#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AASDH	132949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57219583	57219583	+	Silent	SNP	T	T	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr4:57219583T>C	ENST00000205214.6	-	9	1743	c.1563A>G	c.(1561-1563)ccA>ccG	p.P521P	AASDH_ENST00000602986.1_Silent_p.P368P|AASDH_ENST00000513376.1_Silent_p.P421P|AASDH_ENST00000510762.1_5'Flank|AASDH_ENST00000434343.2_Silent_p.P36P|AASDH_ENST00000502617.1_Silent_p.P521P|AASDH_ENST00000451613.1_Silent_p.P521P	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	521					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GGGATGTAAATGGTAGAGAGT	0.323																																					p.P521P		.											.	AASDH	94	0			c.A1563G						.						73.0	72.0	72.0					4																	57219583		2203	4300	6503	SO:0001819	synonymous_variant	132949	exon9			TGTAAATGGTAGA	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1563A>G	4.37:g.57219583T>C		104.0	0.0		66.0	16.0	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Silent	SNP	ENST00000205214.6	37	CCDS3504.1																																																																																			.		0.323	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
AQR	9716	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	35149307	35149307	+	Splice_Site	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr15:35149307T>A	ENST00000156471.5	-	35	4369	c.4144A>T	c.(4144-4146)Act>Tct	p.T1382S		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1382					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TGTAATAAAGTCTAATTAAAA	0.353																																					p.T1382S		.											.	AQR	135	0			c.A4144T						.						90.0	79.0	82.0					15																	35149307		1837	4078	5915	SO:0001630	splice_region_variant	9716	exon35			ATAAAGTCTAATT	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.4144-1A>T	15.37:g.35149307T>A		47.0	0.0		44.0	15.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	6.724	0.502394	0.12822	.	.	ENSG00000021776	ENST00000543879	.	.	.	5.5	3.18	0.36537	.	0.464126	0.25442	N	0.030646	T	0.24928	0.0605	L	0.29908	0.895	0.26649	N	0.97215	B	0.15473	0.013	B	0.11329	0.006	T	0.19679	-1.0298	9	0.08599	T	0.76	-15.6472	7.9422	0.29965	0.0:0.1791:0.0:0.8209	.	1382	O60306	AQR_HUMAN	S	1382	.	ENSP00000445700:T1382S	T	-	1	0	AQR	32936599	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	0.893000	0.28336	1.112000	0.41740	0.533000	0.62120	ACT	.		0.353	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	Missense_Mutation
ARHGEF15	22899	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	8216406	8216417	+	In_Frame_Del	DEL	CGGTCACCCTGC	CGGTCACCCTGC	-			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	CGGTCACCCTGC	CGGTCACCCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr17:8216406_8216417delCGGTCACCCTGC	ENST00000361926.3	+	3	878_889	c.768_779delCGGTCACCCTGC	c.(766-780)atcggtcaccctgcc>atc	p.GHPA257del	ARHGEF15_ENST00000421050.1_In_Frame_Del_p.GHPA257del	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	257					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CTCCAAGCATCGGTCACCCTGCCGTTGTCCTC	0.651																																					p.256_260del		.											.	ARHGEF15	230	0			c.768_779del						.																																			SO:0001651	inframe_deletion	22899	exon3			AAGCATCGGTCAC	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.768_779delCGGTCACCCTGC	17.37:g.8216406_8216417delCGGTCACCCTGC	ENSP00000355026:p.Gly257_Ala260del	58.0	0.0		33.0	11.0	NM_025014	A8K6G1|Q8N449|Q9H8B4	In_Frame_Del	DEL	ENST00000361926.3	37	CCDS11139.1																																																																																			.		0.651	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226993.2	NM_173728	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27094294	27094294	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:27094294C>G	ENST00000324856.7	+	11	3373	c.3002C>G	c.(3001-3003)tCt>tGt	p.S1001C	ARID1A_ENST00000374152.2_Missense_Mutation_p.S618C|ARID1A_ENST00000457599.2_Missense_Mutation_p.S1001C	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1001	Poly-Ser.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCCAGTTCTTCTACTACAACC	0.478			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S1001C		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	0			c.C3002G						.						88.0	79.0	82.0					1																	27094294		2203	4300	6503	SO:0001583	missense	8289	exon11			GTTCTTCTACTAC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3002C>G	1.37:g.27094294C>G	ENSP00000320485:p.Ser1001Cys	76.0	0.0		69.0	33.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.888226	0.72524	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.03152	4.26;4.03;4.07	5.17	3.29	0.37713	ARID/BRIGHT DNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.12518	0.0304	L	0.59436	1.845	0.80722	D	1	D;B;B	0.71674	0.998;0.017;0.005	D;B;B	0.71414	0.973;0.008;0.002	T	0.00431	-1.1743	10	0.66056	D	0.02	-10.562	10.6932	0.45884	0.0:0.7963:0.1324:0.0713	.	1001;1001;655	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	C	1001;1001;618	ENSP00000320485:S1001C;ENSP00000387636:S1001C;ENSP00000363267:S618C	ENSP00000320485:S1001C	S	+	2	0	ARID1A	26966881	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	0.749000	0.32854	-0.175000	0.13238	TCT	.		0.478	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ARID3A	1820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	968403	968403	+	Splice_Site	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:968403A>T	ENST00000263620.3	+	8	1822		c.e8-1			NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)							cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.?(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCTTCCCACAGCCTCCGAAA	0.512																																					.	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A	90	1	Unknown(1)	endometrium(1)	c.1496-2A>T						.						72.0	68.0	69.0					19																	968403		2203	4300	6503	SO:0001630	splice_region_variant	1820	exon8			TCCCACAGCCTCC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.1496-1A>T	19.37:g.968403A>T		153.0	0.0		152.0	56.0	NM_005224	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Splice_Site	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.251681	0.22880	.	.	ENSG00000116017	ENST00000263620	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0247	0.30430	0.7931:0.2069:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARID3A	919403	0.497000	0.26067	0.971000	0.41717	0.125000	0.20455	2.074000	0.41529	1.852000	0.53769	0.374000	0.22700	.	.		0.512	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	Intron
ARNT	405	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	150788840	150788840	+	Silent	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:150788840T>A	ENST00000358595.5	-	19	2045	c.1845A>T	c.(1843-1845)tcA>tcT	p.S615S	ARNT_ENST00000505755.1_Silent_p.S600S|ARNT_ENST00000515192.1_Silent_p.S601S|ARNT_ENST00000354396.2_Silent_p.S613S	NM_001197325.1|NM_001668.3|NM_178427.2	NP_001184254.1|NP_001659.1|NP_848514.1	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator	615					cell differentiation (GO:0030154)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor activity (GO:0004874)|aryl hydrocarbon receptor binding (GO:0017162)|enhancer binding (GO:0035326)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|prostate(2)|skin(4)|stomach(1)	34	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGCAGAAGCTGATGGCTGGA	0.502			T	ETV6	AML																																p.S615S		.		Dom	yes		1	1q21	405	aryl hydrocarbon receptor nuclear translocator		L	.	ARNT	1085	0			c.A1845T						.						69.0	71.0	70.0					1																	150788840		2203	4300	6503	SO:0001819	synonymous_variant	405	exon19			AGAAGCTGATGGC	AF001307	CCDS970.1, CCDS971.1, CCDS65641.1, CCDS65642.1	1q21	2013-05-21			ENSG00000143437	ENSG00000143437		"""Basic helix-loop-helix proteins"""	700	protein-coding gene	gene with protein product		126110					Standard	NM_001668		Approved	HIF-1beta, bHLHe2	uc001evr.2	P27540	OTTHUMG00000035011	ENST00000358595.5:c.1845A>T	1.37:g.150788840T>A		66.0	0.0		124.0	21.0	NM_001668	B2R9H1|C4AMA1|F8WAP6|Q59ED4|Q5QP39|Q8NDC7	Silent	SNP	ENST00000358595.5	37	CCDS970.1																																																																																			.		0.502	ARNT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084741.2		
ART5	116969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	3661593	3661593	+	Silent	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr11:3661593A>T	ENST00000397068.3	-	2	458	c.66T>A	c.(64-66)gcT>gcA	p.A22A	ART5_ENST00000397067.3_Silent_p.A22A|ART5_ENST00000359918.4_Silent_p.A22A|TRPC2_ENST00000526541.1_RNA	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	22					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGATGGGAACAGCCTGGGCCT	0.572																																					p.A22A		.											.	ART5	91	0			c.T66A						.						22.0	23.0	22.0					11																	3661593		2095	4073	6168	SO:0001819	synonymous_variant	116969	exon3			GGGAACAGCCTGG	Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.66T>A	11.37:g.3661593A>T		33.0	0.0		52.0	27.0	NM_001079536	C9IYG7|Q6UX84|Q86W02	Silent	SNP	ENST00000397068.3	37	CCDS7743.1																																																																																			.		0.572	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017	
BBS12	166379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123664496	123664496	+	Silent	SNP	T	T	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr4:123664496T>C	ENST00000314218.3	+	2	1642	c.1449T>C	c.(1447-1449)gaT>gaC	p.D483D	BBS12_ENST00000542236.1_Silent_p.D483D	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	483					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						ATGTTGTAGATAGGAACAACA	0.453									Bardet-Biedl syndrome																												p.D483D		.											.	BBS12	92	0			c.T1449C						.						79.0	77.0	77.0					4																	123664496		2203	4300	6503	SO:0001819	synonymous_variant	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TGTAGATAGGAAC	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1449T>C	4.37:g.123664496T>C		108.0	0.0		54.0	15.0	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Silent	SNP	ENST00000314218.3	37	CCDS3728.1																																																																																			.		0.453	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
BCL11B	64919	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	99641808	99641808	+	Nonsense_Mutation	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr14:99641808G>C	ENST00000357195.3	-	4	1374	c.1365C>G	c.(1363-1365)taC>taG	p.Y455*	BCL11B_ENST00000345514.2_Nonsense_Mutation_p.Y384*|BCL11B_ENST00000443726.2_Nonsense_Mutation_p.Y261*	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	455					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		GCTGGCACTTGTAGGGCTTCT	0.642			T	TLX3	T-ALL																																p.Y455X		.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	1147	0			c.C1365G						.						28.0	28.0	28.0					14																	99641808		2202	4300	6502	SO:0001587	stop_gained	64919	exon4			GCACTTGTAGGGC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1365C>G	14.37:g.99641808G>C	ENSP00000349723:p.Tyr455*	47.0	0.0		44.0	5.0	NM_138576	Q9H162	Nonsense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	G	36	5.813304	0.96975	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	.	.	.	3.72	3.72	0.42706	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.4387	7.5413	0.27740	0.1963:0.0:0.8037:0.0	.	.	.	.	X	455;384;261	.	ENSP00000280435:Y384X	Y	-	3	2	BCL11B	98711561	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.468000	0.73551	1.794000	0.52575	0.462000	0.41574	TAC	.		0.642	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
BMP5	653	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	55620351	55620351	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr6:55620351G>A	ENST00000370830.3	-	7	2043	c.1345C>T	c.(1345-1347)Cgc>Tgc	p.R449C	BMP5_ENST00000446683.2_Missense_Mutation_p.R412C	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	449					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCACATGAGCGTACTACCATA	0.328																																					p.R449C		.											.	BMP5	516	0			c.C1345T						.						55.0	58.0	57.0					6																	55620351		2203	4299	6502	SO:0001583	missense	653	exon7			ATGAGCGTACTAC		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.1345C>T	6.37:g.55620351G>A	ENSP00000359866:p.Arg449Cys	327.0	2.0		430.0	142.0	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	37	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408449	0.62399	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	D;D	0.89415	-2.51;-2.51	5.73	5.73	0.89815	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93501	0.7926	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.973;0.996	D	0.93716	0.7028	10	0.87932	D	0	.	15.0392	0.71774	0.0:0.0:0.8579:0.1421	.	412;449	B4E0Y4;P22003	.;BMP5_HUMAN	C	449;412	ENSP00000359866:R449C;ENSP00000391818:R412C	ENSP00000359866:R449C	R	-	1	0	BMP5	55728310	1.000000	0.71417	0.975000	0.42487	0.994000	0.84299	5.038000	0.64177	2.854000	0.98071	0.655000	0.94253	CGC	.		0.328	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
C1QTNF2	114898	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	159776435	159776435	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr5:159776435C>T	ENST00000393975.3	-	3	736	c.733G>A	c.(733-735)Gac>Aac	p.D245N		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	200	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCGTGATGTCGTAGGTGAAG	0.572																																					p.D245N		.											.	C1QTNF2	91	0			c.G733A						.						88.0	89.0	88.0					5																	159776435		2203	4300	6503	SO:0001583	missense	114898	exon3			TGATGTCGTAGGT	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.733G>A	5.37:g.159776435C>T	ENSP00000377545:p.Asp245Asn	67.0	0.0		77.0	19.0	NM_031908		Missense_Mutation	SNP	ENST00000393975.3	37	CCDS4351.2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056875	0.76074	.	.	ENSG00000145861	ENST00000393975	T	0.74842	-0.88	5.35	5.35	0.76521	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	T	0.76962	0.4061	N	0.16833	0.445	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.76389	-0.2977	10	0.31617	T	0.26	.	18.6668	0.91493	0.0:1.0:0.0:0.0	.	200	Q9BXJ5	C1QT2_HUMAN	N	245	ENSP00000377545:D245N	ENSP00000377545:D245N	D	-	1	0	C1QTNF2	159709013	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	7.818000	0.86416	2.513000	0.84729	0.591000	0.81541	GAC	.		0.572	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
CFAP61	26074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20257971	20257971	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:20257971G>A	ENST00000245957.5	+	22	2741	c.2665G>A	c.(2665-2667)Gcg>Acg	p.A889T	C20orf26_ENST00000377309.2_Missense_Mutation_p.A245T	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		889										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CGTGGCGGACGCGCTAGGAGC	0.667																																					p.A889T		.											.	C20orf26	94	0			c.G2665A						.						66.0	63.0	64.0					20																	20257971		2203	4300	6503	SO:0001583	missense	26074	exon22			GCGGACGCGCTAG																												ENST00000245957.5:c.2665G>A	20.37:g.20257971G>A	ENSP00000245957:p.Ala889Thr	101.0	0.0		105.0	21.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	37	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750304	0.89753	.	.	ENSG00000089101	ENST00000343997;ENST00000377309;ENST00000389655;ENST00000245957	T;T	0.20881	2.04;2.04	5.03	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.33990	0.0882	L	0.61387	1.9	0.80722	D	1	D;P	0.76494	0.999;0.868	P;B	0.56648	0.803;0.229	T	0.02925	-1.1093	10	0.28530	T	0.3	.	12.8135	0.57652	0.0791:0.0:0.9209:0.0	.	855;889	F8W6K4;Q8NHU2	.;CT026_HUMAN	T	829;245;855;889	ENSP00000366524:A245T;ENSP00000245957:A889T	ENSP00000245957:A889T	A	+	1	0	C20orf26	20205971	1.000000	0.71417	0.061000	0.19648	0.012000	0.07955	6.259000	0.72494	2.344000	0.79699	0.460000	0.39030	GCG	.		0.667	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
CAGE1	285782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	7334305	7334305	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr6:7334305T>A	ENST00000512086.1	-	10	2404	c.2202A>T	c.(2200-2202)aaA>aaT	p.K734N	CAGE1_ENST00000338150.4_Missense_Mutation_p.K761N|CAGE1_ENST00000379918.4_Missense_Mutation_p.K774N|SSR1_ENST00000488834.1_5'UTR|CAGE1_ENST00000502583.1_Missense_Mutation_p.K796N|CAGE1_ENST00000296742.7_Missense_Mutation_p.K598N			Q8TC20	CAGE1_HUMAN	cancer antigen 1	734										breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					CCTCTAAATGTTTATTTCTCT	0.274																																					p.K796N		.											.	CAGE1	22	0			c.A2388T						.						35.0	32.0	33.0					6																	7334305		1762	3984	5746	SO:0001583	missense	285782	exon12			TAAATGTTTATTT	BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.2202A>T	6.37:g.7334305T>A	ENSP00000427583:p.Lys734Asn	49.0	0.0		76.0	32.0	NM_001170692	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Missense_Mutation	SNP	ENST00000512086.1	37		.	.	.	.	.	.	.	.	.	.	T	16.78	3.217091	0.58560	.	.	ENSG00000164304	ENST00000541116;ENST00000379918;ENST00000502583;ENST00000296742;ENST00000512086;ENST00000338150	T;T;T;T;T	0.37411	1.27;1.2;1.25;1.25;1.24	4.62	3.46	0.39613	.	0.131360	0.35349	N	0.003272	T	0.30572	0.0769	L	0.47716	1.5	0.22378	N	0.999155	D;D;D	0.67145	0.996;0.996;0.996	P;P;D	0.65573	0.907;0.876;0.936	T	0.06844	-1.0804	10	0.52906	T	0.07	-18.6693	6.8651	0.24088	0.0:0.104:0.0:0.896	.	761;796;734	Q8TC20-3;D6RCT9;Q8TC20	.;.;CAGE1_HUMAN	N	734;774;796;598;734;761	ENSP00000369250:K774N;ENSP00000425493:K796N;ENSP00000296742:K598N;ENSP00000427583:K734N;ENSP00000338107:K761N	ENSP00000296742:K598N	K	-	3	2	CAGE1	7279304	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.685000	0.25378	0.922000	0.37019	0.477000	0.44152	AAA	.		0.274	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	protein_coding	OTTHUMT00000367136.1	NM_175745	
CASP8AP2	9994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	90573432	90573432	+	RNA	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr6:90573432G>T	ENST00000551025.1	+	0	3441									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ACAATACTATGCATTGTGAAG	0.413																																					p.M668I	Colon(187;1656 2025 17045 31481 39901)	.											.	CASP8AP2	24	0			c.G2004T						.						57.0	54.0	55.0					6																	90573432		1913	4131	6044			9994	exon7			TACTATGCATTGT	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90573432G>T		93.0	0.0		89.0	30.0	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	37																																																																																				.		0.413	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
CCDC80	151887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112357309	112357309	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr3:112357309G>A	ENST00000206423.3	-	2	2397	c.1444C>T	c.(1444-1446)Cca>Tca	p.P482S	CCDC80_ENST00000439685.2_Missense_Mutation_p.P482S|CCDC80_ENST00000475181.1_5'Flank	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	482					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GGAGGACCTGGCACCACATTT	0.567																																					p.P482S		.											.	CCDC80	92	0			c.C1444T						.						67.0	69.0	68.0					3																	112357309		2203	4300	6503	SO:0001583	missense	151887	exon2			GACCTGGCACCAC	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1444C>T	3.37:g.112357309G>A	ENSP00000206423:p.Pro482Ser	67.0	0.0		66.0	22.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193645	0.78902	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.44482	0.92;0.92	5.68	5.68	0.88126	.	0.109608	0.64402	D	0.000005	T	0.35653	0.0939	L	0.34521	1.04	0.58432	D	0.999999	P;P;B	0.43169	0.728;0.8;0.352	B;B;B	0.41271	0.324;0.352;0.173	T	0.13522	-1.0506	10	0.49607	T	0.09	-8.7126	14.0057	0.64461	0.0723:0.0:0.9277:0.0	.	493;482;482	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	S	482;482;110	ENSP00000206423:P482S;ENSP00000411814:P482S	ENSP00000206423:P482S	P	-	1	0	CCDC80	113839999	1.000000	0.71417	0.973000	0.42090	0.995000	0.86356	3.261000	0.51530	2.684000	0.91462	0.555000	0.69702	CCA	.		0.567	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
CENPE	1062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	104084644	104084644	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr4:104084644C>A	ENST00000265148.3	-	17	1803	c.1714G>T	c.(1714-1716)Gat>Tat	p.D572Y	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	572					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ACCTCAAGATCTTGATTATAT	0.323																																					p.D572Y		.											.	CENPE	277	0			c.G1714T						.						73.0	67.0	69.0					4																	104084644		2202	4296	6498	SO:0001583	missense	1062	exon17			CAAGATCTTGATT	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1714G>T	4.37:g.104084644C>A	ENSP00000265148:p.Asp572Tyr	319.0	0.0		327.0	77.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	37	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137966	0.56936	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000503705	T;T	0.56103	0.48;0.48	4.98	4.98	0.66077	.	.	.	.	.	T	0.60090	0.2242	L	0.29908	0.895	0.33721	D	0.616939	D	0.89917	1.0	D	0.78314	0.991	T	0.68561	-0.5376	9	0.72032	D	0.01	.	12.1827	0.54221	0.0:0.9221:0.0:0.0779	.	572	Q02224	CENPE_HUMAN	Y	572	ENSP00000265148:D572Y;ENSP00000423981:D572Y	ENSP00000265148:D572Y	D	-	1	0	CENPE	104304093	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.157000	0.50716	2.755000	0.94549	0.555000	0.69702	GAT	.		0.323	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CEP89	84902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33378692	33378692	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:33378692T>A	ENST00000305768.5	-	17	2019	c.1931A>T	c.(1930-1932)aAc>aTc	p.N644I		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	644					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CAGGCGAATGTTGCTTTTTAT	0.398																																					p.N644I		.											.	CEP89	94	0			c.A1931T						.						130.0	105.0	114.0					19																	33378692		2203	4299	6502	SO:0001583	missense	84902	exon17			CGAATGTTGCTTT	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.1931A>T	19.37:g.33378692T>A	ENSP00000306105:p.Asn644Ile	76.0	0.0		86.0	31.0	NM_032816	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	T	11.71	1.720061	0.30503	.	.	ENSG00000121289	ENST00000305768	D	0.88277	-2.36	5.15	3.06	0.35304	.	0.332317	0.32884	N	0.005529	D	0.88265	0.6390	L	0.53249	1.67	0.80722	D	1	P	0.45212	0.853	P	0.49999	0.628	D	0.85478	0.1177	10	0.52906	T	0.07	-11.9859	8.2518	0.31730	0.0:0.2414:0.0:0.7586	.	644	Q96ST8	CEP89_HUMAN	I	644	ENSP00000306105:N644I	ENSP00000306105:N644I	N	-	2	0	CEP89	38070532	0.980000	0.34600	0.700000	0.30305	0.009000	0.06853	0.812000	0.27211	0.492000	0.27815	0.528000	0.53228	AAC	.		0.398	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	
COL13A1	1305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71692351	71692351	+	Silent	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr10:71692351A>T	ENST00000398978.3	+	30	2178	c.1686A>T	c.(1684-1686)ccA>ccT	p.P562P	COL13A1_ENST00000357811.3_Silent_p.P540P|COL13A1_ENST00000398974.3_Silent_p.P550P|COL13A1_ENST00000398972.3_Silent_p.P562P|COL13A1_ENST00000398969.3_Intron|COL13A1_ENST00000522165.1_Silent_p.P543P|COL13A1_ENST00000398964.3_Silent_p.P533P|COL13A1_ENST00000356340.3_Silent_p.P562P|COL13A1_ENST00000398968.3_Silent_p.P543P|COL13A1_ENST00000520267.1_Intron|COL13A1_ENST00000517713.1_Intron|COL13A1_ENST00000520133.1_Intron|COL13A1_ENST00000398971.3_Intron|COL13A1_ENST00000398966.3_Silent_p.P540P|COL13A1_ENST00000354547.3_Silent_p.P540P|COL13A1_ENST00000398973.3_Silent_p.P562P	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						AGGGCAATCCAGGAGCAGAGG	0.507																																					p.P562P		.											.	COL13A1	91	0			c.A1686T						.						100.0	119.0	113.0					10																	71692351		2018	4181	6199	SO:0001819	synonymous_variant	1305	exon30			CAATCCAGGAGCA	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1686A>T	10.37:g.71692351A>T		86.0	0.0		91.0	20.0	NM_001130103		Silent	SNP	ENST00000398978.3	37	CCDS44419.1																																																																																			.		0.507	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
CSHL1	1444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61987890	61987890	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr17:61987890A>T	ENST00000309894.5	-	3	195	c.196T>A	c.(196-198)Tat>Aat	p.Y66N	CSHL1_ENST00000558099.1_5'UTR|CSHL1_ENST00000438387.2_Intron|CSHL1_ENST00000561003.1_Intron|CSHL1_ENST00000346606.6_5'UTR|CSHL1_ENST00000392824.4_Silent_p.P135P|CSHL1_ENST00000259003.10_Intron|CSHL1_ENST00000450719.3_5'UTR	NM_022579.1	NP_072101.1	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	66						extracellular region (GO:0005576)	hormone activity (GO:0005179)|metal ion binding (GO:0046872)			endometrium(3)|lung(6)	9						TTTGTGATATAGGCTTCTTCC	0.517																																					p.Y66N		.											.	CSHL1	90	0			c.T196A						.						143.0	138.0	140.0					17																	61987890		2203	4300	6503	SO:0001583	missense	1444	exon3			TGATATAGGCTTC	BC029365	CCDS11652.1, CCDS42370.1, CCDS45759.1	17q22-q24	2012-10-02							2442	protein-coding gene	gene with protein product	"""chorionic somatomammotropin CS-5"""	603515		CSHP1		8083227	Standard	NM_001318		Approved	hCS-L, CSL, CS-5, MGC149868	uc002jda.1	Q14406		ENST00000309894.5:c.196T>A	17.37:g.61987890A>T	ENSP00000309524:p.Tyr66Asn	94.0	0.0		97.0	44.0	NM_022579	D3DU26|D3DU27|Q0VDB2	Missense_Mutation	SNP	ENST00000309894.5	37	CCDS11652.1	.	.	.	.	.	.	.	.	.	.	a	8.783	0.928739	0.18131	.	.	ENSG00000204414	ENST00000309894;ENST00000259003;ENST00000450719	D	0.90197	-2.63	2.39	1.3	0.21679	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.213239	0.41938	D	0.000783	D	0.91553	0.7332	M	0.86420	2.815	0.20307	N	0.999916	P	0.37708	0.606	P	0.46510	0.519	D	0.85529	0.1208	10	0.72032	D	0.01	.	4.3681	0.11233	0.833:0.0:0.167:0.0	.	66	Q14406	CSHL_HUMAN	N	66;61;61	ENSP00000309524:Y66N	ENSP00000259003:Y61N	Y	-	1	0	GH1	59341622	1.000000	0.71417	0.179000	0.23059	0.003000	0.03518	2.996000	0.49449	0.348000	0.23949	-0.756000	0.03474	TAT	.		0.517	CSHL1-009	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444557.1	NM_022579	
CST5	1473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	23856826	23856826	+	Nonstop_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:23856826T>A	ENST00000304710.4	-	3	501	c.428A>T	c.(427-429)tAg>tTg	p.*143L		NM_001900.4	NP_001891.2	P28325	CYTD_HUMAN	cystatin D	0					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11						CACAGACCCCTAGACTTTCCG	0.542																																					p.X143L		.											.	CST5	90	0			c.A428T						.						84.0	90.0	88.0					20																	23856826		2203	4300	6503	SO:0001578	stop_lost	1473	exon3			GACCCCTAGACTT		CCDS13162.1	20p11.21	2008-04-15			ENSG00000170367	ENSG00000170367			2477	protein-coding gene	gene with protein product		123858				1939105	Standard	NM_001900		Approved		uc002wtr.1	P28325	OTTHUMG00000032089	ENST00000304710.4:c.428A>T	20.37:g.23856826T>A		97.0	0.0		142.0	56.0	NM_001900	Q5JRF5|Q9UCA0	Missense_Mutation	SNP	ENST00000304710.4	37	CCDS13162.1	.	.	.	.	.	.	.	.	.	.	T	1.773	-0.483848	0.04383	.	.	ENSG00000170367	ENST00000304710	.	.	.	2.01	0.887	0.19200	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.6683	0.08264	0.0:0.2028:0.0:0.7972	.	.	.	.	L	143	.	.	X	-	2	0	CST5	23804826	0.001000	0.12720	0.001000	0.08648	0.040000	0.13550	-0.115000	0.10741	0.228000	0.21019	0.368000	0.22195	TAG	.		0.542	CST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078355.2	NM_001900	
CXCR2	3579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	218999787	218999787	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr2:218999787T>A	ENST00000318507.2	+	3	690	c.263T>A	c.(262-264)cTg>cAg	p.L88Q		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	88					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						GTCTACCTGCTGAACCTAGCC	0.567																																					p.L88Q		.											.	CXCR2	658	0			c.T263A						.						145.0	137.0	139.0					2																	218999787		2203	4300	6503	SO:0001583	missense	3579	exon4			ACCTGCTGAACCT	U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.263T>A	2.37:g.218999787T>A	ENSP00000319635:p.Leu88Gln	188.0	0.0		190.0	76.0	NM_001168298	Q8IUZ1|Q9P2T6|Q9P2T7	Missense_Mutation	SNP	ENST00000318507.2	37	CCDS2408.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451960	0.84209	.	.	ENSG00000180871	ENST00000453237;ENST00000415392;ENST00000318507;ENST00000454148;ENST00000428565	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	5.19	5.19	0.71726	GPCR, rhodopsin-like superfamily (1);	0.341780	0.28209	N	0.016190	D	0.91358	0.7274	H	0.98646	4.29	0.45867	D	0.998725	D	0.76494	0.999	D	0.79108	0.992	D	0.94399	0.7621	10	0.87932	D	0	.	14.368	0.66820	0.0:0.0:0.0:1.0	.	88	P25025	CXCR2_HUMAN	Q	88	ENSP00000413686:L88Q;ENSP00000392348:L88Q;ENSP00000319635:L88Q;ENSP00000415148:L88Q;ENSP00000392698:L88Q	ENSP00000319635:L88Q	L	+	2	0	CXCR2	218708032	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.862000	0.87013	2.099000	0.63709	0.454000	0.30748	CTG	.		0.567	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256772.2	NM_001557	
CYP8B1	1582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	42916188	42916188	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr3:42916188T>C	ENST00000316161.4	-	1	1445	c.1121A>G	c.(1120-1122)tAt>tGt	p.Y374C	CYP8B1_ENST00000437102.1_Missense_Mutation_p.Y374C|KRBOX1_ENST00000426937.1_Intron|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	374					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		GCGGAACAGATACTCCTGCCC	0.587																																					p.Y374C		.											.	CYP8B1	92	0			c.A1121G						.						90.0	88.0	89.0					3																	42916188		2203	4300	6503	SO:0001583	missense	1582	exon1			AACAGATACTCCT	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.1121A>G	3.37:g.42916188T>C	ENSP00000318867:p.Tyr374Cys	127.0	0.0		144.0	16.0	NM_004391	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	T	9.804	1.181220	0.21787	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.73469	-0.75;-0.75	4.5	0.549	0.17213	.	0.081309	0.51477	N	0.000089	T	0.73644	0.3613	L	0.59967	1.855	0.37161	D	0.902615	P;P	0.48089	0.905;0.905	P;P	0.53861	0.736;0.736	T	0.71866	-0.4463	10	0.59425	D	0.04	-8.3428	4.4697	0.11706	0.4442:0.086:0.0:0.4698	.	374;374	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	C	374	ENSP00000404499:Y374C;ENSP00000318867:Y374C	ENSP00000318867:Y374C	Y	-	2	0	CYP8B1	42891192	0.989000	0.36119	0.010000	0.14722	0.063000	0.16089	1.971000	0.40530	-0.059000	0.13154	0.459000	0.35465	TAT	.		0.587	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391	
DEFB119	245932	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	29978247	29978247	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:29978247T>A	ENST00000376321.3	-	1	159	c.40A>T	c.(40-42)Ata>Tta	p.I14L	DEFB119_ENST00000376315.2_Missense_Mutation_p.I14L|DEFB119_ENST00000339144.3_Missense_Mutation_p.I14L|DEFB119_ENST00000492344.1_5'UTR	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119	14					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GGTTCTTCTATGGCCAGAAGG	0.547																																					p.I14L		.											.	DEFB119	90	0			c.A40T						.						161.0	148.0	152.0					20																	29978247		2203	4300	6503	SO:0001583	missense	245932	exon1			CTTCTATGGCCAG	AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.40A>T	20.37:g.29978247T>A	ENSP00000365499:p.Ile14Leu	126.0	1.0		190.0	50.0	NM_001271209	Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Missense_Mutation	SNP	ENST00000376321.3	37	CCDS13178.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.990321	0.00439	.	.	ENSG00000180483	ENST00000339144;ENST00000376321;ENST00000376315	T;T	0.26660	1.88;1.72	3.56	1.31	0.21738	.	1.395140	0.04568	N	0.392808	T	0.19967	0.0480	.	.	.	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.0;0.001	T	0.31530	-0.9940	9	0.87932	D	0	-0.1421	5.1769	0.15139	0.0:0.244:0.0:0.756	.	14;14;14	Q8N690-2;Q8N690;Q5TH42	.;DB119_HUMAN;.	L	14	ENSP00000365499:I14L;ENSP00000365492:I14L	ENSP00000345768:I14L	I	-	1	0	DEFB119	29441908	0.001000	0.12720	0.103000	0.21229	0.030000	0.12068	0.160000	0.16462	0.260000	0.21731	0.374000	0.22700	ATA	.		0.547	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078514.1	NM_153289	
DICER1	23405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	95557445	95557445	+	Splice_Site	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr14:95557445T>A	ENST00000526495.1	-	28	5820	c.5529A>T	c.(5527-5529)gaA>gaT	p.E1843D	DICER1_ENST00000541352.1_Splice_Site_p.K1789I|DICER1_ENST00000343455.3_Splice_Site_p.E1843D|DICER1_ENST00000527414.1_Splice_Site_p.E1843D|DICER1_ENST00000393063.1_Splice_Site_p.E1843D|DICER1_ENST00000556045.1_Splice_Site_p.E741D|DICER1_ENST00000527416.2_5'UTR			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1843					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CAGAAAACTTTTCTGCAATCA	0.328			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.E1843D		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	961	0			c.A5529T						.						49.0	50.0	50.0					14																	95557445		2201	4300	6501	SO:0001630	splice_region_variant	23405	exon27	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AAACTTTTCTGCA	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5528-1A>T	14.37:g.95557445T>A		103.0	0.0		124.0	27.0	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.79|13.79	2.343024|2.343024	0.41498|0.41498	.|.	.|.	ENSG00000100697|ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045|ENST00000541352	D;D;D;D;D|T	0.85629|0.53423	-2.01;-2.01;-2.01;-2.01;-2.01|0.62	5.93|5.93	2.32|2.32	0.28847|0.28847	Ribonuclease III (3);|.	0.097745|.	0.64402|.	D|.	0.000001|.	T|T	0.42359|0.42359	0.1199|0.1199	.|.	.|.	.|.	0.25177|0.25177	N|N	0.990233|0.990233	B;P|.	0.35328|.	0.016;0.495|.	B;B|.	0.26517|.	0.011;0.07|.	T|T	0.27673|0.27673	-1.0067|-1.0067	9|6	0.19590|0.33940	T|T	0.45|0.23	.|.	9.4257|9.4257	0.38578|0.38578	0.0:0.2002:0.0:0.7998|0.0:0.2002:0.0:0.7998	.|.	741;1843|.	B3KRG4;Q9UPY3|.	.;DICER_HUMAN|.	D|I	1843;1843;1843;1843;741|1789	ENSP00000343745:E1843D;ENSP00000437256:E1843D;ENSP00000376783:E1843D;ENSP00000435681:E1843D;ENSP00000451041:E741D|ENSP00000444719:K1789I	ENSP00000343745:E1843D|ENSP00000444719:K1789I	E|K	-|-	3|2	2|0	DICER1|DICER1	94627198|94627198	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.658000|0.658000	0.38924|0.38924	2.338000|2.338000	0.43957|0.43957	0.158000|0.158000	0.19367|0.19367	-0.250000|-0.250000	0.11733|0.11733	GAA|AAA	.		0.328	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		Missense_Mutation
EFCAB14	9813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47154101	47154101	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:47154101T>A	ENST00000371933.3	-	7	1887	c.911A>T	c.(910-912)cAg>cTg	p.Q304L	EFCAB14_ENST00000484461.1_5'UTR|EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14_ENST00000544071.1_Intron	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	304							calcium ion binding (GO:0005509)										GTTGACTCTCTGGGTAAGATT	0.443																																					p.Q304L		.											.	.	.	0			c.A911T						.						293.0	230.0	251.0					1																	47154101		2203	4300	6503	SO:0001583	missense	9813	exon7			ACTCTCTGGGTAA	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.911A>T	1.37:g.47154101T>A	ENSP00000361001:p.Gln304Leu	131.0	0.0		130.0	21.0	NM_014774	D3DQ23|Q5SXB8	Missense_Mutation	SNP	ENST00000371933.3	37	CCDS30706.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769092	0.49680	.	.	ENSG00000159658	ENST00000371933	D	0.94280	-3.39	5.3	5.3	0.74995	.	0.055882	0.64402	D	0.000001	D	0.89832	0.6829	L	0.55481	1.735	0.80722	D	1	P	0.35272	0.493	B	0.33042	0.157	D	0.89126	0.3506	10	0.72032	D	0.01	-5.2602	8.1634	0.31211	0.0:0.1332:0.0:0.8668	.	304	O75071	K0494_HUMAN	L	304	ENSP00000361001:Q304L	ENSP00000361001:Q304L	Q	-	2	0	KIAA0494	46926688	0.849000	0.29639	1.000000	0.80357	0.990000	0.78478	0.234000	0.17930	2.231000	0.72958	0.459000	0.35465	CAG	.		0.443	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	65707540	65707540	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr6:65707540G>A	ENST00000370621.3	-	14	2720	c.2194C>T	c.(2194-2196)Cag>Tag	p.Q732*	EYS_ENST00000503581.1_Nonsense_Mutation_p.Q732*|EYS_ENST00000370616.2_Nonsense_Mutation_p.Q732*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	732					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCAATGTCCTGTTCACATCTT	0.408																																					p.Q732X		.											.	EYS	660	0			c.C2194T						.						145.0	121.0	128.0					6																	65707540		692	1591	2283	SO:0001587	stop_gained	346007	exon14			TGTCCTGTTCACA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2194C>T	6.37:g.65707540G>A	ENSP00000359655:p.Gln732*	244.0	0.0		557.0	54.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	39	7.641406	0.98406	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	.	.	.	5.5	0.265	0.15612	.	0.596206	0.12821	N	0.436434	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	3.3294	0.07079	0.1402:0.2513:0.4787:0.1298	.	.	.	.	X	732	.	ENSP00000359650:Q732X	Q	-	1	0	EYS	65764261	1.000000	0.71417	0.109000	0.21407	0.955000	0.61496	1.652000	0.37313	-0.256000	0.09473	0.655000	0.94253	CAG	.		0.408	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM169B	283777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	99023922	99023922	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr15:99023922C>T	ENST00000558256.1	-	4	340	c.91G>A	c.(91-93)Gac>Aac	p.D31N	FAM169B_ENST00000332908.4_Missense_Mutation_p.D31N	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	31										large_intestine(3)|lung(3)|urinary_tract(1)	7						AAAAACATGTCATCATCATCC	0.413																																					p.D31N		.											.	.	.	0			c.G91A						.						103.0	102.0	102.0					15																	99023922		1900	4121	6021	SO:0001583	missense	283777	exon4			ACATGTCATCATC		CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.91G>A	15.37:g.99023922C>T	ENSP00000453554:p.Asp31Asn	116.0	0.0		137.0	24.0	NM_182562	B5MDL8	Missense_Mutation	SNP	ENST00000558256.1	37	CCDS45360.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062678	0.76187	.	.	ENSG00000185087	ENST00000332908	T	0.68624	-0.34	5.07	4.16	0.48862	.	0.439493	0.24328	N	0.039496	T	0.70666	0.3250	L	0.29908	0.895	0.23056	N	0.998366	D	0.76494	0.999	D	0.68943	0.961	T	0.63668	-0.6585	10	0.72032	D	0.01	-3.5146	12.3111	0.54929	0.0:0.917:0.0:0.0829	.	31	Q8N8A8	F169B_HUMAN	N	31	ENSP00000332615:D31N	ENSP00000332615:D31N	D	-	1	0	FAM169B	96841445	0.989000	0.36119	0.572000	0.28498	0.994000	0.84299	1.182000	0.32029	1.127000	0.42034	0.655000	0.94253	GAC	.		0.413	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415488.1	NM_182562	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	80039126	80039126	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr17:80039126delA	ENST00000306749.2	-	38	6727	c.6509delT	c.(6508-6510)ctcfs	p.L2170fs	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2170	Acyl carrier. {ECO:0000255|PROSITE- ProRule:PRU00258}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CACCAGGTTGAGCTCACGCTC	0.657																																					p.L2170fs	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.6509delT						.						29.0	25.0	26.0					17																	80039126		2184	4284	6468	SO:0001589	frameshift_variant	2194	exon38			AGGTTGAGCTCAC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6509delT	17.37:g.80039126delA	ENSP00000304592:p.Leu2170fs	46.0	0.0		48.0	15.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Frame_Shift_Del	DEL	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.657	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FASTKD2	22868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207655393	207655393	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr2:207655393G>T	ENST00000236980.6	+	11	2344	c.1996G>T	c.(1996-1998)Ggt>Tgt	p.G666C	FASTKD2_ENST00000403094.3_Missense_Mutation_p.G666C|FASTKD2_ENST00000402774.3_Missense_Mutation_p.G666C	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	666	RAP. {ECO:0000255|PROSITE- ProRule:PRU00619}.				cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		GAATGCAATGGGTTTTCATGT	0.403																																					p.G666C		.											.	FASTKD2	118	0			c.G1996T						.						148.0	150.0	149.0					2																	207655393		2203	4300	6503	SO:0001583	missense	22868	exon11			GCAATGGGTTTTC	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1996G>T	2.37:g.207655393G>T	ENSP00000236980:p.Gly666Cys	53.0	0.0		65.0	13.0	NM_001136193	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	37	CCDS2371.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179008	0.78564	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	D;D;D	0.88277	-2.36;-2.36;-2.36	5.96	5.96	0.96718	RAP domain (3);	0.000000	0.85682	D	0.000000	D	0.94896	0.8350	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95008	0.8149	10	0.87932	D	0	-7.0316	17.3387	0.87289	0.0:0.0:1.0:0.0	.	666	Q9NYY8	FAKD2_HUMAN	C	666	ENSP00000236980:G666C;ENSP00000385990:G666C;ENSP00000384929:G666C	ENSP00000236980:G666C	G	+	1	0	FASTKD2	207363638	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.598000	0.67585	2.832000	0.97577	0.655000	0.94253	GGT	.		0.403	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
FBXO18	84893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5945116	5945116	+	Silent	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr10:5945116G>C	ENST00000362091.4	+	2	250	c.135G>C	c.(133-135)ccG>ccC	p.P45P	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Silent_p.P96P|FBXO18_ENST00000470089.1_Intron	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	45					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						ATCCTAAACCGAGAACAAAAA	0.458																																					p.P96P		.											.	FBXO18	228	0			c.G288C						.						74.0	71.0	72.0					10																	5945116		2203	4300	6503	SO:0001819	synonymous_variant	84893	exon3			TAAACCGAGAACA	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.135G>C	10.37:g.5945116G>C		76.0	0.0		114.0	37.0	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Silent	SNP	ENST00000362091.4	37	CCDS7072.1																																																																																			.		0.458	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
FBXO7	25793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32881139	32881139	+	Missense_Mutation	SNP	G	G	C	rs533307944		TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr22:32881139G>C	ENST00000266087.7	+	4	1057	c.730G>C	c.(730-732)Gag>Cag	p.E244Q	FBXO7_ENST00000397426.1_Missense_Mutation_p.E130Q|FBXO7_ENST00000382058.3_Missense_Mutation_p.E165Q	NM_012179.3	NP_036311.3	Q9Y3I1	FBX7_HUMAN	F-box protein 7	244	Important for dimerization and interaction with PSMF1.				cell death (GO:0008219)|mitochondrion degradation (GO:0000422)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of lymphocyte differentiation (GO:0045620)|protein targeting to mitochondrion (GO:0006626)|protein ubiquitination (GO:0016567)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TCCTCTCTGCGAGGGCAGCTC	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		17541	0.0		0.0	False		,,,				2504	0.001				p.E244Q		.											.	FBXO7	228	0			c.G730C						.						149.0	126.0	134.0					22																	32881139		2203	4300	6503	SO:0001583	missense	25793	exon4			CTCTGCGAGGGCA	AF129537	CCDS13907.1, CCDS58806.1	22q12.3	2013-09-19	2004-06-15		ENSG00000100225	ENSG00000100225		"""F-boxes /  ""other"""", ""Parkinson disease"""	13586	protein-coding gene	gene with protein product		605648	"""F-box only protein 7"""			10531035, 10531037, 19038853	Standard	NM_001257990		Approved	FBX7, Fbx, PARK15	uc003amq.3	Q9Y3I1	OTTHUMG00000030674	ENST00000266087.7:c.730G>C	22.37:g.32881139G>C	ENSP00000266087:p.Glu244Gln	112.0	0.0		151.0	25.0	NM_012179	B4DNB3|B4DWX5|Q5TGC4|Q5TI86|Q96HM6|Q9UF21|Q9UKT2	Missense_Mutation	SNP	ENST00000266087.7	37	CCDS13907.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889329	0.72524	.	.	ENSG00000100225	ENST00000266087;ENST00000382058;ENST00000397426	T;T;T	0.75050	-0.9;-0.33;-0.31	5.42	4.38	0.52667	.	0.289081	0.39341	N	0.001393	D	0.83949	0.5365	M	0.78916	2.43	0.40423	D	0.979865	D;D;D	0.61697	0.99;0.985;0.982	P;D;P	0.63957	0.842;0.92;0.87	D	0.85884	0.1424	10	0.59425	D	0.04	-4.6036	12.504	0.55972	0.0858:0.0:0.9142:0.0	.	165;244;130	Q9Y3I1-2;Q9Y3I1;Q5TI86	.;FBX7_HUMAN;.	Q	244;165;130	ENSP00000266087:E244Q;ENSP00000371490:E165Q;ENSP00000380571:E130Q	ENSP00000266087:E244Q	E	+	1	0	FBXO7	31211139	1.000000	0.71417	0.905000	0.35620	0.845000	0.48019	5.826000	0.69293	1.315000	0.45114	0.655000	0.94253	GAG	.		0.502	FBXO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129001.1		
FGF18	8817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170876191	170876191	+	Silent	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr5:170876191C>T	ENST00000274625.5	+	4	835	c.291C>T	c.(289-291)gtC>gtT	p.V97V		NM_003862.2	NP_003853.1	O76093	FGF18_HUMAN	fibroblast growth factor 18	97					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte development (GO:0002063)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intramembranous ossification (GO:0001957)|lung development (GO:0030324)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleolus (GO:0005730)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	9	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GTAGTCAAGTCCGGATCAAGG	0.527																																					p.V97V		.											.	FGF18	522	0			c.C291T						.						118.0	97.0	104.0					5																	170876191		2203	4300	6503	SO:0001819	synonymous_variant	8817	exon4			TCAAGTCCGGATC	AB007422	CCDS4378.1	5q34	2008-02-05			ENSG00000156427	ENSG00000156427			3674	protein-coding gene	gene with protein product		603726				9660775, 9742123	Standard	NM_003862		Approved	FGF-18, ZFGF5	uc003mbk.3	O76093	OTTHUMG00000130464	ENST00000274625.5:c.291C>T	5.37:g.170876191C>T		147.0	0.0		136.0	24.0	NM_003862	D3DQL7|Q6UWF1	Silent	SNP	ENST00000274625.5	37	CCDS4378.1																																																																																			.		0.527	FGF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252857.2	NM_033649, NM_003862	
FLG	2312	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	152276112	152276112	+	Silent	SNP	C	C	T	rs201725426	byFrequency	TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:152276112C>T	ENST00000368799.1	-	3	11285	c.11250G>A	c.(11248-11250)gcG>gcA	p.A3750A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3750	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCTTGGGACGCTGAGTGCC	0.597									Ichthyosis				C|||	6	0.00119808	0.0	0.0	5008	,	,		21395	0.005		0.001	False		,,,				2504	0.0				p.A3750A		.											.	FLG	106	0			c.G11250A						.						293.0	289.0	290.0					1																	152276112		2203	4298	6501	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TTGGGACGCTGAG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11250G>A	1.37:g.152276112C>T		143.0	0.0		238.0	26.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			C|0.999;T|0.001		0.597	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	152278842	152278842	+	Silent	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:152278842T>A	ENST00000368799.1	-	3	8555	c.8520A>T	c.(8518-8520)acA>acT	p.T2840T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2840	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATTACGTGTTGTTCTGCTTG	0.562									Ichthyosis																												p.T2840T		.											.	FLG	106	0			c.A8520T						.						323.0	481.0	428.0					1																	152278842		2162	4299	6461	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACGTGTTGTTCTG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8520A>T	1.37:g.152278842T>A		187.0	0.0		350.0	80.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
G2E3	55632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	31077159	31077159	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr14:31077159C>T	ENST00000206595.6	+	12	1538	c.1384C>T	c.(1384-1386)Cct>Tct	p.P462S	G2E3_ENST00000553504.1_Missense_Mutation_p.P492S|G2E3_ENST00000438909.2_Missense_Mutation_p.P416S	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	462	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TCACGGTGGTCCTTCACCTGG	0.363																																					p.P462S		.											.	G2E3	660	0			c.C1384T						.						97.0	90.0	92.0					14																	31077159		2203	4300	6503	SO:0001583	missense	55632	exon12			GGTGGTCCTTCAC	AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1384C>T	14.37:g.31077159C>T	ENSP00000206595:p.Pro462Ser	89.0	0.0		178.0	19.0	NM_017769	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265007	0.95399	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	T;T;T	0.57595	0.39;0.39;0.39	5.43	5.43	0.79202	HECT (2);	0.000000	0.85682	D	0.000000	T	0.74215	0.3687	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77078	-0.2721	10	0.87932	D	0	-13.7913	19.2391	0.93875	0.0:1.0:0.0:0.0	.	462	Q7L622	G2E3_HUMAN	S	462;416;492	ENSP00000206595:P462S;ENSP00000391068:P416S;ENSP00000451653:P492S	ENSP00000206595:P462S	P	+	1	0	G2E3	30146910	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.692000	0.47018	2.510000	0.84645	0.591000	0.81541	CCT	.		0.363	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	
GFI1	2672	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	92946582	92946582	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:92946582G>A	ENST00000370332.1	-	4	680	c.362C>T	c.(361-363)cCg>cTg	p.P121L	GFI1_ENST00000483490.1_5'Flank|GFI1_ENST00000294702.5_Missense_Mutation_p.P121L|GFI1_ENST00000427103.1_Missense_Mutation_p.P121L	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	121					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P121L(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		CCATGAGTACGGTTTGAAAGG	0.662																																					p.P121L		.											.	GFI1	514	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C362T						.						23.0	24.0	24.0					1																	92946582		2203	4300	6503	SO:0001583	missense	2672	exon4			GAGTACGGTTTGA	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.362C>T	1.37:g.92946582G>A	ENSP00000359357:p.Pro121Leu	164.0	0.0		152.0	29.0	NM_005263	Q8N564	Missense_Mutation	SNP	ENST00000370332.1	37	CCDS30773.1	.	.	.	.	.	.	.	.	.	.	g	24.5	4.543632	0.86022	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.18016	2.24;2.24;2.24	4.37	2.44	0.29823	.	0.183997	0.48767	D	0.000168	T	0.09512	0.0234	M	0.68952	2.095	0.80722	D	1	P	0.51240	0.943	B	0.38194	0.267	T	0.09292	-1.0681	10	0.59425	D	0.04	-14.4336	13.2094	0.59815	0.0:0.0:0.7104:0.2896	.	121	Q99684	GFI1_HUMAN	L	121	ENSP00000359357:P121L;ENSP00000399719:P121L;ENSP00000294702:P121L	ENSP00000294702:P121L	P	-	2	0	GFI1	92719170	1.000000	0.71417	0.881000	0.34555	0.961000	0.63080	6.102000	0.71486	0.564000	0.29238	0.556000	0.70494	CCG	.		0.662	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030054.1	NM_005263	
GLE1	2733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131296078	131296078	+	Silent	SNP	A	A	T	rs369775688		TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr9:131296078A>T	ENST00000309971.4	+	11	1600	c.1494A>T	c.(1492-1494)gcA>gcT	p.A498A	GLE1_ENST00000372770.4_Silent_p.A498A|GLE1_ENST00000539582.1_Silent_p.A244A|RP11-216B9.6_ENST00000434999.1_RNA	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	498					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						ACCATGAAGCAGCATTCCCCA	0.483																																					p.A498A		.											.	GLE1	22	0			c.A1494T						.						121.0	119.0	120.0					9																	131296078		2203	4300	6503	SO:0001819	synonymous_variant	2733	exon11			TGAAGCAGCATTC	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.1494A>T	9.37:g.131296078A>T		131.0	0.0		120.0	49.0	NM_001499	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Silent	SNP	ENST00000309971.4	37	CCDS35154.1																																																																																			.		0.483	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
GRK7	131890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	141535712	141535712	+	Silent	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr3:141535712G>T	ENST00000264952.2	+	4	1619	c.1482G>T	c.(1480-1482)ggG>ggT	p.G494G		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	494	AGC-kinase C-terminal.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						AGGTTCGGGGGGTGGAATTTG	0.453																																					p.G494G		.											.	GRK7	522	0			c.G1482T						.						150.0	148.0	148.0					3																	141535712		2203	4300	6503	SO:0001819	synonymous_variant	131890	exon4			TCGGGGGGTGGAA		CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.1482G>T	3.37:g.141535712G>T		98.0	0.0		101.0	22.0	NM_139209		Silent	SNP	ENST00000264952.2	37	CCDS3120.1																																																																																			.		0.453	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353168.1	NM_139209	
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57179476	57179476	+	Silent	SNP	C	C	A	rs372203605		TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr4:57179476C>A	ENST00000504228.1	+	5	573	c.468C>A	c.(466-468)gcC>gcA	p.A156A	KIAA1211_ENST00000541073.1_Silent_p.A149A|KIAA1211_ENST00000264229.6_Silent_p.A156A			Q6ZU35	K1211_HUMAN	KIAA1211	156										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					ACAACAGTGCCGCCAAGCACA	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19920	0.0		0.0	False		,,,				2504	0.0				p.A156A		.											.	KIAA1211	70	0			c.C468A						.	C		1,4093		0,1,2046	111.0	120.0	117.0		468	-5.1	0.9	4		117	0,8378		0,0,4189	no	coding-synonymous	KIAA1211	NM_020722.1		0,1,6235	AA,AC,CC		0.0,0.0244,0.0080		156/1234	57179476	1,12471	2047	4189	6236	SO:0001819	synonymous_variant	57482	exon7			CAGTGCCGCCAAG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.468C>A	4.37:g.57179476C>A		84.0	0.0		71.0	15.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	37	CCDS43230.1																																																																																			.		0.567	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
KIAA1755	85449	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36856566	36856566	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:36856566C>T	ENST00000279024.4	-	6	2219	c.1948G>A	c.(1948-1950)Gcc>Acc	p.A650T		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	650										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GCCTGCAGGGCGCTGACCAGA	0.622																																					p.A650T		.											.	KIAA1755	95	0			c.G1948A						.						34.0	35.0	34.0					20																	36856566		2201	4300	6501	SO:0001583	missense	85449	exon6			GCAGGGCGCTGAC	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1948G>A	20.37:g.36856566C>T	ENSP00000279024:p.Ala650Thr	32.0	0.0		27.0	4.0	NM_001029864	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760519	0.89932	.	.	ENSG00000149633	ENST00000279024;ENST00000373398	T	0.63913	-0.07	4.8	4.8	0.61643	.	0.000000	0.48286	D	0.000187	T	0.79656	0.4483	M	0.80982	2.52	0.45194	D	0.998209	D	0.89917	1.0	D	0.91635	0.999	T	0.81955	-0.0696	10	0.59425	D	0.04	.	15.4315	0.75102	0.0:1.0:0.0:0.0	.	650	Q5JYT7	K1755_HUMAN	T	650;197	ENSP00000279024:A650T	ENSP00000279024:A650T	A	-	1	0	KIAA1755	36289980	0.996000	0.38824	0.990000	0.47175	0.867000	0.49689	4.484000	0.60271	2.495000	0.84180	0.655000	0.94253	GCC	.		0.622	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
KRTAP10-12	386685	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	46117560	46117561	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr21:46117560_46117561insTT	ENST00000400365.3	+	1	474_475	c.444_445insTT	c.(445-447)cagfs	p.Q149fs	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	149	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CCCCGTGTCAACAGTCCTGCTG	0.619																																					p.Q148fs		.											.	KRTAP10-12	90	0			c.444_445insTT						.																																			SO:0001589	frameshift_variant	386685	exon1			GTGTCAACAGTCC	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	Exception_encountered	21.37:g.46117560_46117561insTT	ENSP00000383216:p.Gln149fs	27.0	0.0		28.0	13.0	NM_198699	B2RPA3	Frame_Shift_Ins	INS	ENST00000400365.3	37	CCDS42967.1																																																																																			.		0.619	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
LMNB2	84823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	2435009	2435009	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:2435009T>A	ENST00000582871.1	-	5	871	c.785A>T	c.(784-786)tAc>tTc	p.Y262F	LMNB2_ENST00000325327.3_Missense_Mutation_p.Y282F	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	262	Coil 2.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGGCCTGGTAGGTCTGCTC	0.716																																					p.Y282F		.											.	LMNB2	290	0			c.A845T						.						24.0	26.0	25.0					19																	2435009		2198	4299	6497	SO:0001583	missense	84823	exon5			GCCTGGTAGGTCT	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.785A>T	19.37:g.2435009T>A	ENSP00000462730:p.Tyr262Phe	17.0	0.0		15.0	5.0	NM_032737	O75292|Q14734|Q96DF6	Missense_Mutation	SNP	ENST00000582871.1	37		.	.	.	.	.	.	.	.	.	.	T	14.34	2.505047	0.44558	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.83	4.83	0.62350	Filament (1);	0.123853	0.56097	D	0.000030	T	0.49795	0.1578	L	0.28400	0.85	0.48040	D	0.999571	P	0.38223	0.623	B	0.42959	0.403	T	0.46735	-0.9170	9	0.30078	T	0.28	.	13.2379	0.59979	0.0:0.0:0.0:1.0	.	262	Q03252	LMNB2_HUMAN	F	262	.	ENSP00000327054:Y262F	Y	-	2	0	LMNB2	2386009	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.974000	0.40559	1.807000	0.52817	0.459000	0.35465	TAC	.		0.716	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_032737	
LRRC41	10489	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46746117	46746117	+	Silent	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:46746117G>A	ENST00000343304.6	-	6	2157	c.1872C>T	c.(1870-1872)gcC>gcT	p.A624A	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	624					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					AGGCAAAGGTGGCACTATCCA	0.577																																					p.A624A		.											.	LRRC41	156	0			c.C1872T						.						93.0	100.0	98.0					1																	46746117		2203	4300	6503	SO:0001819	synonymous_variant	10489	exon6			AAAGGTGGCACTA	AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1872C>T	1.37:g.46746117G>A		309.0	0.0		308.0	65.0	NM_006369	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Silent	SNP	ENST00000343304.6	37	CCDS533.1																																																																																			.		0.577	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369	
MAP3K12	7786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53879187	53879187	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr12:53879187G>T	ENST00000267079.2	-	6	1020	c.795C>A	c.(793-795)agC>agA	p.S265R	MAP3K12_ENST00000547151.1_5'Flank|MAP3K12_ENST00000547488.1_Missense_Mutation_p.S298R|MAP3K12_ENST00000547035.1_Missense_Mutation_p.S298R	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						ACATCTTGGTGCTCTTGTCAC	0.517																																					p.S298R		.											.	MAP3K12	604	0			c.C894A						.						220.0	211.0	214.0					12																	53879187		2203	4300	6503	SO:0001583	missense	7786	exon5			CTTGGTGCTCTTG	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.795C>A	12.37:g.53879187G>T	ENSP00000267079:p.Ser265Arg	74.0	0.0		97.0	38.0	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309912	0.81247	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	D;D;D	0.82255	-1.59;-1.59;-1.59	4.84	4.84	0.62591	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000062	D	0.85678	0.5752	N	0.25031	0.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.87713	0.2568	10	0.87932	D	0	.	17.24	0.87010	0.0:0.0:1.0:0.0	.	298;265	G3V1Y2;Q12852	.;M3K12_HUMAN	R	265;298;298	ENSP00000267079:S265R;ENSP00000449038:S298R;ENSP00000448689:S298R	ENSP00000267079:S265R	S	-	3	2	MAP3K12	52165454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.724000	0.38064	2.688000	0.91661	0.561000	0.74099	AGC	.		0.517	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
MAPK6	5597	ucsc.edu;bcgsc.ca	37	15	52342222	52342222	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr15:52342222G>T	ENST00000261845.5	+	3	1395	c.588G>T	c.(586-588)tgG>tgT	p.W196C		NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TTACTAAATGGTACAGATCTC	0.343																																					p.W196C		.											.	MAPK6	1403	0			c.G588T						.						101.0	107.0	105.0					15																	52342222		2195	4292	6487	SO:0001583	missense	5597	exon3			TAAATGGTACAGA	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.588G>T	15.37:g.52342222G>T	ENSP00000261845:p.Trp196Cys	33.0	0.0		37.0	4.0	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	37	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369516	0.82463	.	.	ENSG00000069956	ENST00000261845	T	0.47869	0.83	5.15	5.15	0.70609	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	M	0.62154	1.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71189	-0.4666	10	0.87932	D	0	-6.4376	18.6908	0.91582	0.0:0.0:1.0:0.0	.	196	Q16659	MK06_HUMAN	C	196	ENSP00000261845:W196C	ENSP00000261845:W196C	W	+	3	0	MAPK6	50129514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.865000	0.99609	2.417000	0.82017	0.650000	0.86243	TGG	.		0.343	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
MATN4	8785	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	43929960	43929960	+	Splice_Site	DEL	C	C	-			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:43929960delC	ENST00000372754.1	-	4	898		c.e4+1		MATN4_ENST00000360607.6_Intron|MATN4_ENST00000537548.1_Splice_Site|MATN4_ENST00000372756.1_Splice_Site|MATN4_ENST00000353917.5_Intron|MATN4_ENST00000342716.4_Splice_Site|MATN4_ENST00000372751.4_Splice_Site			O95460	MATN4_HUMAN	matrilin 4						extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				GTGTTGCTCACCCCTGCAGCT	0.582											OREG0025977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	MATN4	90	0			c.766+1G>-						.						97.0	103.0	101.0					20																	43929960		2203	4300	6503	SO:0001630	splice_region_variant	8785	exon5			TGCTCACCCCTGC	AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.889+1G>-	20.37:g.43929960delC		48.0	0.0	920	112.0	26.0	NM_003833	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Splice_Site	DEL	ENST00000372754.1	37																																																																																				.		0.582	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		Intron
MED28	80306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	17625401	17625401	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr4:17625401G>T	ENST00000237380.7	+	4	541	c.517G>T	c.(517-519)Gca>Tca	p.A173S		NM_025205.3	NP_079481.2	Q9H204	MED28_HUMAN	mediator complex subunit 28	173					negative regulation of smooth muscle cell differentiation (GO:0051151)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cortical actin cytoskeleton (GO:0030864)|mediator complex (GO:0016592)|membrane (GO:0016020)				lung(6)|skin(2)	8						CAACATCCCTGCACCTCTGAA	0.582																																					p.A173S		.											.	MED28	90	0			c.G517T						.						37.0	28.0	31.0					4																	17625401		2203	4300	6503	SO:0001583	missense	80306	exon4			ATCCCTGCACCTC	AF317678	CCDS33963.1	4p16	2007-07-30	2007-07-30		ENSG00000118579	ENSG00000118579			24628	protein-coding gene	gene with protein product		610311	"""mediator of RNA polymerase II transcription, subunit 28 homolog (S. cerevisiae)"""			11779215, 15467741	Standard	NM_025205		Approved	EG1, DKFZP434N185, magicin	uc003gpi.1	Q9H204	OTTHUMG00000161980	ENST00000237380.7:c.517G>T	4.37:g.17625401G>T	ENSP00000237380:p.Ala173Ser	265.0	0.0		171.0	57.0	NM_025205	Q9BZJ5	Missense_Mutation	SNP	ENST00000237380.7	37	CCDS33963.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933400	0.92458	.	.	ENSG00000118579	ENST00000237380;ENST00000503945	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.74966	0.3786	L	0.44542	1.39	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.76085	-0.3088	9	0.72032	D	0.01	-0.7114	19.7742	0.96385	0.0:0.0:1.0:0.0	.	173	Q9H204	MED28_HUMAN	S	173;170	.	ENSP00000237380:A173S	A	+	1	0	MED28	17234499	1.000000	0.71417	0.987000	0.45799	0.859000	0.49053	9.472000	0.97709	2.663000	0.90544	0.558000	0.71614	GCA	.		0.582	MED28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360055.3	NM_025205	
MFAP5	8076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8807070	8807070	+	Silent	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr12:8807070A>T	ENST00000359478.2	-	6	367	c.180T>A	c.(178-180)gcT>gcA	p.A60A	MFAP5_ENST00000538107.1_5'UTR|MFAP5_ENST00000396549.2_Silent_p.A60A|MFAP5_ENST00000543369.1_Silent_p.A48A|MFAP5_ENST00000540087.1_Silent_p.A60A|MFAP5_ENST00000535336.1_Silent_p.A60A|MFAP5_ENST00000433590.2_Intron	NM_003480.2	NP_003471.1	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	60					extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|skin(1)	13	Lung SC(5;0.184)					CAGCCAAAACAGCCAAAACTG	0.498																																					p.A60A		.											.	MFAP5	577	0			c.T180A						.						84.0	68.0	73.0					12																	8807070		2203	4300	6503	SO:0001819	synonymous_variant	8076	exon6			CAAAACAGCCAAA	AK124368	CCDS8595.1, CCDS73437.1	12p13.1-p12.3	2004-04-05				ENSG00000197614			29673	protein-coding gene	gene with protein product		601103				9792630, 8557636	Standard	XM_005253485		Approved	MAGP2, MP25	uc001qut.1	Q13361		ENST00000359478.2:c.180T>A	12.37:g.8807070A>T		168.0	0.0		197.0	63.0	NM_003480	B0AZL6|D3DUV1|Q7Z490	Silent	SNP	ENST00000359478.2	37	CCDS8595.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.548320	0.27652	.	.	ENSG00000197614	ENST00000535411	.	.	.	4.87	-3.33	0.04958	.	.	.	.	.	T	0.50939	0.1645	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46569	-0.9182	4	.	.	.	.	7.8546	0.29474	0.7577:0.1251:0.1171:0.0	.	.	.	.	Q	50	.	.	L	-	2	0	MFAP5	8698337	0.920000	0.31207	0.942000	0.38095	0.930000	0.56654	-0.288000	0.08377	-0.697000	0.05092	0.533000	0.62120	CTG	.		0.498	MFAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400656.2	NM_003480	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9085994	9085994	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:9085994T>A	ENST00000397910.4	-	1	6024	c.5821A>T	c.(5821-5823)Att>Ttt	p.I1941F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1941	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCACTGGAATGGATGAAAAA	0.488																																					p.I1941F		.											.	MUC16	566	0			c.A5821T						.						176.0	171.0	172.0					19																	9085994		2047	4187	6234	SO:0001583	missense	94025	exon1			CTGGAATGGATGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5821A>T	19.37:g.9085994T>A	ENSP00000381008:p.Ile1941Phe	60.0	0.0		69.0	35.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	7.373	0.627289	0.14257	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	0.235	0.235	0.15431	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	.	.	.	P	0.47106	0.89	P	0.52554	0.702	T	0.45789	-0.9237	7	0.87932	D	0	.	.	.	.	.	1941	B5ME49	.	F	1941	ENSP00000381008:I1941F	ENSP00000381008:I1941F	I	-	1	0	MUC16	8946994	0.000000	0.05858	0.534000	0.28014	0.535000	0.34838	-1.631000	0.02026	0.263000	0.21812	0.260000	0.18958	ATT	.		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYH14	79784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50789947	50789947	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:50789947A>T	ENST00000596571.1	+	31	4625	c.4625A>T	c.(4624-4626)aAg>aTg	p.K1542M	MYH14_ENST00000262269.8_Missense_Mutation_p.K1583M|MYH14_ENST00000425460.1_Missense_Mutation_p.K1550M|MYH14_ENST00000376970.2_Missense_Mutation_p.K1575M|MYH14_ENST00000601313.1_Missense_Mutation_p.K1583M|MYH14_ENST00000598205.1_Missense_Mutation_p.K1550M|MYH14_ENST00000440075.2_Missense_Mutation_p.K1583M			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1542					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GACGTCGGCAAGAGCGTGAGC	0.622																																					p.K1583M		.											.	MYH14	23	0			c.A4748T						.						11.0	16.0	14.0					19																	50789947		2080	4192	6272	SO:0001583	missense	79784	exon34			TCGGCAAGAGCGT	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4625A>T	19.37:g.50789947A>T	ENSP00000472819:p.Lys1542Met	94.0	0.0		95.0	29.0	NM_001145809	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.103194	0.76983	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	4.7	3.65	0.41850	Myosin tail (1);	.	.	.	.	D	0.88901	0.6563	M	0.86268	2.805	0.48452	D	0.999652	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88617	0.3160	9	0.87932	D	0	.	8.9602	0.35842	0.8337:0.0:0.0:0.1663	.	1583;1542;1550	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	M	1583;1575;1550;1326;1583	ENSP00000406273:K1583M;ENSP00000366169:K1575M;ENSP00000407879:K1550M;ENSP00000262269:K1583M	ENSP00000262269:K1583M	K	+	2	0	MYH14	55481759	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.736000	0.91554	0.895000	0.36342	0.528000	0.53228	AAG	.		0.622	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
NAPB	63908	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23360527	23360527	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:23360527A>C	ENST00000377026.4	-	9	797	c.712T>G	c.(712-714)Tca>Gca	p.S238A	NAPB_ENST00000472855.1_5'UTR|NAPB_ENST00000398425.3_Missense_Mutation_p.S144A|RNA5SP479_ENST00000364858.1_RNA|NAPB_ENST00000432543.2_Missense_Mutation_p.S199A	NM_001283018.1|NM_001283020.1|NM_022080.2	NP_001269947.1|NP_001269949.1|NP_071363.1	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, beta	238					intracellular protein transport (GO:0006886)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	extracellular vesicular exosome (GO:0070062)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					CATTCTCTTGAATCAGTAAAT	0.328																																					p.S238A		.											.	NAPB	91	0			c.T712G						.						49.0	52.0	51.0					20																	23360527		2202	4297	6499	SO:0001583	missense	63908	exon9			CTCTTGAATCAGT	AK022817	CCDS13152.1, CCDS63241.1, CCDS63242.1, CCDS74710.1	20p12.3-p11.21	2008-08-01			ENSG00000125814	ENSG00000125814			15751	protein-coding gene	gene with protein product		611270				8455721	Standard	NM_022080		Approved	SNAP-BETA, SNAPB	uc002wta.3	Q9H115	OTTHUMG00000032062	ENST00000377026.4:c.712T>G	20.37:g.23360527A>C	ENSP00000366225:p.Ser238Ala	350.0	0.0		447.0	108.0	NM_022080	B4DK44|Q4G0M0|Q4G187|Q5JXF9|Q8N3C4	Missense_Mutation	SNP	ENST00000377026.4	37	CCDS13152.1	.	.	.	.	.	.	.	.	.	.	A	18.55	3.648980	0.67358	.	.	ENSG00000125814	ENST00000377026;ENST00000398425;ENST00000432543;ENST00000431864	T;T;T	0.33438	1.41;1.41;1.41	5.76	5.76	0.90799	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	L	0.53249	1.67	0.80722	D	1	B;B;B;B	0.22746	0.041;0.074;0.033;0.018	B;B;B;B	0.25291	0.059;0.059;0.041;0.041	T	0.07083	-1.0791	10	0.49607	T	0.09	-9.0832	15.5474	0.76118	1.0:0.0:0.0:0.0	.	199;144;242;238	B4DK44;Q4G0M0;B4DIV0;Q9H115	.;.;.;SNAB_HUMAN	A	238;144;199;195	ENSP00000366225:S238A;ENSP00000381459:S144A;ENSP00000413600:S199A	ENSP00000366225:S238A	S	-	1	0	NAPB	23308527	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.238000	0.95380	2.322000	0.78497	0.528000	0.53228	TCA	.		0.328	NAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078317.2	NM_022080	
NCOA7	135112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	126196071	126196071	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr6:126196071A>C	ENST00000368357.3	+	5	660	c.308A>C	c.(307-309)aAg>aCg	p.K103T	RN7SKP56_ENST00000410513.1_RNA|NCOA7_ENST00000229634.9_5'UTR|NCOA7_ENST00000392477.2_Missense_Mutation_p.K103T	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	103					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		AAAAAAGAGAAGAAGATGGTG	0.333																																					p.K103T		.											.	NCOA7	227	0			c.A308C						.						109.0	113.0	112.0					6																	126196071		2203	4300	6503	SO:0001583	missense	135112	exon5			AAGAGAAGAAGAT	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.308A>C	6.37:g.126196071A>C	ENSP00000357341:p.Lys103Thr	128.0	0.0		118.0	29.0	NM_001199619	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	37	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.196721	0.79015	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000417494;ENST00000419660	T;T;T;T	0.56103	2.48;2.48;0.66;0.48	5.35	5.35	0.76521	.	0.168242	0.52532	D	0.000075	T	0.53417	0.1795	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.983;0.983;0.991	T	0.60551	-0.7241	10	0.87932	D	0	-23.875	14.958	0.71131	1.0:0.0:0.0:0.0	.	103;103;103	Q8NI08-2;Q8NI08-4;Q8NI08	.;.;NCOA7_HUMAN	T	103	ENSP00000357341:K103T;ENSP00000376269:K103T;ENSP00000406363:K103T;ENSP00000408211:K103T	ENSP00000357341:K103T	K	+	2	0	NCOA7	126237764	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.569000	0.60865	2.371000	0.80710	0.533000	0.62120	AAG	.		0.333	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
NLGN1	22871	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	173996849	173996849	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr3:173996849A>T	ENST00000457714.1	+	6	1487	c.1058A>T	c.(1057-1059)cAc>cTc	p.H353L	NLGN1_ENST00000361589.4_Missense_Mutation_p.H353L|NLGN1_ENST00000401917.3_Missense_Mutation_p.H393L|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Missense_Mutation_p.H353L	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	370					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			GCTCGATACCACATAGCCTTT	0.413																																					p.H353L		.											.	NLGN1	231	0			c.A1058T						.						218.0	196.0	204.0					3																	173996849		2203	4300	6503	SO:0001583	missense	22871	exon6			GATACCACATAGC	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1058A>T	3.37:g.173996849A>T	ENSP00000392500:p.His353Leu	155.0	1.0		181.0	43.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.788070	0.49997	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.59307	0.2184	N	0.25825	0.765	0.80722	D	1	P;B	0.47762	0.9;0.212	P;B	0.50537	0.643;0.128	T	0.55535	-0.8126	10	0.23302	T	0.38	.	16.3109	0.82869	1.0:0.0:0.0:0.0	.	393;353	D2X2H5;Q8N2Q7-2	.;.	L	353;353;353;393	ENSP00000392500:H353L;ENSP00000354541:H353L;ENSP00000441108:H353L;ENSP00000385750:H393L	ENSP00000354541:H353L	H	+	2	0	NLGN1	175479543	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.339000	0.96797	2.257000	0.74773	0.460000	0.39030	CAC	.		0.413	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
OGFR	11054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	61443964	61443964	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:61443964G>C	ENST00000290291.6	+	7	1022	c.997G>C	c.(997-999)Gag>Cag	p.E333Q	OGFR_ENST00000370461.1_Missense_Mutation_p.E281Q	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	333					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CTGTGGGCCAGAGCATAGCAA	0.716																																					p.E333Q		.											.	OGFR	68	0			c.G997C						.																																			SO:0001583	missense	11054	exon7			GGGCCAGAGCATA	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.997G>C	20.37:g.61443964G>C	ENSP00000290291:p.Glu333Gln	70.0	0.0		113.0	45.0	NM_007346	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.545	0.661516	0.14645	.	.	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163;ENST00000370469;ENST00000370461	T;T;T	0.51325	1.69;0.71;1.24	4.11	1.6	0.23607	.	1.044460	0.07493	N	0.905908	T	0.29817	0.0745	L	0.34521	1.04	0.09310	N	1	P;P;P	0.44521	0.596;0.627;0.837	B;B;B	0.34722	0.188;0.139;0.139	T	0.16512	-1.0400	10	0.31617	T	0.26	-18.0957	4.5315	0.12008	0.1879:0.2316:0.5805:0.0	.	333;316;333	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	Q	333;333;333;188;281	ENSP00000290291:E333Q;ENSP00000359499:E333Q;ENSP00000359491:E281Q	ENSP00000290291:E333Q	E	+	1	0	OGFR	60914409	0.030000	0.19436	0.001000	0.08648	0.129000	0.20672	1.492000	0.35594	0.685000	0.31468	0.561000	0.74099	GAG	.		0.716	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OSBPL3	26031	ucsc.edu;bcgsc.ca	37	7	24881964	24881964	+	Silent	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr7:24881964A>T	ENST00000313367.2	-	13	1786	c.1335T>A	c.(1333-1335)acT>acA	p.T445T	OSBPL3_ENST00000431825.2_Silent_p.T378T|OSBPL3_ENST00000353930.1_Silent_p.T409T|OSBPL3_ENST00000396431.1_Silent_p.T414T|OSBPL3_ENST00000352860.1_Silent_p.T414T|OSBPL3_ENST00000396429.1_Silent_p.T409T|OSBPL3_ENST00000409069.1_Silent_p.T378T	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	445					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						AAAGGGAGTCAGTGATGGAGA	0.383																																					p.T445T		.											.	OSBPL3	204	0			c.T1335A						.						179.0	194.0	189.0					7																	24881964		2203	4300	6503	SO:0001819	synonymous_variant	26031	exon13			GGAGTCAGTGATG	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.1335T>A	7.37:g.24881964A>T		142.0	2.0		182.0	57.0	NM_015550	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	ENST00000313367.2	37	CCDS5390.1																																																																																			.		0.383	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
PABPC5	140886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	90691012	90691012	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chrX:90691012G>T	ENST00000312600.3	+	2	650	c.436G>T	c.(436-438)Ggt>Tgt	p.G146C	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	146	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						CGGCTCTAAGGGTTATGCCTA	0.493																																					p.G146C		.											PABPC5,NS,carcinoma,-1	PABPC5	110	0			c.G436T						.						81.0	71.0	74.0					X																	90691012		2203	4300	6503	SO:0001583	missense	140886	exon2			TCTAAGGGTTATG	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.436G>T	X.37:g.90691012G>T	ENSP00000308012:p.Gly146Cys	76.0	0.0		110.0	75.0	NM_080832	A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	37	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511708	0.64522	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.27557	1.66	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.60702	0.2289	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68236	-0.5462	10	0.66056	D	0.02	.	13.8905	0.63736	0.0:0.0:1.0:0.0	.	146	Q96DU9	PABP5_HUMAN	C	146;114	ENSP00000308012:G146C	ENSP00000308012:G146C	G	+	1	0	PABPC5	90577668	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.211000	0.72182	2.450000	0.82876	0.600000	0.82982	GGT	.		0.493	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832	
PCDHB16	57717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140562737	140562737	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr5:140562737T>A	ENST00000361016.2	+	1	1758	c.603T>A	c.(601-603)gaT>gaA	p.D201E		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	201	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGAGCTGGATCGGGAGGAGG	0.493																																					p.D201E		.											.	PCDHB16	92	0			c.T603A						.						61.0	63.0	62.0					5																	140562737		2203	4300	6503	SO:0001583	missense	57717	exon1			GCTGGATCGGGAG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.603T>A	5.37:g.140562737T>A	ENSP00000354293:p.Asp201Glu	78.0	0.0		80.0	25.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	T	19.16	3.774578	0.70107	.	.	ENSG00000196963	ENST00000361016	T	0.63255	-0.03	4.69	0.893	0.19236	Cadherin (4);Cadherin-like (1);	0.000000	0.35378	N	0.003248	D	0.85999	0.5828	H	0.99770	4.765	0.29178	N	0.876675	D	0.89917	1.0	D	0.97110	1.0	T	0.79650	-0.1715	10	0.87932	D	0	.	8.727	0.34476	0.0:0.3938:0.0:0.6062	.	201	Q9NRJ7	PCDBG_HUMAN	E	201	ENSP00000354293:D201E	ENSP00000354293:D201E	D	+	3	2	PCDHB16	140542921	0.000000	0.05858	0.996000	0.52242	0.775000	0.43874	-0.885000	0.04161	0.195000	0.20347	0.533000	0.62120	GAT	.		0.493	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCYT2	5833	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79865686	79865686	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr17:79865686C>A	ENST00000538936.2	-	5	563	c.455G>T	c.(454-456)cGc>cTc	p.R152L	PCYT2_ENST00000570391.1_Missense_Mutation_p.R120L|PCYT2_ENST00000570388.1_Missense_Mutation_p.R74L|PCYT2_ENST00000571105.1_Missense_Mutation_p.R152L|PCYT2_ENST00000538721.2_Missense_Mutation_p.R152L|PCYT2_ENST00000331285.3_Missense_Mutation_p.R74L	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	152					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	CAGCAGCATGCGGCCCACGAG	0.652																																					p.R152L		.											.	PCYT2	68	0			c.G455T						.						77.0	59.0	65.0					17																	79865686		2203	4300	6503	SO:0001583	missense	5833	exon5			AGCATGCGGCCCA	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.455G>T	17.37:g.79865686C>A	ENSP00000439245:p.Arg152Leu	55.0	0.0		54.0	8.0	NM_002861	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	SNP	ENST00000538936.2	37	CCDS11791.1	.	.	.	.	.	.	.	.	.	.	C	35	5.432140	0.96150	.	.	ENSG00000185813	ENST00000538721;ENST00000538936;ENST00000331285	.	.	.	4.48	4.48	0.54585	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.90164	0.6926	H	0.98068	4.14	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.94125	0.7383	9	0.87932	D	0	-28.9973	17.3427	0.87301	0.0:1.0:0.0:0.0	.	120;120;152;74;152	B7Z4W6;B7ZAS0;F5H8B1;B7Z7A5;Q99447	.;.;.;.;PCY2_HUMAN	L	152;152;74	.	ENSP00000331719:R74L	R	-	2	0	PCYT2	77458978	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.463000	0.66712	2.303000	0.77524	0.655000	0.94253	CGC	.		0.652	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	
PDE3A	5139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	20792858	20792858	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr12:20792858C>A	ENST00000359062.3	+	10	2258	c.2218C>A	c.(2218-2220)Cat>Aat	p.H740N	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	740	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GAATTATTTTCATGCTTTGGA	0.313																																					p.H740N		.											.	PDE3A	94	0			c.C2218A						.						85.0	85.0	85.0					12																	20792858		2202	4300	6502	SO:0001583	missense	5139	exon10			TATTTTCATGCTT		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2218C>A	12.37:g.20792858C>A	ENSP00000351957:p.His740Asn	64.0	0.0		91.0	17.0	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	C	19.50	3.838440	0.71373	.	.	ENSG00000172572	ENST00000359062	T	0.76448	-1.02	5.03	5.03	0.67393	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.000000	0.85682	D	0.000000	T	0.80592	0.4652	L	0.31476	0.935	0.80722	D	1	D	0.65815	0.995	P	0.61477	0.889	T	0.79806	-0.1648	10	0.38643	T	0.18	.	18.1402	0.89637	0.0:1.0:0.0:0.0	.	740	Q14432	PDE3A_HUMAN	N	740	ENSP00000351957:H740N	ENSP00000351957:H740N	H	+	1	0	PDE3A	20684125	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.225000	0.65294	2.614000	0.88457	0.491000	0.48974	CAT	.		0.313	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
PMFBP1	83449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72198720	72198720	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr16:72198720C>A	ENST00000237353.10	-	3	369	c.108G>T	c.(106-108)caG>caT	p.Q36H	PMFBP1_ENST00000537465.1_Missense_Mutation_p.Q36H|PMFBP1_ENST00000543746.1_5'UTR|PMFBP1_ENST00000355636.6_5'UTR	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	36						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AGGTCTTCCTCTGTCTCTTGC	0.547																																					p.Q36H		.											.	PMFBP1	92	0			c.G108T						.						121.0	101.0	108.0					16																	72198720		2198	4300	6498	SO:0001583	missense	83449	exon3			CTTCCTCTGTCTC	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.108G>T	16.37:g.72198720C>A	ENSP00000237353:p.Gln36His	50.0	0.0		62.0	8.0	NM_031293	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Missense_Mutation	SNP	ENST00000237353.10	37	CCDS32483.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377496	0.61735	.	.	ENSG00000118557	ENST00000537465;ENST00000237353;ENST00000535461;ENST00000539172;ENST00000536211;ENST00000540440	T;T	0.21031	2.03;2.05	5.85	-1.37	0.09056	.	0.142984	0.32970	N	0.005423	T	0.10465	0.0256	N	0.19112	0.55	0.80722	D	1	B;B	0.32800	0.385;0.385	B;B	0.33295	0.161;0.161	T	0.12604	-1.0541	10	0.40728	T	0.16	-16.5788	6.1373	0.20241	0.0:0.4655:0.1295:0.4051	.	36;36	Q8TBY8-2;G3V1Q7	.;.	H	36	ENSP00000443817:Q36H;ENSP00000237353:Q36H	ENSP00000237353:Q36H	Q	-	3	2	PMFBP1	70756221	0.946000	0.32159	0.996000	0.52242	0.861000	0.49209	-0.376000	0.07465	-0.083000	0.12618	-0.794000	0.03295	CAG	.		0.547	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
PNLIPRP3	119548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118202641	118202641	+	Silent	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr10:118202641A>T	ENST00000369230.3	+	3	425	c.279A>T	c.(277-279)atA>atT	p.I93I		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	93					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		GTATCAACATAGCTGGATGGA	0.398																																					p.I93I		.											.	PNLIPRP3	91	0			c.A279T						.						119.0	107.0	111.0					10																	118202641		2203	4300	6503	SO:0001819	synonymous_variant	119548	exon3			CAACATAGCTGGA	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.279A>T	10.37:g.118202641A>T		90.0	0.0		88.0	15.0	NM_001011709		Silent	SNP	ENST00000369230.3	37	CCDS31292.1																																																																																			.		0.398	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404	
PTGS1	5742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125141054	125141054	+	Splice_Site	SNP	T	T	G			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr9:125141054T>G	ENST00000362012.2	+	5	358	c.353T>G	c.(352-354)gTg>gGg	p.V118G	PTGS1_ENST00000223423.4_Splice_Site_p.V118G|PTGS1_ENST00000373698.5_Splice_Site_p.V9G|PTGS1_ENST00000540753.1_Splice_Site_p.V93G	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	118					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTCTCTGCAGTGCGCTCCAAC	0.517																																					p.V118G		.											.	PTGS1	228	0			c.T353G						.						152.0	133.0	139.0					9																	125141054		2203	4300	6503	SO:0001630	splice_region_variant	5742	exon5			CTGCAGTGCGCTC	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.353-1T>G	9.37:g.125141054T>G		116.0	0.0		107.0	15.0	NM_000962	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	37	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	T	3.558	-0.090208	0.07053	.	.	ENSG00000095303	ENST00000540753;ENST00000362012;ENST00000223423;ENST00000426608;ENST00000373698	T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88	5.68	-0.726	0.11170	.	0.222920	0.45867	D	0.000325	T	0.04998	0.0134	N	0.11698	0.16	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.10450	0.005;0.002;0.005	T	0.45440	-0.9261	9	.	.	.	.	9.9071	0.41384	0.0:0.3363:0.0:0.6637	.	93;118;118	B4DHQ2;P23219;P23219-2	.;PGH1_HUMAN;.	G	93;118;118;76;9	ENSP00000437709:V93G;ENSP00000354612:V118G;ENSP00000223423:V118G;ENSP00000411606:V76G;ENSP00000362802:V9G	.	V	+	2	0	PTGS1	124180875	0.504000	0.26123	0.884000	0.34674	0.084000	0.17831	0.784000	0.26816	-0.370000	0.08016	0.460000	0.39030	GTG	.		0.517	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1		Missense_Mutation
RAB3GAP1	22930	broad.mit.edu;ucsc.edu;mdanderson.org	37	2	135878431	135878431	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr2:135878431C>T	ENST00000264158.8	+	8	734	c.691C>T	c.(691-693)Cga>Tga	p.R231*	RAB3GAP1_ENST00000442034.1_Nonsense_Mutation_p.R231*|RAB3GAP1_ENST00000539493.1_Nonsense_Mutation_p.R187*|RAB3GAP1_ENST00000487003.1_3'UTR	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	231					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		TATTGCTATTCGATTTACCTA	0.363																																					p.R231X		.											.	RAB3GAP1	92	0			c.C691T						.						284.0	263.0	271.0					2																	135878431		2203	4300	6503	SO:0001587	stop_gained	22930	exon8			GCTATTCGATTTA	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.691C>T	2.37:g.135878431C>T	ENSP00000264158:p.Arg231*	107.0	1.0		139.0	26.0	NM_001172435	A6H8Z3|C9J837|Q659F5|Q8TBB4	Nonsense_Mutation	SNP	ENST00000264158.8	37	CCDS33294.1	.	.	.	.	.	.	.	.	.	.	C	36	5.855434	0.97030	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	.	.	.	5.45	5.45	0.79879	.	0.056845	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9888	15.2768	0.73748	0.1408:0.8592:0.0:0.0	.	.	.	.	X	231;187;231	.	ENSP00000264158:R231X	R	+	1	2	RAB3GAP1	135594901	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	3.818000	0.55678	2.696000	0.92011	0.655000	0.94253	CGA	.		0.363	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337514.2	NM_012233	
RALGAPB	57148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	37117219	37117219	+	Silent	SNP	T	T	G			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:37117219T>G	ENST00000262879.6	+	2	428	c.144T>G	c.(142-144)ccT>ccG	p.P48P	RALGAPB_ENST00000397038.1_5'UTR|RALGAPB_ENST00000397042.3_Silent_p.P48P|RALGAPB_ENST00000397040.1_Silent_p.P48P|RALGAPB_ENST00000537204.1_Silent_p.P48P			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	48					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TAGGTACCCCTTCAGTGGCTG	0.423																																					p.P48P		.											.	RALGAPB	92	0			c.T144G						.						172.0	154.0	160.0					20																	37117219		2203	4300	6503	SO:0001819	synonymous_variant	57148	exon2			TACCCCTTCAGTG	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.144T>G	20.37:g.37117219T>G		92.0	0.0		179.0	41.0	NM_020336	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Silent	SNP	ENST00000262879.6	37	CCDS13305.1																																																																																			.		0.423	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	
RIMS2	9699	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	104927768	104927768	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr8:104927768A>G	ENST00000436393.2	+	5	1433	c.1192A>G	c.(1192-1194)Att>Gtt	p.I398V	RIMS2_ENST00000262231.10_Missense_Mutation_p.I475V|RIMS2_ENST00000406091.3_Missense_Mutation_p.I620V|RIMS2_ENST00000507740.1_Missense_Mutation_p.I428V			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	698					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTGTGCATTTATTACTAAAGT	0.333										HNSCC(12;0.0054)																											p.I620V		.											.	RIMS2	279	0			c.A1858G						.						105.0	98.0	100.0					8																	104927768		1815	4076	5891	SO:0001583	missense	9699	exon7			GCATTTATTACTA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1192A>G	8.37:g.104927768A>G	ENSP00000390665:p.Ile398Val	85.0	1.0		151.0	81.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	A	23.2	4.386114	0.82902	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000378492;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77	5.98	5.98	0.97165	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.36771	0.0979	N	0.17278	0.47	0.80722	D	1	B;B;P;B;B;P	0.50528	0.271;0.278;0.608;0.376;0.371;0.936	P;P;D;P;P;D	0.75484	0.8;0.735;0.986;0.878;0.845;0.986	T	0.21861	-1.0233	9	0.44086	T	0.13	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	698;698;398;475;428;620	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	V	620;651;620;698;11;428;475;428;428;398	ENSP00000427018:I620V;ENSP00000384892:I620V;ENSP00000425205:I428V;ENSP00000262231:I475V;ENSP00000423559:I428V;ENSP00000386228:I428V;ENSP00000390665:I398V	ENSP00000262231:I475V	I	+	1	0	RIMS2	104996944	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.339000	0.96797	2.288000	0.76882	0.528000	0.53228	ATT	.		0.333	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
RIOK2	55781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	96503531	96503531	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr5:96503531T>C	ENST00000283109.3	-	8	1105	c.1037A>G	c.(1036-1038)gAg>gGg	p.E346G	RIOK2_ENST00000508447.1_Missense_Mutation_p.E346G|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	346	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		CCCGTAAACCTCTGCTTTTTC	0.403																																					p.E346G		.											.	RIOK2	419	0			c.A1037G						.						157.0	160.0	159.0					5																	96503531		2203	4300	6503	SO:0001583	missense	55781	exon8			TAAACCTCTGCTT	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.1037A>G	5.37:g.96503531T>C	ENSP00000283109:p.Glu346Gly	108.0	0.0		89.0	14.0	NM_001159749	D6RDI3|Q9NUT0	Missense_Mutation	SNP	ENST00000283109.3	37	CCDS4089.1	.	.	.	.	.	.	.	.	.	.	T	11.94	1.788397	0.31685	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.19250	2.16;2.16	5.55	0.0328	0.14177	.	1.007380	0.07962	N	0.982614	T	0.10723	0.0262	N	0.08118	0	0.09310	N	1	B;B	0.17038	0.02;0.018	B;B	0.18263	0.016;0.021	T	0.38693	-0.9649	10	0.28530	T	0.3	-24.9149	8.4858	0.33071	0.0:0.0666:0.3751:0.5583	.	346;346	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	G	346	ENSP00000283109:E346G;ENSP00000420932:E346G	ENSP00000283109:E346G	E	-	2	0	RIOK2	96529287	0.001000	0.12720	0.000000	0.03702	0.054000	0.15201	0.959000	0.29240	-0.210000	0.10140	0.477000	0.44152	GAG	.		0.403	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250628.1	NM_018343	
RMI1	80010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86616085	86616085	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr9:86616085A>T	ENST00000325875.3	+	3	516	c.184A>T	c.(184-186)Agg>Tgg	p.R62W		NM_024945.2	NP_079221.2	Q9H9A7	RMI1_HUMAN	RecQ mediated genome instability 1	62					DNA replication (GO:0006260)|glucose homeostasis (GO:0042593)|multicellular organism growth (GO:0035264)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)	nucleus (GO:0005634)				biliary_tract(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						TACTGATCTGAGGGATTTGGA	0.363																																					p.R62W		.											.	RMI1	90	0			c.A184T						.						97.0	101.0	100.0					9																	86616085		2203	4300	6503	SO:0001583	missense	80010	exon3			GATCTGAGGGATT	AK022950	CCDS6669.1	9q22.1	2013-06-10	2013-06-10	2006-06-12	ENSG00000178966	ENSG00000178966			25764	protein-coding gene	gene with protein product	"""BLM-Associated Polypeptide, 75 kDa"""	610404	"""chromosome 9 open reading frame 76"", ""RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae)"""	C9orf76		15775963, 20826341	Standard	NM_024945		Approved	FLJ12888, BLAP75	uc004anq.4	Q9H9A7	OTTHUMG00000020113	ENST00000325875.3:c.184A>T	9.37:g.86616085A>T	ENSP00000317039:p.Arg62Trp	146.0	0.0		123.0	37.0	NM_024945	Q05BX1|Q05CW3|Q5SQG8|Q5SQG9|Q6P1Q4|Q6PI89|Q7Z6L6	Missense_Mutation	SNP	ENST00000325875.3	37	CCDS6669.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.267373	0.59540	.	.	ENSG00000178966	ENST00000445877;ENST00000325875	T;T	0.53640	0.61;0.61	5.76	4.55	0.56014	Domain of unknown function DUF1767 (1);	0.000000	0.85682	D	0.000000	T	0.66626	0.2808	M	0.78916	2.43	0.50039	D	0.999849	D	0.71674	0.998	D	0.67900	0.954	T	0.71467	-0.4584	10	0.87932	D	0	0.6268	12.8735	0.57978	0.8644:0.1356:0.0:0.0	.	62	Q9H9A7	RMI1_HUMAN	W	62	ENSP00000402433:R62W;ENSP00000317039:R62W	ENSP00000317039:R62W	R	+	1	2	RMI1	85805905	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.765000	0.55272	2.322000	0.78497	0.528000	0.53228	AGG	.		0.363	RMI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052870.1	NM_024945	
RP1	6101	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	55534080	55534080	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr8:55534080A>T	ENST00000220676.1	+	2	702	c.554A>T	c.(553-555)cAg>cTg	p.Q185L		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	185	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCATTTCTACAGCACCTGACA	0.607																																					p.Q185L	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.A554T						.						120.0	123.0	122.0					8																	55534080		2203	4300	6503	SO:0001583	missense	6101	exon2			TTCTACAGCACCT	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.554A>T	8.37:g.55534080A>T	ENSP00000220676:p.Gln185Leu	140.0	1.0		198.0	107.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	17.80	3.477880	0.63849	.	.	ENSG00000104237	ENST00000220676	D	0.92199	-2.99	5.14	-0.0599	0.13791	Doublecortin domain (5);	0.603677	0.14752	N	0.300531	D	0.89385	0.6700	L	0.54323	1.7	0.33728	D	0.617852	P	0.43231	0.801	B	0.43360	0.417	D	0.87628	0.2514	10	0.72032	D	0.01	-0.2034	9.5039	0.39035	0.7406:0.0:0.2594:0.0	.	185	P56715	RP1_HUMAN	L	185	ENSP00000220676:Q185L	ENSP00000220676:Q185L	Q	+	2	0	RP1	55696633	0.999000	0.42202	0.918000	0.36340	0.470000	0.32858	1.606000	0.36826	-0.212000	0.10109	0.528000	0.53228	CAG	.		0.607	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RPS3	6188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	75115172	75115172	+	Silent	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr11:75115172G>A	ENST00000531188.1	+	5	521	c.459G>A	c.(457-459)gtG>gtA	p.V153V	RPS3_ENST00000524851.1_Silent_p.V153V|SNORD15B_ENST00000384714.1_RNA|RPS3_ENST00000278572.6_Silent_p.V169V|RPS3_ENST00000526608.1_Silent_p.V141V|RPS3_ENST00000527446.1_Silent_p.V153V|RPS3_ENST00000529285.1_Intron|RPS3_ENST00000534440.1_Intron	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	153					cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						TGAAGTTTGTGGATGGCCTGA	0.552																																					p.V169V		.											.	RPS3	90	0			c.G507A						.						112.0	96.0	102.0					11																	75115172		2200	4293	6493	SO:0001819	synonymous_variant	6188	exon5			GTTTGTGGATGGC		CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.459G>A	11.37:g.75115172G>A		98.0	0.0		177.0	19.0	NM_001260506	B2R7N5|J3KN86|Q498B5|Q8NI95	Silent	SNP	ENST00000531188.1	37	CCDS8236.1	.	.	.	.	.	.	.	.	.	.	g	10.24	1.296922	0.23650	.	.	ENSG00000149273	ENST00000525933	.	.	.	5.21	2.34	0.29019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.6916	2.0172	0.03500	0.1703:0.159:0.5061:0.1647	.	.	.	.	X	81	.	.	W	+	2	0	RPS3	74792820	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.255000	0.43222	0.358000	0.24211	0.645000	0.84053	TGG	.		0.552	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
RUFY3	22902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71656987	71656987	+	Silent	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr4:71656987A>T	ENST00000226328.4	+	13	1946	c.1383A>T	c.(1381-1383)gcA>gcT	p.A461A	RUFY3_ENST00000536664.1_Silent_p.A445A|RUFY3_ENST00000381006.3_Intron|RUFY3_ENST00000502653.1_Intron	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	461					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			ATAGTGCAGCAAATAAACTGA	0.328																																					p.A461A		.											.	RUFY3	90	0			c.A1383T						.						123.0	115.0	118.0					4																	71656987		2203	4300	6503	SO:0001819	synonymous_variant	22902	exon13			TGCAGCAAATAAA	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.1383A>T	4.37:g.71656987A>T		580.0	1.0		501.0	108.0	NM_014961	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Silent	SNP	ENST00000226328.4	37	CCDS3547.1																																																																																			.		0.328	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38945876	38945876	+	Splice_Site	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:38945876G>C	ENST00000359596.3	+	14	1442	c.1442G>C	c.(1441-1443)gGg>gCg	p.G481A	RYR1_ENST00000355481.4_Splice_Site_p.G481A|RYR1_ENST00000360985.3_Splice_Site_p.G481A			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	481					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TCATCCTAGGGGATGCTCTCC	0.502											OREG0005269	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=RYR1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G481A		.											.	RYR1	100	0			c.G1442C						.						156.0	136.0	143.0					19																	38945876		2203	4300	6503	SO:0001630	splice_region_variant	6261	exon14			CCTAGGGGATGCT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.1441-1G>C	19.37:g.38945876G>C		91.0	0.0	882	67.0	25.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682636	0.47991	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.90004	-2.6;-2.6;-2.6	3.97	3.97	0.46021	Intracellular calcium-release channel (1);	0.000000	0.64402	U	0.000002	D	0.95050	0.8397	M	0.88775	2.98	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.96142	0.9101	10	0.87932	D	0	.	15.8324	0.78764	0.0:0.0:1.0:0.0	.	481;481	P21817-2;P21817	.;RYR1_HUMAN	A	481	ENSP00000352608:G481A;ENSP00000347667:G481A;ENSP00000354254:G481A	ENSP00000347667:G481A	G	+	2	0	RYR1	43637716	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	9.568000	0.98166	2.044000	0.60594	0.407000	0.27541	GGG	.		0.502	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		Missense_Mutation
RYR2	6262	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237872824	237872824	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:237872824T>G	ENST00000366574.2	+	70	10504	c.10187T>G	c.(10186-10188)tTc>tGc	p.F3396C	RYR2_ENST00000542537.1_Missense_Mutation_p.F3380C|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.F3394C	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3396					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGGAGCTCTTCCGCATGGTG	0.428																																					p.F3396C		.											.	RYR2	158	0			c.T10187G						.						93.0	92.0	93.0					1																	237872824		1932	4135	6067	SO:0001583	missense	6262	exon70			AGCTCTTCCGCAT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10187T>G	1.37:g.237872824T>G	ENSP00000355533:p.Phe3396Cys	79.0	1.0		159.0	68.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.540625	0.85917	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.98249	-0.23;-4.82;-0.23	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000002	D	0.98868	0.9617	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99854	1.1075	10	0.87932	D	0	-14.0375	15.6035	0.76642	0.0:0.0:0.0:1.0	.	3396	Q92736	RYR2_HUMAN	C	3396;3394;3380;351	ENSP00000355533:F3396C;ENSP00000353174:F3394C;ENSP00000443798:F3380C	ENSP00000353174:F3394C	F	+	2	0	RYR2	235939447	1.000000	0.71417	0.974000	0.42286	0.978000	0.69477	7.993000	0.88291	2.082000	0.62665	0.533000	0.62120	TTC	.		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SEC14L1	6397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	75186883	75186883	+	Splice_Site	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr17:75186883A>T	ENST00000413679.2	+	4	366		c.e4-1		SEC14L1_ENST00000443798.4_Splice_Site|SEC14L1_ENST00000591437.1_Splice_Site|SEC14L1_ENST00000585618.1_Splice_Site|SEC14L1_ENST00000392476.2_Splice_Site|SEC14L1_ENST00000436233.4_Splice_Site|SEC14L1_ENST00000431431.2_Splice_Site|SEC14L1_ENST00000430767.4_Splice_Site	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)						transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						TTAAATTTATAGGCCTATGAA	0.483																																					.		.											.	SEC14L1	92	0			c.64-2A>T						.						76.0	71.0	73.0					17																	75186883		2203	4300	6503	SO:0001630	splice_region_variant	6397	exon6			ATTTATAGGCCTA	D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.64-1A>T	17.37:g.75186883A>T		41.0	0.0		39.0	12.0	NM_001204408	A8K4E8|B4DDI5|D5G3K1|Q99780	Splice_Site	SNP	ENST00000413679.2	37	CCDS11752.1	.	.	.	.	.	.	.	.	.	.	A	18.69	3.678316	0.68042	.	.	ENSG00000129657	ENST00000392476;ENST00000443798;ENST00000436233;ENST00000430767;ENST00000413679	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3091	0.66403	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC14L1	72698478	1.000000	0.71417	0.995000	0.50966	0.757000	0.42996	8.834000	0.92094	2.035000	0.60131	0.482000	0.46254	.	.		0.483	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003	Intron
SERPINB3	6317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61323009	61323009	+	Missense_Mutation	SNP	A	A	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr18:61323009A>T	ENST00000283752.5	-	8	1198	c.1055T>A	c.(1054-1056)tTc>tAc	p.F352Y	SERPINB3_ENST00000332821.8_Missense_Mutation_p.F300Y|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	352					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TGATGATCCGAATCCTACTAC	0.493																																					p.F352Y		.											.	SERPINB3	228	0			c.T1055A						.						124.0	131.0	129.0					18																	61323009		2203	4300	6503	SO:0001583	missense	6317	exon8			GATCCGAATCCTA	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.1055T>A	18.37:g.61323009A>T	ENSP00000283752:p.Phe352Tyr	137.0	0.0		128.0	58.0	NM_006919	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Missense_Mutation	SNP	ENST00000283752.5	37	CCDS11987.1	.	.	.	.	.	.	.	.	.	.	A	1.388	-0.581531	0.03854	.	.	ENSG00000057149	ENST00000283752;ENST00000332821	D;D	0.82255	-1.59;-1.59	2.99	-5.64	0.02466	Serpin domain (3);	450.141000	0.00166	N	0.000000	T	0.64000	0.2559	N	0.16166	0.38	0.09310	N	1	B;B	0.21688	0.059;0.022	B;B	0.17098	0.017;0.015	T	0.52373	-0.8584	10	0.24483	T	0.36	.	1.9358	0.03337	0.5159:0.1235:0.2404:0.1202	.	300;352	P29508-2;P29508	.;SPB3_HUMAN	Y	352;300	ENSP00000283752:F352Y;ENSP00000329498:F300Y	ENSP00000283752:F352Y	F	-	2	0	SERPINB3	59473989	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.452000	0.06787	-1.297000	0.02351	-3.778000	0.00021	TTC	.		0.493	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
SERPINB3	6317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61323101	61323101	+	Silent	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr18:61323101G>A	ENST00000283752.5	-	8	1106	c.963C>T	c.(961-963)cgC>cgT	p.R321R	SERPINB3_ENST00000332821.8_Silent_p.R269R|SERPINB11_ENST00000489748.1_RNA	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	321					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						GCACGAGACCGCGGCTCCCGG	0.542																																					p.R321R		.											.	SERPINB3	228	0			c.C963T						.						138.0	124.0	129.0					18																	61323101		2203	4300	6503	SO:0001819	synonymous_variant	6317	exon8			GAGACCGCGGCTC	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.963C>T	18.37:g.61323101G>A		109.0	0.0		133.0	32.0	NM_006919	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Silent	SNP	ENST00000283752.5	37	CCDS11987.1																																																																																			.		0.542	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133791.1	NM_006919	
SERPINB10	5273	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61584734	61584734	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr18:61584734A>C	ENST00000238508.3	+	3	272	c.213A>C	c.(211-213)gaA>gaC	p.E71D		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	71					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				GTGACCCTGAAAGTGAAAAAA	0.274																																					p.E71D		.											.	SERPINB10	227	0			c.A213C						.						29.0	29.0	29.0					18																	61584734		2178	4259	6437	SO:0001583	missense	5273	exon2			CCCTGAAAGTGAA	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.213A>C	18.37:g.61584734A>C	ENSP00000238508:p.Glu71Asp	238.0	0.0		304.0	107.0	NM_005024	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	A	5.785	0.329242	0.10956	.	.	ENSG00000242550	ENST00000238508	D	0.84944	-1.92	5.51	0.214	0.15249	Serpin domain (3);	0.621181	0.15380	N	0.265354	T	0.69931	0.3166	L	0.31420	0.93	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.15484	0.013;0.011	T	0.51919	-0.8644	9	.	.	.	.	2.094	0.03663	0.4:0.3572:0.0913:0.1515	.	71;71	P48595;B2RC45	SPB10_HUMAN;.	D	71	ENSP00000238508:E71D	.	E	+	3	2	SERPINB10	59735714	0.102000	0.21896	0.991000	0.47740	0.144000	0.21451	-0.108000	0.10857	0.147000	0.19030	0.528000	0.53228	GAA	.		0.274	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134012.3	NM_005024	
SH3TC2	79628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148388485	148388485	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr5:148388485T>A	ENST00000515425.1	-	15	3508	c.3407A>T	c.(3406-3408)cAg>cTg	p.Q1136L	SH3TC2_ENST00000512049.1_Missense_Mutation_p.Q1129L|SH3TC2_ENST00000538184.1_Missense_Mutation_p.Q683L|SH3TC2_ENST00000502274.1_5'Flank	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1136					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGCTAATCTGCAGCTCTGT	0.532																																					p.Q1136L		.											.	SH3TC2	92	0			c.A3407T						.						134.0	133.0	133.0					5																	148388485		2203	4300	6503	SO:0001583	missense	79628	exon15			CTAATCTGCAGCT	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3407A>T	5.37:g.148388485T>A	ENSP00000423660:p.Gln1136Leu	131.0	0.0		153.0	61.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	37	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	T	6.423	0.446095	0.12164	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049	T;T;T	0.73681	-0.77;-0.73;-0.72	6.03	6.03	0.97812	Tetratricopeptide-like helical (1);	0.086978	0.48286	D	0.000193	T	0.53270	0.1786	N	0.16066	0.365	0.80722	D	1	B;B;B	0.18013	0.025;0.025;0.025	B;B;B	0.16722	0.016;0.01;0.016	T	0.51585	-0.8687	10	0.02654	T	1	-17.2873	11.6211	0.51119	0.1327:0.0:0.0:0.8673	.	1129;1136;1136	Q14CC0;E9PDF1;Q8TF17	.;.;S3TC2_HUMAN	L	683;1136;1129	ENSP00000441427:Q683L;ENSP00000423660:Q1136L;ENSP00000421860:Q1129L	ENSP00000425627:Q1136L	Q	-	2	0	SH3TC2	148368678	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.674000	0.61612	2.302000	0.77476	0.533000	0.62120	CAG	.		0.532	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
SH3YL1	26751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234273	234273	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr2:234273C>T	ENST00000405430.1	-	7	668		c.e7-1		SH3YL1_ENST00000403712.2_Splice_Site|SH3YL1_ENST00000403658.1_Splice_Site|SH3YL1_ENST00000415006.2_Splice_Site|SH3YL1_ENST00000356150.5_Splice_Site|SH3YL1_ENST00000403657.1_Splice_Site|SH3YL1_ENST00000468321.1_Splice_Site			Q96HL8	SH3Y1_HUMAN	SH3 and SYLF domain containing 1						phosphatidylinositol biosynthetic process (GO:0006661)|regulation of ruffle assembly (GO:1900027)	ruffle membrane (GO:0032587)	phosphatase binding (GO:0019902)|phosphatidylinositol binding (GO:0035091)			large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)		AGTCTGATACCTAAAGTGTAG	0.388																																					.		.											.	SH3YL1	91	0			c.292-1G>A						.						76.0	74.0	75.0					2																	234273		1826	4078	5904	SO:0001630	splice_region_variant	26751	exon6			TGATACCTAAAGT		CCDS42646.1, CCDS42646.2, CCDS54332.1, CCDS62841.1	2p25.3	2013-10-18	2013-10-18		ENSG00000035115	ENSG00000035115			29546	protein-coding gene	gene with protein product			"""SH3 domain containing, Ysc84-like 1 (S. cerevisiae)"""			21624956	Standard	NM_001282687		Approved	Ray, DKFZP586F1318	uc002qvx.3	Q96HL8	OTTHUMG00000151359	ENST00000405430.1:c.292-1G>A	2.37:g.234273C>T		63.0	0.0		83.0	17.0	NM_001159597	A8K8E7|B7WNJ4|B7WPL6|Q8NEL2|Q9H5X4|Q9Y3V5	Splice_Site	SNP	ENST00000405430.1	37		.	.	.	.	.	.	.	.	.	.	C	10.45	1.354440	0.24512	.	.	ENSG00000035115	ENST00000415006;ENST00000403712;ENST00000403657;ENST00000405430;ENST00000356150;ENST00000403658;ENST00000451005;ENST00000431160;ENST00000454318	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.809	0.78543	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SH3YL1	224273	1.000000	0.71417	0.991000	0.47740	0.048000	0.14542	7.318000	0.79029	2.804000	0.96469	0.557000	0.71058	.	.		0.388	SH3YL1-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322352.1	NM_015677	Intron
SIK1	150094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44837443	44837443	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr21:44837443C>A	ENST00000270162.6	-	13	2088	c.1956G>T	c.(1954-1956)gaG>gaT	p.E652D		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	652					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	CTAGCACCTCCTCCAGCAGGC	0.716																																					p.E652D		.											.	SIK1	346	0			c.G1956T						.						8.0	10.0	9.0					21																	44837443		2068	4045	6113	SO:0001583	missense	150094	exon13			CACCTCCTCCAGC	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1956G>T	21.37:g.44837443C>A	ENSP00000270162:p.Glu652Asp	65.0	0.0		80.0	20.0	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	ENST00000270162.6	37	CCDS33575.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679536	0.47886	.	.	ENSG00000142178	ENST00000270162	T	0.75477	-0.94	4.22	-2.68	0.06041	.	0.000000	0.85682	D	0.000000	T	0.75744	0.3891	L	0.36672	1.1	0.36851	D	0.887874	D	0.76494	0.999	D	0.76071	0.987	T	0.75263	-0.3379	10	0.59425	D	0.04	.	11.7196	0.51675	0.0:0.3652:0.0:0.6348	.	652	P57059	SIK1_HUMAN	D	652	ENSP00000270162:E652D	ENSP00000270162:E652D	E	-	3	2	SIK1	43661871	0.956000	0.32656	0.936000	0.37596	0.660000	0.38997	0.033000	0.13754	-0.724000	0.04908	-0.793000	0.03317	GAG	.		0.716	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
SKOR1	390598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	68126112	68126112	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr15:68126112A>C	ENST00000380035.2	+	9	2894	c.2836A>C	c.(2836-2838)Aag>Cag	p.K946Q	SKOR1_ENST00000554240.1_Missense_Mutation_p.K907Q|SKOR1_ENST00000341418.5_Missense_Mutation_p.K849Q|SKOR1_ENST00000554054.1_Missense_Mutation_p.K918Q|SKOR1_ENST00000389002.1_Missense_Mutation_p.K902Q|RP11-34F13.2_ENST00000502156.1_lincRNA|RP11-34F13.3_ENST00000558889.1_RNA			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	946					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						TTTCTCCTGCAAGATGCTGAC	0.677											OREG0023216	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K849Q		.											.	SKOR1	90	0			c.A2545C						.						90.0	84.0	86.0					15																	68126112		2200	4298	6498	SO:0001583	missense	390598	exon15			TCCTGCAAGATGC		CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.2836A>C	15.37:g.68126112A>C	ENSP00000369374:p.Lys946Gln	57.0	0.0	1104	69.0	17.0	NM_001258024	A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	ENST00000380035.2	37		.	.	.	.	.	.	.	.	.	.	A	31	5.080584	0.94050	.	.	ENSG00000188779	ENST00000341418;ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37	5.32	5.32	0.75619	.	0.057165	0.64402	D	0.000002	T	0.59998	0.2235	N	0.24115	0.695	0.45194	D	0.998206	D	0.69078	0.997	D	0.80764	0.994	T	0.65162	-0.6235	10	0.72032	D	0.01	-24.1734	15.2538	0.73568	1.0:0.0:0.0:0.0	.	902	P84550-3	.	Q	849;907;918;946;902	ENSP00000343200:K849Q;ENSP00000451193:K907Q;ENSP00000452361:K918Q;ENSP00000369374:K946Q;ENSP00000373654:K902Q	ENSP00000343200:K849Q	K	+	1	0	SKOR1	65913166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.696000	0.91302	2.137000	0.66172	0.459000	0.35465	AAG	.		0.677	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000410832.1	NM_001031807	
SLC25A19	60386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73273550	73273550	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr17:73273550G>C	ENST00000402418.3	-	5	1567	c.658C>G	c.(658-660)Ctg>Gtg	p.L220V	SLC25A19_ENST00000580994.1_Missense_Mutation_p.L220V|SLC25A19_ENST00000320362.3_Missense_Mutation_p.L220V|SLC25A19_ENST00000375261.4_Missense_Mutation_p.L163V|SLC25A19_ENST00000442286.2_Missense_Mutation_p.L220V|SLC25A19_ENST00000416858.2_Missense_Mutation_p.L220V			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19	220					deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			CCACAAAGCAGGTTTTGGAGG	0.512																																					p.L220V		.											.	SLC25A19	91	0			c.C658G						.						83.0	75.0	78.0					17																	73273550		2203	4300	6503	SO:0001583	missense	60386	exon6			AAAGCAGGTTTTG		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.658C>G	17.37:g.73273550G>C	ENSP00000385312:p.Leu220Val	66.0	0.0		59.0	20.0	NM_001126122	E9PF74|Q6V9R7	Missense_Mutation	SNP	ENST00000402418.3	37	CCDS11720.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031943	0.54790	.	.	ENSG00000125454	ENST00000416858;ENST00000442286;ENST00000320362;ENST00000402418;ENST00000375261	D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5	5.35	2.3	0.28687	Mitochondrial carrier domain (2);	0.067029	0.64402	D	0.000011	D	0.82435	0.5036	L	0.45581	1.43	0.45930	D	0.998765	D;P	0.61697	0.99;0.935	P;P	0.62014	0.897;0.513	T	0.81187	-0.1047	10	0.62326	D	0.03	-13.3282	9.0336	0.36273	0.3003:0.0:0.6997:0.0	.	163;220	E9PF74;Q9HC21	.;TPC_HUMAN	V	220;220;220;220;163	ENSP00000397818:L220V;ENSP00000402202:L220V;ENSP00000319574:L220V;ENSP00000385312:L220V;ENSP00000364410:L163V	ENSP00000319574:L220V	L	-	1	2	SLC25A19	70785145	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.657000	0.61490	0.648000	0.30732	-0.157000	0.13467	CTG	.		0.512	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447282.1	NM_021734	
SLC26A7	115111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	92330525	92330525	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr8:92330525G>T	ENST00000276609.3	+	5	798	c.559G>T	c.(559-561)Gcc>Tcc	p.A187S	SLC26A7_ENST00000523719.1_Missense_Mutation_p.A187S|SLC26A7_ENST00000309536.2_Missense_Mutation_p.A187S	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			AACTGGGGCTGCCACCCATGT	0.473																																					p.A187S		.											.	SLC26A7	92	0			c.G559T						.						127.0	122.0	123.0					8																	92330525		2203	4300	6503	SO:0001583	missense	115111	exon5			GGGGCTGCCACCC	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.559G>T	8.37:g.92330525G>T	ENSP00000276609:p.Ala187Ser	74.0	0.0		176.0	22.0	NM_134266		Missense_Mutation	SNP	ENST00000276609.3	37	CCDS6254.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553871	0.65425	.	.	ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536	D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99	5.95	5.95	0.96441	Sulphate transporter (1);	0.000000	0.64402	D	0.000001	D	0.97353	0.9134	L	0.47716	1.5	0.47407	D	0.99941	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.96391	0.9289	10	0.35671	T	0.21	.	20.3921	0.98947	0.0:0.0:1.0:0.0	.	187;187	Q8TE54-2;Q8TE54	.;S26A7_HUMAN	S	187	ENSP00000428881:A187S;ENSP00000428849:A187S;ENSP00000276609:A187S;ENSP00000309504:A187S	ENSP00000276609:A187S	A	+	1	0	SLC26A7	92399701	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.408000	0.73285	2.822000	0.97130	0.650000	0.86243	GCC	.		0.473	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
SLC38A1	81539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	46633498	46633498	+	Missense_Mutation	SNP	T	T	C	rs375543520		TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr12:46633498T>C	ENST00000398637.5	-	3	780	c.86A>G	c.(85-87)aAt>aGt	p.N29S	SLC38A1_ENST00000439706.1_Missense_Mutation_p.N29S|SLC38A1_ENST00000552197.1_Missense_Mutation_p.N29S|SLC38A1_ENST00000546893.1_Missense_Mutation_p.N29S|SLC38A1_ENST00000549049.1_Missense_Mutation_p.N29S|SLC38A1_ENST00000549633.1_Intron	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	29					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			GGTGAAATCATTGGAGTCATT	0.383																																					p.N29S		.											.	SLC38A1	518	0			c.A86G						.	T	SER/ASN,SER/ASN	1,3765		0,1,1882	168.0	156.0	160.0		86,86	4.9	1.0	12		160	0,8254		0,0,4127	no	missense,missense	SLC38A1	NM_001077484.1,NM_030674.3	46,46	0,1,6009	CC,CT,TT		0.0,0.0266,0.0083	possibly-damaging,possibly-damaging	29/488,29/488	46633498	1,12019	1883	4127	6010	SO:0001583	missense	81539	exon3			AAATCATTGGAGT	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.86A>G	12.37:g.46633498T>C	ENSP00000381634:p.Asn29Ser	96.0	0.0		108.0	20.0	NM_030674	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	37	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.579486	0.46006	2.66E-4	0.0	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197;ENST00000550173	T;T;T;T;T	0.07327	3.38;3.38;3.38;3.38;3.2	4.93	4.93	0.64822	.	0.000000	0.56097	D	0.000035	T	0.08179	0.0204	N	0.08118	0	0.39643	D	0.970346	D;P	0.58268	0.982;0.882	P;B	0.54889	0.763;0.332	T	0.44034	-0.9354	10	0.09084	T	0.74	-23.5277	14.896	0.70644	0.0:0.0:0.0:1.0	.	29;29	F8VX04;Q9H2H9	.;S38A1_HUMAN	S	29	ENSP00000449607:N29S;ENSP00000398142:N29S;ENSP00000381634:N29S;ENSP00000447853:N29S;ENSP00000449756:N29S	ENSP00000381634:N29S	N	-	2	0	SLC38A1	44919765	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.839000	0.62810	1.975000	0.57531	0.477000	0.44152	AAT	.		0.383	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
SLC6A17	388662	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	110714799	110714799	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:110714799T>A	ENST00000331565.4	+	3	889	c.404T>A	c.(403-405)aTa>aAa	p.I135K	RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	135					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TGGCACTATATATGTCCCCGC	0.632																																					p.I135K		.											.	SLC6A17	92	0			c.T404A						.						39.0	32.0	34.0					1																	110714799		2202	4299	6501	SO:0001583	missense	388662	exon3			ACTATATATGTCC		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.404T>A	1.37:g.110714799T>A	ENSP00000330199:p.Ile135Lys	45.0	0.0		25.0	4.0	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	.	.	.	.	.	.	.	.	.	.	T	32	5.113466	0.94339	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.79749	-1.3	5.19	5.19	0.71726	.	0.173034	0.50627	D	0.000107	D	0.91492	0.7314	H	0.98111	4.15	0.58432	D	0.999992	P	0.50943	0.94	P	0.58928	0.848	D	0.94383	0.7606	10	0.87932	D	0	.	15.03	0.71698	0.0:0.0:0.0:1.0	.	135	Q9H1V8	S6A17_HUMAN	K	135	ENSP00000330199:I135K	ENSP00000330199:I135K	I	+	2	0	SLC6A17	110516322	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	8.040000	0.89188	1.945000	0.56424	0.477000	0.44152	ATA	.		0.632	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
SMTN	6525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31484509	31484509	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr22:31484509C>T	ENST00000347557.2	+	4	429	c.211C>T	c.(211-213)Cgg>Tgg	p.R71W	SMTN_ENST00000358743.1_Missense_Mutation_p.R71W|SMTN_ENST00000475548.1_3'UTR|SMTN_ENST00000333137.7_Missense_Mutation_p.R71W	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	71					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						CTCTCAGCAGCGGGAAGCTGA	0.617																																					p.R127W		.											.	SMTN	154	0			c.C379T						.						68.0	74.0	72.0					22																	31484509		2203	4300	6503	SO:0001583	missense	6525	exon3			CAGCAGCGGGAAG	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.211C>T	22.37:g.31484509C>T	ENSP00000328635:p.Arg71Trp	73.0	0.0		103.0	19.0	NM_001207018	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	CCDS13886.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.85|17.85	3.491066|3.491066	0.64074|0.64074	.|.	.|.	ENSG00000183963|ENSG00000183963	ENST00000438223|ENST00000426927;ENST00000440425;ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000431481	.|T;T;T;T;T;T	.|0.49139	.|0.79;0.84;0.88;0.88;0.88;0.88	4.79|4.79	2.61|2.61	0.31194|0.31194	.|.	.|0.249386	.|0.20992	.|N	.|0.082011	T|T	0.43612|0.43612	0.1255|0.1255	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.71674	.|0.998;0.998;0.998;0.995;0.998;0.994	.|P;P;P;P;P;P	.|0.60886	.|0.88;0.745;0.817;0.817;0.745;0.629	T|T	0.50558|0.50558	-0.8814|-0.8814	5|10	.|0.87932	.|D	.|0	-9.7473|-9.7473	12.6639|12.6639	0.56830|0.56830	0.435:0.565:0.0:0.0|0.435:0.565:0.0:0.0	.|.	.|127;125;63;71;71;71	.|E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.|.;.;.;.;SMTN_HUMAN;.	V|W	125|125;125;71;71;71;71;63;63	.|ENSP00000399432:R125W;ENSP00000401341:R125W;ENSP00000351593:R71W;ENSP00000328635:R71W;ENSP00000329532:R71W;ENSP00000394637:R63W	.|ENSP00000329393:R71W	A|R	+|+	2|1	0|2	SMTN|SMTN	29814509|29814509	0.974000|0.974000	0.33945|0.33945	0.994000|0.994000	0.49952|0.49952	0.961000|0.961000	0.63080|0.63080	0.254000|0.254000	0.18314|0.18314	0.516000|0.516000	0.28340|0.28340	-0.182000|-0.182000	0.12963|0.12963	GCG|CGG	.		0.617	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
SMYD1	150572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	88396229	88396229	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr2:88396229T>A	ENST00000419482.2	+	6	899	c.814T>A	c.(814-816)Ttt>Att	p.F272I	SMYD1_ENST00000444564.2_Missense_Mutation_p.F259I|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	272	S-adenosyl-L-methionine binding. {ECO:0000250}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GCAGTACTACTTTGACTGCAC	0.498																																					p.F272I		.											.	SMYD1	229	0			c.T814A						.						107.0	98.0	101.0					2																	88396229		2203	4300	6503	SO:0001583	missense	150572	exon6			TACTACTTTGACT	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.814T>A	2.37:g.88396229T>A	ENSP00000393453:p.Phe272Ile	132.0	0.0		119.0	20.0	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.439165	0.63067	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.81247	-1.47;-0.07	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.87366	0.6159	M	0.79475	2.455	0.80722	D	1	D	0.62365	0.991	P	0.56398	0.797	D	0.89151	0.3523	10	0.87932	D	0	-9.7348	15.002	0.71479	0.0:0.0:0.0:1.0	.	272	Q8NB12	SMYD1_HUMAN	I	272;259;93	ENSP00000393453:F272I;ENSP00000407888:F259I	ENSP00000295833:F93I	F	+	1	0	SMYD1	88177344	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	7.639000	0.83342	2.126000	0.65437	0.533000	0.62120	TTT	.		0.498	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
SPTBN4	57731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41021261	41021261	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:41021261G>A	ENST00000352632.3	+	15	2895	c.2809G>A	c.(2809-2811)Gtt>Att	p.V937I	SPTBN4_ENST00000598249.1_Missense_Mutation_p.V937I|SPTBN4_ENST00000344104.3_Missense_Mutation_p.V937I|SPTBN4_ENST00000595535.1_Missense_Mutation_p.V937I|SPTBN4_ENST00000338932.3_Missense_Mutation_p.V937I			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	937					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.V937I(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GATGGGCCGCGTTCTGGACGT	0.577																																					p.V937I		.											.	SPTBN4	94	1	Substitution - Missense(1)	endometrium(1)	c.G2809A						.						55.0	41.0	46.0					19																	41021261		2203	4300	6503	SO:0001583	missense	57731	exon15			GGCCGCGTTCTGG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2809G>A	19.37:g.41021261G>A	ENSP00000263373:p.Val937Ile	64.0	0.0		105.0	20.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	37	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613249	0.28712	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.54675	0.56;0.56;0.56	4.34	4.34	0.51931	.	0.204155	0.31257	N	0.007974	T	0.40094	0.1103	L	0.31157	0.91	0.80722	D	1	B;P	0.50528	0.268;0.936	B;P	0.44860	0.015;0.462	T	0.10543	-1.0625	10	0.20046	T	0.44	.	10.1124	0.42570	0.0969:0.0:0.9031:0.0	.	937;937	Q9H254;Q71S06	SPTN4_HUMAN;.	I	937	ENSP00000263373:V937I;ENSP00000340345:V937I;ENSP00000340741:V937I	ENSP00000340345:V937I	V	+	1	0	SPTBN4	45713101	0.726000	0.28059	0.978000	0.43139	0.951000	0.60555	2.116000	0.41930	2.256000	0.74724	0.491000	0.48974	GTT	.		0.577	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
SSC4D	136853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	76023205	76023205	+	Silent	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr7:76023205G>C	ENST00000275560.3	-	8	1310	c.963C>G	c.(961-963)ccC>ccG	p.P321P	SRCRB4D_ENST00000492979.2_5'Flank	NM_080744.1	NP_542782.1														autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						GGGAAGGCTGGGGGCCAACTC	0.662																																					p.P321P		.											.	SRCRB4D	91	0			c.C963G						.						35.0	34.0	35.0					7																	76023205		2203	4298	6501	SO:0001819	synonymous_variant	136853	exon8			AGGCTGGGGGCCA																												ENST00000275560.3:c.963C>G	7.37:g.76023205G>C		117.0	0.0		205.0	37.0	NM_080744		Silent	SNP	ENST00000275560.3	37	CCDS5585.1																																																																																			.		0.662	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253001.3		
SRRM2	23524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2812757	2812757	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr16:2812757C>T	ENST00000301740.8	+	11	2777	c.2228C>T	c.(2227-2229)tCc>tTc	p.S743F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	743	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGAAGCAGGTCCAATTCAAGC	0.463																																					p.S743F		.											.	SRRM2	93	0			c.C2228T						.						90.0	94.0	92.0					16																	2812757		2198	4300	6498	SO:0001583	missense	23524	exon11			GCAGGTCCAATTC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2228C>T	16.37:g.2812757C>T	ENSP00000301740:p.Ser743Phe	92.0	0.0		103.0	25.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	6.676	0.493295	0.12702	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.29655	1.56	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000015	T	0.38983	0.1061	L	0.27053	0.805	0.39252	D	0.964056	D	0.65815	0.995	P	0.62014	0.897	T	0.30446	-0.9978	10	0.87932	D	0	-8.1768	12.4919	0.55905	0.1669:0.8331:0.0:0.0	.	743	Q9UQ35	SRRM2_HUMAN	F	743;743;708	ENSP00000301740:S743F	ENSP00000301740:S743F	S	+	2	0	SRRM2	2752758	0.994000	0.37717	1.000000	0.80357	0.728000	0.41692	3.406000	0.52637	2.746000	0.94184	0.563000	0.77884	TCC	.		0.463	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
TCEA1	6917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	54882968	54882968	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr8:54882968C>T	ENST00000521604.2	-	9	1284	c.881G>A	c.(880-882)tGt>tAt	p.C294Y	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000396401.3_Missense_Mutation_p.C273Y|TCEA1_ENST00000522635.1_Missense_Mutation_p.C110Y	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	294					DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			TCGATTTCCACATTCATTACA	0.333			T	PLAG1	salivary adenoma																																p.C294Y		.		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	.	TCEA1	661	0			c.G881A						.						87.0	80.0	82.0					8																	54882968		1850	4083	5933	SO:0001583	missense	6917	exon9			TTTCCACATTCAT	X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.881G>A	8.37:g.54882968C>T	ENSP00000428426:p.Cys294Tyr	236.0	0.0		397.0	56.0	NM_006756	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	ENST00000521604.2	37	CCDS47858.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511255	0.85389	.	.	ENSG00000187735	ENST00000396401;ENST00000521604;ENST00000522635	.	.	.	4.9	4.9	0.64082	Zinc finger, TFIIS-type (4);	0.000000	0.85682	D	0.000000	D	0.92159	0.7514	H	0.99842	4.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96044	0.9026	9	0.87932	D	0	-13.4066	18.4641	0.90749	0.0:1.0:0.0:0.0	.	110;273;294	B7Z4S1;P23193-2;P23193	.;.;TCEA1_HUMAN	Y	273;294;110	.	ENSP00000395483:C273Y	C	-	2	0	TCEA1	55045521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.442000	0.82660	0.591000	0.81541	TGT	.		0.333	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377975.2	NM_006756	
THEMIS	387357	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	128134892	128134892	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr6:128134892T>A	ENST00000368248.2	-	4	1042	c.894A>T	c.(892-894)caA>caT	p.Q298H	THEMIS_ENST00000537166.1_Missense_Mutation_p.Q263H|THEMIS_ENST00000543064.1_Missense_Mutation_p.Q298H|THEMIS_ENST00000368250.1_Missense_Mutation_p.Q219H	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	298	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						GTAAAATGCTTTGGGGCAGGT	0.393																																					p.Q298H		.											.	THEMIS	94	0			c.A894T						.						114.0	120.0	118.0					6																	128134892		2203	4300	6503	SO:0001583	missense	387357	exon4			AATGCTTTGGGGC	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.894A>T	6.37:g.128134892T>A	ENSP00000357231:p.Gln298His	120.0	0.0		103.0	24.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.776639	0.00640	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166;ENST00000434358	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	5.59	2.99	0.34606	.	1.081190	0.06909	N	0.807252	T	0.03178	0.0093	L	0.36672	1.1	0.09310	N	1	P;B	0.37573	0.6;0.342	B;B	0.35607	0.206;0.141	T	0.40831	-0.9542	10	0.16420	T	0.52	0.8118	5.3567	0.16065	0.2843:0.0:0.3463:0.3695	.	298;298	F5H1J9;Q8N1K5	.;THMS1_HUMAN	H	219;298;298;263;66	ENSP00000357233:Q219H;ENSP00000439594:Q298H;ENSP00000357231:Q298H;ENSP00000439863:Q263H;ENSP00000387740:Q66H	ENSP00000357231:Q298H	Q	-	3	2	THEMIS	128176585	0.111000	0.22076	0.140000	0.22221	0.053000	0.15095	0.516000	0.22817	0.910000	0.36722	0.374000	0.22700	CAA	.		0.393	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
TMC4	147798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54672012	54672012	+	Silent	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:54672012G>A	ENST00000376591.4	-	5	831	c.700C>T	c.(700-702)Ctg>Ttg	p.L234L	TMC4_ENST00000301187.4_Silent_p.L228L|TMC4_ENST00000476013.2_5'UTR	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	234					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GACCATTCCAGGTAACCCTGT	0.662											OREG0025670	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L234L		.											.	TMC4	91	0			c.C700T						.						13.0	12.0	12.0					19																	54672012		2144	4204	6348	SO:0001819	synonymous_variant	147798	exon5			ATTCCAGGTAACC	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.700C>T	19.37:g.54672012G>A		136.0	0.0	1002	130.0	38.0	NM_001145303	Q7Z5M3|Q8N5E4|Q8TBS7	Silent	SNP	ENST00000376591.4	37	CCDS46174.1																																																																																			.		0.662	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000156164.2		
TPRN	286262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	140086995	140086995	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr9:140086995G>A	ENST00000409012.4	-	2	1960	c.1874C>T	c.(1873-1875)tCa>tTa	p.S625L	TPRN_ENST00000541945.1_5'Flank|TPRN_ENST00000321773.2_Missense_Mutation_p.S564L	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	625	Glu-rich.				sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						CTTCTCCTCTGAGCCGGATCc	0.627																																					p.S625L		.											.	TPRN	90	0			c.C1874T						.						46.0	36.0	39.0					9																	140086995		2200	4299	6499	SO:0001583	missense	286262	exon2			TCCTCTGAGCCGG	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1874C>T	9.37:g.140086995G>A	ENSP00000387100:p.Ser625Leu	65.0	0.0		59.0	6.0	NM_001128228	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	37	CCDS56594.1	.	.	.	.	.	.	.	.	.	.	G	7.993	0.753724	0.15778	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	4.41	1.34	0.21922	.	3.145700	0.01400	N	0.013548	T	0.20700	0.0498	N	0.08118	0	0.09310	N	1	B	0.17038	0.02	B	0.09377	0.004	T	0.14504	-1.0470	9	0.30854	T	0.27	1.9806	5.6391	0.17554	0.3917:0.0:0.6083:0.0	.	625	Q4KMQ1	TPRN_HUMAN	L	423;625;564	.	ENSP00000313704:S564L	S	-	2	0	TPRN	139206816	0.001000	0.12720	0.003000	0.11579	0.438000	0.31896	1.093000	0.30939	0.081000	0.16988	0.561000	0.74099	TCA	.		0.627	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691	
TTI1	9675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36642105	36642105	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:36642105T>A	ENST00000373448.2	-	3	352	c.114A>T	c.(112-114)caA>caT	p.Q38H	TTI1_ENST00000449821.1_Missense_Mutation_p.Q38H|TTI1_ENST00000487362.1_5'UTR|TTI1_ENST00000373447.3_Missense_Mutation_p.Q38H	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	38					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CACTCACAGCTTGTAGTCGTG	0.517																																					p.Q38H		.											.	TTI1	94	0			c.A114T						.						142.0	117.0	126.0					20																	36642105		2203	4300	6503	SO:0001583	missense	9675	exon3			CACAGCTTGTAGT	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.114A>T	20.37:g.36642105T>A	ENSP00000362547:p.Gln38His	109.0	0.0		188.0	55.0	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.336970	0.24253	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.65732	-0.17;-0.17;-0.17	5.33	-2.22	0.06952	Armadillo-type fold (1);	0.726659	0.14318	N	0.327231	T	0.41166	0.1147	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22661	-1.0210	10	0.45353	T	0.12	-17.3632	1.0147	0.01505	0.1797:0.286:0.1671:0.3671	.	38	O43156	TTI1_HUMAN	H	38	ENSP00000362547:Q38H;ENSP00000362546:Q38H;ENSP00000407270:Q38H	ENSP00000362546:Q38H	Q	-	3	2	TTI1	36075519	0.000000	0.05858	0.001000	0.08648	0.825000	0.46686	-1.608000	0.02068	-0.060000	0.13132	0.533000	0.62120	CAA	.		0.517	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
UNC79	57578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94088446	94088446	+	Missense_Mutation	SNP	A	A	G	rs375712940		TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr14:94088446A>G	ENST00000393151.2	+	30	4867	c.4867A>G	c.(4867-4869)Ata>Gta	p.I1623V	UNC79_ENST00000555664.1_Missense_Mutation_p.I1623V|UNC79_ENST00000256339.4_Missense_Mutation_p.I1446V|UNC79_ENST00000553484.1_Missense_Mutation_p.I1645V			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1623					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AAAACACTCTATACTCTCAAC	0.488																																					p.I1446V		.											.	.	.	0			c.A4336G						.						82.0	84.0	84.0					14																	94088446		2203	4300	6503	SO:0001583	missense	57578	exon30			CACTCTATACTCT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4867A>G	14.37:g.94088446A>G	ENSP00000376858:p.Ile1623Val	85.0	0.0		103.0	24.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	A	1.422	-0.572497	0.03882	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18338	2.23;2.22;2.22;2.23	5.65	0.156	0.14910	.	0.478254	0.24339	N	0.039391	T	0.08133	0.0203	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40905	-0.9538	10	0.09590	T	0.72	-1.9916	6.7468	0.23466	0.4307:0.1454:0.4239:0.0	.	1645	C9JQL1	.	V	1446;1623;1645;1623;1645	ENSP00000256339:I1446V;ENSP00000450868:I1623V;ENSP00000451360:I1645V;ENSP00000376858:I1623V	ENSP00000256339:I1446V	I	+	1	0	KIAA1409	93158199	0.168000	0.22989	0.000000	0.03702	0.947000	0.59692	0.772000	0.26647	-0.136000	0.11475	0.402000	0.26972	ATA	.		0.488	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
USP48	84196	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	22021689	22021689	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:22021689delT	ENST00000308271.9	-	23	3401	c.2753delA	c.(2752-2754)aagfs	p.K918fs	USP48_ENST00000400301.1_Intron|USP48_ENST00000529637.1_Frame_Shift_Del_p.K930fs|USP48_ENST00000374732.3_Intron	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	918					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATGGGATATCTTTTGCCGCTT	0.388																																					p.K918fs		.											.	USP48	659	0			c.2753delA						.						142.0	135.0	137.0					1																	22021689		2202	4300	6502	SO:0001589	frameshift_variant	84196	exon23			GATATCTTTTGCC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2753delA	1.37:g.22021689delT	ENSP00000309262:p.Lys918fs	50.0	0.0		56.0	16.0	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Frame_Shift_Del	DEL	ENST00000308271.9	37	CCDS30623.1																																																																																			.		0.388	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
USP9X	8239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	41069765	41069765	+	Silent	SNP	T	T	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chrX:41069765T>A	ENST00000324545.8	+	33	5652	c.5019T>A	c.(5017-5019)ctT>ctA	p.L1673L	USP9X_ENST00000378308.2_Silent_p.L1673L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1673	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TTCTTAGGCTTTGGGGTGAGC	0.333																																					p.L1673L	Ovarian(172;1807 2695 35459 49286)	.											.	USP9X	563	0			c.T5019A						.						111.0	105.0	107.0					X																	41069765		2162	4275	6437	SO:0001819	synonymous_variant	8239	exon33			TAGGCTTTGGGGT	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5019T>A	X.37:g.41069765T>A		108.0	0.0		178.0	55.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	CCDS43930.1																																																																																			.		0.333	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
VWCE	220001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	61026465	61026465	+	Silent	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr11:61026465G>C	ENST00000335613.5	-	20	2936	c.2550C>G	c.(2548-2550)acC>acG	p.T850T	VWCE_ENST00000535710.1_Silent_p.T315T	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	850	Pro-rich.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						CTCCTGGAGGGGTCGAAGGCC	0.657																																					p.T850T		.											.	VWCE	91	0			c.C2550G						.						31.0	36.0	34.0					11																	61026465		2203	4299	6502	SO:0001819	synonymous_variant	220001	exon20			TGGAGGGGTCGAA	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2550C>G	11.37:g.61026465G>C		49.0	0.0		50.0	18.0	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1																																																																																			.		0.657	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
CFAP57	149465	hgsc.bcm.edu;bcgsc.ca	37	1	43687775	43687775	+	Splice_Site	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:43687775G>A	ENST00000372492.4	+	15	2665		c.e15-1			NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN												NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTTCTCTCCAGAATGTTGCAA	0.517																																					.		.											.	WDR65	91	0			c.2342-1G>A						.																																			SO:0001630	splice_region_variant	149465	exon15			TCTCCAGAATGTT																												ENST00000372492.4:c.2342-1G>A	1.37:g.43687775G>A		192.0	0.0		182.0	34.0	NM_001195831	A6NKQ3|Q17RI9|Q5TAI0	Splice_Site	SNP	ENST00000372492.4	37		.	.	.	.	.	.	.	.	.	.	G	14.39	2.522205	0.44866	.	.	ENSG00000243710	ENST00000372492	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6532	0.91439	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR65	43460362	1.000000	0.71417	0.996000	0.52242	0.459000	0.32528	8.205000	0.89743	2.494000	0.84150	0.561000	0.74099	.	.		0.517	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		Intron
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168103964	168103964	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr2:168103964C>A	ENST00000409195.1	+	9	6151	c.6062C>A	c.(6061-6063)gCc>gAc	p.A2021D	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.A2021D|XIRP2_ENST00000409273.1_Missense_Mutation_p.A1799D|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1846					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CTTCCAAAAGCCCCCAAAGGC	0.408																																					p.A2021D		.											.	XIRP2	104	0			c.C6062A						.						52.0	49.0	50.0					2																	168103964		1843	4084	5927	SO:0001583	missense	129446	exon9			CAAAAGCCCCCAA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6062C>A	2.37:g.168103964C>A	ENSP00000386840:p.Ala2021Asp	204.0	0.0		287.0	48.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899282	0.33535	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.22539	1.95;1.95;1.95	5.64	2.8	0.32819	.	0.570193	0.18600	N	0.136500	T	0.39937	0.1097	M	0.67953	2.075	0.39365	D	0.965991	D;D;P	0.89917	1.0;1.0;0.928	D;D;P	0.91635	0.973;0.999;0.79	T	0.08659	-1.0711	10	0.29301	T	0.29	-0.7164	10.0376	0.42137	0.0:0.6677:0.2603:0.072	.	1846;1846;1799	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	D	2021;2021;1799	ENSP00000386840:A2021D;ENSP00000295237:A2021D;ENSP00000387255:A1799D	ENSP00000295237:A2021D	A	+	2	0	XIRP2	167812210	.	.	0.907000	0.35723	0.552000	0.35366	.	.	0.305000	0.22832	-0.283000	0.09986	GCC	.		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZNF14	7561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19823308	19823308	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:19823308C>T	ENST00000344099.3	-	4	920	c.782G>A	c.(781-783)aGt>aAt	p.S261N		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TGTGGGACAACTGAAAGCCTT	0.383																																					p.S261N		.											.	ZNF14	517	0			c.G782A						.						55.0	53.0	54.0					19																	19823308		2203	4300	6503	SO:0001583	missense	7561	exon4			GGACAACTGAAAG	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.782G>A	19.37:g.19823308C>T	ENSP00000340514:p.Ser261Asn	66.0	0.0		109.0	26.0	NM_021030	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601996	0.46423	.	.	ENSG00000105708	ENST00000344099	T	0.07567	3.18	1.8	-0.656	0.11436	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05686	0.0149	L	0.39397	1.21	0.09310	N	1	B	0.12630	0.006	B	0.12837	0.008	T	0.43147	-0.9409	9	0.32370	T	0.25	.	0.5821	0.00714	0.2476:0.3311:0.2439:0.1774	.	261	P17017	ZNF14_HUMAN	N	261	ENSP00000340514:S261N	ENSP00000340514:S261N	S	-	2	0	ZNF14	19684308	0.000000	0.05858	0.003000	0.11579	0.942000	0.58702	-4.765000	0.00188	0.068000	0.16574	0.467000	0.42956	AGT	.		0.383	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
ZNF334	55713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45129982	45129982	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr20:45129982G>A	ENST00000347606.4	-	5	2178	c.1996C>T	c.(1996-1998)Cgc>Tgc	p.R666C	ZNF334_ENST00000457685.2_Missense_Mutation_p.R628C|ZNF334_ENST00000593880.1_Missense_Mutation_p.R689C	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	666					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				GATTTGTGGCGAAATGTTTTC	0.358																																					p.R666C		.											.	ZNF334	92	0			c.C1996T						.						146.0	142.0	143.0					20																	45129982		2203	4300	6503	SO:0001583	missense	55713	exon5			TGTGGCGAAATGT	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1996C>T	20.37:g.45129982G>A	ENSP00000255129:p.Arg666Cys	116.0	0.0		221.0	20.0	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797906	0.31777	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.18502	2.21;2.21	3.23	-4.55	0.03441	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11750	0.0286	L	0.48642	1.525	0.19300	N	0.99997	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.06405	0.002;0.002;0.002	T	0.34279	-0.9835	9	0.42905	T	0.14	.	4.0552	0.09813	0.5027:0.0:0.2103:0.287	.	628;666;689	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	C	628;666	ENSP00000402582:R628C;ENSP00000255129:R666C	ENSP00000255129:R666C	R	-	1	0	ZNF334	44563389	0.000000	0.05858	0.316000	0.25252	0.730000	0.41778	-1.703000	0.01900	-0.745000	0.04772	-0.229000	0.12294	CGC	.		0.358	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	31039817	31039817	+	Silent	SNP	C	C	T	rs202189721		TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:31039817C>T	ENST00000355537.3	+	4	3438	c.3291C>T	c.(3289-3291)acC>acT	p.T1097T		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1097					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GTGCATGGACCGGCCACGTGG	0.547																																					p.T1097T		.											.	ZNF536	144	0			c.C3291T						.						81.0	93.0	89.0					19																	31039817		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon4			ATGGACCGGCCAC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3291C>T	19.37:g.31039817C>T		77.0	0.0		108.0	18.0	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																			C|0.999;T|0.001		0.547	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF383	163087	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37734528	37734528	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:37734528G>C	ENST00000589413.1	+	8	1973	c.1390G>C	c.(1390-1392)Gat>Cat	p.D464H	ZNF383_ENST00000352998.3_Missense_Mutation_p.D464H|ZNF383_ENST00000590503.1_Missense_Mutation_p.D464H			Q8NA42	ZN383_HUMAN	zinc finger protein 383	464					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TAGTGGCTCGGATCTCATTCG	0.353																																					p.D464H		.											.	ZNF383	92	0			c.G1390C						.						64.0	68.0	66.0					19																	37734528		2203	4300	6503	SO:0001583	missense	163087	exon5			GGCTCGGATCTCA	AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.1390G>C	19.37:g.37734528G>C	ENSP00000464871:p.Asp464His	104.0	0.0		127.0	18.0	NM_152604	Q6X2C7	Missense_Mutation	SNP	ENST00000589413.1	37	CCDS12501.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.741496	0.30865	.	.	ENSG00000188283	ENST00000352998	T	0.60299	0.2	3.8	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35008	0.0917	N	0.12831	0.26	0.24216	N	0.995456	B	0.02656	0.0	B	0.04013	0.001	T	0.10965	-1.0607	9	0.17832	T	0.49	.	9.0234	0.36213	0.114:0.0:0.886:0.0	.	464	Q8NA42	ZN383_HUMAN	H	464	ENSP00000340132:D464H	ENSP00000340132:D464H	D	+	1	0	ZNF383	42426368	0.000000	0.05858	1.000000	0.80357	0.976000	0.68499	0.512000	0.22755	2.118000	0.64928	0.563000	0.77884	GAT	.		0.353	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458141.1	NM_152604	
ZNF576	79177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44103150	44103150	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr19:44103150G>A	ENST00000336564.4	+	3	407	c.253G>A	c.(253-255)Gcc>Acc	p.A85T	ZNF576_ENST00000528387.1_Missense_Mutation_p.A85T|ZNF576_ENST00000525771.1_Missense_Mutation_p.A85T|SRRM5_ENST00000607544.1_Intron|ZNF576_ENST00000533118.1_Missense_Mutation_p.A85T|IRGQ_ENST00000422989.1_5'Flank|ZNF576_ENST00000529930.1_Missense_Mutation_p.A85T|ZNF576_ENST00000391965.2_Missense_Mutation_p.A85T|SRRM5_ENST00000526798.1_Intron	NM_001145347.1	NP_001138819.1	Q9H609	ZN576_HUMAN	zinc finger protein 576	85					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(1)|prostate(1)	2		Prostate(69;0.0199)				CTCCTCCAAAGCCCTAATCAC	0.647																																					p.A85T		.											.	ZNF576	90	0			c.G253A						.						96.0	104.0	102.0					19																	44103150		2203	4300	6503	SO:0001583	missense	79177	exon3			TCCAAAGCCCTAA	AK026353	CCDS12625.1	19q13.31	2013-09-20			ENSG00000124444	ENSG00000124444		"""Zinc fingers, C2H2-type"""	28357	protein-coding gene	gene with protein product						12477932	Standard	NM_024327		Approved	MGC2508	uc002owz.2	Q9H609	OTTHUMG00000165479	ENST00000336564.4:c.253G>A	19.37:g.44103150G>A	ENSP00000337852:p.Ala85Thr	73.0	0.0		128.0	36.0	NM_001145347	Q9BU03	Missense_Mutation	SNP	ENST00000336564.4	37	CCDS12625.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865404	0.51588	.	.	ENSG00000124444	ENST00000391965;ENST00000525771;ENST00000533118;ENST00000528387;ENST00000529930;ENST00000336564	T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03	3.7	2.67	0.31697	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.089718	0.46145	D	0.000306	T	0.18800	0.0451	N	0.10945	0.07	0.80722	D	1	B	0.15473	0.013	B	0.17979	0.02	T	0.05582	-1.0876	10	0.09843	T	0.71	-7.8118	7.1531	0.25622	0.1222:0.0:0.8778:0.0	.	85	Q9H609	ZN576_HUMAN	T	85	ENSP00000375827:A85T;ENSP00000436182:A85T;ENSP00000435899:A85T;ENSP00000435934:A85T;ENSP00000435463:A85T;ENSP00000337852:A85T	ENSP00000337852:A85T	A	+	1	0	ZNF576	48794990	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	4.096000	0.57734	1.142000	0.42291	0.591000	0.81541	GCC	.		0.647	ZNF576-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384397.1	NM_024327	
PRG4	10216	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	186276282	186276283	+	Missense_Mutation	DNP	CA	CA	TG	rs200031345|rs146673354|rs139523351	byFrequency	TCGA-UB-A7ME-01A-11D-A33K-10	TCGA-UB-A7ME-10A-01D-A33K-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	346d5148-fd4f-46cc-b15c-c87013dce4fb	a6a194d9-7740-4c01-b154-677cb12daba0	g.chr1:186276282_186276283CA>TG	ENST00000445192.2	+	7	1476_1477	c.1431_1432CA>TG	c.(1429-1434)acCAct>acTGct	p.T478A	PRG4_ENST00000367486.3_Missense_Mutation_p.T435A|PRG4_ENST00000367483.4_Missense_Mutation_p.T437A|PRG4_ENST00000367485.4_Missense_Mutation_p.T385A|PRG4_ENST00000367484.3_Intron	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	478	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTGCACCCACCACTCCCAAAGA	0.658																																					p.T478A		.											.	.	.	0			.						.																																			SO:0001583	missense	10216	.			ACCCACCACTCCC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	Exception_encountered	1.37:g.186276282_186276283delinsTG	ENSP00000399679:p.Thr478Ala	46.0	0.0		89.0	18.0	.	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	DNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.		0.658	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
