Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
BMP8A	353500	broad.mit.edu	37	1	39957981	39957981	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:39957981G>C	uc001cdi.2	+	1	664	c.318G>C	c.(316-318)ATG>ATC	p.M106I		NM_181809	NP_861525	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8A precursor	106					cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACCTGGTCATGAGCTTCGTCA	0.711			NA											6	15					0	0	0.001984	0	0
HEYL	26508	broad.mit.edu	37	1	40092420	40092420	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:40092420C>T	uc001cdp.2	-	5	797	c.746G>A	c.(745-747)CGC>CAC	p.R249H	HEYL_uc010oiw.1_Missense_Mutation_p.R221H	NM_014571	NP_055386	Q9NQ87	HEYL_HUMAN	hairy/enhancer-of-split related with YRPW	249	Pro-rich.				multicellular organismal development|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTCTAGGGGGCGGGCCCTCCG	0.692			NA											4	3					0	0	0.000602	0	0
C8A	731	broad.mit.edu	37	1	57349288	57349288	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:57349288G>T	uc001cyo.2	+	6	921	c.789G>T	c.(787-789)GTG>GTT	p.V263V		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	263	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						CTTTATTGGTGGGTGTAGGTG	0.403			NA											19	54					3.62473e-10	4.03281e-10	0.012319	1	0
TGFBR3	7049	broad.mit.edu	37	1	92187533	92187533	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:92187533G>A	uc001doh.2	-	8	1520	c.1054C>T	c.(1054-1056)CAT>TAT	p.H352Y	TGFBR3_uc009wde.2_Missense_Mutation_p.H130Y|TGFBR3_uc010osy.1_Missense_Mutation_p.H310Y|TGFBR3_uc001doi.2_Missense_Mutation_p.H352Y|TGFBR3_uc001doj.2_Missense_Mutation_p.H352Y	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	352	Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AGCCGAAGATGAAATCTATTA	0.388			NA											4	39					0	0	0.009096	0	0
PYGO2	90780	broad.mit.edu	37	1	154931673	154931673	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:154931673G>A	uc001fft.2	-	3	1009	c.803C>T	c.(802-804)TCT>TTT	p.S268F		NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	pygopus homolog 2	268	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding			skin(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AAAAGCAGTAGAAGCAGGTGG	0.647	NSCLC(87;357 1460 1955 21029 23522)		NA											6	27					0	0	0.001984	0	0
SH2D2A	9047	broad.mit.edu	37	1	156779054	156779054	+	Missense_Mutation	SNP	C	C	T	rs147765972		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:156779054C>T	uc001fqd.2	-	7	1083	c.943G>A	c.(943-945)GCC>ACC	p.A315T	SH2D2A_uc001fqc.1_Missense_Mutation_p.A287T|SH2D2A_uc009wsh.2_Missense_Mutation_p.A325T|SH2D2A_uc001fqe.2_Missense_Mutation_p.A297T|SH2D2A_uc010phs.1_Missense_Mutation_p.A315T	NM_003975	NP_003966	Q9NP31	SH22A_HUMAN	SH2 domain protein 2A isoform 2	315	Pro-rich.				angiogenesis|cell differentiation|signal transduction	cytoplasm|soluble fraction	SH3 domain binding|SH3/SH2 adaptor activity				0	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCAAGGGTGGCGGGTAGGCCC	0.597			NA											119	418					0	0	0.01441	0	0
SPTA1	6708	broad.mit.edu	37	1	158590009	158590009	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:158590009G>T	uc001fst.1	-	44	6567	c.6368C>A	c.(6367-6369)ACA>AAA	p.T2123K		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2123	Spectrin 20.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CACCTCCACTGTTAACCAGGT	0.468			NA											85	98					2.22156e-40	3.08448e-40	0.01441	1	0
ADAMTS4	9507	broad.mit.edu	37	1	161166644	161166644	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:161166644C>T	uc001fyt.3	-	2	1088	c.660G>A	c.(658-660)GTG>GTA	p.V220V	ADAMTS4_uc001fyu.2_Silent_p.V220V|NDUFS2_uc001fyv.2_5'Flank	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	220	Peptidase M12B.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCAGTGTCTCCACAAATCTAC	0.537			NA											222	279					0	0	0.01441	0	0
SELP	6403	broad.mit.edu	37	1	169580746	169580746	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:169580746G>T	uc001ggi.3	-	7	1196	c.1131C>A	c.(1129-1131)CCC>CCA	p.P377P	SELP_uc001ggh.2_Silent_p.P212P|SELP_uc009wvr.2_Silent_p.P377P	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	377	Sushi 3.|Extracellular (Potential).				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	AGGTTGGCAAGGGTGCAGACC	0.542			NA											33	155					2.46105e-21	3.0855e-21	0.010818	1	0
PAPPA2	60676	broad.mit.edu	37	1	176526072	176526072	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:176526072G>C	uc001gkz.2	+	2	1778	c.614G>C	c.(613-615)CGG>CCG	p.R205P	PAPPA2_uc001gky.1_Missense_Mutation_p.R205P|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	205					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TGGAAGAGGCGGGCGGAAGAT	0.562			NA											139	141					0	0	0.01441	0	0
CACNA1E	777	broad.mit.edu	37	1	181708376	181708376	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:181708376G>T	uc001gow.2	+	25	3871	c.3706G>T	c.(3706-3708)GCC>TCC	p.A1236S	CACNA1E_uc009wxs.2_Missense_Mutation_p.A1124S|CACNA1E_uc001gox.1_Missense_Mutation_p.A462S|CACNA1E_uc009wxt.2_Missense_Mutation_p.A462S	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1236	III.|Helical; Name=S3 of repeat III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						CGCATTGGTGGCCTTTGCTCT	0.498			NA											146	184					2.23826e-62	3.13356e-62	0.01441	1	0
ZNF648	127665	broad.mit.edu	37	1	182026337	182026337	+	Missense_Mutation	SNP	T	T	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:182026337T>C	uc001goz.2	-	2	1017	c.809A>G	c.(808-810)GAG>GGG	p.E270G		NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN	zinc finger protein 648	270					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GCCGCGCGTCTCCGCGGGGCT	0.756	NSCLC(71;908 1374 5429 20458 35642)		NA											2	13					0	0	0.009096	0	0
PTGS2	5743	broad.mit.edu	37	1	186643668	186643668	+	Silent	SNP	G	G	A	rs139087930		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:186643668G>A	uc001gsb.2	-	10	1769	c.1632C>T	c.(1630-1632)ATC>ATT	p.I544I	PTGS2_uc009wyo.2_Silent_p.I391I	NM_000963	NP_000954	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 precursor	544					cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	CAGTGTTGATGATTTGAAAAC	0.433			NA											46	152					0	0	0.011902	0	0
LRRN2	10446	broad.mit.edu	37	1	204589053	204589053	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:204589053A>G	uc001hbe.1	-	3	456	c.68T>C	c.(67-69)GTA>GCA	p.V23A	MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.V23A|LRRN2_uc009xbf.1_Missense_Mutation_p.V23A|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor	23	Extracellular (Potential).|LRRNT.				cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ATGCCAGGGTACCACGGGCAC	0.647			NA											15	25					0	0	0.003163	0	0
C1orf116	79098	broad.mit.edu	37	1	207200842	207200842	+	Silent	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:207200842T>A	uc001hfd.2	-	2	361	c.102A>T	c.(100-102)GGA>GGT	p.G34G	C1orf116_uc009xcb.1_Intron	NM_023938	NP_076427	Q9BW04	SARG_HUMAN	specifically androgen-regulated protein isoform	34						cytoplasm|plasma membrane	receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Prostate(682;0.19)					TACGTACAGATCCAGAGCGGG	0.512			NA											39	157					0	0	0.005524	0	0
USH2A	7399	broad.mit.edu	37	1	215807951	215807951	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:215807951C>T	uc001hku.1	-	70	15534	c.15147G>A	c.(15145-15147)ATG>ATA	p.M5049I		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	5049	Helical; (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAAGCCCAGCATCGCCATTA	0.463			NA								HNSCC(13;0.011)			42	173					0	0	0.006999	0	0
HLX	3142	broad.mit.edu	37	1	221055574	221055574	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:221055574G>T	uc001hmv.3	+	3	1298	c.841G>T	c.(841-843)GCT>TCT	p.A281S		NM_021958	NP_068777	Q14774	HLX_HUMAN	H2.0-like homeobox	281	Homeobox.				cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				GBM - Glioblastoma multiforme(131;0.00914)		ATGGTCGCGCGCTGTGTTCTC	0.577			NA											35	68					9.17885e-22	1.15943e-21	0.003271	1	0
FMN2	56776	broad.mit.edu	37	1	240421306	240421306	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:240421306A>G	uc010pyd.1	+	7	4352	c.4127A>G	c.(4126-4128)CAT>CGT	p.H1376R	FMN2_uc010pye.1_Missense_Mutation_p.H1380R|FMN2_uc010pyf.1_Missense_Mutation_p.H22R|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1376	FH2.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCTAGCCTTCATTTAGATATG	0.323			NA											18	93					0	0	0.006122	0	0
OR2W3	343171	broad.mit.edu	37	1	248059823	248059823	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:248059823G>T	uc001idp.1	+	3	1204	c.935G>T	c.(934-936)GGA>GTA	p.G312V	OR2W3_uc010pzb.1_Missense_Mutation_p.G312V	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	312	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGAGAGCTAGGAAAGGAGTAA	0.537			NA											40	43					9.85521e-28	1.30368e-27	0.00623	1	0
OR2T4	127074	broad.mit.edu	37	1	248525231	248525231	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr1:248525231C>A	uc001ieh.1	+	1	349	c.349C>A	c.(349-351)CAG>AAG	p.Q117K		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	117	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTCCTGGACCAGGTCATGGG	0.493			NA											202	205					1.51991e-96	2.16394e-96	0.01441	1	0
FAM188A	80013	broad.mit.edu	37	10	15902236	15902236	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:15902236G>A	uc001iod.1	-	1	284	c.63C>T	c.(61-63)CTC>CTT	p.L21L	FAM188A_uc001ioe.1_5'UTR|FAM188A_uc001iof.1_Silent_p.L21L	NM_024948	NP_079224	Q9H8M7	F188A_HUMAN	chromosome 10 open reading frame 97	21					apoptosis	nucleus	calcium ion binding			ovary(1)	1						TGGTGTCCGAGAGACCGGGGC	0.617	Pancreas(159;946 1953 2111 4475 22008)		NA											4	22					0	0	0.009096	0	0
ANKRD30A	91074	broad.mit.edu	37	10	37430689	37430689	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:37430689G>T	uc001iza.1	+	7	795	c.696G>T	c.(694-696)GCG>GCT	p.A232A		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	288						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CACCCTTGGCGGAAAGAACAC	0.428			NA											8	36					0.000978159	0.00100202	0.010729	1	0
TMEM72	643236	broad.mit.edu	37	10	45429161	45429161	+	Missense_Mutation	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:45429161T>A	uc001jbn.2	+	4	483	c.286T>A	c.(286-288)TAC>AAC	p.Y96N	uc001jbk.1_Intron|uc001jbl.2_Intron|TMEM72_uc009xmm.1_5'UTR	NM_001123376	NP_001116848	A0PK05	TMM72_HUMAN	transmembrane protein 72	96	Helical; (Potential).					integral to membrane					0						GTTCCTGGCCTACCTGCTGCT	0.617			NA											17	59					0	0	0.004007	0	0
PCDH15	65217	broad.mit.edu	37	10	55996691	55996691	+	Nonsense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:55996691C>A	uc001jju.1	-	9	1272	c.877G>T	c.(877-879)GAA>TAA	p.E293*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.E298*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.E298*|PCDH15_uc010qht.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.E293*|PCDH15_uc001jjv.1_Nonsense_Mutation_p.E271*|PCDH15_uc010qhv.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.E256*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.E298*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.E293*|PCDH15_uc010qia.1_Nonsense_Mutation_p.E271*|PCDH15_uc010qib.1_Nonsense_Mutation_p.E271*|PCDH15_uc001jjw.2_Nonsense_Mutation_p.E293*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	293	Cadherin 3.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCAGTTCTTCCTGAAAAAAA	0.398			NA								HNSCC(58;0.16)			37	90					4.65686e-17	5.66923e-17	0.003755	1	0
ANK3	288	broad.mit.edu	37	10	61844435	61844435	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:61844435C>T	uc001jky.2	-	32	4191	c.3999G>A	c.(3997-3999)ATG>ATA	p.M1333I	ANK3_uc001jkw.2_Missense_Mutation_p.M467I|ANK3_uc009xpa.2_Missense_Mutation_p.M467I|ANK3_uc001jkx.2_Missense_Mutation_p.M511I|ANK3_uc010qih.1_Missense_Mutation_p.M1334I|ANK3_uc001jkz.3_Missense_Mutation_p.M1327I|ANK3_uc001jla.1_Missense_Mutation_p.M399I|ANK3_uc001jlb.1_Missense_Mutation_p.M851I|ANK3_uc001jkv.2_5'Flank	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	1333					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TGTCATCTGTCATGCAGAAAC	0.373			NA											9	156					0	0	0.004482	0	0
DYDC2	84332	broad.mit.edu	37	10	82126540	82126540	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:82126540C>G	uc001kca.1	+	5	747	c.367C>G	c.(367-369)CCA>GCA	p.P123A	DYDC2_uc001kbz.1_RNA|DYDC2_uc001kcb.1_Missense_Mutation_p.P123A	NM_032372	NP_115748	Q96IM9	DYDC2_HUMAN	DPY30 domain containing 2	123							protein binding				0			Colorectal(32;0.229)			GGAATTCCTGCCAGGTACTTC	0.468			NA											50	130					0	0	0.01441	0	0
CYP17A1	1586	broad.mit.edu	37	10	104594740	104594740	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr10:104594740C>A	uc001kwg.2	-	3	640	c.468G>T	c.(466-468)ATG>ATT	p.M156I		NM_000102	NP_000093	P05093	CP17A_HUMAN	cytochrome P450, family 17	156					androgen biosynthetic process|glucocorticoid biosynthetic process|sex differentiation|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|oxygen binding|steroid 17-alpha-monooxygenase activity				0		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	NADH(DB00157)|Progesterone(DB00396)	GGGTGGCCAGCATATCACACA	0.502			NA									OREG0020487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	40	123					2.87052e-16	3.44462e-16	0.005524	1	0
MUC6	4588	broad.mit.edu	37	11	1018143	1018143	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:1018143C>T	uc001lsw.2	-	31	4709	c.4658G>A	c.(4657-4659)CGC>CAC	p.R1553H		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1553	Pro-rich.|Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTTCTGGTGCGTGTACTAGT	0.562			NA											75	256					0	0	0.01441	0	0
CARS	833	broad.mit.edu	37	11	3041474	3041474	+	Silent	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:3041474C>A	uc001lxh.2	-	10	1067	c.993G>T	c.(991-993)CCG>CCT	p.P331P	CARS_uc001lxe.2_Silent_p.P321P|CARS_uc001lxf.2_Silent_p.P414P|CARS_uc001lxg.2_Silent_p.P331P|CARS_uc010qxo.1_Silent_p.P414P|CARS_uc010qxp.1_Silent_p.P344P	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	331					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ACGGCCAGGACGGTTCTCCGG	0.622	Ovarian(61;932 1157 5961 20446 52152)		NA	T	ALK	ALCL								47	178					2.47907e-22	3.15517e-22	0.01441	1	0
OR52I1	390037	broad.mit.edu	37	11	4615507	4615507	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:4615507C>T	uc010qyi.1	+	1	239	c.239C>T	c.(238-240)TCC>TTC	p.S80F		NM_001005169	NP_001005169	Q8NGK6	O52I1_HUMAN	olfactory receptor, family 52, subfamily I,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;7.98e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGGCCTCCTCCGTGGTACCC	0.502			NA											58	144					0	0	0.01441	0	0
OR52N4	390072	broad.mit.edu	37	11	5776193	5776193	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:5776193A>T	uc001mbu.2	+	1	271	c.223A>T	c.(223-225)ATG>TTG	p.M75L	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005175	NP_001005175	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TGACCTTGTTATGTGCTCTAG	0.458			NA											34	60					0	0	0.003271	0	0
NLRP14	338323	broad.mit.edu	37	11	7064233	7064233	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:7064233G>C	uc001mfb.1	+	4	1299	c.976G>C	c.(976-978)GAG>CAG	p.E326Q		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	326	NACHT.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CCATTATGTAGAGCTACTAGG	0.403			NA											27	121					0	0	0.009535	0	0
OR5B3	441608	broad.mit.edu	37	11	58170746	58170746	+	Nonsense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:58170746A>T	uc010rkf.1	-	1	137	c.137T>A	c.(136-138)TTG>TAG	p.L46*		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	46	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CCAGAATATCAATACAATAAT	0.423			NA											45	96					0	0	0.009718	0	0
JRKL	8690	broad.mit.edu	37	11	96124962	96124962	+	Missense_Mutation	SNP	A	A	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:96124962A>C	uc009ywu.2	+	2	1401	c.1149A>C	c.(1147-1149)AGA>AGC	p.R383S	CCDC82_uc001pfx.3_5'Flank|CCDC82_uc009ywr.2_5'Flank|CCDC82_uc009ywt.1_5'Flank|JRKL_uc001pfy.2_Missense_Mutation_p.R383S	NM_003772	NP_003763	Q9Y4A0	JERKL_HUMAN	jerky homolog-like	383	DDE.				central nervous system development|regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		CCATTAGCAGAGCATGGAAGA	0.408			NA											7	167					0	0	0.00308	0	0
ZC3H12C	85463	broad.mit.edu	37	11	110007729	110007729	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:110007729C>T	uc009yxw.2	+	2	414	c.363C>T	c.(361-363)TGC>TGT	p.C121C	ZC3H12C_uc010rwc.1_Silent_p.C122C|ZC3H12C_uc010rwd.1_Silent_p.C122C|ZC3H12C_uc001pkr.3_Silent_p.C90C|ZC3H12C_uc001pkq.2_Silent_p.C90C	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	121							endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		GACAGCTCTGCAGGTCTCCCT	0.428			NA											10	27					0	0	0.008291	0	0
ABCG4	64137	broad.mit.edu	37	11	119024780	119024780	+	Silent	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:119024780C>A	uc001pvs.2	+	3	619	c.283C>A	c.(283-285)CGG>AGG	p.R95R	ABCG4_uc009zar.2_Silent_p.R95R|ABCG4_uc001pvt.1_RNA	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	95	Cytoplasmic (Potential).|ABC transporter.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		ATTCTGCCGCCGGGAGCTGAT	0.532			NA											41	109					1.96642e-18	2.4471e-18	0.006999	1	0
OR10G9	219870	broad.mit.edu	37	11	123894107	123894107	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:123894107A>T	uc010sad.1	+	1	388	c.388A>T	c.(388-390)AGG>TGG	p.R130W		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTACCCGCTCAGGTACACCAG	0.537			NA											71	122					0	0	0.01441	0	0
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:25398285C>A	uc001rgp.1	-	2	215	c.34G>T	c.(34-36)GGT>TGT	p.G12C	KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			9	25					1.12685e-05	1.2058e-05	0.004482	1	0
ADAMTS20	80070	broad.mit.edu	37	12	43777759	43777759	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:43777759C>T	uc010skx.1	-	30	4474	c.4474G>A	c.(4474-4476)GGA>AGA	p.G1492R		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1492	TSP type-1 12.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TGCTGAACTCCAGAGCCACAG	0.438			NA											16	41					0	0	0.006122	0	0
ARID2	196528	broad.mit.edu	37	12	46244361	46244361	+	Nonsense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:46244361C>T	uc001ros.1	+	15	2455	c.2455C>T	c.(2455-2457)CAA>TAA	p.Q819*	ARID2_uc001ror.2_Nonsense_Mutation_p.Q819*|ARID2_uc009zkg.1_Nonsense_Mutation_p.Q275*|ARID2_uc009zkh.1_Nonsense_Mutation_p.Q446*|ARID2_uc001rou.1_Nonsense_Mutation_p.Q153*	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	819	Gln-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTCACAGGGTCAACAGTTAAT	0.453			NA											18	28					0	0	0.006122	0	0
CALCOCO1	57658	broad.mit.edu	37	12	54109766	54109766	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:54109766C>T	uc001sef.2	-	9	1215	c.1071G>A	c.(1069-1071)CAG>CAA	p.Q357Q	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Silent_p.Q272Q|CALCOCO1_uc010son.1_Silent_p.Q234Q|CALCOCO1_uc001seh.2_Silent_p.Q357Q|CALCOCO1_uc009znd.2_Silent_p.Q357Q|CALCOCO1_uc001seg.2_Silent_p.Q182Q|CALCOCO1_uc010soo.1_Silent_p.Q350Q	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	357					steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						GGGTGGCTTTCTGCTGGCTTG	0.612			NA											29	28					0	0	0.003271	0	0
HSD17B6	8630	broad.mit.edu	37	12	57178691	57178691	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr12:57178691C>G	uc001smg.1	+	4	737	c.627C>G	c.(625-627)TTC>TTG	p.F209L		NM_003725	NP_003716	O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	209					androgen biosynthetic process|androgen catabolic process	early endosome membrane|endoplasmic reticulum|microsome	binding|electron carrier activity|estradiol 17-beta-dehydrogenase activity|retinol dehydrogenase activity|testosterone 17-beta-dehydrogenase (NAD+) activity			upper_aerodigestive_tract(1)|pancreas(1)	2					Succinic acid(DB00139)	CTGGCTACTTCAGAACGGGAA	0.423			NA											68	138					0	0	0.01441	0	0
MIPEP	4285	broad.mit.edu	37	13	24444289	24444289	+	Missense_Mutation	SNP	T	T	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:24444289T>C	uc001uox.3	-	6	749	c.649A>G	c.(649-651)AGT>GGT	p.S217G		NM_005932	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase precursor	217					protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		AGAAATGTACTACTCAAATCC	0.363			NA											20	41					0	0	0.008871	0	0
ATP8A2	51761	broad.mit.edu	37	13	26129181	26129181	+	Nonsense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:26129181C>A	uc001uqk.2	+	13	1380	c.1238C>A	c.(1237-1239)TCA>TAA	p.S413*	ATP8A2_uc010tdi.1_Nonsense_Mutation_p.S373*|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc001uql.1_Nonsense_Mutation_p.S373*	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	373	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GCCAGGACATCAAACCTTAAT	0.428			NA											36	78					1.59361e-14	1.84639e-14	0.006999	1	0
AKAP11	11215	broad.mit.edu	37	13	42876365	42876365	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:42876365G>T	uc001uys.1	+	8	3658	c.3483G>T	c.(3481-3483)GAG>GAT	p.E1161D		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1161					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AAAAAGAAGAGTTCATGTTGA	0.428			NA											33	77					7.63505e-26	1.0021e-25	0.012213	1	0
DCT	1638	broad.mit.edu	37	13	95114416	95114416	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:95114416G>T	uc001vlv.3	-	5	1318	c.891C>A	c.(889-891)ACC>ACA	p.T297T	DCT_uc010afh.2_Silent_p.T297T	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	297	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CATTGCACAAGGTGACCAGGT	0.299			NA											13	63					4.36969e-10	4.82966e-10	0.001855	1	0
MYO16	23026	broad.mit.edu	37	13	109777480	109777480	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:109777480C>A	uc001vqt.1	+	30	3616	c.3490C>A	c.(3490-3492)CGC>AGC	p.R1164S	MYO16_uc010agk.1_Missense_Mutation_p.R1186S|MYO16_uc010tjh.1_Missense_Mutation_p.R676S	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1164	IQ.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ATTTTTAGCACGCCAGCACCT	0.393			NA											10	38					3.86212e-05	4.08073e-05	0.008291	1	0
ADPRHL1	113622	broad.mit.edu	37	13	114107634	114107634	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr13:114107634G>A	uc001vtq.1	-	1	206	c.119C>T	c.(118-120)TCC>TTC	p.S40F		NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1	40					protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			CAGGCCCCCGGAACGTTGCAG	0.597			NA											23	106					0	0	0.00333	0	0
KIF26A	26153	broad.mit.edu	37	14	104642378	104642378	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr14:104642378G>T	uc001yos.3	+	12	3253	c.3253G>T	c.(3253-3255)GCC>TCC	p.A1085S		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1085					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TGAGTTTGACGCCTACACCTC	0.672			NA											5	11					0.000602214	0.000620687	0.000602	1	0
ZNF770	54989	broad.mit.edu	37	15	35274098	35274098	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:35274098C>T	uc001ziw.2	-	3	1849	c.1538G>A	c.(1537-1539)AGA>AAA	p.R513K		NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	513	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		AGCTGACTGTCTAAAAGATTT	0.348			NA											21	54					0	0	0.010504	0	0
ZNF770	54989	broad.mit.edu	37	15	35274816	35274816	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:35274816C>T	uc001ziw.2	-	3	1131	c.820G>A	c.(820-822)GAG>AAG	p.E274K		NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	274					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TCACCAATCTCACCATTTTCA	0.388			NA											10	48					0	0	0.006214	0	0
CASC5	57082	broad.mit.edu	37	15	40917230	40917231	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:40917230_40917231GG>TT	uc010bbs.1	+	11	5007_5008	c.4846_4847GG>TT	c.(4846-4848)GGA>TTA	p.G1616L	CASC5_uc010ucq.1_Missense_Mutation_p.G1440L|CASC5_uc001zme.2_Missense_Mutation_p.G1590L|CASC5_uc010bbt.1_Missense_Mutation_p.G1590L	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1616					acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ACTTGAATTAGGAAATAAGGCA	0.332			NA											15	63					0	0	0.004672	0	0
SPPL2A	84888	broad.mit.edu	37	15	51032016	51032016	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:51032016C>T	uc001zyv.2	-	6	774	c.594G>A	c.(592-594)TTG>TTA	p.L198L		NM_032802	NP_116191	Q8TCT8	PSL2_HUMAN	signal peptide peptidase-like 2A	198						integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		TCACTGCTTTCAAGTTTTCCC	0.323	Melanoma(50;790 1209 4069 22965 33125)		NA											9	29					0	0	0.006214	0	0
TLN2	83660	broad.mit.edu	37	15	63063322	63063322	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:63063322G>A	uc002alb.3	+	39	5356	c.5356G>A	c.(5356-5358)GGA>AGA	p.G1786R	TLN2_uc002alc.3_Missense_Mutation_p.G179R|TLN2_uc002ald.2_Missense_Mutation_p.G179R	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1786					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AGAAGGTGGCGGAAACCCCAA	0.507			NA											3	101					0	0	0.004672	0	0
BNC1	646	broad.mit.edu	37	15	83932641	83932641	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:83932641G>A	uc002bjt.1	-	4	1450	c.1362C>T	c.(1360-1362)CCC>CCT	p.P454P	BNC1_uc010uos.1_Silent_p.P442P	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	454					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						CAGGGTAGCTGGGAGGAGGCC	0.547			NA											40	100					0	0	0.004878	0	0
DCI	1632	broad.mit.edu	37	16	2293439	2293439	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:2293439C>T	uc002cpr.2	-	5	479	c.443G>A	c.(442-444)GGA>GAA	p.G148E	DCI_uc002cps.2_Missense_Mutation_p.G148E	NM_001919	NP_001910	P42126	ECI1_HUMAN	dodecenoyl-Coenzyme A delta isomerase precursor	148					fatty acid beta-oxidation	mitochondrial matrix	dodecenoyl-CoA delta-isomerase activity				0						GGGGCAGGCTCCCTGCAGGGA	0.652			NA											26	100					0	0	0.008361	0	0
C16orf90	646174	broad.mit.edu	37	16	3544576	3544576	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:3544576G>A	uc002cvi.2	-	2	348	c.348C>T	c.(346-348)CTC>CTT	p.L116L		NM_001080524	NP_001073993	A8MZG2	CP090_HUMAN	hypothetical protein LOC646174	106											0						GGGCTGAACAGAGGCTGTTAC	0.672			NA											14	40					0	0	0.014323	0	0
XYLT1	64131	broad.mit.edu	37	16	17202725	17202725	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:17202725C>G	uc002dfa.2	-	12	2792	c.2707G>C	c.(2707-2709)GAG>CAG	p.E903Q		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	903	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						AGCCATCCCTCCAGCGCTGTG	0.667			NA											24	99					0	0	0.00632	0	0
TAOK2	9344	broad.mit.edu	37	16	29997963	29997963	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:29997963C>T	uc002dva.1	+	16	3153	c.2370C>T	c.(2368-2370)GGC>GGT	p.G790G	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TAOK2_uc002dvb.1_Intron|TAOK2_uc002dvc.1_Intron|TAOK2_uc010bzm.1_Silent_p.G797G|TAOK2_uc002dvd.1_Silent_p.G617G	NM_016151	NP_057235	Q9UL54	TAOK2_HUMAN	TAO kinase 2 isoform 2	790					actin cytoskeleton organization|activation of MAPKK activity|apoptosis|cell migration|focal adhesion assembly|positive regulation of JNK cascade|protein targeting to membrane|regulation of cell growth|regulation of cell shape|response to stress	cytoplasmic vesicle membrane|cytoskeleton|dendrite|integral to membrane|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						GAATGCTTGGCGAGGAGGAGG	0.597			NA											55	146					0	0	0.01441	0	0
SALL1	6299	broad.mit.edu	37	16	51173710	51173710	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:51173710G>T	uc010vgs.1	-	2	2454	c.2423C>A	c.(2422-2424)TCT>TAT	p.S808Y	SALL1_uc010vgr.1_Missense_Mutation_p.S711Y|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	808					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ACCTGTGTCAGACTCCATGGA	0.507	GBM(103;1352 1446 1855 4775 8890)		NA											58	162					1.0442e-30	1.41472e-30	0.01441	1	0
COX4I1	1327	broad.mit.edu	37	16	85838571	85838571	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr16:85838571G>A	uc002fje.2	+	3	266	c.102G>A	c.(100-102)TCG>TCA	p.S34S	COX4I1_uc002fjf.2_Silent_p.S34S|COX4I1_uc002fjg.1_Silent_p.S34S|COX4I1_uc010vom.1_5'UTR	NM_001861	NP_001852	P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	34					respiratory electron transport chain	mitochondrial inner membrane|nucleus	cytochrome-c oxidase activity|protein binding			lung(1)	1		Renal(780;0.228)				AAGACTTTTCGCTCCCAGCTT	0.473			NA											29	65					0	0	0.006999	0	0
VPS53	55275	broad.mit.edu	37	17	534814	534814	+	Missense_Mutation	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:534814T>A	uc002frn.2	-	8	810	c.663A>T	c.(661-663)GAA>GAT	p.E221D	VPS53_uc002frk.2_Translation_Start_Site|VPS53_uc010cjo.1_Missense_Mutation_p.E221D|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.E192D|VPS53_uc002fro.2_Missense_Mutation_p.E23D|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2	221					protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		AAGGAAACGCTTCTTCAAAAT	0.498			NA											30	74					0	0	0.013726	0	0
SLFN12	55106	broad.mit.edu	37	17	33749265	33749265	+	Missense_Mutation	SNP	T	T	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:33749265T>A	uc002hji.3	-	2	1160	c.783A>T	c.(781-783)GAA>GAT	p.E261D	SLFN12_uc002hjj.3_Missense_Mutation_p.E261D|SLFN12_uc010cts.2_Missense_Mutation_p.E261D	NM_018042	NP_060512	Q8IYM2	SLN12_HUMAN	schlafen family member 12	261							ATP binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CGATTTCTCTTTCTAAGTCAT	0.338			NA											29	73					0	0	0.013726	0	0
MED1	5469	broad.mit.edu	37	17	37564758	37564758	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:37564758G>A	uc002hrv.3	-	17	3928	c.3716C>T	c.(3715-3717)TCA>TTA	p.S1239L	MED1_uc010wee.1_Missense_Mutation_p.S1067L|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1239	Ser-rich.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GCCAGAGCTTGAACTAGTTCC	0.502	Pancreas(21;279 768 2492 4877 24026)		NA								HNSCC(31;0.082)			37	79					0	0	0.003755	0	0
TMEM99	147184	broad.mit.edu	37	17	38991095	38991095	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:38991095C>T	uc002hvj.1	+	3	634	c.327C>T	c.(325-327)TTC>TTT	p.F109F		NM_145274	NP_660317	Q8N816	TMM99_HUMAN	transmembrane protein 99 precursor	109	Helical; (Potential).					integral to membrane				skin(1)	1		Breast(137;0.000301)				GGTTGCTCTTCAACAACTGGA	0.493			NA											54	106					0	0	0.01441	0	0
MMD	23531	broad.mit.edu	37	17	53485149	53485149	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:53485149C>G	uc002iui.2	-	4	587	c.302G>C	c.(301-303)AGA>ACA	p.R101T		NM_012329	NP_036461	Q15546	PAQRB_HUMAN	monocyte to macrophage	101	Cytoplasmic (Potential).				cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0						GATAACCATTCTATCACACAT	0.383			NA											5	69					0	0	0.001984	0	0
C17orf70	80233	broad.mit.edu	37	17	79517503	79517503	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr17:79517503C>T	uc002kaq.2	-	3	1072	c.1017G>A	c.(1015-1017)CGG>CGA	p.R339R	C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Silent_p.R188R	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	339					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GGCAGTACTCCCGCAGCTCGG	0.657			NA											32	73					0	0	0.005524	0	0
RAB31	11031	broad.mit.edu	37	18	9814045	9814045	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr18:9814045G>A	uc002kog.2	+	4	405	c.230G>A	c.(229-231)CGA>CAA	p.R77Q		NM_006868	NP_006859	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	76					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity	p.R77*(1)		skin(1)	1						ATGTACTATCGAGGCTCAGCT	0.378			NA											5	5					0	0	0.001168	0	0
STK11	6794	broad.mit.edu	37	19	1220717	1220717	+	Splice_Site	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:1220717G>T	uc002lrl.1	+	5	1849	c.734_splice	c.e5+1	p.L245_splice		NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11						anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.0?(19)|p.?(4)		lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTCACCCTGTAAGTGCCCC	0.711			14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			25	19					9.39395e-14	1.08095e-13	0.00632	1	0
PLIN4	729359	broad.mit.edu	37	19	4512261	4512261	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:4512261C>G	uc002mar.1	-	3	1669	c.1669G>C	c.(1669-1671)GGG>CGG	p.G557R	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	557	27 X 33 AA approximate tandem repeat.|15.					lipid particle|plasma membrane					0						CCCGTGAGCCCAGTGGACATC	0.612			NA											89	193					0	0	0.01441	0	0
OR1M1	125963	broad.mit.edu	37	19	9203982	9203982	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:9203982C>A	uc010xkj.1	+	1	62	c.62C>A	c.(61-63)CCA>CAA	p.P21Q		NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						TCAGAAAAGCCAGAGCAGGAG	0.507			NA											53	23					2.47907e-22	3.15517e-22	0.01441	1	0
KEAP1	9817	broad.mit.edu	37	19	10600510	10600510	+	Nonsense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:10600510C>A	uc002moq.1	-	4	1501	c.1345G>T	c.(1345-1347)GAG>TAG	p.E449*	KEAP1_uc002mop.1_Nonsense_Mutation_p.E167*|KEAP1_uc002mor.1_Nonsense_Mutation_p.E449*	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	449	Kelch 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			AAGTGCCACTCATCCCGCTCT	0.537			NA											18	14					9.7654e-05	0.0001019	0.007413	1	0
S1PR5	53637	broad.mit.edu	37	19	10624671	10624671	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:10624671C>T	uc002mot.1	-	2	1074	c.1017G>A	c.(1015-1017)GCG>GCA	p.A339A	S1PR5_uc002mou.1_Silent_p.A339A	NM_030760	NP_110387	Q9H228	S1PR5_HUMAN	endothelial differentiation, sphingolipid	339	Cytoplasmic (By similarity).					integral to membrane|plasma membrane	lysosphingolipid and lysophosphatidic acid receptor activity			central_nervous_system(1)|pancreas(1)	2						CAGCCGCGCTCGCCGACTGCT	0.746			NA											11	2					0	0	0.004007	0	0
PSG3	5671	broad.mit.edu	37	19	43236960	43236960	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:43236960C>T	uc002oue.2	-	3	817	c.685G>A	c.(685-687)GAC>AAC	p.D229N	PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Missense_Mutation_p.D251N	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	229	Ig-like C2-type 1.				defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				GTGACTGGGTCACTGCGGCTG	0.527			NA											103	434					0	0	0.01441	0	0
NLRP5	126206	broad.mit.edu	37	19	56539676	56539676	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:56539676G>A	uc002qmj.2	+	7	2077	c.2077G>A	c.(2077-2079)GAG>AAG	p.E693K	NLRP5_uc002qmi.2_Missense_Mutation_p.E674K	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	693						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTGTCTTTTCGAGACTCAAGA	0.517			NA											83	159					0	0	0.01441	0	0
ZNF304	57343	broad.mit.edu	37	19	57868090	57868090	+	Nonsense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr19:57868090G>T	uc010ygw.1	+	3	1241	c.853G>T	c.(853-855)GGA>TGA	p.G285*	ZNF304_uc010etw.2_Nonsense_Mutation_p.G332*|ZNF304_uc010etx.2_Nonsense_Mutation_p.G243*	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN	zinc finger protein 304	285	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		TAAGGAGTGTGGAAAAGCCTT	0.418			NA											23	64					2.32416e-17	2.85006e-17	0.014323	1	0
GREB1	9687	broad.mit.edu	37	2	11720872	11720872	+	Missense_Mutation	SNP	C	C	T	rs148901217		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:11720872C>T	uc002rbk.1	+	7	1115	c.815C>T	c.(814-816)CCG>CTG	p.P272L	GREB1_uc002rbl.2_Missense_Mutation_p.P272L|GREB1_uc002rbm.2_Missense_Mutation_p.P162L|GREB1_uc002rbn.1_Missense_Mutation_p.P272L	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	272						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GCAATGGGTCCGGCTGTTTTC	0.532	Ovarian(39;850 945 2785 23371 33093)		NA											52	104					0	0	0.01441	0	0
DNMT3A	1788	broad.mit.edu	37	2	25459873	25459873	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:25459873G>A	uc002rgc.2	-	21	2667	c.2410C>T	c.(2410-2412)CCG>TCG	p.P804S	DNMT3A_uc002rgd.2_Missense_Mutation_p.P804S|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.P615S	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	804					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATGCCAACGGCCTAGGAGGC	0.582			NA	Mis|F|N|S		AML								13	29					0	0	0.001855	0	0
REG1B	5968	broad.mit.edu	37	2	79314691	79314691	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:79314691G>C	uc002sny.2	-	2	160	c.48C>G	c.(46-48)TTC>TTG	p.F16L	REG1B_uc010ffv.1_Missense_Mutation_p.F16L|REG1B_uc010ffw.2_Missense_Mutation_p.F16L	NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	16					cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						TCAGAGACAGGAACATCAGGG	0.473			NA											13	44					0	0	0.001855	0	0
IL1R2	7850	broad.mit.edu	37	2	102641036	102641036	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:102641036G>A	uc002tbm.2	+	7	1022	c.793G>A	c.(793-795)GGC>AGC	p.G265S	IL1R2_uc002tbn.2_Missense_Mutation_p.G265S|IL1R2_uc002tbo.1_Missense_Mutation_p.G265S	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	265	Extracellular (Potential).|Ig-like C2-type 3.				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	TCTGGGAACCGGCACACCCTT	0.607	Pancreas(106;189 1628 2302 5133 12295)		NA											27	58					0	0	0.005443	0	0
SULT1C3	442038	broad.mit.edu	37	2	108881397	108881397	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:108881397G>T	uc010ywo.1	+	6	738	c.738G>T	c.(736-738)ATG>ATT	p.M246I		NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member	246						cytoplasm	alcohol sulfotransferase activity			skin(1)	1						AAAACCCAATGACCAACTATA	0.383			NA											40	85					6.48837e-15	7.6227e-15	0.010771	1	0
RGPD5	84220	broad.mit.edu	37	2	113127775	113127775	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:113127775G>C	uc002ths.1	-	23	5355	c.5278C>G	c.(5278-5280)CCT>GCT	p.P1760A	RGPD8_uc010fkk.1_Missense_Mutation_p.P1620A	NM_005054	NP_005045	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 5 isoform	1760					intracellular transport	cytoplasm	binding				0						GAACGGGAAGGATTTTCTTCC	0.308			NA											5	56					0	0	0.000602	0	0
DPP10	57628	broad.mit.edu	37	2	116497337	116497337	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:116497337C>G	uc002tla.1	+	9	1177	c.720C>G	c.(718-720)ATC>ATG	p.I240M	DPP10_uc002tlb.1_Missense_Mutation_p.I190M|DPP10_uc002tlc.1_Missense_Mutation_p.I236M|DPP10_uc002tle.2_Missense_Mutation_p.I244M|DPP10_uc002tlf.1_Missense_Mutation_p.I233M	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	240	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						ATTCTCACATCGCCCACTGGT	0.463			NA											38	86					0	0	0.004878	0	0
FAM123C	205147	broad.mit.edu	37	2	131519842	131519842	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:131519842C>A	uc002trw.2	+	2	387	c.197C>A	c.(196-198)CCC>CAC	p.P66H	FAM123C_uc010fmv.2_Missense_Mutation_p.P66H|FAM123C_uc010fms.1_Missense_Mutation_p.P66H|FAM123C_uc010fmt.1_Missense_Mutation_p.P66H|FAM123C_uc010fmu.1_Missense_Mutation_p.P66H	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	66										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		GACAGATGCCCCAACAAAGGG	0.632			NA											3	7					6.4e-05	6.72e-05	0.004672	1	0
LRP1B	53353	broad.mit.edu	37	2	141055419	141055419	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:141055419A>T	uc002tvj.1	-	84	13897	c.12925T>A	c.(12925-12927)TGC>AGC	p.C4309S		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4309	Extracellular (Potential).|EGF-like 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGGCAGTGGCAGTAAGGCTGG	0.468	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			83	237					0	0	0.01441	0	0
LRP1B	53353	broad.mit.edu	37	2	141946049	141946049	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:141946049G>T	uc002tvj.1	-	7	1926	c.954C>A	c.(952-954)GTC>GTA	p.V318V	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	318	Extracellular (Potential).|LDL-receptor class B 2.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAATCAGGGTGACACATACAG	0.413	Colon(99;50 2074 2507 20106)		NA								TSP Lung(27;0.18)			22	40					1.28384e-07	1.39152e-07	0.012319	1	0
TTN	7273	broad.mit.edu	37	2	179407873	179407873	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:179407873C>T	uc010zfg.1	-	296	89347	c.89123G>A	c.(89122-89124)AGA>AAA	p.R29708K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R23403K|TTN_uc010zfi.1_Missense_Mutation_p.R23336K|TTN_uc010zfj.1_Missense_Mutation_p.R23211K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30635							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCCTTATTCTAAATAAGTA	0.418			NA											55	216					0	0	0.01441	0	0
FARSB	10056	broad.mit.edu	37	2	223489197	223489197	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:223489197C>G	uc002vne.1	-	12	999	c.964G>C	c.(964-966)GAA>CAA	p.E322Q	FARSB_uc010zlq.1_Missense_Mutation_p.E342Q|FARSB_uc002vnf.1_Missense_Mutation_p.E223Q	NM_005687	NP_005678	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	322	B5.				phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|RNA binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	TCTGGAGTTTCTCTGAAAAAG	0.343			NA											12	23					0	0	0.010729	0	0
NEU2	4759	broad.mit.edu	37	2	233897387	233897387	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:233897387G>A	uc010zmn.1	+	1	6	c.6G>A	c.(4-6)GCG>GCA	p.A2A		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	2							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		GCCCCATGGCGTCCCTTCCTG	0.617			NA											65	151					0	0	0.01441	0	0
ANO7	50636	broad.mit.edu	37	2	242141661	242141661	+	Missense_Mutation	SNP	T	T	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr2:242141661T>C	uc002wax.2	+	8	930	c.827T>C	c.(826-828)CTT>CCT	p.L276P		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	276	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						AAAAACCTGCTTGGGATCCAC	0.612			NA											34	85					0	0	0.00623	0	0
PROKR2	128674	broad.mit.edu	37	20	5283318	5283318	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:5283318C>A	uc010zqw.1	-	2	523	c.523G>T	c.(523-525)GCC>TCC	p.A175S	PROKR2_uc010zqx.1_Missense_Mutation_p.A175S|PROKR2_uc010zqy.1_Missense_Mutation_p.A175S	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	175	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CAGACCAAGGCGATCAGGAAG	0.493			NA								HNSCC(71;0.22)			47	152					4.86159e-25	6.33138e-25	0.01441	1	0
TMEM90B	79953	broad.mit.edu	37	20	24524025	24524025	+	Missense_Mutation	SNP	G	G	A	rs139628724	byFrequency	TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:24524025G>A	uc002wtw.1	+	2	925	c.292G>A	c.(292-294)GTG>ATG	p.V98M		NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B	98	Cytoplasmic (Potential).				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						TTCAGAGGGCGTGCTGCGCTC	0.652			NA											58	112					0	0	0.01441	0	0
DEFB116	245930	broad.mit.edu	37	20	29891023	29891023	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:29891023G>T	uc010ztm.1	-	2	301	c.301C>A	c.(301-303)CAC>AAC	p.H101N		NM_001037731	NP_001032820	Q30KQ4	DB116_HUMAN	beta-defensin 116 precursor	101					defense response to bacterium	extracellular region					0	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			ATTCAAATGTGAGAGTAGCTT	0.378			NA											31	100					1.62565e-12	1.85788e-12	0.012213	1	0
SLC32A1	140679	broad.mit.edu	37	20	37356981	37356981	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:37356981G>T	uc002xjc.2	+	2	1540	c.1277G>T	c.(1276-1278)GGG>GTG	p.G426V		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	426	Lumenal, vesicle (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	AGCGGCGACGGGCGCCTGAAG	0.642			NA											15	40					2.39187e-15	2.82982e-15	0.008871	1	0
COL9A3	1299	broad.mit.edu	37	20	61460132	61460132	+	Missense_Mutation	SNP	A	A	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:61460132A>T	uc002ydm.2	+	18	920	c.917A>T	c.(916-918)GAC>GTC	p.D306V		NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor	306	Triple-helical region 3 (COL3).				axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CCGGGCAAGGACGGCCAGAAT	0.692			NA											18	43					0	0	0.008871	0	0
EEF1A2	1917	broad.mit.edu	37	20	62121879	62121879	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr20:62121879C>T	uc002yfd.1	-	5	1083	c.982G>A	c.(982-984)GAC>AAC	p.D328N	EEF1A2_uc002yfe.1_Missense_Mutation_p.D328N|EEF1A2_uc010gkg.1_Missense_Mutation_p.D328N	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	328						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GACTTGCTGTCCCCACACACG	0.667			NA											25	55					0	0	0.005443	0	0
CECR2	27443	broad.mit.edu	37	22	17983959	17983959	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr22:17983959C>T	uc010gqw.1	+	6	781	c.655C>T	c.(655-657)CGC>TGC	p.R219C	CECR2_uc010gqv.1_Missense_Mutation_p.R98C|CECR2_uc002zml.2_Missense_Mutation_p.R98C|CECR2_uc002zmm.1_Missense_Mutation_p.R98C	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	261					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		CGAGAGTTTTCGCGAGAGGAC	0.562			NA											36	126					0	0	0.00623	0	0
APOBEC3D	140564	broad.mit.edu	37	22	39425483	39425483	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr22:39425483C>A	uc011aoe.1	+	5	775	c.721C>A	c.(721-723)CAC>AAC	p.H241N	APOBEC3D_uc011aof.1_Intron|APOBEC3D_uc003awu.3_Intron|APOBEC3D_uc003awt.3_Missense_Mutation_p.H241N|APOBEC3D_uc010gxu.2_Missense_Mutation_p.H37N	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	241					negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)					TACAAAGCACCACTCAGCTGT	0.478			NA											4	83					0.00909568	0.00926106	0.009096	1	0
CHKB	1120	broad.mit.edu	37	22	51018161	51018161	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr22:51018161G>A	uc003bms.2	-	9	1244	c.1026C>T	c.(1024-1026)GTC>GTT	p.V342V	CPT1B_uc003bmk.3_5'Flank|CPT1B_uc003bml.2_5'Flank|CPT1B_uc003bmm.2_5'Flank|CPT1B_uc003bmo.2_5'Flank|CPT1B_uc011asa.1_5'Flank|CPT1B_uc003bmn.2_5'Flank|CPT1B_uc011asb.1_5'Flank|CHKB-CPT1B_uc003bmp.2_5'Flank|CHKB-CPT1B_uc003bmt.1_Silent_p.V133V|CHKB-CPT1B_uc003bmu.2_Silent_p.V221V|CHKB_uc003bmv.2_Silent_p.V342V	NM_005198	NP_005189	Q9Y259	CHKB_HUMAN	choline kinase beta	342					phosphatidylethanolamine biosynthetic process		ATP binding|choline kinase activity|ethanolamine kinase activity				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	CTCACCGACTGACTTCTACCA	0.522			NA											42	113					0	0	0.00874	0	0
XYLB	9942	broad.mit.edu	37	3	38454427	38454427	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:38454427G>T	uc003cic.2	+	19	1643	c.1534G>T	c.(1534-1536)GTC>TTC	p.V512F	XYLB_uc011ayp.1_Missense_Mutation_p.V375F	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase	512					D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCCCTTCTAGGTCTACGAGGC	0.498			NA											42	107					7.53189e-24	9.73352e-24	0.007835	1	0
TMF1	7110	broad.mit.edu	37	3	69101202	69101202	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:69101202G>A	uc003dnn.2	-	1	283	c.36C>T	c.(34-36)TTC>TTT	p.F12F	TMF1_uc011bfx.1_Silent_p.F12F	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	12					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CCTGCTTAGCGAAGCTGGAGA	0.637			NA											17	196					0	0	0.012319	0	0
ACPP	55	broad.mit.edu	37	3	132075715	132075715	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:132075715C>T	uc010htp.2	+	10	1244	c.1154C>T	c.(1153-1155)ACA>ATA	p.T385I	ACPP_uc003eon.3_Missense_Mutation_p.T352I|ACPP_uc003eop.3_Intron	NM_001099	NP_001090	P15309	PPAP_HUMAN	acid phosphatase, prostate short isoform	385						extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1						GAAGACAGTACAGATTAGTGT	0.502			NA											30	65					0	0	0.009535	0	0
KY	339855	broad.mit.edu	37	3	134322838	134322838	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr3:134322838C>T	uc010hty.2	-	11	1631	c.1569G>A	c.(1567-1569)CTG>CTA	p.L523L	KY_uc011blw.1_3'UTR|KY_uc011blx.1_Silent_p.L502L	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	523						cytoskeleton|Z disc	peptidase activity			ovary(2)	2						GCTGGACTTTCAGCTCGGTCT	0.527			NA											18	67					0	0	0.012319	0	0
TBC1D1	23216	broad.mit.edu	37	4	38051323	38051323	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:38051323G>A	uc003gtb.2	+	11	2057	c.1714G>A	c.(1714-1716)GAC>AAC	p.D572N	TBC1D1_uc011byd.1_Missense_Mutation_p.D572N|TBC1D1_uc010ifd.2_Missense_Mutation_p.D319N|TBC1D1_uc011byf.1_Missense_Mutation_p.D443N	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,	572						nucleus	Rab GTPase activator activity			ovary(1)	1						CCTGTCCAGTGACTCGGAGAG	0.592			NA											51	158					0	0	0.01441	0	0
SRD5A3	79644	broad.mit.edu	37	4	56236046	56236046	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:56236046G>A	uc003hau.2	+	5	840	c.745G>A	c.(745-747)GAA>AAA	p.E249K	uc003hav.1_Intron|uc003haw.1_Intron	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	249	Lumenal (Potential).				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)			AGACTGGTTTGAATATGTTTC	0.423			NA											23	108					0	0	0.00632	0	0
Unknown	0	broad.mit.edu	37	4	69343128	69343128	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:69343128C>T	uc003hdz.3	+	8	813	c.749C>T	c.(748-750)ACA>ATA	p.T250I		NM_014058	NP_054777			transmembrane protease, serine 11E												NA						TTTGGAGTAACAATAAAACCT	0.368			NA											90	170					0	0	0.01441	0	0
NPFFR2	10886	broad.mit.edu	37	4	73013156	73013156	+	Missense_Mutation	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:73013156C>T	uc003hgg.2	+	4	1294	c.1196C>T	c.(1195-1197)TCA>TTA	p.S399L	NPFFR2_uc010iig.1_Missense_Mutation_p.S181L|NPFFR2_uc003hgi.2_Missense_Mutation_p.S300L|NPFFR2_uc003hgh.2_Missense_Mutation_p.S297L|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	399	Extracellular (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ATGATGCTCTCAGACTACGCT	0.483			NA											23	69					0	0	0.014323	0	0
SDAD1	55153	broad.mit.edu	37	4	76898821	76898821	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:76898821C>A	uc003hje.3	-	4	502	c.383G>T	c.(382-384)TGC>TTC	p.C128F	SDAD1_uc003hjf.3_Missense_Mutation_p.C31F|SDAD1_uc011cbr.1_Intron	NM_018115	NP_060585	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	128					protein transport|ribosomal large subunit biogenesis	nucleolus	protein binding			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTATCATGGCAACGAAAAAG	0.383			NA											16	73					6.94344e-10	7.62417e-10	0.006122	1	0
C4orf45	152940	broad.mit.edu	37	4	159894386	159894386	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr4:159894386C>G	uc003iqf.1	-	2	227	c.142G>C	c.(142-144)GAA>CAA	p.E48Q	C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756	Q96LM5	CD045_HUMAN	hypothetical protein LOC152940	48											0						CCAGTTTTTTCTAACGCCAGA	0.378			NA											10	15					0	0	0.008291	0	0
ISL1	3670	broad.mit.edu	37	5	50683505	50683505	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:50683505G>A	uc003jor.2	+	3	948	c.400G>A	c.(400-402)GAT>AAT	p.D134N		NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	134					generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				AGCAGACCACGATGTGGTGGA	0.652			NA											22	115					0	0	0.00278	0	0
TRIM36	55521	broad.mit.edu	37	5	114466398	114466398	+	Missense_Mutation	SNP	A	A	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:114466398A>C	uc003kqs.2	-	9	2232	c.1723T>G	c.(1723-1725)TTC>GTC	p.F575V	TRIM36_uc011cwc.1_Missense_Mutation_p.F563V|TRIM36_uc003kqt.2_Missense_Mutation_p.F420V	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	575	B30.2/SPRY.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding			ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		AAGGCCCAGAAGTGTTTTCCT	0.448			NA											36	139					0	0	0.004289	0	0
TXNDC15	79770	broad.mit.edu	37	5	134235280	134235280	+	Missense_Mutation	SNP	T	T	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:134235280T>G	uc003lac.1	+	5	1646	c.988T>G	c.(988-990)TTA>GTA	p.L330V	TXNDC15_uc010jdy.1_RNA|TXNDC15_uc011cxv.1_RNA	NM_024715	NP_078991	Q96J42	TXD15_HUMAN	disulfide isomerase precursor	330	Helical; (Potential).				cell redox homeostasis	integral to membrane				ovary(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGTATTTTCCTTATTCTTTTT	0.403			NA											82	106					0	0	0.01441	0	0
PCDHGB2	56103	broad.mit.edu	37	5	140741992	140741992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:140741992G>T	uc003ljs.1	+	1	2290	c.2290G>T	c.(2290-2292)GAG>TAG	p.E764*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Nonsense_Mutation_p.E764*|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	764	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCAAGACAGAGTTCAATTT	0.498			NA											128	186					3.29933e-67	4.65788e-67	0.01441	1	0
MRPL22	29093	broad.mit.edu	37	5	154320812	154320812	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:154320812A>G	uc003lvy.3	+	2	102	c.64A>G	c.(64-66)AAG>GAG	p.K22E	MRPL22_uc003lvz.3_5'UTR	NM_014180	NP_054899	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22 isoform a	22					translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome				0	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GAGCCGGGGGAAGCTGGCCTT	0.468			NA											13	110					0	0	0.00245	0	0
FAM71B	153745	broad.mit.edu	37	5	156589711	156589711	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr5:156589711G>T	uc003lwn.2	-	2	1665	c.1565C>A	c.(1564-1566)TCT>TAT	p.S522Y		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	522						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCTGTGCTAGATGCAGATTG	0.502			NA											88	99					5.81834e-28	7.75779e-28	0.01441	1	0
TFAP2A	7020	broad.mit.edu	37	6	10398887	10398887	+	Silent	SNP	C	C	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr6:10398887C>T	uc003myr.2	-	7	1329	c.1077G>A	c.(1075-1077)CTG>CTA	p.L359L	TFAP2A_uc003myq.2_Silent_p.L353L|TFAP2A_uc003mys.2_RNA|TFAP2A_uc011dih.1_Nonsense_Mutation_p.W312*|TFAP2A_uc003myt.2_Silent_p.L355L	NM_003220	NP_003211	P05549	AP2A_HUMAN	transcription factor AP-2 alpha isoform a	359	H-S-H (helix-span-helix), dimerization.				ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GTGAGTTCCCCAGGGGAGATC	0.607			NA											33	509					0	0	0.004878	0	0
FKBPL	63943	broad.mit.edu	37	6	32097522	32097522	+	Missense_Mutation	SNP	C	C	A	rs143627051		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr6:32097522C>A	uc003nzr.2	-	2	306	c.36G>T	c.(34-36)AAG>AAT	p.K12N	ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN	WAF-1/CIP1 stabilizing protein 39	12					response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						GAGAGGTGTCCTTTTCTCCAA	0.493			NA											32	18					8.16721e-17	9.87116e-17	0.010818	1	0
DYNLT1	6993	broad.mit.edu	37	6	159065728	159065728	+	Missense_Mutation	SNP	G	G	C	rs151068285		TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr6:159065728G>C	uc003qrn.1	-	1	13	c.13C>G	c.(13-15)CAG>GAG	p.Q5E		NM_006519	NP_006510	P63172	DYLT1_HUMAN	dynein, light chain, Tctex-type 1	5					cell division|establishment of mitotic spindle orientation|intracellular transport of viral proteins in host cell|mitosis|negative regulation of neurogenesis|regulation of G-protein coupled receptor protein signaling pathway	cytoplasmic dynein complex|Golgi apparatus|microtubule|spindle	identical protein binding|motor activity				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;4.02e-18)|BRCA - Breast invasive adenocarcinoma(81;9.53e-06)		TCCGCAGCCTGGTAGTCTTCC	0.612			NA											8	25					0	0	0.008291	0	0
RBAK	57786	broad.mit.edu	37	7	5105125	5105125	+	Nonsense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:5105125G>T	uc010kss.1	+	6	2362	c.2038G>T	c.(2038-2040)GAA>TAA	p.E680*	LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Nonsense_Mutation_p.E680*	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor	680	Interaction with AR.|C2H2-type 16.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		GAAACCCTATGAATGTAACGA	0.388			NA											45	96					1.61572e-30	2.17153e-30	0.010771	1	0
ZNF12	7559	broad.mit.edu	37	7	6732203	6732203	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:6732203C>G	uc003sqt.1	-	5	924	c.370G>C	c.(370-372)GAA>CAA	p.E124Q	ZNF12_uc011jxa.1_5'UTR|ZNF12_uc003sqs.1_Intron	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a	124					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		GGGTTCGTTTCTACATCAAAA	0.368			NA											82	188					0	0	0.01441	0	0
SCIN	85477	broad.mit.edu	37	7	12668762	12668762	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:12668762G>A	uc003ssn.3	+	9	1444	c.1234G>A	c.(1234-1236)GAC>AAC	p.D412N	SCIN_uc010ktt.2_RNA|SCIN_uc003sso.3_Missense_Mutation_p.D165N	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1	412	Ca(2+)-dependent actin binding.|Gelsolin-like 4.				actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GATCCAAGTTGACCAAAACTC	0.368			NA											16	59					0	0	0.004007	0	0
GLI3	2737	broad.mit.edu	37	7	42012056	42012056	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:42012056C>G	uc011kbh.1	-	13	2074	c.1983G>C	c.(1981-1983)CAG>CAC	p.Q661H	GLI3_uc011kbg.1_Missense_Mutation_p.Q602H	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	661					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GCGACCTGGACTGTGAATGGC	0.612			NA							Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				48	134					0	0	0.01441	0	0
DLD	1738	broad.mit.edu	37	7	107558381	107558381	+	Missense_Mutation	SNP	A	A	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr7:107558381A>G	uc003vet.2	+	12	1359	c.1249A>G	c.(1249-1251)AAA>GAA	p.K417E	DLD_uc011kmg.1_Missense_Mutation_p.K369E|DLD_uc011kmh.1_Missense_Mutation_p.K394E|DLD_uc011kmi.1_Missense_Mutation_p.K318E	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor	417					branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	TATTGAGTACAAAGTTGGGAA	0.393			NA											30	58					0	0	0.012213	0	0
LZTS1	11178	broad.mit.edu	37	8	20110503	20110503	+	Silent	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr8:20110503G>A	uc003wzr.2	-	2	1050	c.939C>T	c.(937-939)GGC>GGT	p.G313G	LZTS1_uc010ltg.1_Silent_p.G313G	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	313	Potential.				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GCTTGTTGCCGCCTTTGGGCT	0.682			NA											36	84					0	0	0.004289	0	0
LRP12	29967	broad.mit.edu	37	8	105509951	105509951	+	Missense_Mutation	SNP	C	C	G			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr8:105509951C>G	uc003yma.2	-	5	924	c.829G>C	c.(829-831)GAC>CAC	p.D277H	LRP12_uc003ymb.2_Missense_Mutation_p.D258H|LRP12_uc003ylz.2_5'Flank	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	277	Extracellular (Potential).|CUB 2.				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GGATAAAAGTCTGGATAATTG	0.403			NA											10	60					0	0	0.013537	0	0
CNTLN	54875	broad.mit.edu	37	9	17466001	17466001	+	Missense_Mutation	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:17466001G>T	uc003zmz.2	+	22	3577	c.3551G>T	c.(3550-3552)TGT>TTT	p.C1184F	CNTLN_uc003zmy.2_Missense_Mutation_p.C1185F|CNTLN_uc010mio.2_Missense_Mutation_p.C864F	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	1185	Potential.					centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		ACTGAAGAATGTTCCAACAAG	0.308			NA											7	18					5.18039e-06	5.57888e-06	0.00308	1	0
Unknown	0	broad.mit.edu	37	9	90746160	90746160	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:90746160G>C	uc011lti.1	-	4	1821	c.1792C>G	c.(1792-1794)CGA>GGA	p.R598G						SubName: Full=cDNA FLJ59639;												NA						AGCCAGGATCGACGCACACTC	0.527			NA											61	189					0	0	0.01441	0	0
PTCH1	5727	broad.mit.edu	37	9	98218671	98218671	+	Missense_Mutation	SNP	C	C	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:98218671C>A	uc004avk.3	-	19	3381	c.3193G>T	c.(3193-3195)GTC>TTC	p.V1065F	PTCH1_uc010mro.2_Missense_Mutation_p.V914F|PTCH1_uc010mrp.2_Missense_Mutation_p.V914F|PTCH1_uc010mrq.2_Missense_Mutation_p.V914F|PTCH1_uc004avl.3_Missense_Mutation_p.V914F|PTCH1_uc010mrr.2_Missense_Mutation_p.V999F|PTCH1_uc004avm.3_Missense_Mutation_p.V1064F	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	1065	Helical; (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	p.V1057_L1102del(1)		skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AACAGCTCGACCGTCATCAGC	0.627			NA							Basal_Cell_Nevus_syndrome				15	34					2.31682e-05	2.46346e-05	0.003163	1	0
ADAMTS13	11093	broad.mit.edu	37	9	136290667	136290667	+	Missense_Mutation	SNP	G	G	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:136290667G>A	uc004cdv.3	+	4	793	c.349G>A	c.(349-351)GAC>AAC	p.D117N	ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.D117N|ADAMTS13_uc004cdu.1_Missense_Mutation_p.D117N|ADAMTS13_uc004cdw.3_Missense_Mutation_p.D117N|ADAMTS13_uc004cdx.3_Missense_Mutation_p.D117N|ADAMTS13_uc004cdq.1_Missense_Mutation_p.D117N|ADAMTS13_uc004cds.1_5'UTR|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	117	Peptidase M12B.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		ACTGCTTCGGGACCCGTCCCT	0.632			NA											11	49					0	0	0.010729	0	0
ADAMTS13	11093	broad.mit.edu	37	9	136291428	136291428	+	Missense_Mutation	SNP	G	G	C			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr9:136291428G>C	uc004cdv.3	+	6	1093	c.649G>C	c.(649-651)GAC>CAC	p.D217H	ADAMTS13_uc004cdp.3_5'UTR|ADAMTS13_uc004cdt.1_Missense_Mutation_p.D217H|ADAMTS13_uc004cdu.1_Missense_Mutation_p.D217H|ADAMTS13_uc004cdw.3_Missense_Mutation_p.D217H|ADAMTS13_uc004cdx.3_Missense_Mutation_p.D217H|ADAMTS13_uc004cdy.1_5'Flank|ADAMTS13_uc004cdq.1_Missense_Mutation_p.D217H|ADAMTS13_uc004cds.1_Silent_p.S46S|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	217	Peptidase M12B.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CACTGGCTTCGACCTGGGAGT	0.637			NA											29	94					0	0	0.008361	0	0
NSDHL	50814	broad.mit.edu	37	X	152027454	152027454	+	Silent	SNP	G	G	T			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chrX:152027454G>T	uc004fgt.1	+	5	669	c.408G>T	c.(406-408)GGG>GGT	p.G136G	NSDHL_uc004fgs.1_Silent_p.G136G	NM_001129765	NP_001123237	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	136					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|C-3 sterol dehydrogenase (C-4 sterol decarboxylase) activity|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity				0	Acute lymphoblastic leukemia(192;6.56e-05)				NADH(DB00157)	AAGAGGCTGGGGTTCAGGTAA	0.517			NA											32	35					2.08457e-15	2.48374e-15	0.010818	1	0
GSTP1	2950	broad.mit.edu	37	11	67353976	67353977	+	Frame_Shift_Ins	INS	-	-	CC			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr11:67353976_67353977insCC	uc001omf.2	+	7	810_811	c.561_562insCC	c.(559-564)CGGCCCfs	p.R187fs	GSTP1_uc001omg.1_Frame_Shift_Ins_p.R168fs	NM_000852	NP_000843	P09211	GSTP1_HUMAN	glutathione transferase	187_188	GST C-terminal.				anti-apoptosis|cellular response to lipopolysaccharide|central nervous system development|common myeloid progenitor cell proliferation|glutathione metabolic process|negative regulation of acute inflammatory response|negative regulation of ERK1 and ERK2 cascade|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 beta production|negative regulation of JUN kinase activity|negative regulation of leukocyte proliferation|negative regulation of monocyte chemotactic protein-1 production|negative regulation of necrotic cell death|negative regulation of nitric-oxide synthase 2 biosynthetic process|negative regulation of stress-activated MAPK cascade|negative regulation of tumor necrosis factor production|nitric oxide storage|positive regulation of superoxide anion generation|response to reactive oxygen species|xenobiotic metabolic process	cytosol|protein complex	dinitrosyl-iron complex binding|glutathione transferase activity|JUN kinase binding|kinase regulator activity|nitric oxide binding|S-nitrosoglutathione binding			ovary(1)	1					Ethacrynic acid(DB00903)|Glutathione(DB00143)	TCAGTGCCCGGCCCAAGCTCAA	0.629			NA											21	63	---	---	---	---	NA	NA	NA	NA	NA
TLN2	83660	broad.mit.edu	37	15	63044512	63044512	+	Frame_Shift_Del	DEL	T	T	-			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr15:63044512delT	uc002alb.3	+	32	4218	c.4218delT	c.(4216-4218)GGTfs	p.G1406fs	TLN2_uc002alc.3_5'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1406					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AGGTTCTGGGTGAATCGATGG	0.512			NA											32	183	---	---	---	---	NA	NA	NA	NA	NA
ELAC1	55520	broad.mit.edu	37	18	48513152	48513152	+	Frame_Shift_Del	DEL	A	A	-			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chr18:48513152delA	uc002lez.2	+	4	895	c.789delA	c.(787-789)GTAfs	p.V263fs	SMAD4_uc010xdo.1_Intron	NM_018696	NP_061166	Q9H777	RNZ1_HUMAN	elaC homolog 1	263					tRNA 3'-trailer cleavage	nucleus	endoribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0		Colorectal(6;0.0269)|all_epithelial(6;0.0729)		Colorectal(21;0.000943)|COAD - Colon adenocarcinoma(17;0.0398)|READ - Rectum adenocarcinoma(32;0.0894)|STAD - Stomach adenocarcinoma(97;0.18)		ATGGAGGAGTAAAACTGTGCT	0.478			NA											21	56	---	---	---	---	NA	NA	NA	NA	NA
RBM10	8241	broad.mit.edu	37	X	47034469	47034470	+	Frame_Shift_Ins	INS	-	-	A			TCGA-35-3615-01A-01D-1040-01	TCGA-35-3615-10A-01D-1489-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	21ce9500-32a5-42f4-ad44-37e9c4946015	326f84e7-ec3d-48b0-a470-d07502cd7fef	g.chrX:47034469_47034470insA	uc004dhf.2	+	6	933_934	c.554_555insA	c.(553-555)ACAfs	p.T185fs	RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Frame_Shift_Ins_p.T108fs|RBM10_uc004dhh.2_Frame_Shift_Ins_p.T185fs|RBM10_uc010nhq.2_Frame_Shift_Ins_p.T108fs|RBM10_uc004dhi.2_Frame_Shift_Ins_p.T250fs	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	185	RRM 1.				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						CAGGACGCTACACGATGGATGG	0.525	Melanoma(171;120 2705 19495 39241)		NA											36	26	---	---	---	---	NA	NA	NA	NA	NA
