.9915	10	0.11794	T	0.64	-27.1628	9.6885	0.40114	0.8585:0.0:0.1415:0.0	.	624	O75334	LIPA2_HUMAN	E	624;606;191;550;635;606;624;525;624;205	ENSP00000450337:D624E;ENSP00000450298:D606E;ENSP00000438337:D191E;ENSP00000385093:D550E;ENSP00000327416:D606E;ENSP00000449338:D624E;ENSP00000388373:D525E;ENSP00000447868:D624E;ENSP00000448941:D205E	ENSP00000327416:D606E	D	-	3	2	PPFIA2	80271151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.969000	0.49232	0.368000	0.24481	0.477000	0.44152	GAT	.		0.433	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
PRDM1	639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106552731	106552731	+	Silent	SNP	C	C	T	rs373718206		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:106552731C>T	ENST00000369096.4	+	5	930	c.696C>T	c.(694-696)agC>agT	p.S232S	PRDM1_ENST00000369089.3_Silent_p.S98S|PRDM1_ENST00000369091.2_Silent_p.S196S	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	232					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		AGCAACCGAGCACTGAGAAAA	0.448			"""D, N, Mis, F, S"""		DLBCL																																p.S232S		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	862	0			c.C696T						.	C	,	0,4406		0,0,2203	172.0	183.0	179.0		696,294	2.5	0.0	6		179	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	PRDM1	NM_001198.3,NM_182907.1	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	232/826,98/692	106552731	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	639	exon5			ACCGAGCACTGAG		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.696C>T	6.37:g.106552731C>T		38.0	0.0		60.0	7.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Silent	SNP	ENST00000369096.4	37	CCDS5054.2																																																																																			.		0.448	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PRKDC	5591	broad.mit.edu;mdanderson.org	37	8	48794656	48794656	+	Silent	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr8:48794656C>T	ENST00000314191.2	-	38	4832	c.4776G>A	c.(4774-4776)gtG>gtA	p.V1592V	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.V1592V	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1593					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	AAACGGCACTCACCTGAGACA	0.383								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						111.0	102.0	105.0					8																	48794656		1873	4110	5983	SO:0001819	synonymous_variant	5591	.			GGCACTCACCTGA		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.4776G>A	8.37:g.48794656C>T		35.0	0.0		56.0	10.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37																																																																																				.		0.383	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	69020369	69020369	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr8:69020369C>T	ENST00000288368.4	+	24	3018	c.2741C>T	c.(2740-2742)gCc>gTc	p.A914V		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	914					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAGAATAGGGCCTGGCCTACT	0.393																																					p.A914V		.											.	PREX2	390	0			c.C2741T						.						84.0	74.0	77.0					8																	69020369		2203	4300	6503	SO:0001583	missense	80243	exon24			ATAGGGCCTGGCC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2741C>T	8.37:g.69020369C>T	ENSP00000288368:p.Ala914Val	50.0	0.0		94.0	5.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.730242	0.30684	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.27720	1.65	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.22475	0.0542	N	0.25286	0.73	0.80722	D	1	B;B	0.26195	0.144;0.0	B;B	0.27076	0.076;0.002	T	0.07028	-1.0794	10	0.02654	T	1	.	20.1634	0.98142	0.0:1.0:0.0:0.0	.	979;914	Q70Z35-2;Q70Z35	.;PREX2_HUMAN	V	914;980	ENSP00000288368:A914V	ENSP00000288368:A914V	A	+	2	0	PREX2	69182923	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.773000	0.95371	0.655000	0.94253	GCC	.		0.393	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PTGER2	5732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	52781678	52781678	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr14:52781678A>G	ENST00000245457.5	+	1	566	c.412A>G	c.(412-414)Atc>Gtc	p.I138V	PTGER2_ENST00000557436.1_Intron	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	138					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CTACCTCTCGATCGGGCACCC	0.652																																					p.I138V		.											.	PTGER2	658	0			c.A412G						.						60.0	61.0	60.0					14																	52781678		2200	4298	6498	SO:0001583	missense	5732	exon1			CTCTCGATCGGGC		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.412A>G	14.37:g.52781678A>G	ENSP00000245457:p.Ile138Val	72.0	0.0		56.0	14.0	NM_000956	D3DSC0|Q52LG8	Missense_Mutation	SNP	ENST00000245457.5	37	CCDS9708.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645913	0.67358	.	.	ENSG00000125384	ENST00000245457	T	0.76709	-1.04	5.23	2.66	0.31614	GPCR, rhodopsin-like superfamily (1);	0.050329	0.85682	D	0.000000	T	0.77405	0.4125	L	0.56769	1.78	0.43259	D	0.995192	P	0.39737	0.685	P	0.46208	0.507	T	0.78048	-0.2356	10	0.72032	D	0.01	-26.2719	10.3392	0.43868	0.6864:0.3136:0.0:0.0	.	138	P43116	PE2R2_HUMAN	V	138	ENSP00000245457:I138V	ENSP00000245457:I138V	I	+	1	0	PTGER2	51851428	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	2.186000	0.42593	0.918000	0.36919	-0.460000	0.05396	ATC	.		0.652	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276890.1		
PTPRB	5787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	70949887	70949887	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:70949887A>G	ENST00000261266.5	-	17	4131	c.4102T>C	c.(4102-4104)Tcc>Ccc	p.S1368P	PTPRB_ENST00000550358.1_Missense_Mutation_p.S1498P|PTPRB_ENST00000334414.6_Missense_Mutation_p.S1586P|PTPRB_ENST00000451516.2_Missense_Mutation_p.S1278P|PTPRB_ENST00000550857.1_Missense_Mutation_p.S1278P|PTPRB_ENST00000538708.1_Missense_Mutation_p.S1278P	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1368	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATGGCCGTGGAGTTCTGAGGC	0.443																																					p.S1586P		.											.	PTPRB	226	0			c.T4756C						.						45.0	42.0	43.0					12																	70949887		1839	4086	5925	SO:0001583	missense	5787	exon19			CCGTGGAGTTCTG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.4102T>C	12.37:g.70949887A>G	ENSP00000261266:p.Ser1368Pro	81.0	0.0		76.0	6.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.540052	0.85917	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.64461	0.2600	L	0.27053	0.805	0.58432	D	0.999999	D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.898	D;D;D;D;P	0.97110	1.0;1.0;1.0;1.0;0.876	T	0.62765	-0.6785	10	0.30854	T	0.27	.	15.7577	0.78046	1.0:0.0:0.0:0.0	.	1278;1278;1586;1368;1498	P23467-2;F5H3G6;P23467-3;P23467;F8VU56	.;.;.;PTPRB_HUMAN;.	P	1586;1278;1498;1278;1278;1368	ENSP00000334928:S1586P;ENSP00000393028:S1278P;ENSP00000448058:S1498P;ENSP00000438927:S1278P;ENSP00000447302:S1278P;ENSP00000261266:S1368P	ENSP00000261266:S1368P	S	-	1	0	PTPRB	69236154	1.000000	0.71417	0.995000	0.50966	0.968000	0.65278	8.573000	0.90759	2.117000	0.64856	0.533000	0.62120	TCC	.		0.443	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PUM1	9698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	31438867	31438867	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:31438867G>A	ENST00000257075.5	-	13	2141	c.2048C>T	c.(2047-2049)gCc>gTc	p.A683V	PUM1_ENST00000490546.1_5'Flank|PUM1_ENST00000373741.4_Missense_Mutation_p.A719V|SNORD85_ENST00000363311.1_RNA|PUM1_ENST00000373747.3_Missense_Mutation_p.A684V|PUM1_ENST00000440538.2_Missense_Mutation_p.A657V|PUM1_ENST00000423018.2_Missense_Mutation_p.A539V|PUM1_ENST00000424085.2_Missense_Mutation_p.A441V|PUM1_ENST00000373742.2_Missense_Mutation_p.A624V|PUM1_ENST00000426105.2_Missense_Mutation_p.A683V	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	683	Ser-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TCCCAGGGTGGCGCCGAGAGA	0.493																																					p.A683V		.											.	PUM1	92	0			c.C2048T						.						74.0	78.0	77.0					1																	31438867		2203	4300	6503	SO:0001583	missense	9698	exon13			AGGGTGGCGCCGA	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.2048C>T	1.37:g.31438867G>A	ENSP00000257075:p.Ala683Val	124.0	0.0		135.0	15.0	NM_014676	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.	.	.	.	.	.	.	.	.	.	G	31	5.086143	0.94100	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	T;T;T;T;T;T;T;T	0.18810	2.22;2.19;2.47;2.46;2.47;2.45;2.45;2.22	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	L	0.45228	1.405	0.80722	D	1	D;B;D;B;D;D;D;D	0.69078	0.997;0.084;0.997;0.137;0.982;0.994;0.982;0.982	P;B;P;B;P;P;P;P	0.59357	0.856;0.042;0.856;0.092;0.772;0.856;0.772;0.772	T	0.00500	-1.1703	10	0.25751	T	0.34	-8.5673	20.3931	0.98965	0.0:0.0:1.0:0.0	.	624;539;719;657;683;683;684;683	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.;.	V	441;683;684;421;683;657;719;539;624	ENSP00000400141:A441V;ENSP00000257075:A683V;ENSP00000362852:A684V;ENSP00000391723:A683V;ENSP00000401777:A657V;ENSP00000362846:A719V;ENSP00000399440:A539V;ENSP00000362847:A624V	ENSP00000257075:A683V	A	-	2	0	PUM1	31211454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	2.824000	0.97209	0.655000	0.94253	GCC	.		0.493	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
CTC-497E21.3	0	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	13031864	13031864	+	lincRNA	SNP	C	C	G	rs374969897		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:13031864C>G	ENST00000533002.1	-	0	0																											AGCGGCTCCACGAGCTGGACC	0.642																																					p.H247Q		.											.	.	.	0			c.C741G						.	C	GLN/HIS	1,4113		0,1,2056	11.0	13.0	12.0		741	-2.5	0.9	11		12	0,7968		0,0,3984	no	missense	RASSF10	NM_001080521.2	24	0,1,6040	GG,GC,CC		0.0,0.0243,0.0083	benign	247/508	13031864	1,12081	2057	3984	6041			644943	exon1			GCTCCACGAGCTG																													11.37:g.13031864C>G		130.0	0.0		117.0	32.0	NM_001080521		Missense_Mutation	SNP	ENST00000533002.1	37																																																																																				.		0.642	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
RELA	5970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65422089	65422089	+	Silent	SNP	G	G	T	rs150493312		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:65422089G>T	ENST00000406246.3	-	11	1677	c.1416C>A	c.(1414-1416)tcC>tcA	p.S472S	RELA_ENST00000308639.9_Silent_p.S469S|RELA_ENST00000525693.1_3'UTR	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	472					acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						GCTGAAACTCGGAGTTGTCGA	0.577																																					p.S472S		.											.	RELA	872	0			c.C1416A						.						63.0	63.0	63.0					11																	65422089		2201	4297	6498	SO:0001819	synonymous_variant	5970	exon11			AAACTCGGAGTTG	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.1416C>A	11.37:g.65422089G>T		81.0	0.0		73.0	20.0	NM_021975	Q6GTV1|Q6SLK1	Silent	SNP	ENST00000406246.3	37	CCDS31609.1																																																																																			G|1.000;C|0.000		0.577	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390457.2	NM_021975	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111732714	111732714	+	Missense_Mutation	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr6:111732714T>C	ENST00000358835.3	-	4	827	c.373A>G	c.(373-375)Atc>Gtc	p.I125V	REV3L_ENST00000368805.1_Missense_Mutation_p.I125V|REV3L_ENST00000368802.3_Missense_Mutation_p.I125V|REV3L_ENST00000435970.1_Missense_Mutation_p.I47V			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	125					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TAAAGATAGATCTTCATAAAG	0.234								DNA polymerases (catalytic subunits)																													p.I125V		.											.	REV3L	294	0			c.A373G						.						35.0	35.0	35.0					6																	111732714		2175	4279	6454	SO:0001583	missense	5980	exon3			GATAGATCTTCAT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.373A>G	6.37:g.111732714T>C	ENSP00000351697:p.Ile125Val	131.0	0.0		234.0	56.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	15.06	2.720937	0.48728	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.58	5.58	0.84498	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.04497	0.0123	L	0.60957	1.885	0.34316	D	0.685982	P	0.38129	0.619	B	0.33890	0.172	T	0.15093	-1.0449	10	0.62326	D	0.03	.	10.8914	0.46998	0.0:0.0729:0.0:0.9271	.	125	O60673	DPOLZ_HUMAN	V	125;125;125;47	ENSP00000357792:I125V;ENSP00000357795:I125V;ENSP00000351697:I125V;ENSP00000402003:I47V	ENSP00000351697:I125V	I	-	1	0	REV3L	111839407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.823000	0.62694	2.121000	0.65114	0.533000	0.62120	ATC	.		0.234	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RGPD4	285190	broad.mit.edu;ucsc.edu;mdanderson.org	37	2	108487761	108487761	+	Missense_Mutation	SNP	C	C	G	rs556511922		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:108487761C>G	ENST00000408999.3	+	20	3378	c.3301C>G	c.(3301-3303)Cga>Gga	p.R1101G	RGPD4_ENST00000354986.4_Missense_Mutation_p.R1101G	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1101	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AATGCTGATGCGAAGAGAACA	0.428																																					p.R1101G		.											.	RGPD4	2	0			c.C3301G						.						14.0	10.0	11.0					2																	108487761		689	1572	2261	SO:0001583	missense	285190	exon20			CTGATGCGAAGAG	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3301C>G	2.37:g.108487761C>G	ENSP00000386810:p.Arg1101Gly	14.0	0.0		28.0	5.0	NM_182588	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	3.676	-0.066528	0.07273	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.66280	-0.2;-0.2	2.33	-0.118	0.13547	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.81389	0.4812	H	0.96333	3.805	0.24009	N	0.996181	P	0.49559	0.925	P	0.61397	0.888	T	0.69771	-0.5055	9	0.72032	D	0.01	-6.6328	8.471	0.32986	0.534:0.466:0.0:0.0	.	1101	Q7Z3J3	RGPD4_HUMAN	G	1101;1101;859	ENSP00000347081:R1101G;ENSP00000386810:R1101G	ENSP00000347081:R1101G	R	+	1	2	RGPD4	107854193	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	1.633000	0.37113	0.262000	0.21774	0.162000	0.16502	CGA	.		0.428	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
RTKN2	219790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	63976948	63976948	+	Frame_Shift_Del	DEL	G	G	-	rs77837774		TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr10:63976948delG	ENST00000373789.3	-	9	1045	c.949delC	c.(949-951)ctcfs	p.L317fs	RTKN2_ENST00000395265.1_Frame_Shift_Del_p.L317fs|RTKN2_ENST00000315289.2_Frame_Shift_Del_p.L98fs	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	317	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					AAACAATAGAGTTTACCTCCT	0.328																																					p.L317fs		.											.	RTKN2	68	0			c.949delC						.						119.0	136.0	131.0					10																	63976948		2203	4300	6503	SO:0001589	frameshift_variant	219790	exon9			AATAGAGTTTACC	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.949delC	10.37:g.63976948delG	ENSP00000362894:p.Leu317fs	174.0	0.0		151.0	39.0	NM_145307	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Frame_Shift_Del	DEL	ENST00000373789.3	37	CCDS7263.1																																																																																			.		0.328	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	NM_145307	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33825515	33825515	+	Missense_Mutation	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr15:33825515C>A	ENST00000389232.4	+	5	428	c.358C>A	c.(358-360)Cta>Ata	p.L120I	RYR3_ENST00000415757.3_Missense_Mutation_p.L120I	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	120	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTCACAGTATCTAACATGCTT	0.418																																					p.L120I		.											.	RYR3	520	0			c.C358A						.						105.0	101.0	103.0					15																	33825515		1961	4159	6120	SO:0001583	missense	6263	exon5			CAGTATCTAACAT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.358C>A	15.37:g.33825515C>A	ENSP00000373884:p.Leu120Ile	26.0	0.0		31.0	7.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752348	0.69533	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98437	-4.93;-4.93	4.43	4.43	0.53597	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);	0.000000	0.64402	D	0.000005	D	0.98460	0.9487	M	0.73962	2.25	0.48341	D	0.999631	D;D	0.56746	0.957;0.977	D;D	0.73380	0.98;0.93	D	0.98387	1.0561	10	0.87932	D	0	.	9.2379	0.37477	0.0:0.8618:0.0:0.1382	.	120;120	Q15413-2;Q15413	.;RYR3_HUMAN	I	120	ENSP00000373884:L120I;ENSP00000399610:L120I	ENSP00000354735:L120I	L	+	1	2	RYR3	31612807	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.078000	0.30754	2.442000	0.82660	0.655000	0.94253	CTA	.		0.418	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SIK3	23387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	116728796	116728796	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:116728796G>A	ENST00000292055.4	-	20	3102	c.3067C>T	c.(3067-3069)Cac>Tac	p.H1023Y	SIK3_ENST00000375288.1_Missense_Mutation_p.H358Y|SIK3_ENST00000375300.1_Missense_Mutation_p.H1081Y|SIK3_ENST00000542607.1_Missense_Mutation_p.H963Y|SIK3_ENST00000446921.2_Missense_Mutation_p.H1021Y|SIK3_ENST00000434315.2_Missense_Mutation_p.H862Y|AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000488337.1_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	1023					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GCATACCCGTGGGGCGGGGTG	0.557																																					p.H1023Y		.											.	SIK3	919	0			c.C3067T						.						86.0	91.0	89.0					11																	116728796		2201	4296	6497	SO:0001583	missense	23387	exon20			ACCCGTGGGGCGG	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.3067C>T	11.37:g.116728796G>A	ENSP00000292055:p.His1023Tyr	124.0	0.0		80.0	22.0	NM_025164	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	ENST00000292055.4	37	CCDS8379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.79|12.79	2.043583|2.043583	0.36085|0.36085	.|.	.|.	ENSG00000160584|ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000375288;ENST00000542607;ENST00000434315|ENST00000445177;ENST00000446921	T;T;T;T;T|T	0.32515|0.31769	1.45;1.45;1.45;1.45;1.45|1.48	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.000000|.	0.42548|.	U|.	0.000685|.	T|T	0.37210|0.37210	0.0995|0.0995	N|N	0.24115|0.24115	0.695|0.695	0.38431|0.38431	D|D	0.946435|0.946435	B;B;B;B;P|.	0.34757|.	0.205;0.357;0.13;0.203;0.467|.	B;B;B;B;B|.	0.31686|.	0.126;0.081;0.033;0.052;0.134|.	T|T	0.32428|0.32428	-0.9907|-0.9907	10|7	0.87932|0.72032	D|D	0|0.01	.|.	19.4865|19.4865	0.95030|0.95030	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1023;963;862;1023;358|.	Q9Y2K2-3;A1A5A8;A1A5A9;Q9Y2K2;Q9Y2K2-2|.	.;.;.;SIK3_HUMAN;.|.	Y|L	1081;1023;358;963;862|1122;985	ENSP00000364449:H1081Y;ENSP00000292055:H1023Y;ENSP00000364437:H358Y;ENSP00000438108:H963Y;ENSP00000415873:H862Y|ENSP00000391295:P1122L	ENSP00000292055:H1023Y|ENSP00000391295:P1122L	H|P	-|-	1|2	0|0	SIK3|SIK3	116234006|116234006	1.000000|1.000000	0.71417|0.71417	0.919000|0.919000	0.36401|0.36401	0.766000|0.766000	0.43426|0.43426	4.991000|4.991000	0.63883|0.63883	2.585000|2.585000	0.87301|0.87301	0.563000|0.563000	0.77884|0.77884	CAC|CCA	.		0.557	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_025164	
SLC22A15	55356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	116574033	116574033	+	Missense_Mutation	SNP	A	A	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:116574033A>C	ENST00000369503.4	+	6	905	c.775A>C	c.(775-777)Agt>Cgt	p.S259R	SLC22A15_ENST00000369502.1_Nonstop_Mutation_p.*246C	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	259					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GGGTCGACTGAGTGAGGCTGA	0.493																																					p.S259R		.											.	SLC22A15	67	0			c.A775C						.						83.0	83.0	83.0					1																	116574033		1977	4162	6139	SO:0001583	missense	55356	exon6			CGACTGAGTGAGG	AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.775A>C	1.37:g.116574033A>C	ENSP00000358515:p.Ser259Arg	112.0	0.0		100.0	21.0	NM_018420	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	ENST00000369503.4	37	CCDS44198.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.50|12.50	1.956343|1.956343	0.34565|0.34565	.|.	.|.	ENSG00000163393|ENSG00000163393	ENST00000369503|ENST00000369502	T|.	0.56941|.	0.43|.	4.81|4.81	-0.816|-0.816	0.10839|0.10839	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.535487|.	0.22852|.	N|.	0.054859|.	T|.	0.05502|.	0.0145|.	N|N	0.02412|0.02412	-0.56|-0.56	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.13407|.	0.009|.	T|.	0.38950|.	-0.9637|.	10|.	0.23891|.	T|.	0.37|.	.|.	15.5677|15.5677	0.76306|0.76306	0.4101:0.5899:0.0:0.0|0.4101:0.5899:0.0:0.0	.|.	259|.	Q8IZD6|.	S22AF_HUMAN|.	R|C	259|246	ENSP00000358515:S259R|.	ENSP00000358515:S259R|.	S|X	+|+	1|3	0|0	SLC22A15|SLC22A15	116375556|116375556	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.982000|0.982000	0.71751|0.71751	1.859000|1.859000	0.39418|0.39418	-0.002000|-0.002000	0.14469|0.14469	0.533000|0.533000	0.62120|0.62120	AGT|TGA	.		0.493	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033220.2	NM_018420	
SLC25A32	81034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	104427069	104427069	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr8:104427069C>T	ENST00000297578.4	-	1	263	c.97G>A	c.(97-99)Ggc>Agc	p.G33S	SLC25A32_ENST00000543107.1_5'UTR|DCAF13_ENST00000521716.1_5'Flank|DCAF13_ENST00000297579.5_5'UTR|DCAF13_ENST00000519682.1_5'Flank|DCAF13_ENST00000521971.1_5'Flank	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	33					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	GATAAGACGCCGCCGCTCACG	0.657																																					p.G33S		.											.	SLC25A32	91	0			c.G97A						.						27.0	31.0	29.0					8																	104427069		2203	4300	6503	SO:0001583	missense	81034	exon1			AGACGCCGCCGCT	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.97G>A	8.37:g.104427069C>T	ENSP00000297578:p.Gly33Ser	113.0	0.0		173.0	102.0	NM_030780	Q96JZ6|Q96SU7	Missense_Mutation	SNP	ENST00000297578.4	37	CCDS6300.1	.	.	.	.	.	.	.	.	.	.	C	36	5.927375	0.97110	.	.	ENSG00000164933	ENST00000297578;ENST00000424899	D	0.85171	-1.95	5.02	5.02	0.67125	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.93854	0.8034	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94896	0.8052	10	0.87932	D	0	-0.8709	18.1346	0.89614	0.0:1.0:0.0:0.0	.	33	Q9H2D1	MFTC_HUMAN	S	33;17	ENSP00000297578:G33S	ENSP00000297578:G33S	G	-	1	0	SLC25A32	104496245	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	7.315000	0.78998	2.590000	0.87494	0.655000	0.94253	GGC	.		0.657	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780	
SLC51A	200931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195953959	195953959	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr3:195953959G>A	ENST00000296327.5	+	3	466	c.257G>A	c.(256-258)cGg>cAg	p.R86Q		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	86					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	ATCAAGAGGCGGACTCTGCTC	0.597																																					p.R86Q		.											.	.	.	0			c.G257A						.						95.0	86.0	89.0					3																	195953959		2203	4300	6503	SO:0001583	missense	200931	exon3			AGAGGCGGACTCT		CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.257G>A	3.37:g.195953959G>A	ENSP00000296327:p.Arg86Gln	43.0	0.0		51.0	5.0	NM_152672	Q6ZMC7	Missense_Mutation	SNP	ENST00000296327.5	37	CCDS3314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.82|14.82	2.648913|2.648913	0.47362|0.47362	.|.	.|.	ENSG00000163959|ENSG00000163959	ENST00000428985|ENST00000296327	.|T	.|0.48522	.|0.81	5.86|5.86	-1.94|-1.94	0.07571|0.07571	.|.	.|0.384133	.|0.22351	.|N	.|0.061212	T|T	0.37785|0.37785	0.1016|0.1016	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	.|P;B	.|0.52577	.|0.954;0.384	.|B;B	.|0.39738	.|0.308;0.057	T|T	0.43458|0.43458	-0.9390|-0.9390	5|10	.|0.54805	.|T	.|0.06	.|.	12.2156|12.2156	0.54404|0.54404	0.6951:0.0:0.3049:0.0|0.6951:0.0:0.3049:0.0	.|.	.|86;86	.|B4DVA3;Q86UW1	.|.;OSTA_HUMAN	R|Q	57|86	.|ENSP00000296327:R86Q	.|ENSP00000296327:R86Q	G|R	+|+	1|2	0|0	AC069257.9|AC069257.9	197438356|197438356	0.981000|0.981000	0.34729|0.34729	0.947000|0.947000	0.38551|0.38551	0.306000|0.306000	0.27790|0.27790	0.130000|0.130000	0.15850|0.15850	-0.243000|-0.243000	0.09653|0.09653	0.563000|0.563000	0.77884|0.77884	GGA|CGG	.		0.597	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	
SLIT3	6586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	168123358	168123358	+	Silent	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr5:168123358G>A	ENST00000519560.1	-	28	3440	c.3021C>T	c.(3019-3021)aaC>aaT	p.N1007N	SLIT3_ENST00000404867.3_Silent_p.N1007N|SLIT3_ENST00000332966.8_Silent_p.N1014N	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1007	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTGGCATTGTTTTCGCAGT	0.552																																					p.N1014N	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3	95	0			c.C3042T						.						285.0	230.0	249.0					5																	168123358		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon28			GGCATTGTTTTCG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3021C>T	5.37:g.168123358G>A		68.0	0.0		74.0	32.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																			.		0.552	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SNX15	29907	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64802558	64802558	+	Missense_Mutation	SNP	G	G	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr11:64802558G>T	ENST00000377244.3	+	5	530	c.400G>T	c.(400-402)Gtg>Ttg	p.V134L	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.V134L	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	134					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						ACCCTTGGAGGTGTCCAGGGA	0.627																																					p.V134L	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SNX15	227	0			c.G400T						.						31.0	32.0	31.0					11																	64802558		2201	4296	6497	SO:0001583	missense	29907	exon5			TTGGAGGTGTCCA	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.400G>T	11.37:g.64802558G>T	ENSP00000366452:p.Val134Leu	140.0	0.0		109.0	9.0	NM_147777	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	.	.	.	.	.	.	.	.	.	.	G	1.296	-0.606227	0.03717	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000524831;ENST00000352068;ENST00000525648	T;T;T;T	0.32515	1.89;1.45;1.47;1.88	4.77	0.393	0.16294	.	1.552840	0.03597	N	0.232706	T	0.15696	0.0378	N	0.14661	0.345	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.18429	-1.0337	10	0.02654	T	1	-9.4708	6.039	0.19724	0.2645:0.0:0.6026:0.1328	.	134;134;134	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	L	134;130;122;134;54	ENSP00000366452:V134L;ENSP00000437277:V130L;ENSP00000431690:V122L;ENSP00000316410:V134L	ENSP00000316410:V134L	V	+	1	0	SNX15	64559134	0.008000	0.16893	0.000000	0.03702	0.015000	0.08874	0.038000	0.13862	-0.231000	0.09825	-1.151000	0.01829	GTG	.		0.627	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
STAB2	55576	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	104157269	104157269	+	Splice_Site	SNP	G	G	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:104157269G>C	ENST00000388887.2	+	68	7692		c.e68-1		RP11-341G23.4_ENST00000550029.1_RNA|RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTTCCAAACAGTCGGAAGAGG	0.527																																					.		.											.	STAB2	104	0			c.7489-1G>C						.						248.0	241.0	243.0					12																	104157269		2203	4300	6503	SO:0001630	splice_region_variant	55576	exon68			CAAACAGTCGGAA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7489-1G>C	12.37:g.104157269G>C		69.0	0.0		75.0	21.0	NM_017564		Splice_Site	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674513	0.47781	.	.	ENSG00000136011	ENST00000388887	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1808	0.81898	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB2	102681399	1.000000	0.71417	0.967000	0.41034	0.718000	0.41266	5.912000	0.69948	2.490000	0.84030	0.561000	0.74099	.	.		0.527	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		Intron
STXBP4	252983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	53158439	53158439	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr17:53158439A>G	ENST00000376352.2	+	16	1591	c.1384A>G	c.(1384-1386)Act>Gct	p.T462A	STXBP4_ENST00000434978.2_Missense_Mutation_p.T440A	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	462					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						AGCTTCTCAGACTTCCCTCAC	0.393																																					p.T462A		.											.	STXBP4	91	0			c.A1384G						.						142.0	129.0	134.0					17																	53158439		2203	4300	6503	SO:0001583	missense	252983	exon16			TCTCAGACTTCCC	BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1384A>G	17.37:g.53158439A>G	ENSP00000365530:p.Thr462Ala	105.0	0.0		131.0	47.0	NM_178509	Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	37	CCDS11584.2	.	.	.	.	.	.	.	.	.	.	A	8.004	0.756099	0.15846	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	T;T	0.44482	0.92;0.92	5.48	3.17	0.36434	.	0.400500	0.29822	N	0.011101	T	0.26882	0.0658	L	0.50919	1.6	0.80722	D	1	B;B	0.33857	0.429;0.077	B;B	0.24006	0.05;0.026	T	0.04440	-1.0951	10	0.12103	T	0.63	-11.7525	6.2359	0.20762	0.7763:0.0:0.0804:0.1433	.	440;462	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	A	462;440	ENSP00000365530:T462A;ENSP00000391087:T440A	ENSP00000365530:T462A	T	+	1	0	STXBP4	50513438	0.999000	0.42202	0.991000	0.47740	0.035000	0.12851	2.160000	0.42348	1.053000	0.40415	0.533000	0.62120	ACT	.		0.393	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	NM_178509	
TAMM41	132001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	11858718	11858718	+	Missense_Mutation	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr3:11858718A>G	ENST00000444133.2	-	5	798	c.656T>C	c.(655-657)aTa>aCa	p.I219T	TAMM41_ENST00000455809.1_Missense_Mutation_p.I219T|TAMM41_ENST00000273037.5_Missense_Mutation_p.I219T			Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)	219					cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										TTCCTGTAGTATGCTGCCATA	0.413																																					p.I219T		.											.	.	.	0			c.T656C						.						138.0	136.0	137.0					3																	11858718		2203	4300	6503	SO:0001583	missense	132001	exon5			TGTAGTATGCTGC		CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000444133.2:c.656T>C	3.37:g.11858718A>G	ENSP00000388598:p.Ile219Thr	90.0	0.0		71.0	16.0	NM_138807	B4DIY7|C9J2U4	Missense_Mutation	SNP	ENST00000444133.2	37		.	.	.	.	.	.	.	.	.	.	A	18.10	3.547439	0.65311	.	.	ENSG00000144559	ENST00000455809;ENST00000273037;ENST00000444133	T;T;T	0.35048	1.33;1.33;1.33	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.54711	0.1875	L	0.60455	1.87	0.54753	D	0.999988	D;D;P	0.71674	0.987;0.998;0.642	D;D;P	0.70227	0.953;0.968;0.574	T	0.56492	-0.7970	10	0.54805	T	0.06	-40.35	13.9613	0.64182	1.0:0.0:0.0:0.0	.	219;219;219	B4DIY7;C9J2U4;Q96BW9	.;.;TAM41_HUMAN	T	219	ENSP00000398596:I219T;ENSP00000273037:I219T;ENSP00000388598:I219T	ENSP00000273037:I219T	I	-	2	0	TAMM41	11833718	1.000000	0.71417	0.967000	0.41034	0.994000	0.84299	9.069000	0.93967	1.898000	0.54952	0.450000	0.29827	ATA	.		0.413	TAMM41-008	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000339258.2	NM_138807	
TCF23	150921	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	27372096	27372096	+	Missense_Mutation	SNP	G	G	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:27372096G>A	ENST00000296096.5	+	1	225	c.95G>A	c.(94-96)aGg>aAg	p.R32K	TCF23_ENST00000407815.3_3'UTR	NM_175769.2	NP_786951.1	Q7RTU1	TCF23_HUMAN	transcription factor 23	32					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	nucleus (GO:0005634)				large_intestine(2)|lung(11)|prostate(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCGCTGACAGGAAGAGGAGC	0.642																																					p.R32K		.											.	TCF23	90	0			c.G95A						.						32.0	26.0	28.0					2																	27372096		2176	4273	6449	SO:0001583	missense	150921	exon1			CTGACAGGAAGAG	AC013403	CCDS33163.1	2p23.3	2013-05-21			ENSG00000163792	ENSG00000163792		"""Basic helix-loop-helix proteins"""	18602	protein-coding gene	gene with protein product		609635				11701948, 10652346	Standard	NM_175769		Approved	OUT, bHLHa24	uc010ylg.2	Q7RTU1	OTTHUMG00000152031	ENST00000296096.5:c.95G>A	2.37:g.27372096G>A	ENSP00000296096:p.Arg32Lys	98.0	0.0		109.0	6.0	NM_175769	B2RNZ3	Missense_Mutation	SNP	ENST00000296096.5	37	CCDS33163.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054589	0.36277	.	.	ENSG00000163792	ENST00000296096;ENST00000407815	D	0.97404	-4.37	4.79	1.96	0.26148	.	1.000500	0.08067	N	0.999266	D	0.93956	0.8065	L	0.49350	1.555	0.24634	N	0.993609	B	0.12013	0.005	B	0.08055	0.003	D	0.84527	0.0631	10	0.20519	T	0.43	-10.5645	6.242	0.20795	0.3154:0.0:0.6846:0.0	.	32	Q7RTU1	TCF23_HUMAN	K	32	ENSP00000296096:R32K	ENSP00000296096:R32K	R	+	2	0	TCF23	27225600	0.999000	0.42202	0.892000	0.35008	0.796000	0.44982	0.819000	0.27308	0.559000	0.29153	0.462000	0.41574	AGG	.		0.642	TCF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324980.1	NM_175769	
TGOLN2	10618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85554158	85554158	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:85554158C>T	ENST00000409232.3	-	2	758	c.697G>A	c.(697-699)Gac>Aac	p.D233N	TGOLN2_ENST00000377386.3_Missense_Mutation_p.D233N|TGOLN2_ENST00000444342.2_Missense_Mutation_p.D233N|TGOLN2_ENST00000282120.2_Missense_Mutation_p.D135N|TGOLN2_ENST00000398263.2_Missense_Mutation_p.D233N|TGOLN2_ENST00000409015.1_Missense_Mutation_p.D233N			O43493	TGON2_HUMAN	trans-golgi network protein 2	233	14 X 14 AA tandem repeats.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											CTGGGCCCGTCTATTGGGCCC	0.577																																					p.D233N		.											.	TGOLN2	22	0			c.G697A						.						114.0	117.0	116.0					2																	85554158		1917	4103	6020	SO:0001583	missense	10618	exon2			GCCCGTCTATTGG	AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.697G>A	2.37:g.85554158C>T	ENSP00000386443:p.Asp233Asn	78.0	0.0		58.0	7.0	NM_001206841	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Missense_Mutation	SNP	ENST00000409232.3	37	CCDS56126.1	.	.	.	.	.	.	.	.	.	.	C	1.878	-0.458548	0.04508	.	.	ENSG00000152291	ENST00000377386;ENST00000282120;ENST00000398263;ENST00000409232;ENST00000409015;ENST00000444342	T;T;T;T;T;T	0.12569	2.75;2.68;2.67;2.79;2.76;2.73	2.12	-4.24	0.03777	.	.	.	.	.	T	0.08980	0.0222	L	0.52573	1.65	0.09310	N	1	B;P;P;B	0.42518	0.025;0.782;0.615;0.058	B;B;B;B	0.37888	0.015;0.26;0.188;0.01	T	0.24225	-1.0166	9	0.14656	T	0.56	.	5.26	0.15567	0.0:0.2037:0.4123:0.3839	.	233;233;233;233	O43493;O43493-5;O43493-4;O43493-2	TGON2_HUMAN;.;.;.	N	233;135;233;233;233;233	ENSP00000366603:D233N;ENSP00000282120:D135N;ENSP00000381312:D233N;ENSP00000386443:D233N;ENSP00000387035:D233N;ENSP00000391190:D233N	ENSP00000282120:D135N	D	-	1	0	TGOLN2	85407669	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.362000	0.07602	-1.210000	0.02627	-0.506000	0.04501	GAC	.		0.577	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
TMEM132D	121256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	129569203	129569203	+	Missense_Mutation	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr12:129569203C>A	ENST00000422113.2	-	6	1814	c.1488G>T	c.(1486-1488)atG>atT	p.M496I	TMEM132D_ENST00000389441.4_Missense_Mutation_p.M34I	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	496					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCTTGCCTTTCATTTCTTTCC	0.542																																					p.M496I		.											.	TMEM132D	106	0			c.G1488T						.						124.0	95.0	105.0					12																	129569203		2203	4300	6503	SO:0001583	missense	121256	exon6			GCCTTTCATTTCT	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1488G>T	12.37:g.129569203C>A	ENSP00000408581:p.Met496Ile	109.0	0.0		95.0	19.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	c	12.14	1.847441	0.32606	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.47528	0.84;0.84	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.50429	0.1615	L	0.41710	1.295	0.45621	D	0.998558	D;P	0.56035	0.974;0.594	P;B	0.50659	0.647;0.39	T	0.47484	-0.9114	9	.	.	.	-70.0423	17.8083	0.88608	0.0:1.0:0.0:0.0	.	496;34	Q14C87;Q14C87-2	T132D_HUMAN;.	I	34;496	ENSP00000374092:M34I;ENSP00000408581:M496I	.	M	-	3	0	TMEM132D	128135156	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	2.559000	0.45888	2.181000	0.69327	0.556000	0.70494	ATG	.		0.542	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr17:7577114C>T	ENST00000269305.4	-	8	1013	c.824G>A	c.(823-825)tGt>tAt	p.C275Y	TP53_ENST00000359597.4_Missense_Mutation_p.C275Y|TP53_ENST00000445888.2_Missense_Mutation_p.C275Y|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C275Y|TP53_ENST00000455263.2_Missense_Mutation_p.C275Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C275Y	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	c.G824A	GRCh37	CM076568|CM951234	TP53	M		.						71.0	61.0	64.0					17																	7577114		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAGGCACAAACAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>A	17.37:g.7577114C>T	ENSP00000269305:p.Cys275Tyr	84.0	0.0		52.0	15.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605675	0.87157	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.997	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	275;275;275;275;275;264;143	ENSP00000352610:C275Y;ENSP00000269305:C275Y;ENSP00000398846:C275Y;ENSP00000391127:C275Y;ENSP00000391478:C275Y;ENSP00000425104:C143Y	ENSP00000269305:C275Y	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179427137	179427137	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:179427137C>T	ENST00000591111.1	-	276	79023	c.78799G>A	c.(78799-78801)Gaa>Aaa	p.E26267K	TTN_ENST00000359218.5_Missense_Mutation_p.E18968K|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E27908K|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E18843K|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E19035K|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E25340K|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26267	Fibronectin type-III 91. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCACTTTTCACTCCCTTTA	0.433																																					p.E27908K		.											.	TTN	636	0			c.G83722A						.						100.0	96.0	98.0					2																	179427137		1939	4153	6092	SO:0001583	missense	7273	exon326			ACTTTTCACTCCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78799G>A	2.37:g.179427137C>T	ENSP00000465570:p.Glu26267Lys	33.0	0.0		64.0	17.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	16.82	3.228079	0.58777	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.89	5.89	0.94794	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57417	0.2052	L	0.46819	1.47	0.58432	D	0.999998	P;P;P;P	0.43231	0.801;0.801;0.801;0.684	B;B;B;B	0.40741	0.339;0.339;0.339;0.258	T	0.61802	-0.6988	9	0.87932	D	0	.	20.2618	0.98447	0.0:1.0:0.0:0.0	.	18843;18968;19035;26267	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	25340;18843;19035;18968;18841	ENSP00000343764:E25340K;ENSP00000434586:E18843K;ENSP00000340554:E19035K;ENSP00000352154:E18968K	ENSP00000340554:E19035K	E	-	1	0	TTN	179135383	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.361000	0.52306	2.793000	0.96121	0.655000	0.94253	GAA	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TRPM8	79054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234875362	234875362	+	Missense_Mutation	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr2:234875362C>T	ENST00000324695.4	+	15	2028	c.1988C>T	c.(1987-1989)gCc>gTc	p.A663V	TRPM8_ENST00000433712.2_Missense_Mutation_p.A351V	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	663					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GCGGTGGAGGCCACAGACCAG	0.547																																					p.A663V		.											.	TRPM8	94	0			c.C1988T						.						87.0	76.0	80.0					2																	234875362		2203	4300	6503	SO:0001583	missense	79054	exon15			TGGAGGCCACAGA	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.1988C>T	2.37:g.234875362C>T	ENSP00000323926:p.Ala663Val	47.0	0.0		73.0	23.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802817	0.70682	.	.	ENSG00000144481	ENST00000324695;ENST00000433712;ENST00000456930	D;D;T	0.98455	-4.94;-4.94;-0.78	5.61	4.71	0.59529	.	0.000000	0.64402	D	0.000003	D	0.97810	0.9281	M	0.78049	2.395	0.47862	D	0.99953	D;P	0.57571	0.98;0.489	P;B	0.46389	0.515;0.177	D	0.97781	1.0232	10	0.87932	D	0	-14.6178	15.4281	0.75069	0.0:0.8604:0.1396:0.0	.	351;663	A0AVG2;Q7Z2W7	.;TRPM8_HUMAN	V	663;351;34	ENSP00000323926:A663V;ENSP00000404423:A351V;ENSP00000414198:A34V	ENSP00000323926:A663V	A	+	2	0	TRPM8	234540101	0.998000	0.40836	0.896000	0.35187	0.985000	0.73830	4.281000	0.58965	1.460000	0.47911	0.655000	0.94253	GCC	.		0.547	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
UGT2A1	10941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	70504723	70504723	+	Intron	SNP	C	C	T			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr4:70504723C>T	ENST00000503640.1	-	1	771				UGT2A1_ENST00000286604.4_Intron|UGT2A1_ENST00000514019.1_Silent_p.Q413Q|UGT2A1_ENST00000512704.1_Intron|UGT2A2_ENST00000457664.2_Silent_p.Q212Q	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus						cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						CAAAGGTCATCTGGTCAGTGA	0.428																																					p.Q413Q		.											.	UGT2A1	92	0			c.G1239A						.						49.0	49.0	49.0					4																	70504723		1897	4118	6015	SO:0001627	intron_variant	10941	exon3			GGTCATCTGGTCA	AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.715+7924G>A	4.37:g.70504723C>T		160.0	0.0		196.0	22.0	NM_001252274	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Silent	SNP	ENST00000503640.1	37	CCDS3529.1																																																																																			.		0.428	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215808006	215808006	+	Missense_Mutation	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:215808006C>A	ENST00000307340.3	-	70	15478	c.15092G>T	c.(15091-15093)cGg>cTg	p.R5031L	USH2A_ENST00000366943.2_Missense_Mutation_p.R5031L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	5031			R -> W (in dbSNP:rs56038610). {ECO:0000269|PubMed:18273898}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTTTTGCTCCGCGATCCCTT	0.448										HNSCC(13;0.011)																											p.R5031L		.											.	USH2A	115	0			c.G15092T						.						115.0	109.0	111.0					1																	215808006		2203	4300	6503	SO:0001583	missense	7399	exon70			TTGCTCCGCGATC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.15092G>T	1.37:g.215808006C>A	ENSP00000305941:p.Arg5031Leu	94.0	0.0		155.0	18.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	3.441	-0.114151	0.06881	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12774	2.65;2.65	5.82	2.87	0.33458	.	0.495526	0.16770	N	0.200241	T	0.08714	0.0216	L	0.36672	1.1	0.09310	N	1	B	0.16166	0.016	B	0.14578	0.011	T	0.44452	-0.9327	10	0.07644	T	0.81	.	6.3204	0.21215	0.0:0.5532:0.1289:0.3178	.	5031	O75445	USH2A_HUMAN	L	5031	ENSP00000305941:R5031L;ENSP00000355910:R5031L	ENSP00000305941:R5031L	R	-	2	0	USH2A	213874629	0.005000	0.15991	0.000000	0.03702	0.121000	0.20230	0.426000	0.21363	0.088000	0.17205	-0.797000	0.03246	CGG	.		0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USP32	84669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	58260713	58260713	+	Missense_Mutation	SNP	C	C	A			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr17:58260713C>A	ENST00000300896.4	-	31	4130	c.3936G>T	c.(3934-3936)ttG>ttT	p.L1312F	USP32_ENST00000592339.1_Missense_Mutation_p.L982F	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1312	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CTCTTGGTACCAAAAAAGCAC	0.458																																					p.L1312F		.											.	USP32	704	0			c.G3936T						.						74.0	76.0	75.0					17																	58260713		2203	4300	6503	SO:0001583	missense	84669	exon31			TGGTACCAAAAAA	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.3936G>T	17.37:g.58260713C>A	ENSP00000300896:p.Leu1312Phe	111.0	0.0		161.0	84.0	NM_032582	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	ENST00000300896.4	37	CCDS32697.1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865340	0.71949	.	.	ENSG00000170832	ENST00000300896	T	0.34072	1.38	5.78	1.07	0.20283	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.52025	0.1709	M	0.74467	2.265	0.80722	D	1	D	0.69078	0.997	D	0.65874	0.939	T	0.51896	-0.8647	10	0.72032	D	0.01	.	8.1786	0.31296	0.1198:0.676:0.0:0.2042	.	1312	Q8NFA0	UBP32_HUMAN	F	1312	ENSP00000300896:L1312F	ENSP00000300896:L1312F	L	-	3	2	USP32	55615495	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	1.826000	0.39092	0.354000	0.24105	0.650000	0.86243	TTG	.		0.458	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449235.2	NM_032582	
VPS13A	23230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79820239	79820239	+	Silent	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr9:79820239A>G	ENST00000360280.3	+	4	458	c.198A>G	c.(196-198)aaA>aaG	p.K66K	VPS13A_ENST00000376634.4_Silent_p.K66K|VPS13A_ENST00000357409.5_Silent_p.K66K|VPS13A_ENST00000376636.3_Silent_p.K66K	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	66					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTAATCTTAAACTTATAATTC	0.289																																					p.K66K		.											.	VPS13A	161	0			c.A198G						.						35.0	41.0	39.0					9																	79820239		2197	4275	6472	SO:0001819	synonymous_variant	23230	exon4			TCTTAAACTTATA	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.198A>G	9.37:g.79820239A>G		213.0	0.0		235.0	56.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	37	CCDS6655.1																																																																																			.		0.289	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
CFAP43	80217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105932273	105932273	+	Missense_Mutation	SNP	T	T	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr10:105932273T>G	ENST00000278064.2	-	20	2599	c.2274A>C	c.(2272-2274)gaA>gaC	p.E758D	WDR96_ENST00000357060.3_Missense_Mutation_p.E827D|WDR96_ENST00000428666.1_Missense_Mutation_p.E828D																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTTTGTCATTTTCTTCCATCA	0.318																																					p.E827D		.											.	WDR96	95	0			c.A2481C						.						76.0	68.0	71.0					10																	105932273		2202	4298	6500	SO:0001583	missense	80217	exon20			GTCATTTTCTTCC																												ENST00000278064.2:c.2274A>C	10.37:g.105932273T>G	ENSP00000278064:p.Glu758Asp	45.0	0.0		40.0	11.0	NM_025145		Missense_Mutation	SNP	ENST00000278064.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.78|14.78	2.636559|2.636559	0.47049|0.47049	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064|ENST00000434629	T;T;T|.	0.16743|.	2.32;2.32;2.34|.	5.59|5.59	3.19|3.19	0.36642|0.36642	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.55924|0.55924	0.1951|0.1951	M|M	0.71581|0.71581	2.175|2.175	0.34078|0.34078	D|D	0.659268|0.659268	P;P;P|.	0.45474|.	0.707;0.859;0.859|.	B;B;B|.	0.41571|.	0.286;0.36;0.334|.	T|T	0.62158|0.62158	-0.6913|-0.6913	10|5	0.52906|.	T|.	0.07|.	.|.	4.9171|4.9171	0.13851|0.13851	0.138:0.1443:0.0:0.7177|0.138:0.1443:0.0:0.7177	.|.	828;828;827|.	G5E9L1;B4DHB6;Q8NDM7|.	.;.;WDR96_HUMAN|.	D|T	827;828;758|188	ENSP00000349568:E827D;ENSP00000400289:E828D;ENSP00000278064:E758D|.	ENSP00000278064:E758D|.	E|K	-|-	3|2	2|0	WDR96|WDR96	105922263|105922263	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.866000|0.866000	0.49608|0.49608	0.891000|0.891000	0.28309|0.28309	0.377000|0.377000	0.24735|0.24735	0.528000|0.528000	0.53228|0.53228	GAA|AAA	.		0.318	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		
ZC2HC1A	51101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	79598833	79598833	+	Silent	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr8:79598833T>C	ENST00000263849.4	+	4	444	c.342T>C	c.(340-342)tcT>tcC	p.S114S	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	114							metal ion binding (GO:0046872)										CTCCACCTTCTTATGATCCTG	0.378																																					p.S114S		.											.	.	.	0			c.T342C						.						55.0	55.0	55.0					8																	79598833		2203	4300	6503	SO:0001819	synonymous_variant	51101	exon4			ACCTTCTTATGAT		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.342T>C	8.37:g.79598833T>C		127.0	0.0		270.0	37.0	NM_016010	Q9Y372	Silent	SNP	ENST00000263849.4	37	CCDS6223.1																																																																																			.		0.378	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
ZNF683	257101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	26694244	26694244	+	Silent	SNP	A	A	G			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr1:26694244A>G	ENST00000436292.1	-	3	279	c.159T>C	c.(157-159)caT>caC	p.H53H	ZNF683_ENST00000374204.1_Silent_p.H53H|ZNF683_ENST00000349618.3_Silent_p.H53H|ZNF683_ENST00000403843.1_Silent_p.H53H			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	53			H -> R (in dbSNP:rs10794531).		natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		AGGATGGGCCATGAGCATCCA	0.652																																					p.H53H		.											.	.	.	0			c.T159C						.						28.0	25.0	26.0					1																	26694244		2203	4297	6500	SO:0001819	synonymous_variant	257101	exon3			TGGGCCATGAGCA	BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.159T>C	1.37:g.26694244A>G		101.0	0.0		81.0	19.0	NM_173574	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Silent	SNP	ENST00000436292.1	37																																																																																				.		0.652	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000009794.2	NM_173574	
ZNF91	7644	hgsc.bcm.edu;bcgsc.ca	37	19	23545412	23545412	+	Silent	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr19:23545412T>C	ENST00000300619.7	-	4	574	c.369A>G	c.(367-369)agA>agG	p.R123R	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Silent_p.R91R	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	123					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TACAACCTTTTCTTAACTGTA	0.358																																					p.R123R		.											.	ZNF91	90	0			c.A369G						.						69.0	73.0	72.0					19																	23545412		2132	4273	6405	SO:0001819	synonymous_variant	7644	exon4			ACCTTTTCTTAAC	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.369A>G	19.37:g.23545412T>C		40.0	0.0		39.0	4.0	NM_003430	A8K5E1|B7Z6G6	Silent	SNP	ENST00000300619.7	37	CCDS42541.1																																																																																			.		0.358	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ZNFX1	57169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47864862	47864862	+	Missense_Mutation	SNP	T	T	C			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr20:47864862T>C	ENST00000396105.1	-	14	4945	c.4699A>G	c.(4699-4701)Atg>Gtg	p.M1567V	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Missense_Mutation_p.M1567V	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1567							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ACCTCATCCATGTGGCAGATC	0.542																																					p.M1567V		.											.	ZNFX1	24	0			c.A4699G						.						88.0	92.0	90.0					20																	47864862		2203	4300	6503	SO:0001583	missense	57169	exon14			CATCCATGTGGCA	AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.4699A>G	20.37:g.47864862T>C	ENSP00000379412:p.Met1567Val	85.0	0.0		72.0	35.0	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	ENST00000396105.1	37	CCDS13417.1	.	.	.	.	.	.	.	.	.	.	T	2.695	-0.272365	0.05716	.	.	ENSG00000124201	ENST00000371752;ENST00000396105	T;T	0.56103	0.48;0.48	6.04	4.02	0.46733	.	0.970787	0.08522	N	0.933342	T	0.34803	0.0910	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24154	-1.0168	10	0.26408	T	0.33	0.3078	9.3459	0.38109	0.0:0.1749:0.5493:0.2758	.	1567	Q9P2E3	ZNFX1_HUMAN	V	1567	ENSP00000360817:M1567V;ENSP00000379412:M1567V	ENSP00000360817:M1567V	M	-	1	0	ZNFX1	47298269	0.861000	0.29849	0.845000	0.33349	0.896000	0.52359	1.830000	0.39131	0.793000	0.33875	-0.366000	0.07423	ATG	.		0.542	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
NIN	51199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	51233078	51233079	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-RG-A7D4-01A-12D-A33Q-10	TCGA-RG-A7D4-10A-01D-A33Q-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d11dc224-6c52-4463-837f-20d99569f8b9	473df61f-c817-4a0c-a458-934d47687fa9	g.chr14:51233078_51233079GG>TT	ENST00000382041.3	-	14	1771_1772	c.1581_1582CC>AA	c.(1579-1584)ttCCtg>ttAAtg	p.527_528FL>LM	NIN_ENST00000382043.4_Missense_Mutation_p.527_528FL>LM|NIN_ENST00000453196.1_Missense_Mutation_p.527_528FL>LM|NIN_ENST00000389868.3_Missense_Mutation_p.527_528FL>LM|NIN_ENST00000324330.9_Missense_Mutation_p.527_528FL>LM|NIN_ENST00000245441.5_Missense_Mutation_p.527_528FL>LM|NIN_ENST00000530997.2_Missense_Mutation_p.527_528FL>LM	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	527					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TCTTCTTGCAGGAAGAACTCAG	0.49			T	PDGFRB	MPD																																p.FL527LM		.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	.	.	0			.						.																																			SO:0001583	missense	51199	.			CTTGCAGGAAGAA	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.1581_1582delinsTT	14.37:g.51233078_51233079delinsTT	ENSP00000371472:p.F527_L528delinsLM	78.0	0.0		81.0	14.0	.	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	DNP	ENST00000382041.3	37	CCDS32079.1																																																																																			.		0.490	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
