Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
SCNN1D	6339	broad.mit.edu	37	1	1222560	1222560	+	Nonsense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:1222560C>A	uc001adu.1	+	8	1323	c.699C>A	c.(697-699)TAC>TAA	p.Y233*	SCNN1D_uc001adt.1_Nonsense_Mutation_p.Y397*|SCNN1D_uc001adw.2_Nonsense_Mutation_p.Y299*|SCNN1D_uc001adx.2_5'UTR|SCNN1D_uc001adv.2_Nonsense_Mutation_p.Y233*	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		AGGACTGGTACCACTTCCACT	0.642			NA											7	29					0.00198382	0.00210617	0.001984	1	0
MAD2L2	10459	broad.mit.edu	37	1	11740467	11740467	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:11740467G>T	uc001asp.2	-	3	290	c.102C>A	c.(100-102)CGC>CGA	p.R34R	MAD2L2_uc009vnc.2_Silent_p.R34R|MAD2L2_uc001asq.3_Silent_p.R34R	NM_006341	NP_006332	Q9UI95	MD2L2_HUMAN	MAD2 homolog	34	Mediates interaction with REV1 and REV3L and homodimerization.|HORMA.				cell division|DNA damage response, signal transduction resulting in transcription|double-strand break repair|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of mitotic anaphase-promoting complex activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription, DNA-dependent|regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleoplasm|spindle|zeta DNA polymerase complex	JUN kinase binding				0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGTAGACCTCGCGCACGTAGA	0.617			NA						DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					15	184					2.35188e-11	2.89185e-11	0.006122	1	0
RCC2	55920	broad.mit.edu	37	1	17755624	17755624	+	Silent	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:17755624T>A	uc001bal.2	-	2	404	c.357A>T	c.(355-357)CGA>CGT	p.R119R	RCC2_uc001bam.2_Silent_p.R119R	NM_001136204	NP_001129676	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	119	RCC1 1.				cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle					0		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		GCACTTCTTTTCGACCAATCA	0.398			NA											14	109					0	0	0.00499	0	0
KIF17	57576	broad.mit.edu	37	1	21014237	21014237	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:21014237C>T	uc001bdr.3	-	8	1700	c.1582G>A	c.(1582-1584)GAA>AAA	p.E528K	KIF17_uc001bdp.3_5'Flank|KIF17_uc001bdq.3_5'Flank|KIF17_uc009vpx.2_Intron|KIF17_uc001bds.3_Missense_Mutation_p.E528K	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	528					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TTGGAGGGTTCCACCTTGGGC	0.562			NA											19	98					0	0	0.012319	0	0
USP48	84196	broad.mit.edu	37	1	22030794	22030794	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:22030794C>G	uc001bfb.2	-	20	2714	c.2476G>C	c.(2476-2478)GAT>CAT	p.D826H	USP48_uc001bfa.2_Missense_Mutation_p.D364H|USP48_uc010odq.1_Missense_Mutation_p.D838H|USP48_uc009vqc.2_Missense_Mutation_p.D760H|USP48_uc001bfc.2_Missense_Mutation_p.D826H|USP48_uc001bfd.1_5'UTR	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	826					ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		GGGTTTACATCTCCCACTTCA	0.373			NA											14	110					0	0	0.00245	0	0
DHDDS	79947	broad.mit.edu	37	1	26774059	26774059	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:26774059G>T	uc001bml.2	+	6	571	c.450G>T	c.(448-450)CTG>CTT	p.L150L	DHDDS_uc001bmk.2_Silent_p.L150L|DHDDS_uc001bmm.2_Silent_p.L57L|DHDDS_uc001bmn.2_Silent_p.L111L|DHDDS_uc010ofd.1_Intron	NM_205861	NP_995583	Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase isoform b	150							protein binding|transferase activity, transferring alkyl or aryl (other than methyl) groups			breast(3)	3		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		GGTGTTTCCTGAATGTCTGTT	0.507			NA											6	66					2.0095e-06	2.30614e-06	0.001984	1	0
C1orf173	127254	broad.mit.edu	37	1	75038823	75038823	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:75038823G>T	uc001dgg.2	-	14	2790	c.2571C>A	c.(2569-2571)GAC>GAA	p.D857E		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	857	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						GTCCTATGGGGTCTGACCCCC	0.527			NA											25	207					1.17739e-12	1.47022e-12	0.005443	1	0
ST6GALNAC3	256435	broad.mit.edu	37	1	76779523	76779523	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:76779523G>A	uc001dhh.2	+	2	215	c.52G>A	c.(52-54)GCG>ACG	p.A18T	ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.A18T|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	18	Helical; Signal-anchor for type II membrane protein; (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						CTTCATAGCAGCGTTCCTTTT	0.403			NA											15	116					0	0	0.004007	0	0
GBP6	163351	broad.mit.edu	37	1	89846103	89846103	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:89846103C>T	uc001dnf.2	+	6	1058	c.784C>T	c.(784-786)CAG>TAG	p.Q262*	GBP6_uc010ost.1_Nonsense_Mutation_p.Q132*	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	262							GTP binding|GTPase activity			ovary(2)	2		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		TCCCAAATTCCAGGAACAAAC	0.438			NA											8	47					0	0	0.006214	0	0
PPM1J	333926	broad.mit.edu	37	1	113253122	113253122	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:113253122C>G	uc001ect.1	-	9	1357	c.1330G>C	c.(1330-1332)GAC>CAC	p.D444H	PPM1J_uc009wgl.1_RNA|PPM1J_uc001ecs.1_Missense_Mutation_p.D238H	NM_005167	NP_005158	Q5JR12	PPM1J_HUMAN	protein phosphatase 1J (PP2C domain containing)	444	PP2C-like.									breast(2)|central_nervous_system(1)	3	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCACCCTGTCCACAGTGGCA	0.547			NA											12	68					0	0	0.008871	0	0
LOC728989	728989	broad.mit.edu	37	1	146494510	146494510	+	Silent	SNP	T	T	C	rs11585592	by1000genomes	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:146494510T>C	uc001epd.2	-	4	563	c.489A>G	c.(487-489)GCA>GCG	p.A163A		NR_024442				SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;												0						TGCCAGGCAGTGCAGGGATGT	0.557			NA											4	26					0	0	0.009096	0	0
HRNR	388697	broad.mit.edu	37	1	152191367	152191367	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:152191367G>T	uc001ezt.1	-	3	2814	c.2738C>A	c.(2737-2739)TCC>TAC	p.S913Y		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	913	10.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACCGACCGGAGCCAGACCC	0.637			NA											21	190					2.50493e-22	3.24564e-22	0.004656	1	0
SHC1	6464	broad.mit.edu	37	1	154940731	154940731	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:154940731G>A	uc001ffv.2	-	5	974	c.753C>T	c.(751-753)ATC>ATT	p.I251I	SHC1_uc001ffu.2_5'Flank|SHC1_uc001ffz.1_Silent_p.I22I|SHC1_uc001ffw.2_Silent_p.I251I|SHC1_uc001ffx.2_Silent_p.I141I|SHC1_uc001ffy.2_Silent_p.I141I	NM_183001	NP_892113	P29353	SHC1_HUMAN	SHC-transforming protein 1 isoform 1	251	PID.				activation of MAPK activity|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|positive regulation of DNA replication|Ras protein signal transduction|regulation of epidermal growth factor receptor activity|regulation of growth	cytosol|mitochondrial matrix|Shc-EGFR complex	epidermal growth factor receptor binding|insulin receptor binding|insulin-like growth factor receptor binding|phospholipid binding|protein binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(1)|skin(1)	2	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGTTGGCGATGATCTGAGAAT	0.567	NSCLC(4;32 234 1864 2492 3259 13747 17376)		NA											19	254					0	0	0.006122	0	0
FAM129A	116496	broad.mit.edu	37	1	184863220	184863220	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:184863220C>T	uc001gra.2	-	3	501	c.307G>A	c.(307-309)GAG>AAG	p.E103K	FAM129A_uc009wyh.1_Missense_Mutation_p.E103K|FAM129A_uc009wyi.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	103					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						TCTTTATTCTCATAGCTCTCC	0.353			NA											9	114					0	0	0.010729	0	0
ASPM	259266	broad.mit.edu	37	1	197112595	197112595	+	Missense_Mutation	SNP	T	T	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:197112595T>G	uc001gtu.2	-	3	1044	c.787A>C	c.(787-789)AGT>CGT	p.S263R	ASPM_uc001gtv.2_Missense_Mutation_p.S263R|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	263					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						ACGTTGGCACTGTGTACATTT	0.378			NA											11	94					0	0	0.008291	0	0
PPP1R15B	84919	broad.mit.edu	37	1	204379201	204379201	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:204379201C>G	uc001hav.3	-	1	1744	c.1339G>C	c.(1339-1341)GAT>CAT	p.D447H		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	447					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TCATCCCAATCCTCACCTTCT	0.458			NA											21	313					0	0	0.012319	0	0
SLC26A9	115019	broad.mit.edu	37	1	205890767	205890767	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:205890767G>C	uc001hdq.2	-	17	2096	c.1982C>G	c.(1981-1983)ACC>AGC	p.T661S	SLC26A9_uc001hdo.2_Missense_Mutation_p.T329S|SLC26A9_uc001hdp.2_Missense_Mutation_p.T661S	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a	661	STAS.					integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GGTGTGGAAGGTGACGAAGGG	0.647			NA											4	24					0	0	0.001168	0	0
CENPF	1063	broad.mit.edu	37	1	214819010	214819010	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:214819010C>G	uc001hkm.2	+	13	6271	c.6097C>G	c.(6097-6099)CTC>GTC	p.L2033V		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	2129	Potential.|Interaction with NDE1 and NDEL1.				cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CAAAACTCATCTCCAGGAAAA	0.438	Colon(80;575 1284 11000 14801 43496)		NA											7	122					0	0	0.00308	0	0
OR2C3	81472	broad.mit.edu	37	1	247694892	247694892	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr1:247694892C>T	uc009xgy.2	-	2	1284	c.922G>A	c.(922-924)GAG>AAG	p.E308K	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CAGCAGTTCTCTAATACCATG	0.512			NA											7	62					0	0	0.004482	0	0
CUBN	8029	broad.mit.edu	37	10	16996511	16996511	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:16996511C>A	uc001ioo.2	-	32	4784	c.4732G>T	c.(4732-4734)GCC>TCC	p.A1578S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1578	CUB 10.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CACGTCCTGGCAAGGCGGGAC	0.527			NA											19	94					1.56452e-12	1.94356e-12	0.007413	1	0
PCDH15	65217	broad.mit.edu	37	10	55912864	55912864	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:55912864G>T	uc001jju.1	-	14	2175	c.1780C>A	c.(1780-1782)CGA>AGA	p.R594R	PCDH15_uc010qhq.1_Silent_p.R599R|PCDH15_uc010qhr.1_Silent_p.R594R|PCDH15_uc010qhs.1_Silent_p.R606R|PCDH15_uc010qht.1_Silent_p.R601R|PCDH15_uc010qhu.1_Silent_p.R594R|PCDH15_uc001jjv.1_Silent_p.R572R|PCDH15_uc010qhv.1_Silent_p.R594R|PCDH15_uc010qhw.1_Silent_p.R557R|PCDH15_uc010qhx.1_Silent_p.R594R|PCDH15_uc010qhy.1_Silent_p.R599R|PCDH15_uc010qhz.1_Silent_p.R594R|PCDH15_uc010qia.1_Silent_p.R572R|PCDH15_uc010qib.1_Silent_p.R572R|PCDH15_uc001jjw.2_Silent_p.R594R	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	594	Cadherin 5.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AATTACCTTCGCTCTGCAGGA	0.458			NA								HNSCC(58;0.16)			4	34					0.00909568	0.00944853	0.009096	1	0
MYPN	84665	broad.mit.edu	37	10	69881674	69881674	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:69881674A>C	uc001jnm.3	+	3	664	c.479A>C	c.(478-480)GAG>GCG	p.E160A	MYPN_uc001jnl.1_Missense_Mutation_p.E160A|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.E160A|MYPN_uc001jnp.1_Missense_Mutation_p.E160A|MYPN_uc009xps.2_Missense_Mutation_p.E160A|MYPN_uc009xpt.2_Missense_Mutation_p.E160A|MYPN_uc010qit.1_5'UTR|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	160	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						TTCATTGAAGAGCTATCCTCC	0.423			NA											14	93					0	0	0.004007	0	0
C10orf93	255352	broad.mit.edu	37	10	134755107	134755107	+	Silent	SNP	C	C	T	rs143120032		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr10:134755107C>T	uc001llt.1	-	3	370	c.294G>A	c.(292-294)TCG>TCA	p.S98S	C10orf93_uc001llu.2_Silent_p.S98S	NM_173572	NP_775843	Q5SR76	CJ093_HUMAN	hypothetical protein LOC255352	98	TPR 1.						binding			pancreas(1)	1		all_cancers(35;1.8e-07)|all_epithelial(44;6.22e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Colorectal(31;0.119)|Glioma(114;0.172)|Melanoma(40;0.175)		Epithelial(32;4.28e-05)|OV - Ovarian serous cystadenocarcinoma(35;4.31e-05)|all cancers(32;5.02e-05)		GGTTTTCTGCCGACTTCGGGG	0.567			NA											15	70					0	0	0.004007	0	0
RRM1	6240	broad.mit.edu	37	11	4142838	4142838	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:4142838C>T	uc001lyw.3	+	10	1200	c.881C>T	c.(880-882)CCT>CTT	p.P294L	RRM1_uc009yej.2_RNA|RRM1_uc009yei.2_Missense_Mutation_p.P254L|RRM1_uc010qyc.1_Missense_Mutation_p.P197L|RRM1_uc010qyd.1_5'UTR	NM_001033	NP_001024	P23921	RIR1_HUMAN	ribonucleoside-diphosphate reductase M1 chain	294					deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	CACTAGCGTCCTGGGGCATTT	0.368	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)		NA											13	97					0	0	0.00245	0	0
TPP1	1200	broad.mit.edu	37	11	6636182	6636182	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:6636182T>C	uc001mel.1	-	12	1527	c.1466A>G	c.(1465-1467)AAT>AGT	p.N489S	TAF10_uc001mej.1_5'Flank|TPP1_uc001mek.1_Missense_Mutation_p.N246S	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein	489					bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		CCTGTGCTCATTGATCAAGGA	0.527			NA											44	198					0	0	0.011902	0	0
NLRP14	338323	broad.mit.edu	37	11	7079078	7079078	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:7079078C>A	uc001mfb.1	+	7	2785	c.2462C>A	c.(2461-2463)TCC>TAC	p.S821Y		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	821	LRR 4.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GAGAGACTGTCGTGAGTGTTT	0.398			NA											11	134					3.07112e-06	3.49122e-06	0.010729	1	0
OR4A5	81318	broad.mit.edu	37	11	51412143	51412143	+	Missense_Mutation	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:51412143A>T	uc001nhi.1	-	1	253	c.253T>A	c.(253-255)TGT>AGT	p.C85S		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)				TTTTTATCACAGAATAAGCCT	0.438			NA											5	56					0	0	0.001168	0	0
OR5M8	219484	broad.mit.edu	37	11	56258676	56258676	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:56258676G>T	uc001nix.1	-	1	171	c.171C>A	c.(169-171)CCC>CCA	p.P57P		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					AAAAGTACATGGGCATGTGGA	0.493			NA											17	114					2.94398e-08	3.52985e-08	0.007413	1	0
TNKS1BP1	85456	broad.mit.edu	37	11	57089342	57089342	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:57089342G>A	uc001njr.2	-	1	330	c.18C>T	c.(16-18)CTC>CTT	p.L6L	TNKS1BP1_uc001njs.2_Silent_p.L6L|TNKS1BP1_uc009ymd.1_5'UTR	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	6	Arg/Glu/Lys/Pro-rich (charged).				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				AGCTTTCCCTGAGAGTAGACA	0.597			NA											5	36					0	0	0.004482	0	0
OSBP	5007	broad.mit.edu	37	11	59361700	59361700	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:59361700A>C	uc001noc.1	-	8	1820	c.1340T>G	c.(1339-1341)CTT>CGT	p.L447R	OSBP_uc009ymr.1_RNA	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	447	Sterol binding (By similarity).				lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AAGGCGCTGAAGCATGGACAA	0.393			NA											19	90					0	0	0.014323	0	0
MRPL16	54948	broad.mit.edu	37	11	59575233	59575233	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:59575233C>T	uc001noh.2	-	3	425	c.211G>A	c.(211-213)GAC>AAC	p.D71N		NM_017840	NP_060310	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16 precursor	71							rRNA binding			central_nervous_system(1)	1						CCCCGTATGTCACTTAAATTT	0.413			NA											53	300					0	0	0.01441	0	0
TMEM151A	256472	broad.mit.edu	37	11	66062484	66062484	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:66062484G>A	uc001ohl.2	+	2	879	c.767G>A	c.(766-768)CGC>CAC	p.R256H		NM_153266	NP_694998	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	256						integral to membrane				central_nervous_system(1)	1						CTGGAGGCGCGCGAGGGCATG	0.692			NA											4	15					0	0	0.009096	0	0
FAT3	120114	broad.mit.edu	37	11	92533924	92533924	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:92533924C>G	uc001pdj.3	+	9	7762	c.7745C>G	c.(7744-7746)ACT>AGT	p.T2582S		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2582	Cadherin 23.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGAGAACAACTTTCTGCACT	0.483			NA								TCGA Ovarian(4;0.039)			6	60					0	0	0.001984	0	0
CWC15	51503	broad.mit.edu	37	11	94705238	94705238	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:94705238G>C	uc001pfd.3	-	2	235	c.112C>G	c.(112-114)CAT>GAT	p.H38D	CWC15_uc009ywl.1_Missense_Mutation_p.H38D|KDM4D_uc001pfe.2_5'Flank	NM_016403	NP_057487	Q9P013	CWC15_HUMAN	CWC15 homolog	38					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	protein binding|RNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATCTTTGTATGAGAGGGTAGG	0.398			NA											38	165					0	0	0.005524	0	0
PUS3	83480	broad.mit.edu	37	11	125765210	125765210	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr11:125765210T>C	uc001qcy.2	-	3	951	c.853A>G	c.(853-855)ATC>GTC	p.I285V	HYLS1_uc009zbv.2_Intron|HYLS1_uc001qcx.3_Intron	NM_031307	NP_112597	Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	285						nucleus	RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		AGAAAGAGGATAGCCATCATA	0.443			NA											10	87					0	0	0.013537	0	0
LRRK2	120892	broad.mit.edu	37	12	40702915	40702915	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:40702915G>T	uc001rmg.3	+	30	4318	c.4197G>T	c.(4195-4197)GAG>GAT	p.E1399D	LRRK2_uc009zjw.2_Missense_Mutation_p.E237D|LRRK2_uc001rmi.2_Missense_Mutation_p.E232D	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1399	Roc.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TAGGTCGTGAGGAATTCTATA	0.368			NA											7	73					5.18039e-06	5.86138e-06	0.00308	1	0
CDK4	1019	broad.mit.edu	37	12	58145430	58145430	+	Missense_Mutation	SNP	C	C	A	rs104894340		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:58145430C>A	uc001spv.2	-	2	298	c.71G>T	c.(70-72)CGT>CTT	p.R24L	CDK4_uc010ssb.1_5'UTR|CDK4_uc001spw.2_RNA|uc010ssc.1_RNA	NM_000075	NP_000066	P11802	CDK4_HUMAN	cyclin-dependent kinase 4	24	Protein kinase.		R -> H (in CMM3).		cell division|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|positive regulation of fibroblast proliferation|regulation of gene expression|response to drug|S phase of mitotic cell cycle	cyclin-dependent protein kinase holoenzyme complex|cytosol|membrane	ATP binding|cyclin-dependent protein kinase activity|protein binding			lung(1)|breast(1)|central_nervous_system(1)	3	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			GTGGGGATCACGGGCCTTGTA	0.557			NA	Mis			melanoma 			Hereditary_Melanoma				15	80					1.67942e-08	2.0237e-08	0.006122	1	0
LRRIQ1	84125	broad.mit.edu	37	12	85449619	85449619	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:85449619A>C	uc001tac.2	+	8	1159	c.1048A>C	c.(1048-1050)AAA>CAA	p.K350Q	LRRIQ1_uc001tab.1_Missense_Mutation_p.K350Q|LRRIQ1_uc001taa.1_Missense_Mutation_p.K325Q	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	350	Glu-rich.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		agaagagagaaaaaagcaaaa	0.07			NA											4	15					0	0	0.009096	0	0
ALX1	8092	broad.mit.edu	37	12	85680674	85680674	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:85680674G>T	uc001tae.3	+	3	579	c.575G>T	c.(574-576)CGT>CTT	p.R192L		NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1	192					brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)		AAAAGGGAACGTTATGGCCAA	0.348			NA											11	41					1.58986e-06	1.83329e-06	0.008291	1	0
PXN	5829	broad.mit.edu	37	12	120651681	120651681	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:120651681G>A	uc001txt.2	-	11	1604	c.1473C>T	c.(1471-1473)CTC>CTT	p.L491L	PXN_uc001txu.2_Silent_p.L303L|PXN_uc001txv.2_Silent_p.L372L|PXN_uc001txx.2_Silent_p.L324L|PXN_uc001txy.2_Silent_p.L457L|PXN_uc001txz.2_RNA	NM_001080855	NP_001074324	P49023	PAXI_HUMAN	paxillin isoform 1	491	LIM zinc-binding 3.				cell junction assembly|cell-matrix adhesion|cellular response to reactive oxygen species|epidermal growth factor receptor signaling pathway|growth hormone receptor signaling pathway|muscle contraction|signal complex assembly	cytoplasm|focal adhesion|lamellipodium|microtubule associated complex	beta-catenin binding|vinculin binding|zinc ion binding	p.L457L(1)		ovary(1)|breast(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACAGCGTGTTGAGGGCTGAGA	0.617			NA											3	13					0	0	0.009096	0	0
MPHOSPH9	10198	broad.mit.edu	37	12	123706321	123706321	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:123706321G>C	uc001uel.2	-	1	121	c.14C>G	c.(13-15)TCT>TGT	p.S5C	MPHOSPH9_uc010tal.1_5'UTR|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_5'UTR	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	5					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		ACTGCTTAGAGAAAAAAAACC	0.373			NA											19	128					0	0	0.010504	0	0
AACS	65985	broad.mit.edu	37	12	125561082	125561082	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr12:125561082A>G	uc001uhc.2	+	3	489	c.283A>G	c.(283-285)AAA>GAA	p.K95E	AACS_uc009zyg.2_RNA|AACS_uc001uhd.2_Missense_Mutation_p.K95E|AACS_uc009zyh.2_RNA	NM_023928	NP_076417	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	95					fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		CGAGTGGTTCAAAGGCAGTCG	0.493			NA											14	155					0	0	0.00499	0	0
KCTD4	386618	broad.mit.edu	37	13	45768147	45768147	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr13:45768147C>T	uc001uzx.3	-	2	960	c.556G>A	c.(556-558)GAG>AAG	p.E186K	GTF2F2_uc001uzv.2_Intron|GTF2F2_uc001uzw.2_Intron	NM_198404	NP_940686	Q8WVF5	KCTD4_HUMAN	potassium channel tetramerisation domain	186						voltage-gated potassium channel complex	voltage-gated potassium channel activity				0		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		ATTGAAAACTCCTCTGGAAAT	0.363			NA											12	135					0	0	0.013537	0	0
UGGT2	55757	broad.mit.edu	37	13	96624892	96624892	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr13:96624892C>T	uc001vmt.2	-	11	1296	c.1126G>A	c.(1126-1128)GAT>AAT	p.D376N		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	376					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						AGACGAGCATCGCCTGGCTGA	0.308			NA											9	93					0	0	0.006214	0	0
TRAPPC6B	122553	broad.mit.edu	37	14	39628703	39628703	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr14:39628703G>C	uc001wut.1	-	2	468	c.133C>G	c.(133-135)CAA>GAA	p.Q45E	TRAPPC6B_uc001wuu.1_Missense_Mutation_p.Q45E|TRAPPC6B_uc001wuv.1_RNA|TRAPPC6B_uc010tqd.1_Intron	NM_001079537	NP_001073005	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B isoform	45					vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus	guanylate cyclase activity|heme binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		ATCAATCCTTGTCCCACTCGA	0.338			NA											12	108					0	0	0.007413	0	0
NIN	51199	broad.mit.edu	37	14	51288719	51288719	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr14:51288719C>A	uc001wym.2	-	3	247	c.56G>T	c.(55-57)AGT>ATT	p.S19I	NIN_uc001wyi.2_Missense_Mutation_p.S19I|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.S19I|NIN_uc010tqp.1_Intron|NIN_uc001wyo.2_Missense_Mutation_p.S19I|NIN_uc001wyp.1_Splice_Site	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	19	EF-hand 1.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CGTGTCAAAACTGTCAAACAG	0.582			NA	T	PDGFRB	MPD								42	395					4.44401e-20	5.69685e-20	0.010771	1	0
SQRDL	58472	broad.mit.edu	37	15	45981368	45981368	+	Silent	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:45981368C>G	uc001zvt.2	+	10	1437	c.1248C>G	c.(1246-1248)CTC>CTG	p.L416L	SQRDL_uc001zvu.2_Silent_p.L416L|SQRDL_uc001zvv.2_Silent_p.L416L	NM_021199	NP_067022	Q9Y6N5	SQRD_HUMAN	sulfide dehydrogenase like precursor	416							oxidoreductase activity			ovary(1)	1		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		CCATGTATCTCATGAAAGCTG	0.473			NA											20	156					0	0	0.014323	0	0
HSP90AB4P	664618	broad.mit.edu	37	15	58984338	58984338	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:58984338G>A	uc002afh.1	-	2	925	c.925C>T	c.(925-927)CAT>TAT	p.H309Y	ADAM10_uc002afd.1_Intron|ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Intron	NR_002927				RecName: Full=Putative heat shock protein HSP 90-beta 4;												0						ATCCACACATGATGGACACAG	0.443			NA											7	16					0	0	0.001984	0	0
C15orf26	161502	broad.mit.edu	37	15	81440802	81440802	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:81440802G>T	uc002bgb.2	+	7	861	c.834G>T	c.(832-834)ATG>ATT	p.M278I		NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	278											0						CGTCCTCCATGTTGGATCTGC	0.542			NA											12	122					0.000978159	0.00105239	0.010729	1	0
SH3GL3	6457	broad.mit.edu	37	15	84245390	84245390	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr15:84245390G>T	uc002bjw.2	+	6	716	c.521G>T	c.(520-522)CGA>CTA	p.R174L	SH3GL3_uc010uot.1_Missense_Mutation_p.R174L|SH3GL3_uc002bjx.2_Missense_Mutation_p.R105L|SH3GL3_uc002bju.2_Missense_Mutation_p.R182L|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	174	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						AAAAAGAAACGAGTAGGTAAG	0.398			NA											9	83					0.000274275	0.000299096	0.004482	1	0
BAIAP3	8938	broad.mit.edu	37	16	1392790	1392790	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:1392790T>A	uc002clk.1	+	13	1241	c.1241T>A	c.(1240-1242)CTG>CAG	p.L414Q	BAIAP3_uc002clj.2_Missense_Mutation_p.L396Q|BAIAP3_uc010uuz.1_Missense_Mutation_p.L379Q|BAIAP3_uc010uva.1_Missense_Mutation_p.L351Q|BAIAP3_uc010uvc.1_Missense_Mutation_p.L343Q	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	414					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGCCATCTGCTGCGGTTGGAG	0.672			NA											4	24					0	0	0.001984	0	0
ITGAL	3683	broad.mit.edu	37	16	30495497	30495497	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:30495497G>A	uc002dyi.3	+	9	1095	c.919G>A	c.(919-921)GCG>ACG	p.A307T	ITGAL_uc010veu.1_RNA|ITGAL_uc002dyj.3_Missense_Mutation_p.A224T|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	307	VWFA.|Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	ATCAAAACCCGCGAGCGAGTT	0.473	NSCLC(110;1462 1641 3311 33990 49495)		NA											43	261					0	0	0.007835	0	0
PHKG2	5261	broad.mit.edu	37	16	30768316	30768316	+	Silent	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:30768316C>A	uc002dzk.1	+	10	1212	c.1119C>A	c.(1117-1119)CTC>CTA	p.L373L	PHKG2_uc002dzi.1_Silent_p.L377L|PHKG2_uc002dzj.1_Silent_p.L271L	NM_000294	NP_000285	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	373					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity			ovary(1)	1			Colorectal(24;0.198)			GGGCGGCTCTCTTTCAGCACC	0.612			NA											25	166					3.7963e-18	4.84079e-18	0.00333	1	0
SETD1A	9739	broad.mit.edu	37	16	30972797	30972797	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:30972797C>T	uc002ead.1	+	4	1142	c.456C>T	c.(454-456)GTC>GTT	p.V152V	SETD1A_uc002eae.1_Silent_p.V152V	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	152	RRM.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						AGGAAACGGTCAAAAACCTCC	0.597			NA											7	50					0	0	0.00308	0	0
ITGAM	3684	broad.mit.edu	37	16	31341648	31341648	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:31341648G>T	uc002ebq.2	+	27	3178	c.3080G>T	c.(3079-3081)TGC>TTC	p.C1027F	ITGAM_uc002ebr.2_Missense_Mutation_p.C1028F|ITGAM_uc010can.2_Missense_Mutation_p.C433F	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	1027	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						ATCGCTGTCTGCCAGAGAATC	0.547			NA											17	81					1.50039e-11	1.85433e-11	0.012319	1	0
NLRC5	84166	broad.mit.edu	37	16	57063703	57063703	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:57063703C>T	uc002ekk.1	+	9	2487	c.2262C>T	c.(2260-2262)CTC>CTT	p.L754L	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Silent_p.L559L|NLRC5_uc002ekm.2_Silent_p.L559L|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	754	LRR 3.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				ACAACCAGCTCAGTGACCAGG	0.582			NA											7	45					0	0	0.00308	0	0
NIP7	51388	broad.mit.edu	37	16	69373735	69373735	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:69373735G>A	uc002exa.2	+	1	190	c.3G>A	c.(1-3)ATG>ATA	p.M1I	COG8_uc002ewy.2_5'Flank|COG8_uc002ewz.3_5'Flank|NIP7_uc002exb.2_Missense_Mutation_p.M1I	NM_016101	NP_057185	Q9Y221	NIP7_HUMAN	nuclear import 7	1					ribosome assembly	nucleolus	protein binding|RNA binding			breast(1)	1		Ovarian(137;0.101)				GGGGAAAAATGCGGCCTTTGA	0.592			NA									OREG0023907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	39	380					0	0	0.009718	0	0
TAT	6898	broad.mit.edu	37	16	71604652	71604652	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:71604652C>A	uc002fap.2	-	8	941	c.842G>T	c.(841-843)CGC>CTC	p.R281L		NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	281					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	AACCAGCCAGCGCTTGGCCAG	0.512	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)		NA											5	41					0.000673444	0.000727803	0.008291	1	0
GLG1	2734	broad.mit.edu	37	16	74524978	74524978	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:74524978C>A	uc002fcy.3	-	8	1420	c.1370G>T	c.(1369-1371)CGA>CTA	p.R457L	GLG1_uc002fcx.2_Missense_Mutation_p.R457L|GLG1_uc002fcw.3_Missense_Mutation_p.R446L|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	457	Extracellular (Potential).|Cys-rich GLG1 6.					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						CCGCCCTTTTCGATGTAATCC	0.507			NA											27	138					9.04412e-07	1.05296e-06	0.004656	1	0
WDR59	79726	broad.mit.edu	37	16	74920199	74920199	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr16:74920199G>A	uc002fdh.1	-	24	2617	c.2515C>T	c.(2515-2517)CGA>TGA	p.R839*	WDR59_uc002fdf.1_Nonsense_Mutation_p.R284*|WDR59_uc002fdg.1_Nonsense_Mutation_p.R431*	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	839										ovary(1)|breast(1)	2						TCGCGTTCTCGCTCACGGGGA	0.547			NA											19	152					0	0	0.008871	0	0
ITGAE	3682	broad.mit.edu	37	17	3649126	3649126	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:3649126A>C	uc002fwo.3	-	18	2350	c.2251T>G	c.(2251-2253)TGC>GGC	p.C751G		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	751	Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TCCCTCAGGCAGCCCAGACAG	0.597	NSCLC(182;635 2928 8995 38788)		NA											16	115					0	0	0.007413	0	0
POLR2A	5430	broad.mit.edu	37	17	7405004	7405004	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:7405004A>G	uc002ghf.3	+	14	2539	c.2305A>G	c.(2305-2307)ATG>GTG	p.M769V		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	769					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				CTTCAAGTCTATGGTCGTGTC	0.483			NA											8	79					0	0	0.004482	0	0
TP53	7157	broad.mit.edu	37	17	7577081	7577081	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:7577081T>C	uc002gim.2	-	8	1051	c.857A>G	c.(856-858)GAA>GGA	p.E286G	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E286G|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E154G|TP53_uc010cng.1_Missense_Mutation_p.E154G|TP53_uc002gii.1_Missense_Mutation_p.E154G|TP53_uc010cnh.1_Missense_Mutation_p.E286G|TP53_uc010cni.1_Missense_Mutation_p.E286G|TP53_uc002gij.2_Missense_Mutation_p.E286G	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	286	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> V (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> G (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E286K(50)|p.E286*(14)|p.E286G(14)|p.0?(7)|p.E286V(6)|p.E286Q(5)|p.?(2)|p.E286D(2)|p.E286E(2)|p.R283fs*16(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.E286A(1)|p.V272_K292del21(1)|p.E285_L289delEEENL(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GAGATTCTCTTCCTCTGTGCG	0.562	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			11	53					0	0	0.010729	0	0
C17orf48	56985	broad.mit.edu	37	17	10614344	10614344	+	Silent	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:10614344A>T	uc002gmt.2	+	4	987	c.912A>T	c.(910-912)CCA>CCT	p.P304P	C17orf48_uc002gmu.2_RNA|C17orf48_uc002gmv.2_RNA	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase	304							ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						AAACAGCTCCAGACAGCCAAG	0.433			NA											11	77					0	0	0.008291	0	0
NLE1	54475	broad.mit.edu	37	17	33460195	33460195	+	Silent	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:33460195G>C	uc002hiy.1	-	12	1468	c.1440C>G	c.(1438-1440)CTC>CTG	p.L480L	NLE1_uc010ctn.1_Intron|NLE1_uc002hiz.1_Silent_p.L188L	NM_018096	NP_060566	Q9NVX2	NLE1_HUMAN	Notchless gene homolog isoform a	480	WD 8.					nucleolus				breast(3)|ovary(1)	4		Ovarian(249;0.17)				CTCACATCCGGAGGCATTTGT	0.557			NA											11	111					0	0	0.004007	0	0
MED1	5469	broad.mit.edu	37	17	37566052	37566052	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:37566052G>A	uc002hrv.3	-	17	2634	c.2422C>T	c.(2422-2424)CGA>TGA	p.R808*	MED1_uc010wee.1_Nonsense_Mutation_p.R636*|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	808	Interaction with ESR1.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GAAGAATCTCGAAGAGGGGTG	0.443	Pancreas(21;279 768 2492 4877 24026)		NA								HNSCC(31;0.082)			41	142					0	0	0.01441	0	0
BRCA1	672	broad.mit.edu	37	17	41244550	41244550	+	Missense_Mutation	SNP	C	C	G	rs80357124		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:41244550C>G	uc002icq.2	-	10	3230	c.2998G>C	c.(2998-3000)GAG>CAG	p.E1000Q	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.E929Q|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.E953Q|BRCA1_uc002ict.2_Missense_Mutation_p.E1000Q|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.E1000Q|BRCA1_uc002ide.1_Missense_Mutation_p.E831Q|BRCA1_uc010cyy.1_Missense_Mutation_p.E1000Q|BRCA1_uc010whs.1_Missense_Mutation_p.E1000Q|BRCA1_uc010cyz.2_Missense_Mutation_p.E953Q|BRCA1_uc010cza.2_Missense_Mutation_p.E974Q|BRCA1_uc010wht.1_Missense_Mutation_p.E704Q	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1000					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAGTTTTCCTCTAGCAGATTT	0.343			NA	D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			9	167					0	0	0.004482	0	0
DGKE	8526	broad.mit.edu	37	17	54912529	54912529	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:54912529C>T	uc002iur.2	+	2	553	c.373C>T	c.(373-375)CAC>TAC	p.H125Y	DGKE_uc002ius.1_Missense_Mutation_p.H125Y|C17orf67_uc002iuq.2_5'Flank	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	125	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)					CGCCATGCCCCACCACTGGAT	0.577			NA											11	95					0	0	0.010729	0	0
PPM1D	8493	broad.mit.edu	37	17	58725387	58725387	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:58725387C>G	uc002iyt.1	+	4	1183	c.961C>G	c.(961-963)CCA>GCA	p.P321A	PPM1D_uc010ddm.1_RNA	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D	321	PP2C-like.				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GAATATGATTCCACCACAAGA	0.408			NA											29	142					0	0	0.007291	0	0
TANC2	26115	broad.mit.edu	37	17	61498475	61498475	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:61498475A>G	uc002jal.3	+	25	5155	c.5132A>G	c.(5131-5133)TAC>TGC	p.Y1711C	TANC2_uc010wpe.1_3'UTR|TANC2_uc002jao.3_Missense_Mutation_p.Y822C	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1711							binding			ovary(2)	2						GGCGTGAGATACAGCCAGACA	0.557			NA											23	238					0	0	0.014323	0	0
POLG2	11232	broad.mit.edu	37	17	62492601	62492601	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:62492601C>T	uc002jei.2	-	1	569	c.486G>A	c.(484-486)CTG>CTA	p.L162L	POLG2_uc010deg.1_Silent_p.L162L	NM_007215	NP_009146	Q9UHN1	DPOG2_HUMAN	DNA polymerase subunit gamma-2, mitochondrial	162					DNA repair|DNA-dependent DNA replication|glycyl-tRNA aminoacylation	mitochondrial chromosome	ATP binding|DNA-directed DNA polymerase activity|glycine-tRNA ligase activity|identical protein binding|single-stranded DNA binding			central_nervous_system(1)	1	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			GTTCCTTACTCAGCTCTTTGT	0.473	Colon(3;18 21 435 17652 48887)		NA											38	207					0	0	0.004878	0	0
SLC39A11	201266	broad.mit.edu	37	17	70732859	70732859	+	Splice_Site	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:70732859C>G	uc002jjb.2	-	7	738	c.623_splice	c.e7-1	p.E208_splice	SLC39A11_uc002jja.2_Splice_Site_p.E201_splice	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						GCGAGACCCTCTGAAATAGAT	0.483	NSCLC(95;736 1527 12296 39625 41839)		NA											14	144					0	0	0.003163	0	0
COG1	9382	broad.mit.edu	37	17	71197584	71197584	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:71197584G>A	uc002jjg.2	+	7	1654	c.1618G>A	c.(1618-1620)GAC>AAC	p.D540N	COG1_uc002jjh.2_Missense_Mutation_p.D540N|COG1_uc002jjf.1_Missense_Mutation_p.D540N	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	540					Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			CCCCTCTGATGACTCATCACT	0.532			NA											28	274					0	0	0.00632	0	0
CD300LB	124599	broad.mit.edu	37	17	72527484	72527484	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr17:72527484C>A	uc002jkx.2	-	1	130	c.117G>T	c.(115-117)TGG>TGT	p.W39C	CD300LB_uc010wqz.1_Missense_Mutation_p.W39C	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	2						integral to membrane|plasma membrane	receptor activity			ovary(1)	1						CAGGGGGCAGCCACATGGCTC	0.627			NA											13	87					1.5842e-08	1.91855e-08	0.001855	1	0
CLUL1	27098	broad.mit.edu	37	18	645015	645015	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:645015G>A	uc002kkp.2	+	8	1460	c.1315G>A	c.(1315-1317)GAA>AAA	p.E439K	CLUL1_uc010wys.1_Missense_Mutation_p.E491K|CLUL1_uc002kkq.2_Missense_Mutation_p.E439K	NM_014410	NP_055225	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal) precursor	439					cell death	extracellular region				ovary(2)	2						GATCCCTCTTGAAGAAAGTGC	0.393			NA											24	95					0	0	0.005443	0	0
TWSG1	57045	broad.mit.edu	37	18	9396447	9396447	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:9396447G>A	uc002knz.2	+	4	584	c.393G>A	c.(391-393)GAG>GAA	p.E131E	TWSG1_uc002koa.2_Silent_p.E56E	NM_020648	NP_065699	Q9GZX9	TWSG1_HUMAN	twisted gastrulation precursor	131										ovary(1)|pancreas(1)	2						CACATCATGAGAATCTGGTTT	0.448			NA											9	136					0	0	0.006214	0	0
GALNT1	2589	broad.mit.edu	37	18	33282891	33282891	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:33282891G>C	uc010dmu.2	+	10	1383	c.1330G>C	c.(1330-1332)GAT>CAT	p.D444H	GALNT1_uc002kyz.3_Missense_Mutation_p.D384H|GALNT1_uc002kzb.2_Missense_Mutation_p.D444H	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	444	Lumenal (Potential).|Ricin B-type lectin.				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						TCAGTGTCTAGATAACATGGC	0.343			NA											12	77					0	0	0.003163	0	0
PIK3C3	5289	broad.mit.edu	37	18	39647380	39647380	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:39647380C>T	uc002lap.2	+	24	2610	c.2552C>T	c.(2551-2553)TCG>TTG	p.S851L	PIK3C3_uc010xcl.1_Missense_Mutation_p.S788L|PIK3C3_uc002laq.2_Missense_Mutation_p.S336L	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	851	PI3K/PI4K.				cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						TTAGACCTGTCGGATGAAGAG	0.423	NSCLC(37;552 1060 2683 16430 37914)		NA								TSP Lung(28;0.18)			12	48					0	0	0.00499	0	0
ATP5A1	498	broad.mit.edu	37	18	43671709	43671709	+	Missense_Mutation	SNP	C	C	T	rs146467617	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:43671709C>T	uc002lbr.1	-	3	338	c.248G>A	c.(247-249)CGC>CAC	p.R83H	ATP5A1_uc010dnl.1_Missense_Mutation_p.R33H|ATP5A1_uc002lbs.1_Missense_Mutation_p.R33H|ATP5A1_uc002lbt.1_Missense_Mutation_p.R83H|ATP5A1_uc010xct.1_Missense_Mutation_p.R33H|ATP5A1_uc010dnm.1_RNA	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	83					ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						CCCATGTACGCGGGCAATACC	0.393			NA											20	141					0	0	0.008871	0	0
ALPK2	115701	broad.mit.edu	37	18	56203560	56203560	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:56203560C>G	uc002lhj.3	-	5	4073	c.3859G>C	c.(3859-3861)GAA>CAA	p.E1287Q	ALPK2_uc002lhk.1_Missense_Mutation_p.E618Q	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1287							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						GGGGCCAATTCAGGCACAACA	0.507			NA											13	219					0	0	0.00245	0	0
TNFRSF11A	8792	broad.mit.edu	37	18	60028991	60028991	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr18:60028991G>T	uc002lin.2	+	7	733	c.695G>T	c.(694-696)GGC>GTC	p.G232V	TNFRSF11A_uc010dpv.2_Intron	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	232	Helical; (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				ATCATCTTTGGCGTTTGCTAT	0.413			NA							Paget_Disease_of_Bone				71	414					6.07461e-23	7.91341e-23	0.01441	1	0
FUT3	2525	broad.mit.edu	37	19	5844225	5844225	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:5844225T>C	uc002mdk.2	-	2	723	c.626A>G	c.(625-627)TAC>TGC	p.Y209C	FUT3_uc002mdm.2_Missense_Mutation_p.Y209C|FUT3_uc002mdj.2_Missense_Mutation_p.Y209C|FUT3_uc002mdl.2_Missense_Mutation_p.Y209C	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	209	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						GCTCTGGTAGTAGCGCACCCT	0.657	Esophageal Squamous(82;745 1728 24593 44831)		NA											22	96					0	0	0.010504	0	0
QTRT1	81890	broad.mit.edu	37	19	10823252	10823252	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:10823252G>C	uc002mpr.2	+	7	834	c.809G>C	c.(808-810)TGC>TCC	p.C270S	DNM2_uc010dxk.2_5'Flank	NM_031209	NP_112486	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	270					queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity			skin(1)	1			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CTGGTAGTCTGCGTGGCTCTT	0.642			NA											32	248					0	0	0.003755	0	0
ZNF763	284390	broad.mit.edu	37	19	12087895	12087895	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:12087895G>T	uc002msw.2	+	2	201	c.46G>T	c.(46-48)GAG>TAG	p.E16*	ZNF763_uc010xmf.1_Nonsense_Mutation_p.E36*|ZNF763_uc002msv.2_Nonsense_Mutation_p.E19*|ZNF763_uc010xmg.1_Intron	NM_001012753	NP_001012771	Q0D2J5	ZN763_HUMAN	zinc finger protein 763	16	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						CTTCACCCAGGAGGAGTGGGC	0.507			NA											23	162					1.22574e-08	1.49193e-08	0.014323	1	0
FARSA	2193	broad.mit.edu	37	19	13035487	13035487	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:13035487G>A	uc002mvs.2	-	10	1209	c.1161C>T	c.(1159-1161)CTC>CTT	p.L387L	FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Silent_p.L356L|FARSA_uc010dyy.1_Silent_p.L308L	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	387					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	GAACGCCCATGAGGTGGCCCA	0.637			NA											7	68					0	0	0.00308	0	0
FAM129C	199786	broad.mit.edu	37	19	17653042	17653042	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:17653042C>T	uc010xpr.1	+	11	1499	c.1361C>T	c.(1360-1362)GCA>GTA	p.A454V	FAM129C_uc010xpq.1_Missense_Mutation_p.A454V|FAM129C_uc002ngy.3_Missense_Mutation_p.A180V|FAM129C_uc010xpu.1_Missense_Mutation_p.A180V|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Missense_Mutation_p.A180V|FAM129C_uc002nhb.2_Missense_Mutation_p.A53V	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	454											0						CAGCTGGCAGCACCGTTTGGC	0.627			NA											37	274					0	0	0.00623	0	0
ZNF257	113835	broad.mit.edu	37	19	22272062	22272062	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:22272062C>G	uc010ecx.2	+	4	1679	c.1510C>G	c.(1510-1512)CAA>GAA	p.Q504E	ZNF257_uc010ecy.2_Missense_Mutation_p.Q472E	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	504	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACACCTTTCTCAACATAAGAT	0.383			NA											10	54					0	0	0.006214	0	0
NPHS1	4868	broad.mit.edu	37	19	36322010	36322010	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:36322010C>T	uc002oby.2	-	27	3426	c.3426G>A	c.(3424-3426)CTG>CTA	p.L1142L	NPHS1_uc010eem.1_RNA	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	1142	Cytoplasmic (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGAAGTCCCTCAGGGAGCGGT	0.587			NA											29	149					0	0	0.010818	0	0
SFRS16	11129	broad.mit.edu	37	19	45559743	45559743	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:45559743G>A	uc002pak.2	+	6	513	c.415G>A	c.(415-417)GAT>AAT	p.D139N	SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Missense_Mutation_p.D77N|SFRS16_uc002pam.2_Missense_Mutation_p.D139N|SFRS16_uc002pan.1_RNA	NM_007056	NP_008987	Q8N2M8	CLASR_HUMAN	splicing factor, arginine/serine-rich 16	139					mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GATCTACATTGATGAGTTGTA	0.552			NA											9	131					0	0	0.010729	0	0
ZC3H4	23211	broad.mit.edu	37	19	47569697	47569697	+	Silent	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:47569697C>A	uc002pga.3	-	15	3866	c.3828G>T	c.(3826-3828)CCG>CCT	p.P1276P	ZC3H4_uc002pgb.1_RNA	NM_015168	NP_055983	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1276							nucleic acid binding|zinc ion binding			skin(4)|ovary(2)	6		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		CCTCGCGGGCCGGACTGTTCC	0.637			NA											3	11					6.4e-05	7.10783e-05	0.004672	1	0
CRX	1406	broad.mit.edu	37	19	48342693	48342693	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:48342693G>A	uc002phq.3	+	4	573	c.369G>A	c.(367-369)ACG>ACA	p.T123T		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	123					organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		AGGCGGGCACGTCCCCAAGAC	0.557	Pancreas(57;461 1196 22201 40716 47188)		NA											17	119					0	0	0.007413	0	0
SIGLEC14	100049587	broad.mit.edu	37	19	52149116	52149116	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:52149116G>T	uc002pxf.3	-	3	739	c.619C>A	c.(619-621)CAT>AAT	p.H207N		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	207	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		TTGGTGCCATGGTCCTCGGGC	0.632			NA											7	73					0.00198382	0.00210617	0.001984	1	0
ZNF616	90317	broad.mit.edu	37	19	52618739	52618739	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:52618739G>A	uc002pym.2	-	4	1961	c.1678C>T	c.(1678-1680)CAA>TAA	p.Q560*	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	560	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CGTGAACATTGACTGAAGACC	0.438			NA											10	94					0	0	0.008291	0	0
TSEN34	79042	broad.mit.edu	37	19	54696204	54696204	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr19:54696204G>C	uc002qdu.2	+	4	834	c.725G>C	c.(724-726)GGT>GCT	p.G242A	MBOAT7_uc002qdq.2_5'Flank|MBOAT7_uc002qdr.2_5'Flank|MBOAT7_uc002qds.2_5'Flank|MBOAT7_uc010yen.1_5'Flank|MBOAT7_uc002qdt.3_5'Flank|TSEN34_uc010yeo.1_Missense_Mutation_p.G242A|TSEN34_uc002qdv.2_Missense_Mutation_p.G242A|TSEN34_uc002qdw.2_Missense_Mutation_p.G242A	NM_024075	NP_076980	Q9BSV6	SEN34_HUMAN	tRNA-intron endonuclease 34	242					mRNA processing|tRNA-type intron splice site recognition and cleavage	nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity				0	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AAGTTCGGAGGTGACTTCCTG	0.547	Esophageal Squamous(37;841 964 4869 42824)		NA											9	107					0	0	0.004482	0	0
C2orf86	51057	broad.mit.edu	37	2	63666936	63666936	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:63666936C>A	uc002sch.2	-	7	900	c.454G>T	c.(454-456)GAC>TAC	p.D152Y	C2orf86_uc002scf.2_5'Flank|C2orf86_uc010ypu.1_5'Flank|C2orf86_uc002scg.2_5'UTR|C2orf86_uc002sci.1_Missense_Mutation_p.D128Y|C2orf86_uc010fcr.1_Missense_Mutation_p.D42Y	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	152					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0						AGGCTTCTGTCAATCACCACT	0.507			NA											23	115					0.00047179	0.000512168	0.00333	1	0
MOGS	7841	broad.mit.edu	37	2	74690085	74690085	+	Silent	SNP	T	T	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:74690085T>G	uc010ffj.2	-	4	994	c.831A>C	c.(829-831)GTA>GTC	p.V277V	MOGS_uc010ffh.2_Silent_p.V2V|MOGS_uc010yrt.1_Silent_p.V158V|MOGS_uc010ffi.2_Silent_p.V171V|MOGS_uc010yru.1_3'UTR	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	277	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0						GGCGACTCTTTACCATCTCTG	0.537			NA											45	318					0	0	0.01441	0	0
RETSAT	54884	broad.mit.edu	37	2	85576586	85576586	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:85576586C>T	uc002spd.2	-	5	1109	c.918G>A	c.(916-918)GTG>GTA	p.V306V	RETSAT_uc010fge.2_RNA|RETSAT_uc010ysm.1_Silent_p.V245V|RETSAT_uc010fgf.2_Silent_p.V97V	NM_017750	NP_060220	Q6NUM9	RETST_HUMAN	all-trans-13,14-dihydroretinol saturase	306					retinol metabolic process	endoplasmic reticulum membrane|nuclear outer membrane	all-trans-retinol 13,14-reductase activity|electron carrier activity			ovary(2)	2					Vitamin A(DB00162)	CCCGCTGAATCACAGGGATGG	0.592			NA											10	85					0	0	0.001855	0	0
C2orf40	84417	broad.mit.edu	37	2	106694260	106694260	+	Silent	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:106694260C>A	uc010fjf.2	+	4	433	c.325C>A	c.(325-327)CGA>AGA	p.R109R		NM_032411	NP_115787	Q9H1Z8	AUGN_HUMAN	esophageal cancer related gene 4 protein	109						extracellular region|transport vesicle					0						TAACAGAGATCGAAATGGACA	0.453			NA											14	108					2.23348e-06	2.55104e-06	0.004007	1	0
IL1F6	27179	broad.mit.edu	37	2	113763598	113763598	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:113763598C>T	uc010yxr.1	+	2	58	c.58C>T	c.(58-60)CAT>TAT	p.H20Y		NM_014440	NP_055255	Q9UHA7	IL36A_HUMAN	interleukin 1 family, member 6 (epsilon)	20					immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding				0						GGATATCAATCATCGGGTGTG	0.473			NA											13	131					0	0	0.00245	0	0
MKI67IP	84365	broad.mit.edu	37	2	122488554	122488554	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:122488554C>T	uc002tnk.2	-	4	556	c.479G>A	c.(478-480)CGG>CAG	p.R160Q	MKI67IP_uc010fls.2_Missense_Mutation_p.R160Q	NM_032390	NP_115766	Q9BYG3	MK67I_HUMAN	MKI67 interacting nucleolar phosphoprotein	160					protein complex assembly|rRNA metabolic process|rRNA transcription	condensed nuclear chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						CTCCTCCATCCGTAGCTTTTG	0.343			NA											16	134					0	0	0.00499	0	0
ACMSD	130013	broad.mit.edu	37	2	135621051	135621051	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:135621051G>A	uc002ttz.2	+	5	403	c.336G>A	c.(334-336)GTG>GTA	p.V112V	ACMSD_uc002tua.2_Silent_p.V54V	NM_138326	NP_612199	Q8TDX5	ACMSD_HUMAN	aminocarboxymuconate semialdehyde decarboxylase	112					quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)		GGAGGTTCGTGGGTCTGGGGA	0.592			NA											18	116					0	0	0.008871	0	0
THSD7B	80731	broad.mit.edu	37	2	138373849	138373849	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:138373849G>A	uc002tva.1	+	17	3441	c.3441G>A	c.(3439-3441)CTG>CTA	p.L1147L	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTTGCCTCCTGAATGAAAATT	0.453			NA											20	143					0	0	0.010504	0	0
PLA2R1	22925	broad.mit.edu	37	2	160836348	160836348	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:160836348C>G	uc002ube.1	-	14	2468	c.2261G>C	c.(2260-2262)AGA>ACA	p.R754T	PLA2R1_uc010zcp.1_Missense_Mutation_p.R754T|PLA2R1_uc002ubf.2_Missense_Mutation_p.R754T	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor	754	Extracellular (Potential).|C-type lectin 4.				endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						TACAGGAGTTCTATCAGACCA	0.428			NA											4	25					0	0	0.009096	0	0
TTN	7273	broad.mit.edu	37	2	179479392	179479392	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:179479392G>T	uc010zfg.1	-	210	41369	c.41145C>A	c.(41143-41145)ACC>ACA	p.T13715T	uc002ump.1_RNA|TTN_uc010zfh.1_Silent_p.T7410T|TTN_uc010zfi.1_Silent_p.T7343T|TTN_uc010zfj.1_Silent_p.T7218T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14642							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGTTTTCCGGTTACGGTGG	0.433			NA											7	44					0.00621372	0.00651089	0.006214	1	0
DNAH7	56171	broad.mit.edu	37	2	196664163	196664163	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:196664163T>C	uc002utj.3	-	55	10311	c.10210A>G	c.(10210-10212)AGA>GGA	p.R3404G		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3404	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CGTCCCAATCTGTTGATTATA	0.393			NA											10	109					0	0	0.010729	0	0
SPAG16	79582	broad.mit.edu	37	2	215274887	215274887	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:215274887G>T	uc002veq.2	+	16	1836	c.1744G>T	c.(1744-1746)GGC>TGC	p.G582C	SPAG16_uc002ver.2_Missense_Mutation_p.G528C|SPAG16_uc010zjk.1_Missense_Mutation_p.G488C|VWC2L_uc002vet.2_5'Flank|VWC2L_uc010zjl.1_5'Flank	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	582	WD 6.				cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TCAGGCAAGTGGCAATGGTGT	0.433			NA											11	104					3.86212e-05	4.30912e-05	0.008291	1	0
SERPINE2	5270	broad.mit.edu	37	2	224847476	224847476	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:224847476C>G	uc002vnu.2	-	6	1150	c.907G>C	c.(907-909)GAT>CAT	p.D303H	SERPINE2_uc002vnt.2_Missense_Mutation_p.D303H|SERPINE2_uc010zlr.1_Missense_Mutation_p.D315H|SERPINE2_uc002vnv.2_Missense_Mutation_p.D303H	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2	303					negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TCCTTCAAATCTGTTTGTGCT	0.353			NA											6	46					0	0	0.001984	0	0
COL4A4	1286	broad.mit.edu	37	2	227924124	227924124	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:227924124C>T	uc010zlt.1	-	28	3034	c.2380G>A	c.(2380-2382)GAA>AAA	p.E794K		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	794	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CTCATACCTTCAGCCCCTGGA	0.517			NA											33	237					0	0	0.004878	0	0
DGKD	8527	broad.mit.edu	37	2	234358641	234358641	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:234358641G>C	uc002vui.1	+	16	1914	c.1902G>C	c.(1900-1902)CAG>CAC	p.Q634H	DGKD_uc002vuj.1_Missense_Mutation_p.Q590H|DGKD_uc010fyh.1_Missense_Mutation_p.Q501H|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	634					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCGATGAGCAGAATGCCCAGA	0.632			NA											6	70					0	0	0.008291	0	0
PDYN	5173	broad.mit.edu	37	20	1961296	1961296	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:1961296C>T	uc010gaj.2	-	3	680	c.438G>A	c.(436-438)ATG>ATA	p.M146I	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.M146I|PDYN_uc010zpt.1_5'UTR	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	146					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						GGGCATCCCTCATCAGCTCAG	0.557			NA											11	152					0	0	0.013537	0	0
HAO1	54363	broad.mit.edu	37	20	7915177	7915177	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:7915177G>T	uc002wmw.1	-	2	267	c.243C>A	c.(241-243)GCC>GCA	p.A81A	HAO1_uc010gbu.2_Silent_p.A81A	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	81	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						TGCGCTGCATGGCCGTAGCCC	0.532			NA											12	135					1.3612e-06	1.57716e-06	0.003163	1	0
TOP1	7150	broad.mit.edu	37	20	39728776	39728776	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:39728776C>G	uc002xjl.2	+	12	1302	c.1056C>G	c.(1054-1056)AAC>AAG	p.N352K	uc002xjn.1_Intron	NM_003286	NP_003277	P11387	TOP1_HUMAN	DNA topoisomerase I	352					DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)	GGATTGCTAACTTCAAGATAG	0.428			NA	T	NUP98	AML*								9	62					0	0	0.004482	0	0
EYA2	2139	broad.mit.edu	37	20	45725774	45725774	+	Missense_Mutation	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:45725774A>T	uc002xsm.2	+	9	1229	c.855A>T	c.(853-855)TTA>TTT	p.L285F	EYA2_uc010ghp.2_Missense_Mutation_p.L285F|EYA2_uc002xsn.2_Missense_Mutation_p.L290F|EYA2_uc002xso.2_Missense_Mutation_p.L285F|EYA2_uc002xsp.2_Missense_Mutation_p.L285F|EYA2_uc002xsq.2_Missense_Mutation_p.L285F	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a	285					DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				TTCACTCCTTACTCACGGGGA	0.423	Pancreas(120;56 1725 18501 25218 43520)		NA											43	294					0	0	0.011902	0	0
TAF4	6874	broad.mit.edu	37	20	60584215	60584215	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:60584215C>T	uc002ybs.2	-	5	1777	c.1777G>A	c.(1777-1779)GTG>ATG	p.V593M		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	593	TAFH.				interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CATTTCTTCACGTTTTCCATA	0.343			NA											9	66					0	0	0.004482	0	0
SRMS	6725	broad.mit.edu	37	20	62178813	62178813	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:62178813C>T	uc002yfi.1	-	1	45	c.4G>A	c.(4-6)GAG>AAG	p.E2K		NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory	2							ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|lung(1)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			AGGAACGGCTCCATCCCCCGG	0.731			NA											7	46					0	0	0.00308	0	0
C21orf29	54084	broad.mit.edu	37	21	45987864	45987864	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr21:45987864C>T	uc002zfe.1	-	2	174	c.108G>A	c.(106-108)GCG>GCA	p.A36A	C21orf29_uc010gpv.1_5'UTR	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	36					cell adhesion	extracellular region	structural molecule activity				0						GGACCACTTCCGCCAGGATGT	0.587			NA											4	45					0	0	0.000602	0	0
MYO18B	84700	broad.mit.edu	37	22	26422991	26422991	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:26422991T>A	uc003abz.1	+	43	7301	c.7051T>A	c.(7051-7053)TGC>AGC	p.C2351S	MYO18B_uc003aca.1_Missense_Mutation_p.C2232S|MYO18B_uc010guy.1_Missense_Mutation_p.C2233S|MYO18B_uc010guz.1_Missense_Mutation_p.C2231S|MYO18B_uc011aka.1_Missense_Mutation_p.C1505S|MYO18B_uc011akb.1_Missense_Mutation_p.C1864S|MYO18B_uc010gva.1_Missense_Mutation_p.C334S|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2351						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ATTCAGTTCCTGCGAGTCCCT	0.562			NA											13	167					0	0	0.003163	0	0
SFI1	9814	broad.mit.edu	37	22	31924785	31924785	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:31924785C>T	uc003ale.2	+	3	595	c.202C>T	c.(202-204)CTA>TTA	p.L68L	SFI1_uc003ald.1_Silent_p.L68L|SFI1_uc003alf.2_Silent_p.L68L|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Silent_p.L68L|SFI1_uc003alh.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	68					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TACCAGTCATCTAGTGCAGTA	0.493			NA											16	151					0	0	0.00499	0	0
CBX7	23492	broad.mit.edu	37	22	39530045	39530045	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:39530045C>T	uc003axb.2	-	6	696	c.607G>A	c.(607-609)GAC>AAC	p.D203N	CBX7_uc003axc.2_Missense_Mutation_p.D110N	NM_175709	NP_783640	O95931	CBX7_HUMAN	chromobox homolog 7	203					chromatin modification|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear chromatin|PcG protein complex				ovary(1)	1	Melanoma(58;0.04)					TCGGCCAGGTCGGCATCTGCT	0.647	GBM(46;845 904 3560 9866 23971)		NA											8	111					0	0	0.006214	0	0
TNRC6B	23112	broad.mit.edu	37	22	40697001	40697001	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr22:40697001G>A	uc011aor.1	+	14	4139	c.3928G>A	c.(3928-3930)GAG>AAG	p.E1310K	TNRC6B_uc003aym.2_Missense_Mutation_p.E506K|TNRC6B_uc003ayn.3_Missense_Mutation_p.E1200K|TNRC6B_uc003ayo.2_Missense_Mutation_p.E1057K	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	1310					gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						CCAACAGCAAGAGCAGCAGGT	0.527			NA											4	20					0	0	0.009096	0	0
CCDC13	152206	broad.mit.edu	37	3	42777198	42777198	+	Splice_Site	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:42777198C>T	uc003cly.3	-	10	1455	c.1371_splice	c.e10+1	p.H457_splice		NM_144719	NP_653320	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13											ovary(1)	1						GCCCTACTCACGTGCACATTG	0.587			NA											33	202					0	0	0.003755	0	0
CCR2	729230	broad.mit.edu	37	3	46399605	46399605	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:46399605G>A	uc003cpn.3	+	2	1072	c.587G>A	c.(586-588)CGA>CAA	p.R196Q	CCR2_uc003cpm.3_Missense_Mutation_p.R196Q	NM_001123041	NP_001116513	P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2 isoform A	196	Extracellular (Potential).				astrocyte cell migration|blood vessel remodeling|cellular defense response|chemokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response|interspecies interaction between organisms|JAK-STAT cascade|monocyte extravasation|negative regulation of adenylate cyclase activity|negative regulation of angiogenesis|negative regulation of eosinophil degranulation|negative regulation of type 2 immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of immune complex clearance by monocytes and macrophages|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-2 production|positive regulation of monocyte chemotaxis|positive regulation of T cell chemotaxis|positive regulation of T cell extravasation|positive regulation of T-helper 1 type immune response|positive regulation of tumor necrosis factor biosynthetic process|regulation of vascular endothelial growth factor production|T-helper 17 cell chemotaxis	cytosol|dendrite|integral to plasma membrane|perikaryon|perinuclear region of cytoplasm|soluble fraction	C-C chemokine receptor activity|CCR2 chemokine receptor binding|protein homodimerization activity			lung(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		TATTTTCCACGAGGATGGAAT	0.458			NA											50	414					0	0	0.01441	0	0
SCAP	22937	broad.mit.edu	37	3	47456639	47456639	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:47456639C>G	uc003crh.1	-	19	3343	c.3088G>C	c.(3088-3090)GAT>CAT	p.D1030H	SCAP_uc011baz.1_Missense_Mutation_p.D774H|SCAP_uc003crg.2_Missense_Mutation_p.D637H|uc003cri.2_RNA	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	1030	Interaction with SREBF2 (By similarity).|Cytoplasmic (By similarity).|WD 3.				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GAGAAGAAATCAAGGGAACCG	0.622	Pancreas(149;978 1908 29304 37806 46700)		NA											5	50					0	0	0.000602	0	0
CELSR3	1951	broad.mit.edu	37	3	48677227	48677227	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:48677227G>A	uc003cul.2	-	34	10072	c.9791C>T	c.(9790-9792)TCA>TTA	p.S3264L	CELSR3_uc003cuf.1_Missense_Mutation_p.S3362L|CELSR3_uc010hkf.2_Missense_Mutation_p.S554L|CELSR3_uc010hkg.2_Missense_Mutation_p.S1247L	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3264	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGTGTGCTTGAAGATTGCAC	0.597			NA											33	178					0	0	0.003755	0	0
P4HTM	54681	broad.mit.edu	37	3	49042348	49042348	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49042348G>T	uc003cvg.2	+	6	1291	c.942G>T	c.(940-942)CTG>CTT	p.L314L	P4HTM_uc003cvh.2_Silent_p.L314L|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	314	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	GCGAGCCGCTGCAGGTTGTTC	0.637			NA											10	75					0.000219431	0.000242582	0.00245	1	0
P4HTM	54681	broad.mit.edu	37	3	49042350	49042350	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49042350A>C	uc003cvg.2	+	6	1293	c.944A>C	c.(943-945)CAG>CCG	p.Q315P	P4HTM_uc003cvh.2_Missense_Mutation_p.Q315P|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	315	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	GAGCCGCTGCAGGTTGTTCGA	0.637			NA											11	75					0	0	0.003163	0	0
LAMB2	3913	broad.mit.edu	37	3	49161339	49161339	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49161339G>A	uc003cwe.2	-	24	3918	c.3619C>T	c.(3619-3621)CGT>TGT	p.R1207C		NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1207	Domain II.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGCTGTGTACGGGCTGCCAAG	0.612			NA											6	55					0	0	0.008291	0	0
MST1	4485	broad.mit.edu	37	3	49724892	49724892	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:49724892G>A	uc003cxg.2	-	4	447	c.375C>T	c.(373-375)ATC>ATT	p.I125I	MST1_uc011bcs.1_Silent_p.I125I|MST1_uc010hkx.2_Silent_p.I46I|MST1_uc011bct.1_Silent_p.I125I|MST1_uc011bcu.1_Intron|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	111	Kringle 1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CATTGTTCATGATGCAGGTCC	0.597	GBM(110;181 1524 8005 22865 46297)		NA											19	87					0	0	0.006122	0	0
FLNB	2317	broad.mit.edu	37	3	58080588	58080588	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:58080588G>T	uc003djj.2	+	5	978	c.813G>T	c.(811-813)GTG>GTT	p.V271V	FLNB_uc010hne.2_Silent_p.V271V|FLNB_uc003djk.2_Silent_p.V271V|FLNB_uc010hnf.2_Silent_p.V271V|FLNB_uc003djl.2_Silent_p.V102V|FLNB_uc003djm.2_Silent_p.V102V	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	271	Filamin 1.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GAAACATGGTGAAGCAGCCAG	0.537			NA											26	178					5.61819e-17	7.12623e-17	0.005443	1	0
KIAA2018	205717	broad.mit.edu	37	3	113375010	113375010	+	Nonsense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:113375010G>C	uc003eam.2	-	7	5930	c.5519C>G	c.(5518-5520)TCA>TGA	p.S1840*	KIAA2018_uc003eal.2_Nonsense_Mutation_p.S1784*	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	1840					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						CTGATGTTCTGAGAGTGACCT	0.448			NA											23	141					0	0	0.014323	0	0
CPNE4	131034	broad.mit.edu	37	3	131261579	131261579	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:131261579C>T	uc003eok.2	-	15	1796	c.1361G>A	c.(1360-1362)CGG>CAG	p.R454Q	CPNE4_uc011blq.1_Missense_Mutation_p.R472Q|CPNE4_uc003eol.2_Missense_Mutation_p.R472Q|CPNE4_uc003eom.2_Missense_Mutation_p.R454Q|CPNE4_uc003eoj.2_Missense_Mutation_p.R5Q	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV	454	VWFA.									upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AATGGCCTCCCGGGTGTCGGC	0.557			NA											8	93					0	0	0.00308	0	0
MED12L	116931	broad.mit.edu	37	3	150883660	150883660	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:150883660C>T	uc003eyp.2	+	10	1423	c.1385C>T	c.(1384-1386)ACG>ATG	p.T462M	MED12L_uc011bnz.1_Missense_Mutation_p.T322M|MED12L_uc003eyn.2_Missense_Mutation_p.T462M|MED12L_uc003eyo.2_Missense_Mutation_p.T462M	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	462					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTTTTGCACACGTTGGAAGTT	0.383			NA											19	183					0	0	0.010504	0	0
SI	6476	broad.mit.edu	37	3	164725726	164725726	+	Missense_Mutation	SNP	C	C	T	rs145734588	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:164725726C>T	uc003fei.2	-	36	4302	c.4240G>A	c.(4240-4242)GAA>AAA	p.E1414K		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1414	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TAATTTAGTTCGTCATTTCTG	0.244			NA								HNSCC(35;0.089)			4	43					0	0	0.009096	0	0
MAP3K13	9175	broad.mit.edu	37	3	185167766	185167766	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:185167766G>T	uc010hyf.2	+	7	1355	c.1089G>T	c.(1087-1089)TGG>TGT	p.W363C	MAP3K13_uc011brt.1_Missense_Mutation_p.W156C|MAP3K13_uc003fph.3_Missense_Mutation_p.W131C|MAP3K13_uc011bru.1_Missense_Mutation_p.W219C|MAP3K13_uc003fpi.2_Missense_Mutation_p.W363C|MAP3K13_uc010hyg.2_Missense_Mutation_p.W53C	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	363	Protein kinase.				activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CCATTATCTGGGGTGTTGGAA	0.468			NA											17	97					3.41278e-10	4.17503e-10	0.00499	1	0
LPP	4026	broad.mit.edu	37	3	188426068	188426068	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr3:188426068G>T	uc003frs.1	+	7	1373	c.1127G>T	c.(1126-1128)GGG>GTG	p.G376V	LPP_uc011bsg.1_Missense_Mutation_p.G229V|LPP_uc011bsi.1_Missense_Mutation_p.G376V|LPP_uc003frt.2_Missense_Mutation_p.G376V|LPP_uc011bsj.1_Missense_Mutation_p.G213V	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation	376					cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		GGCCATTCAGGGCAACTGGGG	0.517			NA	T	HMGA2|MLL|C12orf9	lipoma|leukemia								12	91					2.27111e-07	2.70959e-07	0.013537	1	0
JAKMIP1	152789	broad.mit.edu	37	4	6055780	6055780	+	Silent	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:6055780G>C	uc003giu.3	-	13	2079	c.1803C>G	c.(1801-1803)CTC>CTG	p.L601L	JAKMIP1_uc010idb.1_Silent_p.L601L|JAKMIP1_uc010idc.1_Silent_p.L416L|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Silent_p.L436L|JAKMIP1_uc003giv.3_Silent_p.L601L|JAKMIP1_uc010ide.2_3'UTR	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	601	Mediates interaction with TYK2 and GABBR1.|Potential.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						CTCTTACTTCGAGTTCTAGCA	0.403			NA											30	251					0	0	0.009535	0	0
TADA2B	93624	broad.mit.edu	37	4	7056332	7056332	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:7056332G>C	uc003gjw.3	+	2	965	c.814G>C	c.(814-816)GAT>CAT	p.D272H	TADA2B_uc010idi.2_Missense_Mutation_p.D197H	NM_152293	NP_689506	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2 (ADA2 homolog,	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|zinc ion binding				0						CAAGGAGTTTGATGACCTTTT	0.522			NA											9	76					0	0	0.008291	0	0
UGT2B10	7365	broad.mit.edu	37	4	69682206	69682206	+	Nonsense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:69682206G>T	uc003hee.2	+	1	494	c.469G>T	c.(469-471)GAG>TAG	p.E157*	UGT2B10_uc011cam.1_Intron	NM_001075	NP_001066	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2B10 isoform 1	157					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						ACCCTGTGGTGAGCTGCTGGC	0.388	Melanoma(133;755 1763 25578 26334 46021)		NA											9	107					4.3838e-07	5.15364e-07	0.001855	1	0
COPS4	51138	broad.mit.edu	37	4	83984321	83984321	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:83984321G>C	uc003hoa.2	+	7	947	c.808G>C	c.(808-810)GAT>CAT	p.D270H	COPS4_uc003hob.2_Missense_Mutation_p.D270H|COPS4_uc010ijw.2_Missense_Mutation_p.D270H|COPS4_uc010ijx.2_Missense_Mutation_p.D270H	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	270	PCI.				cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				AATGTATCTAGATAGGATCAT	0.438			NA											10	80					0	0	0.010729	0	0
TIGD2	166815	broad.mit.edu	37	4	90034222	90034222	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:90034222G>A	uc003hsk.2	+	1	255	c.97G>A	c.(97-99)GTG>ATG	p.V33M	FAM13A_uc003hsh.1_5'Flank	NM_145715	NP_663761	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	33	H-T-H motif (By similarity).|HTH psq-type.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		AAAACTTTCCGTGGTGTACGG	0.373			NA											22	160					0	0	0.012319	0	0
LEF1	51176	broad.mit.edu	37	4	109088908	109088908	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:109088908C>T	uc003hyt.1	-	1	671	c.16G>A	c.(16-18)GGA>AGA	p.G6R	LEF1_uc011cfj.1_5'Flank|LEF1_uc011cfk.1_5'Flank|LEF1_uc003hyu.1_Missense_Mutation_p.G6R|LEF1_uc003hyv.1_Missense_Mutation_p.G6R|LEF1_uc010imb.1_RNA	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1	6	Poly-Gly.|CTNNB1-binding (By similarity).				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		CCACCTCCTCCGGAGAGTTGG	0.647			NA											11	122					0	0	0.008871	0	0
SPATA5	166378	broad.mit.edu	37	4	124235149	124235149	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:124235149C>G	uc003iez.3	+	16	2685	c.2612C>G	c.(2611-2613)CCT>CGT	p.P871R		NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	871					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0						ACTGTGACACCTAGAATTCCT	0.413			NA											12	90					0	0	0.013537	0	0
FHDC1	85462	broad.mit.edu	37	4	153874673	153874673	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr4:153874673G>A	uc003inf.2	+	2	596	c.521G>A	c.(520-522)CGG>CAG	p.R174Q		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	174	FH2.				actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					GATGCAAAACGGAGCATGAAC	0.313			NA											16	96					0	0	0.007413	0	0
RNASEN	29102	broad.mit.edu	37	5	31515172	31515172	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:31515172C>T	uc003jhg.2	-	7	1572	c.1213G>A	c.(1213-1215)GAA>AAA	p.E405K	RNASEN_uc003jhh.2_Missense_Mutation_p.E368K|RNASEN_uc003jhi.2_Missense_Mutation_p.E368K|RNASEN_uc010iui.1_Missense_Mutation_p.E328K	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	405					gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						AGAAGTTCTTCTTCTTCCTCC	0.463			NA											27	162					0	0	0.008361	0	0
NIPBL	25836	broad.mit.edu	37	5	36985803	36985803	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:36985803C>T	uc003jkl.3	+	10	3020	c.2521C>T	c.(2521-2523)CGA>TGA	p.R841*	NIPBL_uc003jkk.3_Nonsense_Mutation_p.R841*|NIPBL_uc003jkm.1_Nonsense_Mutation_p.R720*	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	841					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GTCTAGGGTTCGAAGACCAGA	0.403			NA											9	66					0	0	0.004482	0	0
ARL15	54622	broad.mit.edu	37	5	53467697	53467697	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:53467697C>G	uc003jpg.1	-	2	204	c.110G>C	c.(109-111)TGC>TCC	p.C37S	ARL15_uc010ivs.1_Intron	NM_019087	NP_061960	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	37							GTP binding			ovary(1)	1		Lung NSC(810;0.000779)				GAGGCCTATGCAAACCAGGTC	0.498			NA											7	38					0	0	0.00308	0	0
RNF180	285671	broad.mit.edu	37	5	63509899	63509899	+	Missense_Mutation	SNP	A	A	T	rs142108516		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:63509899A>T	uc003jti.2	+	4	856	c.746A>T	c.(745-747)CAT>CTT	p.H249L	RNF180_uc003jth.3_Missense_Mutation_p.H249L|RNF180_uc010iws.2_Intron	NM_001113561	NP_001107033	Q86T96	RN180_HUMAN	ring finger protein 180 isoform 1	249	Cytoplasmic (Potential).					integral to membrane|nuclear envelope	zinc ion binding				0		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		TATGAAATACATAGTAAGACT	0.358			NA											15	128					0	0	0.004007	0	0
C5orf44	80006	broad.mit.edu	37	5	64956651	64956651	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:64956651G>C	uc003jtz.3	+	10	1154	c.824G>C	c.(823-825)GGA>GCA	p.G275A	C5orf44_uc003jua.3_Missense_Mutation_p.G275A|C5orf44_uc003juc.3_Missense_Mutation_p.G269A|C5orf44_uc010iwv.2_Missense_Mutation_p.G269A	NM_024941	NP_079217	A5PLN9	CE044_HUMAN	hypothetical protein LOC80006 isoform 2	275										ovary(1)	1						ACAGTAATTGGAAAATTGGAT	0.398			NA											8	28					0	0	0.00308	0	0
RGNEF	64283	broad.mit.edu	37	5	73048996	73048996	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:73048996G>A	uc011csq.1	+	3	455	c.444G>A	c.(442-444)GAG>GAA	p.E148E	RGNEF_uc003kcx.2_Silent_p.E148E|RGNEF_uc003kcy.1_Silent_p.E148E|RGNEF_uc010izf.2_Silent_p.E148E	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	148					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		TGCCTCTAGAGTGGACTGTGT	0.512			NA											5	25					0	0	0.001168	0	0
PCDHB11	56125	broad.mit.edu	37	5	140580730	140580730	+	Silent	SNP	C	C	T	rs114264306	byFrequency	TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:140580730C>T	uc003liy.2	+	1	1383	c.1383C>T	c.(1381-1383)CGC>CGT	p.R461R	PCDHB11_uc011daj.1_Silent_p.R96R	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	461	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTCCGCGAGAACAACA	0.592			NA											19	192					0	0	0.00278	0	0
PCDHGC4	56098	broad.mit.edu	37	5	140865098	140865098	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:140865098G>C	uc003lky.1	+	1	358	c.358G>C	c.(358-360)GAG>CAG	p.E120Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Missense_Mutation_p.E120Q	NM_018928	NP_061751	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4 isoform 1	120	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACCGAGCAGAGGTAGAGAT	0.577			NA											11	134					0	0	0.008291	0	0
ZNF354C	30832	broad.mit.edu	37	5	178506452	178506452	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:178506452G>A	uc003mju.2	+	5	1134	c.1019G>A	c.(1018-1020)AGA>AAA	p.R340K		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	340	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TTCAACTGTAGAGCAAAACTT	0.428			NA											16	290					0	0	0.006122	0	0
ADAMTS2	9509	broad.mit.edu	37	5	178581848	178581848	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr5:178581848G>A	uc003mjw.2	-	7	1205	c.1205C>T	c.(1204-1206)TCA>TTA	p.S402L	ADAMTS2_uc011dgm.1_Missense_Mutation_p.S402L	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	402	Peptidase M12B.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CACAAACGCTGAGGAGAAGCC	0.652			NA											4	15					0	0	0.000602	0	0
DAAM2	23500	broad.mit.edu	37	6	39835326	39835326	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:39835326C>G	uc003oow.2	+	6	625	c.469C>G	c.(469-471)CTG>GTG	p.L157V	DAAM2_uc010jxc.2_Missense_Mutation_p.L157V|DAAM2_uc003oox.2_Missense_Mutation_p.L157V	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	157	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTTGACCTGTCTGCTAAATTT	0.478			NA											9	131					0	0	0.004482	0	0
C6orf138	442213	broad.mit.edu	37	6	47976380	47976380	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:47976380G>T	uc011dwm.1	-	2	931	c.846C>A	c.(844-846)TTC>TTA	p.F282L	C6orf138_uc011dwn.1_Missense_Mutation_p.F46L|C6orf138_uc003ozf.2_Missense_Mutation_p.F299L	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	299	Helical; (Potential).|SSD.					integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						CCATGGCGAAGAACGGGATTC	0.473			NA											7	28					3.09899e-07	3.67909e-07	0.004482	1	0
DST	667	broad.mit.edu	37	6	56371470	56371470	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:56371470C>G	uc003pdf.2	-	70	13028	c.13000G>C	c.(13000-13002)GAT>CAT	p.D4334H	DST_uc003pcz.3_Missense_Mutation_p.D4156H|DST_uc011dxj.1_Missense_Mutation_p.D4185H|DST_uc011dxk.1_Missense_Mutation_p.D4196H|DST_uc003pcy.3_Missense_Mutation_p.D3830H	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6242	Spectrin 13.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGTACCTCATCTATACTCTTC	0.358			NA											8	50					0	0	0.004482	0	0
ELOVL4	6785	broad.mit.edu	37	6	80629227	80629227	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:80629227C>T	uc003pja.3	-	5	898	c.579G>A	c.(577-579)GTG>GTA	p.V193V	ELOVL4_uc011dyt.1_Intron	NM_022726	NP_073563	Q9GZR5	ELOV4_HUMAN	elongation of very long chain fatty acids-like	193	Helical; (Potential).				fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups			ovary(1)|skin(1)	2		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	AGTACATAATCACATGGATAA	0.363			NA											15	61					0	0	0.004007	0	0
CNR1	1268	broad.mit.edu	37	6	88854698	88854698	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:88854698C>G	uc011dzq.1	-	2	3859	c.296G>C	c.(295-297)GGG>GCG	p.G99A	CNR1_uc010kbz.2_Missense_Mutation_p.G99A|CNR1_uc011dzr.1_Missense_Mutation_p.G99A|CNR1_uc011dzs.1_Missense_Mutation_p.G99A|CNR1_uc003pmq.3_Missense_Mutation_p.G99A|CNR1_uc011dzt.1_Missense_Mutation_p.G99A|CNR1_uc010kca.2_Missense_Mutation_p.G66A	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	99	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	GAAGTTCTCCCCACACTGGAT	0.532			NA											7	75					0	0	0.00308	0	0
ASCC3	10973	broad.mit.edu	37	6	100957385	100957385	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:100957385C>G	uc003pqk.2	-	42	6815	c.6486G>C	c.(6484-6486)ATG>ATC	p.M2162I		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	2162	SEC63 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AGCAGTCACTCATGAAATATA	0.358			NA											10	111					0	0	0.010729	0	0
C6orf170	221322	broad.mit.edu	37	6	121624836	121624836	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:121624836G>A	uc003pyo.1	-	9	1075	c.1007C>T	c.(1006-1008)TCA>TTA	p.S336L	C6orf170_uc003pyq.1_RNA	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	336					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		AATCTTTTGTGAGACAACATG	0.318			NA											8	38					0	0	0.006214	0	0
HIVEP2	3097	broad.mit.edu	37	6	143095798	143095798	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:143095798C>G	uc003qjd.2	-	5	821	c.78G>C	c.(76-78)TGG>TGC	p.W26C		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	26					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GTTCCTGTCTCCATCTACCTG	0.448	Esophageal Squamous(107;843 1510 13293 16805 42198)		NA											26	300					0	0	0.003954	0	0
MAP3K4	4216	broad.mit.edu	37	6	161470184	161470184	+	Missense_Mutation	SNP	A	A	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr6:161470184A>T	uc003qtn.2	+	3	1022	c.880A>T	c.(880-882)ATT>TTT	p.I294F	MAP3K4_uc010kkc.1_Missense_Mutation_p.I294F|MAP3K4_uc003qto.2_Missense_Mutation_p.I294F|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	294					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CATCCCAGATATTATTAATGA	0.428			NA											15	97					0	0	0.003163	0	0
HOXA6	3203	broad.mit.edu	37	7	27187160	27187160	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:27187160G>T	uc003syo.1	-	1	209	c.209C>A	c.(208-210)GCG>GAG	p.A70E	uc003syp.1_Intron|HOXA6_uc003syq.1_Intron	NM_024014	NP_076919	P31267	HXA6_HUMAN	homeobox A6	70						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CTCGTAGGACGCCCGGTTGCA	0.637			NA											26	78					4.87955e-14	6.12486e-14	0.005443	1	0
INHBA	3624	broad.mit.edu	37	7	41729294	41729294	+	Missense_Mutation	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:41729294T>C	uc003thq.2	-	2	1470	c.1235A>G	c.(1234-1236)AAA>AGA	p.K412R	INHBA_uc003thr.2_Missense_Mutation_p.K412R	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	412					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						AATGTCCTTTTTGATGATGTT	0.522			NA								TSP Lung(11;0.080)			39	91					0	0	0.011902	0	0
SEMA3A	10371	broad.mit.edu	37	7	83640502	83640502	+	Silent	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:83640502G>A	uc003uhz.2	-	8	1237	c.922C>T	c.(922-924)CTG>TTG	p.L308L		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	308	Sema.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						TTCTTACGCAGTTCATCAAAA	0.383			NA											5	67					0	0	0.000602	0	0
AKAP9	10142	broad.mit.edu	37	7	91660865	91660865	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:91660865G>A	uc003ulg.2	+	16	4510	c.4285G>A	c.(4285-4287)GTT>ATT	p.V1429I	AKAP9_uc003ule.2_Missense_Mutation_p.V1441I|AKAP9_uc003ulf.2_Missense_Mutation_p.V1429I|AKAP9_uc003uli.2_Missense_Mutation_p.V1054I	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	1441	Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AACAAATATCGTTAAGTTGCT	0.284			NA	T	BRAF	papillary thyroid								15	97					0	0	0.003163	0	0
AKAP9	10142	broad.mit.edu	37	7	91700233	91700233	+	Silent	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:91700233A>G	uc003ulg.2	+	28	6747	c.6522A>G	c.(6520-6522)AAA>AAG	p.K2174K	AKAP9_uc003ulf.2_Silent_p.K2166K|AKAP9_uc003uli.2_Silent_p.K1797K|AKAP9_uc003ulj.2_5'UTR	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2186	Potential.|Glu-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGGACCGAAAACACTTTGGAG	0.284			NA	T	BRAF	papillary thyroid								42	102					0	0	0.01441	0	0
ANKRD7	56311	broad.mit.edu	37	7	117876197	117876197	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:117876197C>G	uc003vji.2	+	4	744	c.571C>G	c.(571-573)CAA>GAA	p.Q191E		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	191	ANK 5.				male gonad development						0						AGATAATTATCAAAGGTATAA	0.259			NA											28	81					0	0	0.008361	0	0
LRRC4	64101	broad.mit.edu	37	7	127670635	127670635	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:127670635G>A	uc003vmk.2	-	2	196	c.59C>T	c.(58-60)CCG>CTG	p.P20L	SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	NM_022143	NP_071426	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4 precursor	20						cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4				Lung(243;0.124)		GTAGACGAACGGGAGCAGGAT	0.597			NA											17	140					0	0	0.00499	0	0
CPA4	51200	broad.mit.edu	37	7	129945750	129945750	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:129945750C>A	uc003vpr.2	+	6	628	c.581C>A	c.(580-582)ACG>AAG	p.T194K	CPA4_uc011kpd.1_Missense_Mutation_p.T161K|CPA4_uc011kpe.1_Missense_Mutation_p.T90K	NM_016352	NP_057436	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4 preproprotein	194					histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					GCAATCTGGACGGCAAGGAAG	0.632			NA											34	91					3.76114e-14	4.74573e-14	0.004289	1	0
MLL3	58508	broad.mit.edu	37	7	151884816	151884816	+	Missense_Mutation	SNP	A	A	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:151884816A>C	uc003wla.2	-	32	4996	c.4777T>G	c.(4777-4779)TCT>GCT	p.S1593A	MLL3_uc003wkz.2_Missense_Mutation_p.S654A	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1593					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TCAGGATAAGAGGATTGTGCA	0.388	Colon(68;14 1149 1884 27689 34759)		NA	N		medulloblastoma								19	159					0	0	0.012319	0	0
KIAA1429	25962	broad.mit.edu	37	8	95508682	95508682	+	Silent	SNP	G	G	A	rs139309146		TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:95508682G>A	uc003ygo.1	-	18	4270	c.4257C>T	c.(4255-4257)CTC>CTT	p.L1419L	KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1419					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTACTTCCATGAGACCATTAT	0.363			NA											19	120					0	0	0.012319	0	0
RGS22	26166	broad.mit.edu	37	8	100990155	100990155	+	Missense_Mutation	SNP	T	T	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:100990155T>G	uc003yjb.1	-	23	3704	c.3509A>C	c.(3508-3510)AAA>ACA	p.K1170T	RGS22_uc003yja.1_Missense_Mutation_p.K989T|RGS22_uc003yjc.1_Missense_Mutation_p.K1158T	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1170	Potential.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CTTTCCAGATTTTTCGTCTTC	0.289			NA											6	80					0	0	0.004482	0	0
PTPRD	5789	broad.mit.edu	37	9	8518128	8518128	+	Silent	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:8518128C>G	uc003zkk.2	-	20	1974	c.1263G>C	c.(1261-1263)CCG>CCC	p.P421P	PTPRD_uc003zkp.2_Silent_p.P421P|PTPRD_uc003zkq.2_Silent_p.P421P|PTPRD_uc003zkr.2_Silent_p.P415P|PTPRD_uc003zks.2_Silent_p.P411P|PTPRD_uc003zkl.2_Silent_p.P421P|PTPRD_uc003zkm.2_Silent_p.P408P|PTPRD_uc003zkn.2_Silent_p.P421P|PTPRD_uc003zko.2_Silent_p.P418P	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	421	Fibronectin type-III 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GGACATCCCTCGGGGCACTGG	0.493			NA								TSP Lung(15;0.13)			25	194					0	0	0.00632	0	0
NFIB	4781	broad.mit.edu	37	9	14150265	14150265	+	Splice_Site	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:14150265C>A	uc003zle.2	-	5	1121	c.686_splice	c.e5-1	p.T229_splice	NFIB_uc003zld.2_Splice_Site|NFIB_uc003zlf.2_Splice_Site_p.T229_splice|NFIB_uc011lmo.1_Splice_Site_p.T229_splice	NM_005596	NP_005587	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		GTTATGGGCGCTGAGGAATAA	0.438	Esophageal Squamous(132;921 1730 14828 40753 46471)		NA	T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								10	206					3.86212e-05	4.30912e-05	0.008291	1	0
ADAMTSL1	92949	broad.mit.edu	37	9	18574179	18574179	+	Missense_Mutation	SNP	T	T	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:18574179T>A	uc003zne.3	+	4	516	c.389T>A	c.(388-390)CTG>CAG	p.L130Q	ADAMTSL1_uc003znb.2_Missense_Mutation_p.L130Q|ADAMTSL1_uc003znc.3_Missense_Mutation_p.L130Q	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	130						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		GGAACAACCCTGGTTGTTGAA	0.443			NA											13	168					0	0	0.00245	0	0
DNAI1	27019	broad.mit.edu	37	9	34514476	34514476	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:34514476C>G	uc003zum.2	+	17	1847	c.1654C>G	c.(1654-1656)CAC>GAC	p.H552D		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	552	WD 3.				cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		GAACCCATACCACACCAAGGT	0.572			NA							Kartagener_syndrome				16	173					0	0	0.00499	0	0
CTSL3	392360	broad.mit.edu	37	9	90388437	90388437	+	Nonsense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:90388437G>A	uc004apm.1	+	3	303	c.297G>A	c.(295-297)TGG>TGA	p.W99*		NR_027917				RecName: Full=Putative cathepsin L-like protein 3;          Short=Cathepsin L-like protein; AltName: Full=HCTSL-s;											ovary(1)	1						TGCAGACCTGGTGGACTGCTC	0.468			NA											14	86					0	0	0.001855	0	0
PALM2-AKAP2	445815	broad.mit.edu	37	9	112705636	112705636	+	Missense_Mutation	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:112705636G>C	uc004bei.2	+	7	1359	c.1167G>C	c.(1165-1167)GAG>GAC	p.E389D	PALM2_uc004bef.2_Missense_Mutation_p.E391D|PALM2_uc004beg.2_Missense_Mutation_p.E357D|PALM2_uc004beh.3_Missense_Mutation_p.E389D|PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	Error:Variant_position_missing_in_Q9Y2D5_after_alignment							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						GGAAGGAAGAGAGCCTAGCTA	0.557			NA											21	130					0	0	0.010504	0	0
BAT2L1	84726	broad.mit.edu	37	9	134371229	134371229	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr9:134371229C>G	uc004can.3	+	31	6713	c.6658C>G	c.(6658-6660)CGG>GGG	p.R2220G	BAT2L1_uc004cao.3_3'UTR|BAT2L1_uc004cap.3_Missense_Mutation_p.R366G|BAT2L1_uc011mch.1_Missense_Mutation_p.R143G	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	2220							protein binding				0						GATCAAGCCTCGGGCTGTCAA	0.637			NA											4	42					0	0	0.009096	0	0
TLR7	51284	broad.mit.edu	37	X	12904699	12904699	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:12904699G>T	uc004cvc.2	+	3	1211	c.1072G>T	c.(1072-1074)GCA>TCA	p.A358S		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	358	Extracellular (Potential).|LRR 12.				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	GGTCTATCGTGCATCTATGAA	0.388			NA											15	140					2.31682e-05	2.60913e-05	0.003163	1	0
SCML1	6322	broad.mit.edu	37	X	17762333	17762333	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:17762333C>G	uc004cyb.2	+	2	352	c.27C>G	c.(25-27)ATC>ATG	p.I9M	SCML1_uc004cyc.2_Missense_Mutation_p.I9M|SCML1_uc004cyd.2_Intron|SCML1_uc004cye.2_Intron	NM_001037540	NP_001032629	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 isoform a	9					anatomical structure morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)	3	Hepatocellular(33;0.183)					CCAGTGAAATCGATGTGGTTT	0.328			NA											16	140					0	0	0.00499	0	0
MAGEB18	286514	broad.mit.edu	37	X	26157580	26157580	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:26157580C>A	uc004dbq.1	+	2	665	c.478C>A	c.(478-480)CTT>ATT	p.L160I		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	160	MAGE.						protein binding			central_nervous_system(1)	1						GGAGCTGGCACTTGGTGTTGA	0.418			NA											5	28					5.9392e-07	6.94829e-07	0.001168	1	0
ZNF41	7592	broad.mit.edu	37	X	47308566	47308566	+	Missense_Mutation	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:47308566G>T	uc004dhs.3	-	4	796	c.729C>A	c.(727-729)AAC>AAA	p.N243K	ZNF41_uc004dhu.3_Missense_Mutation_p.N235K|ZNF41_uc004dht.3_Missense_Mutation_p.N115K|ZNF41_uc004dhv.3_Missense_Mutation_p.N211K|ZNF41_uc004dhw.3_Missense_Mutation_p.N203K|ZNF41_uc004dhy.3_Missense_Mutation_p.N201K|ZNF41_uc004dhx.3_Missense_Mutation_p.N201K|ZNF41_uc011mlm.1_Missense_Mutation_p.N115K	NM_153380	NP_700359	P51814	ZNF41_HUMAN	zinc finger protein 41	243						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3		all_lung(315;0.000129)				GATTATGTGAGTTTAAAGTAT	0.328			NA											38	210					6.2361e-21	8.03691e-21	0.007835	1	0
ZNF182	7569	broad.mit.edu	37	X	47835779	47835779	+	Silent	SNP	G	G	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:47835779G>T	uc004dir.2	-	7	2053	c.1707C>A	c.(1705-1707)CCC>CCA	p.P569P	ZNF182_uc004dis.2_Silent_p.P550P|ZNF182_uc004dit.2_Silent_p.P569P|ZNF182_uc011mlu.1_Silent_p.P549P	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	569					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						TGCATGCATAGGGTTTCTCTC	0.423			NA											17	92					3.32936e-07	3.93321e-07	0.006122	1	0
PHF8	23133	broad.mit.edu	37	X	54029107	54029107	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:54029107G>A	uc004dsu.2	-	9	1136	c.1063C>T	c.(1063-1065)CAT>TAT	p.H355Y	PHF8_uc004dst.2_Missense_Mutation_p.H319Y|PHF8_uc004dsv.2_Missense_Mutation_p.H185Y|PHF8_uc004dsw.2_Missense_Mutation_p.H319Y|PHF8_uc004dsx.2_Missense_Mutation_p.H83Y|PHF8_uc004dsy.2_Missense_Mutation_p.H319Y	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	355	JmjC.	Iron; catalytic.			brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						AGCACAGCATGGATCCACCCT	0.488			NA											5	63					0	0	0.001168	0	0
FAM120C	54954	broad.mit.edu	37	X	54161289	54161289	+	Missense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:54161289C>T	uc004dsz.3	-	7	1674	c.1591G>A	c.(1591-1593)GAT>AAT	p.D531N	FAM120C_uc011moh.1_Missense_Mutation_p.D531N	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954	531										ovary(1)|central_nervous_system(1)	2						TTTGGCTCATCACCATCAGAG	0.463			NA											8	47					0	0	0.004482	0	0
PGK1	5230	broad.mit.edu	37	X	77373668	77373668	+	Splice_Site	SNP	G	G	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:77373668G>C	uc004ecz.3	+	6	813	c.641_splice	c.e6+1	p.G214_splice	PGK1_uc010nlz.2_Splice_Site|PGK1_uc011mqq.1_Splice_Site_p.G186_splice	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						TCCTGGGCGGGTATGAAGAAC	0.423			NA											14	136					0	0	0.001855	0	0
ZCCHC5	203430	broad.mit.edu	37	X	77912563	77912563	+	Missense_Mutation	SNP	C	C	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:77912563C>A	uc004edc.1	-	2	1651	c.1355G>T	c.(1354-1356)GGT>GTT	p.G452V		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	452	CCHC-type.						nucleic acid binding|zinc ion binding			ovary(1)	1						GGCAAAATGACCAGGATAACC	0.557			NA											7	60					0.00307968	0.00324106	0.00308	1	0
ZCCHC5	203430	broad.mit.edu	37	X	77913582	77913582	+	Silent	SNP	T	T	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:77913582T>C	uc004edc.1	-	2	632	c.336A>G	c.(334-336)CCA>CCG	p.P112P		NM_152694	NP_689907	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	112	Pro-rich.						nucleic acid binding|zinc ion binding			ovary(1)	1						CCAGGGACTCTGGGGCTGCTG	0.642			NA											5	25					0	0	0.000602	0	0
MCART6	401612	broad.mit.edu	37	X	103349436	103349436	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:103349436G>A	uc004elu.2	-	2	686	c.505C>T	c.(505-507)CGG>TGG	p.R169W		NM_001012755	NP_001012773	Q5H9E4	MCAR6_HUMAN	mitochondrial carrier triple repeat 6	169	Solcar 2.				transport	integral to membrane|mitochondrial inner membrane					0						AGTGACAGCCGCCCCCAAAGC	0.532			NA											40	196					0	0	0.007835	0	0
CXorf41	139212	broad.mit.edu	37	X	106466059	106466059	+	Silent	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:106466059C>T	uc004enc.2	+	5	479	c.417C>T	c.(415-417)TGC>TGT	p.C139C	CXorf41_uc004end.2_Silent_p.C139C	NM_173494	NP_775765	Q9NQM4	CX041_HUMAN	hypothetical protein LOC139212	139											0						CAGGTTGTTGCAGTGAACTAG	0.358			NA											26	157					0	0	0.00632	0	0
ZCCHC12	170261	broad.mit.edu	37	X	117960105	117960105	+	Missense_Mutation	SNP	A	A	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:117960105A>G	uc004equ.2	+	4	1371	c.898A>G	c.(898-900)AGA>GGA	p.R300G		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	300					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						AGACAGGGCCAGACCTCAGGA	0.562			NA											28	184					0	0	0.008361	0	0
GRIA3	2892	broad.mit.edu	37	X	122537344	122537344	+	Missense_Mutation	SNP	C	C	G			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:122537344C>G	uc004etq.3	+	10	1560	c.1267C>G	c.(1267-1269)CGG>GGG	p.R423G	GRIA3_uc004etr.3_Missense_Mutation_p.R423G|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.R407G	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	423	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	CTCAGAGAATCGGACCATAGT	0.433			NA											25	220					0	0	0.00333	0	0
CDR1	1038	broad.mit.edu	37	X	139865753	139865753	+	Nonsense_Mutation	SNP	C	C	T			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:139865753C>T	uc004fbg.1	-	1	971	c.779G>A	c.(778-780)TGG>TAG	p.W260*	uc004fbf.1_RNA	NM_004065	NP_004056	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1,	260											0	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CTAGATCTTCCAGTCAATCAG	0.413			NA											22	176					0	0	0.00278	0	0
MTM1	4534	broad.mit.edu	37	X	149839952	149839952	+	Missense_Mutation	SNP	G	G	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:149839952G>A	uc004fef.3	+	15	1772	c.1696G>A	c.(1696-1698)GAA>AAA	p.E566K	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Missense_Mutation_p.E529K|MTM1_uc011mxz.1_Missense_Mutation_p.E451K|MTM1_uc010nte.2_Missense_Mutation_p.E434K	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	566					endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CTTACGCGACGAATACATAAA	0.522			NA											8	70					0	0	0.004482	0	0
GPR50	9248	broad.mit.edu	37	X	150349062	150349063	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	CC	CC	-	-	CC	CC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chrX:150349062_150349063CC>AA	uc010ntg.1	+	2	1142_1143	c.1007_1008CC>AA	c.(1006-1008)GCC>GAA	p.A336E	uc004fes.1_5'Flank|GPR50_uc011myc.1_3'UTR	NM_004224	NP_004215	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	336	Cytoplasmic (Potential).|Pro-rich.				cell-cell signaling	integral to plasma membrane	melatonin receptor activity			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					CGTACCCTGGCCCGCGCCCGTG	0.564			NA											16	196					0	0	0.004672	0	0
KIF26A	26153	broad.mit.edu	37	14	104643849	104643849	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr14:104643849delC	uc001yos.3	+	12	4724	c.4724delC	c.(4723-4725)GCCfs	p.A1575fs		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1575					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCCAGTGGAGCCCCGGGCCGA	0.731			NA											2	4	---	---	---	---	NA	NA	NA	NA	NA
KIDINS220	57498	broad.mit.edu	37	2	8931289	8931289	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:8931289delC	uc002qzc.2	-	13	1524	c.1342delG	c.(1342-1344)GCAfs	p.A448fs	KIDINS220_uc010yiv.1_Frame_Shift_Del_p.A214fs|KIDINS220_uc002qzd.2_Frame_Shift_Del_p.A406fs|KIDINS220_uc010yiw.1_Frame_Shift_Del_p.A449fs	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	448	Cytoplasmic (Potential).|KAP NTPase.				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGAATATCTGCCAGGGCACTG	0.418			NA											13	98	---	---	---	---	NA	NA	NA	NA	NA
DOK1	1796	broad.mit.edu	37	2	74783669	74783669	+	Frame_Shift_Del	DEL	C	C	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr2:74783669delC	uc002sms.2	+	5	896	c.874delC	c.(874-876)CCCfs	p.P292fs	LOXL3_uc002smp.1_5'Flank|LOXL3_uc002smq.1_5'Flank|LOXL3_uc010ffn.1_5'Flank|DOK1_uc002smr.2_Frame_Shift_Del_p.P153fs|DOK1_uc010ffo.2_Frame_Shift_Del_p.P153fs|DOK1_uc002smt.2_Frame_Shift_Del_p.P78fs|DOK1_uc002smu.2_Frame_Shift_Del_p.P78fs|DOK1_uc010yrz.1_Frame_Shift_Del_p.P281fs|DOK1_uc002smv.2_Frame_Shift_Del_p.P153fs|DOK1_uc002smw.1_Frame_Shift_Del_p.P78fs	NM_001381	NP_001372	Q99704	DOK1_HUMAN	docking protein 1	292	Pro-rich.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol|perinuclear region of cytoplasm	insulin receptor binding				0						CCTCGACAGTCCCCCAGCCCT	0.617	Esophageal Squamous(36;520 860 12502 33616 51270)		NA											22	136	---	---	---	---	NA	NA	NA	NA	NA
RPRD1B	58490	broad.mit.edu	37	20	36676873	36676874	+	Frame_Shift_Ins	INS	-	-	C			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr20:36676873_36676874insC	uc002xho.3	+	3	807_808	c.405_406insC	c.(403-408)CCTCCCfs	p.P135fs		NM_021215	NP_067038	Q9NQG5	RPR1B_HUMAN	Regulation of nuclear pre-mRNA domain containing	135_136										pancreas(1)	1						CCAAGAGCCCTCCCCCCAAAGG	0.47			NA											8	86	---	---	---	---	NA	NA	NA	NA	NA
VWC2	375567	broad.mit.edu	37	7	49842429	49842430	+	Frame_Shift_Ins	INS	-	-	A			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr7:49842429_49842430insA	uc003tot.1	+	3	1375_1376	c.819_820insA	c.(817-822)TGCAAAfs	p.C273fs		NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	273_274	VWFC 2.				negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space					0						GTCCCATCTGCAAAAATGGTAT	0.569			NA											19	78	---	---	---	---	NA	NA	NA	NA	NA
RPL30	6156	broad.mit.edu	37	8	99054903	99054904	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	TG	TG	-	-	TG	TG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:99054903_99054904delTG	uc003yif.2	-	4	337_338	c.267_268delCA	c.(265-270)TACAGAfs	p.Y89fs	RPL30_uc010mbk.1_Intron|SNORA72_uc003yig.1_5'Flank	NM_000989	NP_000980	P62888	RL30_HUMAN	ribosomal protein L30	89_90					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			GTGCACACTCTGTAGTATTTTC	0.366			NA											20	133	---	---	---	---	NA	NA	NA	NA	NA
FER1L6	654463	broad.mit.edu	37	8	125074159	125074159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-44-3396-01A-01D-1265-08	TCGA-44-3396-10A-01D-1265-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	d68b216c-b304-4b30-9af7-eb3a9a1a55ae	bffb3f71-7fdc-4be0-ab25-90716d87bcba	g.chr8:125074159delG	uc003yqw.2	+	25	3420	c.3214delG	c.(3214-3216)GGGfs	p.G1072fs	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1072	Cytoplasmic (Potential).|C2 4.					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GAGAGCTTTTGGGAGGAGTAC	0.547			NA											16	195	---	---	---	---	NA	NA	NA	NA	NA
