Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
CHD5	26038	broad.mit.edu	37	1	6203888	6203888	+	Missense_Mutation	SNP	C	C	A	rs139532134		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:6203888C>A	uc001amb.1	-	13	2138	c.2038G>T	c.(2038-2040)GTG>TTG	p.V680L	CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	680					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCACGTCCACAATGGGCGTG	0.617			NA											5	39					8.12818e-05	8.79322e-05	0.001984	1	0
AADACL3	126767	broad.mit.edu	37	1	12785267	12785267	+	Silent	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:12785267C>A	uc009vnn.1	+	4	590	c.357C>A	c.(355-357)TCC>TCA	p.S119S	AADACL3_uc001aug.1_Silent_p.S49S	NM_001103170	NP_001096640	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3 isoform 1	119							hydrolase activity				0	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTGAAGTCCCTGGATGCAT	0.512			NA											15	78					1.05317e-09	1.20507e-09	0.020292	1	0
WNT4	54361	broad.mit.edu	37	1	22447964	22447964	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:22447964C>T	uc001bfs.3	-	3	523	c.419G>A	c.(418-420)AGG>AAG	p.R140K	WNT4_uc010odt.1_Missense_Mutation_p.R77K	NM_030761	NP_110388	P56705	WNT4_HUMAN	wingless-type MMTV integration site family,	140					adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|negative regulation of transcription, DNA-dependent|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription corepressor activity			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ATGCACTGTCCTGTCACAGCC	0.667			NA											13	74					0	0	0.007413	0	0
NRD1	4898	broad.mit.edu	37	1	52283748	52283748	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:52283748G>A	uc001ctc.3	-	12	1877	c.1555C>T	c.(1555-1557)CAA>TAA	p.Q519*	NRD1_uc009vzb.2_Nonsense_Mutation_p.Q214*|NRD1_uc001ctd.3_Nonsense_Mutation_p.Q451*|NRD1_uc001cte.2_Nonsense_Mutation_p.Q387*|NRD1_uc001ctf.2_Nonsense_Mutation_p.Q451*|NRD1_uc010ong.1_RNA|NRD1_uc009vzc.1_Nonsense_Mutation_p.Q319*	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a	450					cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						CTGTAATGTTGCTGTTGAGGA	0.348			NA											3	22					0	0	0.009096	0	0
LMO4	8543	broad.mit.edu	37	1	87805268	87805268	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:87805268G>C	uc001dmi.2	+	3	1066	c.286G>C	c.(286-288)GCG>CCG	p.A96P	LMO4_uc001dmj.2_Missense_Mutation_p.A96P	NM_006769	NP_006760	P61968	LMO4_HUMAN	LIM domain only 4	96	LIM zinc-binding 2.				neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding				0		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		GTCGATTCCTGCGAGTGAACT	0.398			NA											7	34					0	0	0.00308	0	0
LRRC8B	23507	broad.mit.edu	37	1	90058463	90058463	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:90058463A>G	uc001dni.2	+	8	2780	c.2273A>G	c.(2272-2274)AAT>AGT	p.N758S	LRRC8B_uc001dnh.2_Missense_Mutation_p.N758S|LRRC8B_uc001dnj.2_Missense_Mutation_p.N758S	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	758	LRR 13.					integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		CTCATTGGTAATTACCTGGAA	0.433			NA											25	94					0	0	0.01892	0	0
DENND2C	163259	broad.mit.edu	37	1	115168247	115168247	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:115168247C>G	uc001efd.1	-	4	1061	c.359G>C	c.(358-360)CGG>CCG	p.R120P	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.R120P	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	120										skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCTTTGACCCGAGAACATAC	0.348			NA											5	108					0	0	0.014758	0	0
HMGCS2	3158	broad.mit.edu	37	1	120300051	120300051	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:120300051A>T	uc001eid.2	-	5	912	c.861T>A	c.(859-861)GAT>GAA	p.D287E	HMGCS2_uc010oxj.1_Missense_Mutation_p.D245E|HMGCS2_uc001eie.2_Missense_Mutation_p.D195E	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1	287					acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		TGAAGGGTCGATCGCTGCCAG	0.507			NA											7	22					0	0	0.001984	0	0
SLC27A3	11000	broad.mit.edu	37	1	153748035	153748035	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:153748035A>G	uc001fcz.2	+	1	268	c.203A>G	c.(202-204)CAC>CGC	p.H68R	SLC27A3_uc009won.2_RNA	NM_024330	NP_077306	Q5K4L6	S27A3_HUMAN	solute carrier family 27 member 3	68	Helical; (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial membrane	ligase activity|nucleotide binding			ovary(1)	1	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ctgAAGCTACACCTCTGGCCG	0.527			NA											7	13					0	0	0.001984	0	0
FCER1A	2205	broad.mit.edu	37	1	159273855	159273855	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:159273855G>C	uc001ftq.2	+	4	313	c.214G>C	c.(214-216)GAA>CAA	p.E72Q		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	72	Extracellular (Potential).|Ig-like 1.					integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	CAGCCTTTCAGAAGAGACAAA	0.363			NA											12	57					0	0	0.010729	0	0
TSNAX	7257	broad.mit.edu	37	1	231700631	231700631	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:231700631C>G	uc001huw.2	+	6	1011	c.853C>G	c.(853-855)CAA>GAA	p.Q285E	TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	NM_005999	NP_005990	Q99598	TSNAX_HUMAN	translin-associated factor X	285					cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding				0		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				AATGATAGATCAAGAAGAGGG	0.333			NA											6	41					0	0	0.001984	0	0
TSNAX	7257	broad.mit.edu	37	1	231700636	231700636	+	Silent	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:231700636A>G	uc001huw.2	+	6	1016	c.858A>G	c.(856-858)GAA>GAG	p.E286E	TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	NM_005999	NP_005990	Q99598	TSNAX_HUMAN	translin-associated factor X	286					cell differentiation|multicellular organismal development|spermatogenesis	nucleus|perinuclear region of cytoplasm	protein transporter activity|sequence-specific DNA binding				0		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				TAGATCAAGAAGAGGGCATTT	0.328			NA											5	37					0	0	0.001168	0	0
OR2W3	343171	broad.mit.edu	37	1	248059023	248059023	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr1:248059023C>G	uc001idp.1	+	3	404	c.135C>G	c.(133-135)ATC>ATG	p.I45M	OR2W3_uc010pzb.1_Missense_Mutation_p.I45M	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	45	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACACCACCATCATCCTGGTGT	0.582			NA											7	124					0	0	0.00308	0	0
AKR1E2	83592	broad.mit.edu	37	10	4877971	4877971	+	Silent	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:4877971C>G	uc001ihi.2	+	4	544	c.429C>G	c.(427-429)CCC>CCG	p.P143P	AKR1E2_uc001ihl.1_RNA|AKR1E2_uc010qam.1_Silent_p.P104P|AKR1E2_uc001ihh.1_Silent_p.P143P|AKR1E2_uc009xhw.2_Silent_p.P143P|AKR1E2_uc001ihj.2_RNA|AKR1E2_uc001ihk.2_Silent_p.P143P	NM_001040177	NP_001035267	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	143						cytoplasm	1,5-anhydro-D-fructose reductase activity				0						TGGTTATTCCCAGTGACACGG	0.567	NSCLC(43;343 1097 20371 28813 45509)		NA											7	41					0	0	0.00308	0	0
ANKRD26	22852	broad.mit.edu	37	10	27329051	27329051	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:27329051C>T	uc001ith.2	-	21	2387	c.2215G>A	c.(2215-2217)GAA>AAA	p.E739K	ANKRD26_uc001itg.2_Missense_Mutation_p.E426K|ANKRD26_uc009xku.1_Missense_Mutation_p.E740K	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	739						centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TTTTTAAGTTCTAATAATCTT	0.299			NA											10	32					0	0	0.006214	0	0
TMEM20	159371	broad.mit.edu	37	10	95660511	95660511	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:95660511C>T	uc001kjg.1	+	3	423	c.362C>T	c.(361-363)ACT>ATT	p.T121I	TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.T120I|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.T104I|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN	transmembrane protein 20 isoform 1	121	DUF6 1.					integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)		ATTTACAGAACTGGGTTTATA	0.259			NA											7	52					0	0	0.001984	0	0
PDZD7	79955	broad.mit.edu	37	10	102782064	102782064	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:102782064G>A	uc001kso.1	-	5	836	c.621C>T	c.(619-621)GTC>GTT	p.V207V	PDZD7_uc001ksn.2_Silent_p.V207V	NM_024895	NP_079171	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	207						cilium|nucleus	protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CGATGCGCCGGACACCATCTT	0.592			NA											4	32					0	0	0.014758	0	0
WDR11	55717	broad.mit.edu	37	10	122622304	122622304	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:122622304C>T	uc010qtf.1	+	5	822	c.584C>T	c.(583-585)TCA>TTA	p.S195L	WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_5'UTR	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	195						integral to membrane					0						AAGCCTCCCTCAGGCCCTGGG	0.443			NA											7	145					0	0	0.004482	0	0
C10orf90	118611	broad.mit.edu	37	10	128193152	128193152	+	Missense_Mutation	SNP	C	C	T	rs148312578		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:128193152C>T	uc001ljq.2	-	3	738	c.617G>A	c.(616-618)CGG>CAG	p.R206Q	C10orf90_uc001ljp.2_Missense_Mutation_p.R159Q|C10orf90_uc010qum.1_Missense_Mutation_p.R303Q|C10orf90_uc009yao.2_Missense_Mutation_p.R303Q|C10orf90_uc001ljs.1_Missense_Mutation_p.R159Q	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	206								p.R206W(1)		ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		AACCTTCAGCCGCACCACGGA	0.592			NA									OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	76					0	0	0.010729	0	0
ASCL3	56676	broad.mit.edu	37	11	8959615	8959615	+	Nonsense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:8959615C>A	uc001mhd.1	-	2	154	c.94G>T	c.(94-96)GAG>TAG	p.E32*		NM_020646	NP_065697	Q9NQ33	ASCL3_HUMAN	ASCL3	31					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus	DNA binding				0				Epithelial(150;1.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0228)		ACCATGGGCTCCAGATAGAAG	0.547			NA											7	119					1.12685e-05	1.23023e-05	0.004482	1	0
RAG1	5896	broad.mit.edu	37	11	36596221	36596221	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:36596221C>T	uc001mwu.3	+	2	1491	c.1367C>T	c.(1366-1368)GCC>GTC	p.A456V	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	456	NBD.				histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				GAGCTGGAGGCCATCATGCAG	0.557	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)		NA							Familial_Hemophagocytic_Lymphohistiocytosis				8	46					0	0	0.00308	0	0
LRRC4C	57689	broad.mit.edu	37	11	40136625	40136625	+	Silent	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:40136625G>T	uc001mxa.1	-	2	3182	c.1218C>A	c.(1216-1218)CTC>CTA	p.L406L	LRRC4C_uc001mxc.1_Silent_p.L402L|LRRC4C_uc001mxd.1_Silent_p.L402L|LRRC4C_uc001mxb.1_Silent_p.L402L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	406	Ig-like C2-type.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				TACCATCACTGAGCACAGCTA	0.448			NA											23	111					1.1804e-14	1.37713e-14	0.021523	1	0
OR8H3	390152	broad.mit.edu	37	11	55890333	55890333	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:55890333C>A	uc001nii.1	+	1	485	c.485C>A	c.(484-486)TCC>TAC	p.S162Y		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	162	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					AATGTGGTTTCCATGAGCAGA	0.438			NA											34	155					1.36615e-20	1.62571e-20	0.013726	1	0
OR5A1	219982	broad.mit.edu	37	11	59211414	59211414	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:59211414C>T	uc001nnx.1	+	1	773	c.773C>T	c.(772-774)GCC>GTC	p.A258V		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						TTTGGGACAGCCCTTTTCGTG	0.552			NA											30	156					0	0	0.009535	0	0
ARAP1	116985	broad.mit.edu	37	11	72412759	72412759	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:72412759T>G	uc001osu.2	-	16	2426	c.2237A>C	c.(2236-2238)CAC>CCC	p.H746P	ARAP1_uc001osv.2_Missense_Mutation_p.H746P|ARAP1_uc001osr.2_Missense_Mutation_p.H506P|ARAP1_uc001oss.2_Missense_Mutation_p.H501P|ARAP1_uc009yth.2_Missense_Mutation_p.H440P|ARAP1_uc010rre.1_Missense_Mutation_p.H501P|ARAP1_uc001osw.1_Missense_Mutation_p.H34P	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	746	PH 3.				actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						GAAGCCACTGTGGCTCACGGT	0.617	Ovarian(102;1198 1520 13195 17913 37529)		NA											37	159					0	0	0.009718	0	0
P2RY6	5031	broad.mit.edu	37	11	73007896	73007896	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr11:73007896C>T	uc001otm.2	+	4	738	c.333C>T	c.(331-333)CAC>CAT	p.H111H	P2RY6_uc001otn.2_Silent_p.H111H|P2RY6_uc001oto.2_Silent_p.H111H|P2RY6_uc001otp.2_Silent_p.H111H|P2RY6_uc001otq.2_Silent_p.H111H|P2RY6_uc001otr.2_Silent_p.H111H|P2RY6_uc001ots.2_Silent_p.H111H	NM_176796	NP_789766	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y6	111	Helical; Name=3; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1						CCAACCTGCACGGCAGCATCC	0.647			NA											14	106					0	0	0.004007	0	0
KRT1	3848	broad.mit.edu	37	12	53074043	53074043	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:53074043C>T	uc001sau.1	-	1	149	c.90G>A	c.(88-90)AGG>AGA	p.R30R	KRT1_uc001sav.1_Silent_p.R30R	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	30	Head.|Gly/Phe/Ser-rich.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						TGCTGGTGGTCCTGCGCTGGT	0.448			NA											6	38					0	0	0.001984	0	0
HNRNPA1	3178	broad.mit.edu	37	12	54675629	54675629	+	Silent	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:54675629A>G	uc001sfl.2	+	3	287	c.183A>G	c.(181-183)ACA>ACG	p.T61T	CBX5_uc001sfk.3_5'Flank|CBX5_uc001sfi.3_5'Flank|HNRNPA1_uc001sfm.2_Silent_p.T61T|HNRNPA1_uc009zng.2_Silent_p.T61T|HNRNPA1_uc009znh.2_Silent_p.T61T|HNRNPA1_uc009zni.2_Silent_p.T61T|HNRNPA1_uc001sfn.2_Silent_p.T61T|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc001sfp.1_Silent_p.T16T|HNRNPA1_uc009znj.1_Silent_p.T16T	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	61	Globular A domain.|RRM 1.				interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding			skin(2)|ovary(1)	3						GGTTTGTCACATATGCCACTG	0.473	Colon(83;502 1289 8436 16406 24870)		NA											5	36					0	0	0.001168	0	0
COQ10A	93058	broad.mit.edu	37	12	56664024	56664024	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:56664024C>T	uc001sko.3	+	5	928	c.667C>T	c.(667-669)CGT>TGT	p.R223C	COQ10A_uc001skp.3_Missense_Mutation_p.R191C|COQ10A_uc001skq.3_Missense_Mutation_p.R206C	NM_144576	NP_653177	Q96MF6	CQ10A_HUMAN	coenzyme Q10 homolog A isoform a	223						mitochondrial inner membrane				ovary(1)	1						TGCCTTTGAGCGTCGGGCAGC	0.517			NA											4	113					0	0	0.009096	0	0
MBD6	114785	broad.mit.edu	37	12	57919411	57919411	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:57919411C>T	uc001soj.1	+	6	884	c.660C>T	c.(658-660)ATC>ATT	p.I220I	MBD6_uc001sok.1_Silent_p.I87I|MBD6_uc001sol.1_5'Flank	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	220	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						CACCTGCTATCAGCCTCAATG	0.647			NA											6	162					0	0	0.001984	0	0
NAV3	89795	broad.mit.edu	37	12	78516195	78516196	+	Missense_Mutation	DNP	AC	AC	TG			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	AC	AC	-	-	AC	AC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:78516195_78516196AC>TG	uc001syp.2	+	16	4398_4399	c.4225_4226AC>TG	c.(4225-4227)ACT>TGT	p.T1409C	NAV3_uc001syo.2_Missense_Mutation_p.T1409C|NAV3_uc010sub.1_Missense_Mutation_p.T909C|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1409	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TGTGAGATCTACTCTCTCAGAA	0.525			NA								HNSCC(70;0.22)			18	45					0	0	0.004672	0	0
LRRIQ1	84125	broad.mit.edu	37	12	85449827	85449827	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:85449827A>C	uc001tac.2	+	8	1367	c.1256A>C	c.(1255-1257)AAG>ACG	p.K419T	LRRIQ1_uc001tab.1_Missense_Mutation_p.K419T|LRRIQ1_uc001taa.1_Missense_Mutation_p.K394T	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	419										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TCAAATGATAAGGGTGATATA	0.318			NA											15	95					0	0	0.004007	0	0
CMKLR1	1240	broad.mit.edu	37	12	108686166	108686166	+	Missense_Mutation	SNP	T	T	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:108686166T>C	uc009zuw.2	-	3	765	c.574A>G	c.(574-576)AAC>GAC	p.N192D	CMKLR1_uc001tmw.2_Missense_Mutation_p.N192D|CMKLR1_uc001tmv.2_Missense_Mutation_p.N190D|CMKLR1_uc009zuv.2_Missense_Mutation_p.N192D	NM_001142345	NP_001135817	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a	192	Extracellular (Potential).				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						AGGCTGAAGTTGTTGAAGCAG	0.567			NA											6	33					0	0	0.006214	0	0
CMKLR1	1240	broad.mit.edu	37	12	108686195	108686195	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:108686195T>G	uc009zuw.2	-	3	736	c.545A>C	c.(544-546)AAC>ACC	p.N182T	CMKLR1_uc001tmw.2_Missense_Mutation_p.N182T|CMKLR1_uc001tmv.2_Missense_Mutation_p.N180T|CMKLR1_uc009zuv.2_Missense_Mutation_p.N182T	NM_001142345	NP_001135817	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a	182	Extracellular (Potential).				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						CCCATGCAGGTTGGCTGTGTC	0.562			NA											5	29					0	0	0.001984	0	0
CMKLR1	1240	broad.mit.edu	37	12	108686229	108686229	+	Missense_Mutation	SNP	T	T	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:108686229T>G	uc009zuw.2	-	3	702	c.511A>C	c.(511-513)AGT>CGT	p.S171R	CMKLR1_uc001tmw.2_Missense_Mutation_p.S171R|CMKLR1_uc001tmv.2_Missense_Mutation_p.S169R|CMKLR1_uc009zuv.2_Missense_Mutation_p.S171R	NM_001142345	NP_001135817	Q99788	CML1_HUMAN	chemokine-like receptor 1 isoform a	171	Helical; Name=4; (Potential).				chemotaxis|immune response|negative regulation of interleukin-12 production|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage chemotaxis|regulation of calcium-mediated signaling|skeletal system development	integral to plasma membrane	chemokine receptor activity			lung(3)|ovary(1)|pancreas(1)	5						GATGGGGAACTCAAGAAGAAA	0.572			NA											4	37					0	0	0.001168	0	0
RPH3A	22895	broad.mit.edu	37	12	113319638	113319638	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:113319638C>G	uc010syl.1	+	15	1675	c.1313C>G	c.(1312-1314)CCG>CGG	p.P438R	RPH3A_uc001ttz.2_Missense_Mutation_p.P438R|RPH3A_uc001tty.2_Missense_Mutation_p.P434R|RPH3A_uc009zwe.1_Missense_Mutation_p.P434R|RPH3A_uc010sym.1_Missense_Mutation_p.P389R|RPH3A_uc001tua.2_Missense_Mutation_p.P198R	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	438	C2 1.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CACCTCCTGCCGGGAGCCAGC	0.592			NA											4	85					0	0	0.014758	0	0
MYO16	23026	broad.mit.edu	37	13	109496821	109496821	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr13:109496821G>A	uc001vqt.1	+	10	1288	c.1162G>A	c.(1162-1164)GGT>AGT	p.G388S	MYO16_uc010agk.1_Missense_Mutation_p.G410S|MYO16_uc001vqu.1_Missense_Mutation_p.G188S	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	388					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CATGATGAGCGGTTCCACCAA	0.388			NA											7	43					0	0	0.004482	0	0
DYNC1H1	1778	broad.mit.edu	37	14	102500313	102500313	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr14:102500313G>C	uc001yks.2	+	55	10578	c.10414G>C	c.(10414-10416)GTA>CTA	p.V3472L		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	3472	Stalk (By similarity).|Potential.				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TTCCTTTTAGGTAAACCGGAG	0.453			NA											15	58					0	0	0.003163	0	0
OR4N4	283694	broad.mit.edu	37	15	22382659	22382659	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr15:22382659C>T	uc001yuc.1	+	7	1168	c.187C>T	c.(187-189)CTG>TTG	p.L63L	LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Silent_p.L63L	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	63	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTATTTATTTCTGGGCAACTT	0.463			NA											27	268					0	0	0.005524	0	0
BUB1B	701	broad.mit.edu	37	15	40500858	40500858	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr15:40500858G>A	uc001zkx.3	+	16	2242	c.2030G>A	c.(2029-2031)CGT>CAT	p.R677H		NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	677					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		GAAGACAGTCGTGAAGCCACA	0.343			NA	Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				5	34					0	0	0.001984	0	0
TRAP1	10131	broad.mit.edu	37	16	3725361	3725361	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:3725361G>A	uc002cvt.3	-	8	941	c.852C>T	c.(850-852)CCC>CCT	p.P284P	TRAP1_uc002cvs.2_Silent_p.P75P|TRAP1_uc010uxf.1_Silent_p.P231P	NM_016292	NP_057376	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1 precursor	284					cellular response to oxidative stress|protein folding	mitochondrion	ATP binding|tumor necrosis factor receptor binding|unfolded protein binding			central_nervous_system(1)	1		Ovarian(90;0.0261)				TCAAGTACAAGGGGAAGCTGA	0.483			NA											6	28					0	0	0.001984	0	0
CREBBP	1387	broad.mit.edu	37	16	3817765	3817765	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:3817765C>T	uc002cvv.2	-	16	3410	c.3206G>A	c.(3205-3207)GGC>GAC	p.G1069D	CREBBP_uc002cvw.2_Missense_Mutation_p.G1031D	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1069					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	p.G1069S(1)		haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGAGGCTGTGCCGTTACTGCT	0.428			NA	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybsyndrome				4	113					0	0	0.009096	0	0
MMP2	4313	broad.mit.edu	37	16	55522477	55522477	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:55522477C>G	uc002ehz.3	+	6	1166	c.855C>G	c.(853-855)AAC>AAG	p.N285K	MMP2_uc010vhd.1_Missense_Mutation_p.N209K|MMP2_uc010ccc.2_Missense_Mutation_p.N235K	NM_004530	NP_004521	P08253	MMP2_HUMAN	matrix metalloproteinase 2 isoform a	285	Collagen-binding.				angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)	TGGGCGGCAACGCTGAAGGAC	0.612			NA											3	16					0	0	0.009096	0	0
COQ9	57017	broad.mit.edu	37	16	57490845	57490845	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr16:57490845A>G	uc002elq.2	+	5	540	c.524A>G	c.(523-525)AAG>AGG	p.K175R	COQ9_uc010vhn.1_3'UTR|COQ9_uc010vho.1_Missense_Mutation_p.K175R|COQ9_uc010vhp.1_Silent_p.E168E|COQ9_uc002elr.2_Intron|COQ9_uc002els.2_5'Flank	NM_020312	NP_064708	O75208	COQ9_HUMAN	coenzyme Q9 homolog precursor	175					ubiquinone biosynthetic process	mitochondrion				breast(1)	1						TCTTCCAGGAAGAGGAAGACA	0.537			NA											8	23					0	0	0.00308	0	0
MYO1C	4641	broad.mit.edu	37	17	1370595	1370595	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:1370595C>T	uc002fsp.2	-	31	3326	c.3106G>A	c.(3106-3108)GAC>AAC	p.D1036N	MYO1C_uc002fsn.2_Missense_Mutation_p.D1017N|MYO1C_uc002fso.2_Missense_Mutation_p.D1001N	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a	1036					mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGTGTGAAGTCAATGGTGCCA	0.632			NA											4	12					0	0	0.014758	0	0
NLRP1	22861	broad.mit.edu	37	17	5436224	5436224	+	Missense_Mutation	SNP	G	G	A	rs149973177		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:5436224G>A	uc002gci.2	-	11	3769	c.3214C>T	c.(3214-3216)CCT>TCT	p.P1072S	NLRP1_uc002gcg.1_Missense_Mutation_p.P1076S|NLRP1_uc002gck.2_Missense_Mutation_p.P1072S|NLRP1_uc002gcj.2_Missense_Mutation_p.P1042S|NLRP1_uc002gcl.2_Missense_Mutation_p.P1042S|NLRP1_uc002gch.3_Missense_Mutation_p.P1072S|NLRP1_uc010clh.2_Missense_Mutation_p.P1072S	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1072					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				GTCCCCAAAGGCTTCGTATGC	0.577			NA											14	37					0	0	0.016723	0	0
NLGN2	57555	broad.mit.edu	37	17	7315483	7315483	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:7315483C>T	uc002ggt.1	+	2	538	c.465C>T	c.(463-465)CTC>CTT	p.L155L		NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN	neuroligin 2 precursor	155	Extracellular (Potential).				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity			central_nervous_system(1)	1		Prostate(122;0.157)				TAGGTCCGCTCACAAAAAAAC	0.348			NA											12	23					0	0	0.013537	0	0
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	C	T	rs112431538		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:7577085C>T	uc002gim.2	-	8	1047	c.853G>A	c.(853-855)GAG>AAG	p.E285K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E285K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E153K|TP53_uc010cng.1_Missense_Mutation_p.E153K|TP53_uc002gii.1_Missense_Mutation_p.E153K|TP53_uc010cnh.1_Missense_Mutation_p.E285K|TP53_uc010cni.1_Missense_Mutation_p.E285K|TP53_uc002gij.2_Missense_Mutation_p.E285K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	285	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCTCTTCCTCTGTGCGCCGG	0.562	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			12	25					0	0	0.013537	0	0
ACACA	31	broad.mit.edu	37	17	35512644	35512644	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:35512644G>C	uc002hnm.2	-	43	5488	c.5297C>G	c.(5296-5298)TCT>TGT	p.S1766C	ACACA_uc002hnk.2_Missense_Mutation_p.S1688C|ACACA_uc002hnl.2_Missense_Mutation_p.S1708C|ACACA_uc002hnn.2_Missense_Mutation_p.S1766C|ACACA_uc002hno.2_Missense_Mutation_p.S1803C|ACACA_uc010cuy.2_Missense_Mutation_p.S411C|ACACA_uc010wdc.1_5'UTR	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1766	Carboxyltransferase.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ACAATGGACAGAGTTGAGAGC	0.353	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)		NA											22	94					0	0	0.004656	0	0
CDK12	51755	broad.mit.edu	37	17	37687195	37687195	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:37687195G>C	uc010cvv.2	+	14	4685	c.4099G>C	c.(4099-4101)GTC>CTC	p.V1367L	CDK12_uc002hrw.3_Missense_Mutation_p.V1358L	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	1367					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						AGAATCCTTGGTCCAGACCCT	0.537			NA								TCGA Ovarian(9;0.13)			9	38					0	0	0.004482	0	0
C17orf53	78995	broad.mit.edu	37	17	42226342	42226342	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:42226342A>C	uc002ifi.1	+	3	1356	c.1171A>C	c.(1171-1173)ACC>CCC	p.T391P	C17orf53_uc010czq.1_Missense_Mutation_p.T391P|C17orf53_uc002ifj.1_Missense_Mutation_p.T391P|C17orf53_uc002ifk.1_RNA	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995	391											0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCATCCCTCCACCCGAGCCAA	0.622			NA											9	55					0	0	0.010504	0	0
OR4D1	26689	broad.mit.edu	37	17	56233005	56233005	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr17:56233005T>A	uc010wno.1	+	1	491	c.491T>A	c.(490-492)CTT>CAT	p.L164H	MSX2P1_uc002ivn.2_5'Flank	NM_012374	NP_036506	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D,	164	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GCTCTGATACTTCCACTGCCC	0.527			NA											13	75					0	0	0.004007	0	0
DSC1	1823	broad.mit.edu	37	18	28728565	28728565	+	Missense_Mutation	SNP	T	T	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr18:28728565T>A	uc002kwn.2	-	6	930	c.668A>T	c.(667-669)GAA>GTA	p.E223V	DSC1_uc002kwm.2_Missense_Mutation_p.E223V	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	223	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			GAGTGGATATTCTGGTGCATA	0.368			NA											16	79					0	0	0.004007	0	0
MOCOS	55034	broad.mit.edu	37	18	33779985	33779985	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr18:33779985G>A	uc002kzq.3	+	4	662	c.639G>A	c.(637-639)CTG>CTA	p.L213L		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	213					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	GATACCCCCTGTCCTGGATAG	0.577			NA											13	40					0	0	0.020292	0	0
KEAP1	9817	broad.mit.edu	37	19	10602796	10602796	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr19:10602796C>G	uc002moq.1	-	3	938	c.782G>C	c.(781-783)CGG>CCG	p.R261P	KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.R261P	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	261	BACK.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			GACGTAGAACCGTCGCTGTTC	0.632			NA											13	36					0	0	0.003163	0	0
APOB	338	broad.mit.edu	37	2	21236089	21236089	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:21236089C>G	uc002red.2	-	25	4287	c.4159G>C	c.(4159-4161)GCT>CCT	p.A1387P		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1387					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGGTAACGAGCCCGAAGGCTG	0.532			NA											28	100					0	0	0.010818	0	0
DOK1	1796	broad.mit.edu	37	2	74784050	74784050	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:74784050C>T	uc002sms.2	+	5	1277	c.1255C>T	c.(1255-1257)CCC>TCC	p.P419S	LOXL3_uc002smp.1_5'Flank|LOXL3_uc002smq.1_5'Flank|LOXL3_uc010ffn.1_5'Flank|DOK1_uc002smr.2_Missense_Mutation_p.P280S|DOK1_uc010ffo.2_Missense_Mutation_p.P280S|DOK1_uc002smt.2_Missense_Mutation_p.P205S|DOK1_uc002smu.2_Missense_Mutation_p.P205S|DOK1_uc010yrz.1_Missense_Mutation_p.P408S|DOK1_uc002smv.2_Missense_Mutation_p.P280S|DOK1_uc002smw.1_Missense_Mutation_p.P205S	NM_001381	NP_001372	Q99704	DOK1_HUMAN	docking protein 1	419	Pro-rich.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol|perinuclear region of cytoplasm	insulin receptor binding				0						GAGCACAAAGCCCCTCCTTGC	0.612	Esophageal Squamous(36;520 860 12502 33616 51270)		NA											21	129					0	0	0.014323	0	0
XIRP2	129446	broad.mit.edu	37	2	168106620	168106620	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:168106620G>C	uc002udx.2	+	8	8736	c.8718G>C	c.(8716-8718)GAG>GAC	p.E2906D	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2731D|XIRP2_uc010fpq.2_Missense_Mutation_p.E2684D|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.E252D	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2731					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GCATACAAGAGAAACAAGTCT	0.378			NA											12	77					0	0	0.010729	0	0
COL5A2	1290	broad.mit.edu	37	2	189950490	189950490	+	Silent	SNP	T	T	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:189950490T>C	uc002uqk.2	-	10	974	c.699A>G	c.(697-699)GCA>GCG	p.A233A	COL5A2_uc010frx.2_5'UTR	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	233					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CTGTAGGTCCTGCACCACCCT	0.393			NA											10	47					0	0	0.006214	0	0
RPE	6120	broad.mit.edu	37	2	210882212	210882212	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:210882212A>G	uc002vdn.2	+	5	498	c.493A>G	c.(493-495)ACC>GCC	p.T165A	RPE_uc002vdm.2_Missense_Mutation_p.T165A|RPE_uc002vdo.2_Missense_Mutation_p.T115A|RPE_uc010zjf.1_Intron|RPE_uc002vdp.2_Missense_Mutation_p.T112A|RPE_uc010fup.2_Missense_Mutation_p.T97A|RPE_uc002vdq.2_Missense_Mutation_p.T115A|RPE_uc002vdr.2_Missense_Mutation_p.T80A	NM_199229	NP_954699	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase isoform 1	165					pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		CTGGTTGAGGACCCAGTTCCC	0.363			NA											4	57					0	0	0.009096	0	0
FRG1B	284802	broad.mit.edu	37	20	29624081	29624081	+	Missense_Mutation	SNP	A	A	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr20:29624081A>T	uc010ztl.1	+	1	47	c.15A>T	c.(13-15)TTA>TTT	p.L5F	FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CTGTCAAATTATCTGATTCCA	0.279			NA											3	11					0	0	0.009096	0	0
DSN1	79980	broad.mit.edu	37	20	35384135	35384135	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr20:35384135G>A	uc010gfr.2	-	9	1196	c.823C>T	c.(823-825)CAG>TAG	p.Q275*	DSN1_uc002xfz.2_Nonsense_Mutation_p.Q275*|DSN1_uc002xfy.3_Nonsense_Mutation_p.Q65*|DSN1_uc002xga.2_Nonsense_Mutation_p.Q275*|DSN1_uc010zvs.1_Nonsense_Mutation_p.Q168*|DSN1_uc002xgc.2_Nonsense_Mutation_p.Q259*|DSN1_uc002xgb.2_Nonsense_Mutation_p.Q259*	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,	275					cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				AATATTTTCTGGTAGTCAGGT	0.398			NA											12	45					0	0	0.010729	0	0
ITSN1	6453	broad.mit.edu	37	21	35190760	35190760	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr21:35190760A>G	uc002yta.1	+	23	3185	c.2917A>G	c.(2917-2919)ATA>GTA	p.I973V	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_RNA|ITSN1_uc002ysz.2_Missense_Mutation_p.I968V|ITSN1_uc010gmg.2_Missense_Mutation_p.I931V|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Missense_Mutation_p.I973V|ITSN1_uc010gmi.2_Missense_Mutation_p.I936V|ITSN1_uc010gmj.2_Missense_Mutation_p.I852V|ITSN1_uc002ysy.2_Missense_Mutation_p.I968V|ITSN1_uc002ysx.2_Missense_Mutation_p.I931V|ITSN1_uc002ytb.1_Missense_Mutation_p.I968V|ITSN1_uc002ytd.2_RNA|ITSN1_uc010gmk.2_Missense_Mutation_p.I936V|ITSN1_uc010gml.2_Intron|ITSN1_uc002ytj.2_Missense_Mutation_p.I968V|ITSN1_uc010gmm.1_RNA|ITSN1_uc002yte.2_Missense_Mutation_p.I907V|ITSN1_uc002ytg.1_Missense_Mutation_p.I26V	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	973					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						TTCAGGGCCCATAAGGAAGTC	0.403			NA											20	100					0	0	0.012319	0	0
ANO10	55129	broad.mit.edu	37	3	43596810	43596810	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr3:43596810C>T	uc003cmv.2	-	10	1799	c.1628G>A	c.(1627-1629)CGT>CAT	p.R543H	ANO10_uc011azs.1_Missense_Mutation_p.R543H|ANO10_uc003cmw.2_Missense_Mutation_p.R477H|ANO10_uc010hil.2_Missense_Mutation_p.R353H|ANO10_uc011azt.1_Missense_Mutation_p.R432H	NM_018075	NP_060545	Q9NW15	ANO10_HUMAN	transmembrane protein 16K	543	Cytoplasmic (Potential).				cell death	chloride channel complex	chloride channel activity			ovary(2)	2						TGAGAATGGACGTTTGAAGAC	0.363			NA											14	53					0	0	0.003163	0	0
PTH1R	5745	broad.mit.edu	37	3	46937261	46937261	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr3:46937261C>A	uc003cqm.2	+	5	418	c.215C>A	c.(214-216)GCG>GAG	p.A72E	PTH1R_uc003cqn.2_Missense_Mutation_p.A72E	NM_000316	NP_000307	Q03431	PTH1R_HUMAN	parathyroid hormone receptor 1 precursor	72	Extracellular (Potential).					cytoplasm|integral to plasma membrane|nucleus	parathyroid hormone receptor activity|peptide hormone binding|protein self-association			breast(1)	1						TGGACATCTGCGTCCACATCA	0.542			NA							Ollier_disease_/_Maffucsyndrome		OREG0015543	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	31					0.00307968	0.00321475	0.00308	1	0
FAM3D	131177	broad.mit.edu	37	3	58629398	58629398	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr3:58629398G>T	uc003dkq.2	-	6	610	c.313C>A	c.(313-315)CTG>ATG	p.L105M		NM_138805	NP_620160	Q96BQ1	FAM3D_HUMAN	family with sequence similarity 3, member D	105					negative regulation of insulin secretion	extracellular region	cytokine activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000225)|Kidney(10;0.000667)|KIRC - Kidney renal clear cell carcinoma(10;0.000802)|OV - Ovarian serous cystadenocarcinoma(275;0.169)		CCATTCACCAGGGCGATGTTT	0.448			NA											10	39					1.08611e-07	1.21931e-07	0.010729	1	0
HAUS3	79441	broad.mit.edu	37	4	2242226	2242226	+	Nonsense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr4:2242226G>A	uc003ges.1	-	2	678	c.448C>T	c.(448-450)CAG>TAG	p.Q150*	POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Nonsense_Mutation_p.Q150*|HAUS3_uc003get.1_Nonsense_Mutation_p.Q150*	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	150	Potential.				cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				large_intestine(2)|breast(2)	4						CCTTGACTCTGCTTCAGCTTT	0.264			NA											18	72					0	0	0.00499	0	0
ENAM	10117	broad.mit.edu	37	4	71508556	71508556	+	Nonsense_Mutation	SNP	T	T	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr4:71508556T>A	uc011caw.1	+	9	1694	c.1413T>A	c.(1411-1413)TAT>TAA	p.Y471*		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	471					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			AATCAAATTATAAACTGCCTC	0.388			NA											8	33					0	0	0.004482	0	0
NPY5R	4889	broad.mit.edu	37	4	164272190	164272190	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr4:164272190C>T	uc003iqn.2	+	4	947	c.765C>T	c.(763-765)ATC>ATT	p.I255I		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	255	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				ATGAGATGATCAACTTAACTC	0.383	Melanoma(139;1287 1774 9781 19750 25599)		NA											3	62					0	0	0.004672	0	0
POLK	51426	broad.mit.edu	37	5	74892989	74892989	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:74892989G>T	uc003kdw.2	+	13	2567	c.2471G>T	c.(2470-2472)AGC>ATC	p.S824I	POLK_uc003kdx.2_RNA|POLK_uc003kdy.2_RNA|POLK_uc010izq.2_Missense_Mutation_p.S626I|POLK_uc003kec.2_Missense_Mutation_p.S734I|POLK_uc010izr.2_RNA|POLK_uc010izs.2_RNA|POLK_uc003ked.2_Intron|POLK_uc003kee.2_Intron|POLK_uc003kef.2_Missense_Mutation_p.S734I	NM_016218	NP_057302	Q9UBT6	POLK_HUMAN	DNA-directed DNA polymerase kappa	824					DNA replication|nucleotide-excision repair, DNA gap filling	nucleus	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|kidney(2)	4		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		CCCAAAGAAAGCTCCAGAAGT	0.294			NA						DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					16	76					1.02788e-11	1.18755e-11	0.00499	1	0
TTC37	9652	broad.mit.edu	37	5	94878980	94878980	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:94878980C>A	uc003klb.2	-	5	412	c.142G>T	c.(142-144)GTT>TTT	p.V48F	TTC37_uc010jbf.1_Intron	NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	48	TPR 2.						binding			ovary(3)|pancreas(1)	4						GCTGCAGCAACGCCAATAAAA	0.373			NA											16	99					1.3612e-06	1.51386e-06	0.003163	1	0
MYOT	9499	broad.mit.edu	37	5	137206504	137206504	+	Missense_Mutation	SNP	C	C	T	rs121908457		TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:137206504C>T	uc011cye.1	+	2	181	c.164C>T	c.(163-165)TCC>TTC	p.S55F	MYOT_uc003lbv.2_Missense_Mutation_p.S55F|MYOT_uc011cyg.1_Intron|MYOT_uc011cyh.1_Intron	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	55			S -> F (in LGMD1A and MFM3).		muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTTTCTGCCTCCTCAACACTG	0.542			NA											17	66					0	0	0.006122	0	0
CTNNA1	1495	broad.mit.edu	37	5	138269764	138269764	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:138269764A>G	uc003ldh.2	+	18	2802	c.2707A>G	c.(2707-2709)ATG>GTG	p.M903V	CTNNA1_uc011cyx.1_Missense_Mutation_p.M800V|CTNNA1_uc011cyy.1_Missense_Mutation_p.M780V|CTNNA1_uc003ldi.2_Missense_Mutation_p.M601V|CTNNA1_uc003ldj.2_3'UTR|CTNNA1_uc003ldl.2_Missense_Mutation_p.M533V	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	903					adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTTCAAAGCTATGGACAGCAT	0.527			NA											6	30					0	0	0.001168	0	0
PCDHA1	56147	broad.mit.edu	37	5	140167508	140167508	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:140167508C>G	uc003lhb.2	+	1	1633	c.1633C>G	c.(1633-1635)CTG>GTG	p.L545V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.L545V	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	545	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGCCGCCTCTGGGCAGCAA	0.682			NA											4	100					0	0	0.009096	0	0
ABLIM3	22885	broad.mit.edu	37	5	148626096	148626096	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:148626096G>A	uc003lpy.2	+	17	1789	c.1538G>A	c.(1537-1539)CGC>CAC	p.R513H	ABLIM3_uc003lpz.1_Missense_Mutation_p.R513H|ABLIM3_uc003lqa.1_Missense_Mutation_p.R410H|ABLIM3_uc003lqb.2_Missense_Mutation_p.R402H|ABLIM3_uc003lqc.1_Missense_Mutation_p.R480H|ABLIM3_uc003lqd.1_Missense_Mutation_p.R418H|ABLIM3_uc003lqf.2_Missense_Mutation_p.R402H|ABLIM3_uc003lqe.1_Missense_Mutation_p.R402H	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	513					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATTTTGACCGCAGCATGCAC	0.418			NA											3	48					0	0	0.009096	0	0
NMUR2	56923	broad.mit.edu	37	5	151775143	151775143	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:151775143C>A	uc003luv.2	-	3	980	c.814G>T	c.(814-816)GTC>TTC	p.V272F		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	272	Helical; Name=6; (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AAGACCAAGACAACTGAAAAT	0.458			NA											4	11					0.00024832	0.000266217	0.009096	1	0
LSM11	134353	broad.mit.edu	37	5	157181030	157181030	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:157181030G>A	uc003lxe.1	+	3	611	c.607G>A	c.(607-609)GAG>AAG	p.E203K	LSM11_uc003lxf.1_5'Flank	NM_173491	NP_775762	P83369	LSM11_HUMAN	LSM11, U7 small nuclear RNA associated	203	SM 1.				histone mRNA 3'-end processing|S phase of mitotic cell cycle|termination of RNA polymerase II transcription	histone pre-mRNA 3'end processing complex|nucleoplasm|U7 snRNP	protein binding|U7 snRNA binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGATGTGGATGAGACCTACCG	0.408			NA											14	40					0	0	0.003163	0	0
ATP10B	23120	broad.mit.edu	37	5	160114890	160114890	+	Silent	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr5:160114890C>T	uc003lym.1	-	5	1039	c.192G>A	c.(190-192)AGG>AGA	p.R64R	ATP10B_uc003lyp.2_Silent_p.R64R|ATP10B_uc011deg.1_Silent_p.R108R|ATP10B_uc003lyo.2_5'Flank	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	64	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGGGTATCTCCTGGAGACCT	0.498			NA											27	127					0	0	0.00632	0	0
ATXN1	6310	broad.mit.edu	37	6	16327538	16327538	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr6:16327538C>T	uc003nbt.2	-	8	1975	c.1004G>A	c.(1003-1005)GGG>GAG	p.G335E	ATXN1_uc010jpi.2_Missense_Mutation_p.G335E|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	335					cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GGACGGGGCCCCGTACCGCCG	0.682			NA											21	70					0	0	0.010504	0	0
UHRF1BP1	54887	broad.mit.edu	37	6	34825625	34825625	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr6:34825625C>G	uc003oju.3	+	13	1932	c.1698C>G	c.(1696-1698)ATC>ATG	p.I566M	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_5'Flank	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	566										ovary(3)	3						TCAAAGCTATCTACAAGCTGG	0.443			NA											7	104					0	0	0.001984	0	0
PNLDC1	154197	broad.mit.edu	37	6	160239658	160239658	+	Missense_Mutation	SNP	A	A	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr6:160239658A>C	uc003qsx.1	+	16	1367	c.1196A>C	c.(1195-1197)AAC>ACC	p.N399T	PNLDC1_uc003qsy.1_Missense_Mutation_p.N410T	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	399	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AACCAAGTGAACCTCATCCGA	0.572			NA											7	34					0	0	0.008291	0	0
KCND2	3751	broad.mit.edu	37	7	119914843	119914843	+	Missense_Mutation	SNP	C	C	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr7:119914843C>G	uc003vjj.1	+	1	1122	c.157C>G	c.(157-159)CAG>GAG	p.Q53E		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	53	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					CACCCGCTTCCAGACGTGGCA	0.562			NA											5	192					0	0	0.014758	0	0
SND1	27044	broad.mit.edu	37	7	127724820	127724820	+	Missense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr7:127724820G>T	uc003vmi.2	+	19	2381	c.2155G>T	c.(2155-2157)GCC>TCC	p.A719S	SND1_uc010lle.2_Missense_Mutation_p.A372S	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	719					gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CAATGACATTGCCAGTCACCC	0.562			NA											6	37					0.00116845	0.00124147	0.001168	1	0
MLL3	58508	broad.mit.edu	37	7	151849821	151849821	+	Missense_Mutation	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr7:151849821C>A	uc003wla.2	-	49	12714	c.12495G>T	c.(12493-12495)CAG>CAT	p.Q4165H	MLL3_uc003wkz.2_Missense_Mutation_p.Q3283H|MLL3_uc003wkx.2_Missense_Mutation_p.Q323H|MLL3_uc003wky.2_Missense_Mutation_p.Q1729H	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	4165					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GTACATTAGGCTGCTTCAGCC	0.473	Colon(68;14 1149 1884 27689 34759)		NA	N		medulloblastoma								16	88					3.52763e-06	3.88693e-06	0.00499	1	0
MTMR9	66036	broad.mit.edu	37	8	11174186	11174186	+	Missense_Mutation	SNP	G	G	C			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:11174186G>C	uc003wtm.2	+	8	1516	c.1118G>C	c.(1117-1119)GGT>GCT	p.G373A	MTMR9_uc010lrx.2_Missense_Mutation_p.G266A|MTMR9_uc011kxa.1_Missense_Mutation_p.G288A|uc003wtn.1_RNA	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	373	Myotubularin phosphatase.					cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CCCTAGGCTGGTCACCCATTC	0.522			NA											5	10					0	0	0.014758	0	0
RAD54B	25788	broad.mit.edu	37	8	95416341	95416341	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:95416341C>T	uc003ygk.2	-	6	1006	c.908G>A	c.(907-909)GGA>GAA	p.G303E	RAD54B_uc010may.1_Missense_Mutation_p.G110E|RAD54B_uc003ygl.1_RNA	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GAATATGATTCCTTCTTTCTG	0.328			NA						Direct_reversal_of_damage|Homologous_recombination					11	31					0	0	0.010729	0	0
TRIB1	10221	broad.mit.edu	37	8	126445604	126445604	+	Nonsense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:126445604C>T	uc003yrx.2	+	2	988	c.406C>T	c.(406-408)CAG>TAG	p.Q136*	TRIB1_uc011lis.1_5'UTR|TRIB1_uc010mdn.2_5'Flank	NM_025195	NP_079471	Q96RU8	TRIB1_HUMAN	G-protein-coupled receptor induced protein	136	Protein kinase.				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			GCCTTACATCCAGCTGCCATC	0.512			NA											6	205					0	0	0.001984	0	0
TRIB1	10221	broad.mit.edu	37	8	126448609	126448609	+	Nonsense_Mutation	SNP	G	G	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:126448609G>T	uc003yrx.2	+	3	1597	c.1015G>T	c.(1015-1017)GAG>TAG	p.E339*	TRIB1_uc011lis.1_Nonsense_Mutation_p.E173*|TRIB1_uc010mdn.2_Nonsense_Mutation_p.E108*	NM_025195	NP_079471	Q96RU8	TRIB1_HUMAN	G-protein-coupled receptor induced protein	339					JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			CCCCTGGTTTGAGTCCGTCTT	0.547			NA											11	87					1.08611e-07	1.21931e-07	0.010729	1	0
TMED10P1	286102	broad.mit.edu	37	8	146220464	146220464	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr8:146220464G>A	uc003zey.2	+	1	214	c.193G>A	c.(193-195)GGG>AGG	p.G65R	ZNF252_uc003zew.3_Intron|ZNF252_uc011llo.1_Intron	NR_002807				Homo sapiens mRNA for Tmp21-II putative transcribed pseudogene.												0						TGACCAGTCTGGGGGCACTGG	0.478			NA											5	26					0	0	0.014758	0	0
KIAA0020	9933	broad.mit.edu	37	9	2811463	2811463	+	Silent	SNP	C	C	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr9:2811463C>A	uc003zhp.1	-	15	1629	c.1533G>T	c.(1531-1533)GTG>GTT	p.V511V	KIAA0020_uc010mhc.1_Silent_p.V510V|KIAA0020_uc003zhq.1_Silent_p.V510V	NM_014878	NP_055693	Q15397	K0020_HUMAN	KIAA0020 protein	511						endoplasmic reticulum|nucleolus	RNA binding			ovary(1)	1				GBM - Glioblastoma multiforme(50;0.0319)		GAATGTCAGACACCAACACAC	0.537			NA											15	87					4.75885e-15	5.60696e-15	0.00499	1	0
SH2D3C	10044	broad.mit.edu	37	9	130536699	130536699	+	Missense_Mutation	SNP	A	A	G			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr9:130536699A>G	uc004bsc.2	-	2	227	c.85T>C	c.(85-87)TCC>CCC	p.S29P	SH2D3C_uc004bsd.1_5'UTR	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	29					JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						AGAGTGAAGGACCGAGGGAGG	0.512			NA											3	28					0	0	0.004672	0	0
PHKA2	5256	broad.mit.edu	37	X	18927024	18927024	+	Missense_Mutation	SNP	C	C	T			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chrX:18927024C>T	uc004cyv.3	-	21	2685	c.2255G>A	c.(2254-2256)AGA>AAA	p.R752K	PHKA2_uc004cyu.3_Missense_Mutation_p.R50K	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	752					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					ATGGTCATCTCTGGGCCACTG	0.468			NA											26	68					0	0	0.004656	0	0
DMD	1756	broad.mit.edu	37	X	32361373	32361373	+	Silent	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chrX:32361373G>A	uc004dda.1	-	40	5861	c.5617C>T	c.(5617-5619)CTA>TTA	p.L1873L	DMD_uc004dcw.2_Silent_p.L529L|DMD_uc004dcx.2_Silent_p.L532L|DMD_uc004dcz.2_Silent_p.L1750L|DMD_uc004dcy.1_Silent_p.L1869L|DMD_uc004ddb.1_Silent_p.L1865L|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1873	Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAAATTTCTAGAGCCTTTTTT	0.378			NA											17	35					0	0	0.007413	0	0
GPR112	139378	broad.mit.edu	37	X	135487991	135487991	+	Missense_Mutation	SNP	G	G	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chrX:135487991G>A	uc004ezu.1	+	23	9086	c.8795G>A	c.(8794-8796)CGG>CAG	p.R2932Q	GPR112_uc010nsb.1_Missense_Mutation_p.R2727Q	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2932	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AAGACTCGGCGGAAGATGATC	0.458			NA											14	47					0	0	0.016723	0	0
LRRTM3	347731	broad.mit.edu	37	10	68686763	68686763	+	Frame_Shift_Del	DEL	C	C	-			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr10:68686763delC	uc001jmz.1	+	2	639	c.89delC	c.(88-90)GCCfs	p.A30fs	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Frame_Shift_Del_p.A30fs	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	30						integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						CTTTCTTCTGCCGAACGAGGA	0.438			NA											7	68	---	---	---	---	NA	NA	NA	NA	NA
NFE2	4778	broad.mit.edu	37	12	54686563	54686571	+	In_Frame_Del	DEL	CGTAGGAAA	CGTAGGAAA	-			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	CGTAGGAAA	CGTAGGAAA	-	-	CGTAGGAAA	CGTAGGAAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr12:54686563_54686571delCGTAGGAAA	uc009znk.2	-	2	1219_1227	c.709_717delTTTCCTACG	c.(709-717)TTTCCTACGdel	p.FPT237del	NFE2_uc001sfq.2_In_Frame_Del_p.FPT237del|NFE2_uc001sfr.3_In_Frame_Del_p.FPT237del|NFE2_uc009znl.2_In_Frame_Del_p.FPT237del	NM_006163	NP_006154	Q16621	NFE2_HUMAN	nuclear factor, erythroid derived 2 isoform 1	237_239					blood circulation|blood coagulation|multicellular organismal development|nucleosome disassembly|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	actin cytoskeleton|cytoplasm|PML body	protein dimerization activity|protein N-terminus binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|WW domain binding				0						CAATCTTGTCCGTAGGAAAAGGAATCTTC	0.589			NA											7	52	---	---	---	---	NA	NA	NA	NA	NA
CTDSP1	58190	broad.mit.edu	37	2	219266341	219266342	+	Frame_Shift_Ins	INS	-	-	A			TCGA-50-5939-01A-11D-1625-08	TCGA-50-5939-11A-01D-1625-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	aa9108d7-5036-4059-ad82-dc64161d5bc3	aacf37f4-0e46-4277-9122-e11cbefa7158	g.chr2:219266341_219266342insA	uc002vhy.2	+	2	458_459	c.122_123insA	c.(121-123)TCAfs	p.S41fs	CTDSP1_uc002vhx.2_Frame_Shift_Ins_p.S41fs|CTDSP1_uc002vhz.2_5'Flank|uc010zkd.1_5'Flank|MIR26B_hsa-mir-26b|MI0000084_5'Flank	NM_021198	NP_067021	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	41					protein dephosphorylation|regulation of transcription from RNA polymerase II promoter	nucleus	CTD phosphatase activity|metal ion binding|protein binding			ovary(1)	1		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATCCTCCACTCACTCTTCTGCT	0.639			NA											10	69	---	---	---	---	NA	NA	NA	NA	NA
