Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
FAF1	11124	broad.mit.edu	37	1	51253830	51253830	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:51253830C>G	uc009vyx.1	-	5	272	c.209G>C	c.(208-210)AGT>ACT	p.S70T	FAF1_uc009vyw.1_RNA|FAF1_uc001cse.1_Missense_Mutation_p.S70T	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1	70					apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		AGCTGGATGACTTGCTGGATT	0.423			NA											10	35					0	0	0.010729	0	0
USP33	23032	broad.mit.edu	37	1	78189060	78189060	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:78189060C>G	uc001dht.2	-	13	1785	c.1438G>C	c.(1438-1440)GAT>CAT	p.D480H	USP33_uc001dhs.2_Missense_Mutation_p.D201H|USP33_uc001dhu.2_Missense_Mutation_p.D449H|USP33_uc001dhv.2_Missense_Mutation_p.D285H|USP33_uc001dhw.2_Missense_Mutation_p.D480H	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1	480					axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						ATTGTTCCATCAAATATGTCT	0.323	Melanoma(152;72 1870 11110 26780 42647)		NA											14	40					0	0	0.028581	0	0
LRIG2	9860	broad.mit.edu	37	1	113637318	113637318	+	Silent	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:113637318G>C	uc001edf.1	+	6	942	c.744G>C	c.(742-744)CGG>CGC	p.R248R	LRIG2_uc009wgn.1_Silent_p.R145R	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	248	LRR 8.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AAATGCAGCGGAATGGAATTA	0.358			NA											15	92					0	0	0.024245	0	0
SMG5	23381	broad.mit.edu	37	1	156235927	156235927	+	Silent	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:156235927A>G	uc001foc.3	-	12	1649	c.1500T>C	c.(1498-1500)AGT>AGC	p.S500S	SMG5_uc009wrv.2_5'UTR	NM_015327	NP_056142	Q9UPR3	SMG5_HUMAN	SMG5 homolog nonsense mediated mRNA decay	500					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|nucleus	protein phosphatase 2A binding			ovary(2)|skin(2)|pancreas(1)	5	Hepatocellular(266;0.158)					CACCTTCAAGACTCTTGTCAG	0.532			NA											16	98					0	0	0.010504	0	0
KLHL20	27252	broad.mit.edu	37	1	173720961	173720961	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:173720961C>G	uc001gjc.2	+	4	835	c.656C>G	c.(655-657)TCC>TGC	p.S219C	KLHL20_uc010pmr.1_Missense_Mutation_p.S30C|KLHL20_uc009wwf.2_Missense_Mutation_p.S201C	NM_014458	NP_055273	Q9Y2M5	KLH20_HUMAN	kelch-like 20	219	BACK.				cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1						GATATAATATCCAGTGATGAG	0.403	GBM(159;862 2695 6559 23041)		NA											8	31					0	0	0.006214	0	0
HMCN1	83872	broad.mit.edu	37	1	186120395	186120395	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:186120395C>T	uc001grq.1	+	94	14901	c.14672C>T	c.(14671-14673)GCT>GTT	p.A4891V	HMCN1_uc001grs.1_Missense_Mutation_p.A460V	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4891	Nidogen G2 beta-barrel.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TTTGGAATTGCTTTCCTTAAT	0.398			NA											16	81					0	0	0.028581	0	0
ADIPOR1	51094	broad.mit.edu	37	1	202912932	202912932	+	Silent	SNP	C	C	T	rs145759019		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:202912932C>T	uc001gyq.3	-	6	1026	c.759G>A	c.(757-759)GCG>GCA	p.A253A	ADIPOR1_uc010pqd.1_Silent_p.A177A|ADIPOR1_uc001gyr.3_Silent_p.A52A|ADIPOR1_uc001gys.3_Silent_p.A253A	NM_015999	NP_057083	Q96A54	ADR1_HUMAN	adiponectin receptor 1	253	Helical; Name=4; (Potential).				fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane|plasma membrane	hormone binding|protein kinase binding|receptor activity				0			BRCA - Breast invasive adenocarcinoma(75;0.141)			GGTCCCACTGCGCCACAATGA	0.537			NA											9	51					0	0	0.013537	0	0
NFASC	23114	broad.mit.edu	37	1	204944417	204944417	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:204944417G>A	uc001hbj.2	+	15	1905	c.1577G>A	c.(1576-1578)CGG>CAG	p.R526Q	NFASC_uc001hbh.2_Missense_Mutation_p.R526Q|NFASC_uc010pqz.1_Missense_Mutation_p.R520Q|NFASC_uc010pra.1_Missense_Mutation_p.R537Q|NFASC_uc001hbi.2_Missense_Mutation_p.R537Q|NFASC_uc010prb.1_Missense_Mutation_p.R537Q|NFASC_uc010prc.1_Missense_Mutation_p.R93Q|NFASC_uc001hbk.1_Missense_Mutation_p.R347Q	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	526	Extracellular (Potential).|Ig-like C2-type 6.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGGATCTACCGGATGCCCGAG	0.632			NA									OREG0014142	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	75					0	0	0.010729	0	0
TARBP1	6894	broad.mit.edu	37	1	234566017	234566017	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr1:234566017C>G	uc001hwd.2	-	15	2425	c.2425G>C	c.(2425-2427)GTA>CTA	p.V809L		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	809					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			ATGCTCACTACTCTCTGAATC	0.483			NA											9	44					0	0	0.010729	0	0
ANKRD30A	91074	broad.mit.edu	37	10	37431192	37431192	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr10:37431192A>T	uc001iza.1	+	7	1298	c.1199A>T	c.(1198-1200)GAA>GTA	p.E400V		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	456						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CCTACAAAAGAATCATCTACA	0.378			NA											4	20					0	0	0.021553	0	0
GFRA1	2674	broad.mit.edu	37	10	117884826	117884826	+	Nonsense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr10:117884826G>A	uc001lcj.2	-	6	1374	c.676C>T	c.(676-678)CGA>TGA	p.R226*	GFRA1_uc001lci.2_Nonsense_Mutation_p.R221*|GFRA1_uc009xyr.2_Nonsense_Mutation_p.R221*	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a	226	2.				axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)		ATGGTCTGTCGCCTCCGCTCT	0.562	Ovarian(128;329 1725 45498 46808 50759)		NA											9	44					0	0	0.004482	0	0
DMBT1	1755	broad.mit.edu	37	10	124402690	124402690	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr10:124402690G>T	uc001lgk.1	+	53	7124	c.7018G>T	c.(7018-7020)GCC>TCC	p.A2340S	DMBT1_uc001lgl.1_Missense_Mutation_p.A2330S|DMBT1_uc001lgm.1_Missense_Mutation_p.A1712S|DMBT1_uc009xzz.1_Missense_Mutation_p.A2339S|DMBT1_uc010qtx.1_Missense_Mutation_p.A1060S|DMBT1_uc009yab.1_Missense_Mutation_p.A1043S|DMBT1_uc009yac.1_Missense_Mutation_p.A634S	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	2340	ZP.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCTTCGCATTGCCCGCTTCCG	0.577	Ovarian(182;93 2026 18125 22222 38972)		NA											21	71					1.96292e-10	2.15166e-10	0.010504	1	0
NUP98	4928	broad.mit.edu	37	11	3800193	3800193	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:3800193T>C	uc001lyh.2	-	4	556	c.265A>G	c.(265-267)AAT>GAT	p.N89D	NUP98_uc001lyi.2_Missense_Mutation_p.N89D|NUP98_uc001lyj.1_Missense_Mutation_p.N89D|NUP98_uc001lyk.1_Missense_Mutation_p.N89D|NUP98_uc010qxv.1_Intron	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	89	Gly/Thr-rich.				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AACAAGGTATTTGCTGTTCCT	0.478			NA	T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								6	70					0	0	0.00308	0	0
CNGA4	1262	broad.mit.edu	37	11	6265487	6265487	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:6265487G>C	uc001mco.2	+	6	1683	c.1576G>C	c.(1576-1578)GCT>CCT	p.A526P	CNGA4_uc010raa.1_3'UTR|CNGA4_uc001mcn.2_3'UTR	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	526	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTTAAGATTGCTTACCGCAT	0.592			NA											6	52					0	0	0.02938	0	0
OR10A5	144124	broad.mit.edu	37	11	6867169	6867169	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:6867169C>G	uc001met.1	+	1	256	c.256C>G	c.(256-258)CTG>GTG	p.L86V		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	86	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCTGGGGACCCTGCTTGCCCA	0.498	Pancreas(44;21 1072 25662 28041 45559)		NA											4	45					0	0	0.009096	0	0
CCDC73	493860	broad.mit.edu	37	11	32635535	32635535	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:32635535G>C	uc001mtv.2	-	16	2373	c.2329C>G	c.(2329-2331)CTT>GTT	p.L777V		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	777										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTAAGATGAAGATGGGAAATG	0.328			NA											9	38					0	0	0.004482	0	0
API5	8539	broad.mit.edu	37	11	43333683	43333683	+	Silent	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:43333683G>C	uc010rfh.1	+	1	179	c.6G>C	c.(4-6)CCG>CCC	p.P2P	API5_uc010rfg.1_5'UTR|API5_uc001mxf.2_Silent_p.P2P|API5_uc010rfi.1_Silent_p.P2P	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a	2		Not acetylated.			anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						TCACCATGCCGACAGTAGAGG	0.647	Pancreas(1;98 122 5625 20895 49453)		NA									OREG0020900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	25					0	0	0.004482	0	0
PLAC1L	219990	broad.mit.edu	37	11	59812153	59812153	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:59812153G>C	uc001nol.2	+	3	438	c.253G>C	c.(253-255)GAG>CAG	p.E85Q		NM_173801	NP_776162	Q86WS3	PLACL_HUMAN	placenta-specific 1-like precursor	85						extracellular region				ovary(2)|skin(1)	3						GGTAGTTTCTGAGGAAACTCT	0.398			NA											7	34					0	0	0.006214	0	0
ARL2	402	broad.mit.edu	37	11	64787927	64787927	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:64787927A>G	uc001och.3	+	4	470	c.376A>G	c.(376-378)AAG>GAG	p.K126E	SNX15_uc001oci.3_Intron	NM_001667	NP_001658	P36404	ARL2_HUMAN	ADP-ribosylation factor-like 2	126	GTP (By similarity).				cell cycle|centrosome organization|maintenance of protein location in nucleus|negative regulation of GTPase activity|positive regulation of cell-substrate adhesion|positive regulation of microtubule polymerization|small GTPase mediated signal transduction|tight junction assembly|tubulin complex assembly	centrosome|lateral plasma membrane|mitochondrial intermembrane space|nucleus	GTP binding|GTPase activity|GTPase inhibitor activity|protein binding				0						CTTTGCTAATAAGCAGGACCT	0.587			NA											4	29					0	0	0.021553	0	0
FAM89B	23625	broad.mit.edu	37	11	65341071	65341071	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:65341071C>T	uc001oem.2	+	2	811	c.490C>T	c.(490-492)CGT>TGT	p.R164C	FAM89B_uc001oen.2_3'UTR|FAM89B_uc001oel.2_Missense_Mutation_p.R177C|EHBP1L1_uc001oeo.3_5'Flank	NM_152832	NP_690045	Q8N5H3	FA89B_HUMAN	family with sequence similarity 89, member B	164											0						GCACAATGCCCGTGACCAGTG	0.662			NA											11	43					0	0	0.008291	0	0
LOC645332	645332	broad.mit.edu	37	11	67570529	67570529	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:67570529C>T	uc001omt.3	-	2	126	c.103G>A	c.(103-105)GAA>AAA	p.E35K	LOC645332_uc001omu.3_Missense_Mutation_p.E35K	NR_024249				SubName: Full=cDNA FLJ57700, weakly similar to Protein FAM86A;												0						AACTTTGCTTCTAAGCTCTGT	0.478			NA											4	56					0	0	0.02938	0	0
SUV420H1	51111	broad.mit.edu	37	11	67925781	67925781	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr11:67925781C>G	uc001onm.1	-	11	2288	c.2032G>C	c.(2032-2034)GTG>CTG	p.V678L	SUV420H1_uc009yse.1_Missense_Mutation_p.V264L|SUV420H1_uc001onn.1_Missense_Mutation_p.V506L|SUV420H1_uc009ysf.2_Missense_Mutation_p.V438L	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	678					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						TCTGATGTCACAACTGAACAA	0.463			NA											10	34					0	0	0.008291	0	0
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	A	rs121913530		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:25398285C>A	uc001rgp.1	-	2	215	c.34G>T	c.(34-36)GGT>TGT	p.G12C	KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			19	16					7.88262e-20	8.75278e-20	0.01892	1	0
ADAMTS20	80070	broad.mit.edu	37	12	43846118	43846118	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:43846118C>T	uc010skx.1	-	14	2038	c.2038G>A	c.(2038-2040)GGA>AGA	p.G680R		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	680	Cys-rich.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTTTCAGTTCCACAAGGAGTA	0.343			NA											24	37					0	0	0.024334	0	0
ARID2	196528	broad.mit.edu	37	12	46298746	46298746	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:46298746C>G	uc001ros.1	+	21	5393	c.5393C>G	c.(5392-5394)TCA>TGA	p.S1798*	ARID2_uc009zkg.1_Nonsense_Mutation_p.S1254*|ARID2_uc009zkh.1_Nonsense_Mutation_p.S1425*|ARID2_uc001rou.1_3'UTR	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1798					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AATAACTTATCAGTGCTAGCC	0.358			NA											6	34					0	0	0.00308	0	0
ACVRL1	94	broad.mit.edu	37	12	52309021	52309021	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:52309021C>G	uc001rzj.2	+	7	1068	c.785C>G	c.(784-786)TCA>TGA	p.S262*	ACVRL1_uc001rzk.2_Nonsense_Mutation_p.S262*|ACVRL1_uc010snm.1_Nonsense_Mutation_p.S88*	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	262	Cytoplasmic (Potential).|Protein kinase.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	TTCATCGCCTCAGACATGACC	0.423			NA							Hereditary_Hemorrhagic_Telangiectasia				17	50					0	0	0.007413	0	0
RNF41	10193	broad.mit.edu	37	12	56600242	56600242	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:56600242C>G	uc001skf.1	-	7	1312	c.943G>C	c.(943-945)GAA>CAA	p.E315Q	RNF41_uc001ske.1_Missense_Mutation_p.E244Q|RNF41_uc001skg.1_Missense_Mutation_p.E315Q|RNF41_uc010sqg.1_Missense_Mutation_p.E250Q|RNF41_uc010sqh.1_Missense_Mutation_p.E244Q	NM_005785	NP_005776	Q9H4P4	RNF41_HUMAN	ring finger protein 41 isoform 1	315					apoptosis|induction of apoptosis|protein polyubiquitination|regulation of reactive oxygen species metabolic process		protein binding|protein tag|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						TATATCTCTTCCACGCCATGC	0.512			NA									OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	144					0	0	0.010771	0	0
B4GALNT1	2583	broad.mit.edu	37	12	58023955	58023955	+	Missense_Mutation	SNP	T	T	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:58023955T>A	uc001spg.1	-	6	1124	c.692A>T	c.(691-693)CAG>CTG	p.Q231L	B4GALNT1_uc010sru.1_Missense_Mutation_p.Q176L|B4GALNT1_uc010srv.1_Missense_Mutation_p.Q231L|B4GALNT1_uc001sph.2_Missense_Mutation_p.Q231L|B4GALNT1_uc001spi.2_Missense_Mutation_p.Q231L	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	231	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TGTGTTGGTCTGGTAGCTTCG	0.577			NA											7	86					0	0	0.004482	0	0
PHLDA1	22822	broad.mit.edu	37	12	76424317	76424317	+	Nonstop_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:76424317C>G	uc001sxu.2	-	1	1240	c.1205G>C	c.(1204-1206)TGA>TCA	p.*402S		NM_007350	NP_031376	Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A,	402					apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)				CTGCCCCTTTCAGGCAGAGTT	0.443			NA											9	61					0	0	0.016723	0	0
PHLDA1	22822	broad.mit.edu	37	12	76424750	76424750	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:76424750C>G	uc001sxu.2	-	1	807	c.772G>C	c.(772-774)GAG>CAG	p.E258Q		NM_007350	NP_031376	Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A,	258	PH.				apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)				TCCTTGCCCTCTGCCATCACC	0.577			NA											8	33					0	0	0.006214	0	0
PHLDA1	22822	broad.mit.edu	37	12	76425191	76425191	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:76425191C>G	uc001sxu.2	-	1	366	c.331G>C	c.(331-333)GAG>CAG	p.E111Q		NM_007350	NP_031376	Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A,	111					apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)				GCGCCGTCCTCGCCCCAGCGG	0.756			NA											4	4					0	0	0.009096	0	0
BTG1	694	broad.mit.edu	37	12	92538099	92538099	+	Silent	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:92538099A>G	uc001tby.3	-	2	635	c.273T>C	c.(271-273)AGT>AGC	p.S91S	BTG1_uc001tbv.1_5'Flank|BTG1_uc001tbw.1_5'Flank|BTG1_uc001tbx.1_5'Flank|BTG1_uc009zss.1_5'Flank|uc001tca.2_5'Flank	NM_001731	NP_001722	P62324	BTG1_HUMAN	B-cell translocation protein 1	91					cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				ACAGCTCCTGACTGCTCAGTC	0.507			NA	T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	86					0	0	0.016522	0	0
CCDC64	92558	broad.mit.edu	37	12	120510394	120510394	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:120510394C>T	uc001txl.1	+	6	1194	c.1169C>T	c.(1168-1170)TCA>TTA	p.S390L	CCDC64_uc001txk.2_Missense_Mutation_p.S390L|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Missense_Mutation_p.S39L	NM_207311	NP_997194	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	390					Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGTGCTGACTCAGCCGTCTCC	0.567			NA											27	78					0	0	0.034045	0	0
CCDC64	92558	broad.mit.edu	37	12	120510439	120510439	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:120510439C>T	uc001txl.1	+	6	1239	c.1214C>T	c.(1213-1215)TCG>TTG	p.S405L	CCDC64_uc001txk.2_Missense_Mutation_p.S405L|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_Missense_Mutation_p.S54L	NM_207311	NP_997194	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	405					Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCAGAAACCTCGTCCGCCAAG	0.567			NA											15	54					0	0	0.0333	0	0
GCN1L1	10985	broad.mit.edu	37	12	120613633	120613633	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr12:120613633G>C	uc001txo.2	-	11	971	c.958C>G	c.(958-960)CTG>GTG	p.L320V		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	320	HEAT 2.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGCAGTGCCAGCACAGCTTCA	0.552			NA											7	30					0	0	0.02938	0	0
DIS3	22894	broad.mit.edu	37	13	73346337	73346337	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr13:73346337T>G	uc001vix.3	-	10	1837	c.1463A>C	c.(1462-1464)GAT>GCT	p.D488A	DIS3_uc001viy.3_Missense_Mutation_p.D458A|DIS3_uc001viz.2_RNA	NM_014953	NP_055768	Q9Y2L1	RRP44_HUMAN	DIS3 mitotic control isoform a	488					CUT catabolic process|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA catabolic process|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|nucleoplasm	3'-5'-exoribonuclease activity|endonuclease activity|guanyl-nucleotide exchange factor activity|protein binding|RNA binding			central_nervous_system(1)	1		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		ATGTAGAGCATCGTCTATATC	0.363			NA								Multiple Myeloma(4;0.011)			8	32					0	0	0.00308	0	0
ATP11A	23250	broad.mit.edu	37	13	113510301	113510301	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr13:113510301G>C	uc001vsi.3	+	20	2408	c.2320G>C	c.(2320-2322)GAC>CAC	p.D774H	ATP11A_uc001vsj.3_Missense_Mutation_p.D774H|ATP11A_uc001vsm.1_Missense_Mutation_p.D650H|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	774	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GCCTCGAGAAGACGGGAGTTC	0.542			NA											27	100					0	0	0.034045	0	0
OR4N5	390437	broad.mit.edu	37	14	20612192	20612192	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr14:20612192C>G	uc010tla.1	+	1	298	c.298C>G	c.(298-300)CAG>GAG	p.Q100E		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	100	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CTGCATCACTCAGCTCTTTTT	0.493			NA											9	75					0	0	0.004482	0	0
ZC3H14	79882	broad.mit.edu	37	14	89077222	89077222	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr14:89077222C>G	uc001xww.2	+	16	2367	c.2142C>G	c.(2140-2142)TTC>TTG	p.F714L	ZC3H14_uc010twd.1_Missense_Mutation_p.F713L|ZC3H14_uc010twe.1_Missense_Mutation_p.F708L|ZC3H14_uc001xwx.2_Missense_Mutation_p.F557L|ZC3H14_uc010twf.1_Missense_Mutation_p.F427L|ZC3H14_uc001xwy.2_Missense_Mutation_p.F549L|ZC3H14_uc010twg.1_Missense_Mutation_p.F403L|ZC3H14_uc001xxa.2_Missense_Mutation_p.F259L|ZC3H14_uc001xxc.2_Missense_Mutation_p.F258L|ZC3H14_uc001xxb.2_Missense_Mutation_p.F284L	NM_024824	NP_079100	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14 isoform 1	714	C3H1-type 5.					cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3						ACTGCACATTCTACCATCCCA	0.393			NA											20	84					0	0	0.027356	0	0
TTC7B	145567	broad.mit.edu	37	14	91161916	91161916	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr14:91161916C>G	uc001xyp.2	-	6	827	c.705G>C	c.(703-705)TTG>TTC	p.L235F	uc001xyr.1_5'Flank	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	235	TPR 2.						binding			ovary(2)	2		Melanoma(154;0.222)				CTCCTCTTGTCAAGTTCCTGT	0.383			NA											6	34					0	0	0.021553	0	0
USP8	9101	broad.mit.edu	37	15	50769116	50769116	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr15:50769116G>T	uc001zym.3	+	10	1420	c.920G>T	c.(919-921)TGT>TTT	p.C307F	USP8_uc001zyk.1_Missense_Mutation_p.V7F|USP8_uc001zyl.3_Missense_Mutation_p.C307F|USP8_uc001zyn.3_Missense_Mutation_p.C307F|USP8_uc010ufh.1_Missense_Mutation_p.C230F|USP8_uc010bev.1_Intron	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	307	Rhodanese.				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TGGCTCCTTTGTTATCCCCAG	0.388			NA											16	63					1.33834e-09	1.45768e-09	0.007413	1	0
MYO5A	4644	broad.mit.edu	37	15	52622589	52622589	+	Nonsense_Mutation	SNP	T	T	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr15:52622589T>A	uc002aby.2	-	34	4685	c.4441A>T	c.(4441-4443)AAG>TAG	p.K1481*	MYO5A_uc002abx.3_Nonsense_Mutation_p.K1454*|MYO5A_uc010ugd.1_Nonsense_Mutation_p.K203*|MYO5A_uc002abz.1_RNA	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	1481					actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TCATCCTCCTTCTTGTATTCC	0.428			NA											28	141					0	0	0.015359	0	0
VPS13C	54832	broad.mit.edu	37	15	62169209	62169209	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr15:62169209T>G	uc002agz.2	-	75	10261	c.10187A>C	c.(10186-10188)CAG>CCG	p.Q3396P	VPS13C_uc002aha.2_Missense_Mutation_p.Q3353P|VPS13C_uc002ahb.1_Missense_Mutation_p.Q3396P|VPS13C_uc002ahc.1_Missense_Mutation_p.Q3353P	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	3396					protein localization					ovary(2)	2						CCATATAAGCTGATCTCTCTT	0.294			NA											10	97					0	0	0.010729	0	0
CRAMP1L	57585	broad.mit.edu	37	16	1705274	1705274	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:1705274G>C	uc010uvh.1	+	8	1092	c.1092G>C	c.(1090-1092)CAG>CAC	p.Q364H	CRAMP1L_uc002cmf.2_RNA	NM_020825	NP_065876	Q96RY5	CRML_HUMAN	Crm, cramped-like	364						nucleus	DNA binding				0						TCTTGAAGCAGAAGTGGGCGC	0.552			NA											32	32					0	0	0.023175	0	0
CLUAP1	23059	broad.mit.edu	37	16	3562389	3562389	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:3562389G>A	uc002cvk.1	+	5	511	c.406G>A	c.(406-408)GAT>AAT	p.D136N	CLUAP1_uc002cvj.1_Missense_Mutation_p.D136N|CLUAP1_uc002cvl.1_Missense_Mutation_p.D136N|CLUAP1_uc002cvm.1_Intron	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	136						nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3						CCAGATTGCAGATTTGAAGGC	0.343			NA											3	55					0	0	0.009096	0	0
CREBBP	1387	broad.mit.edu	37	16	3781195	3781195	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:3781195C>T	uc002cvv.2	-	30	5374	c.5170G>A	c.(5170-5172)GAG>AAG	p.E1724K	CREBBP_uc002cvw.2_Missense_Mutation_p.E1686K	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1724	Interaction with TRERF1.|ZZ-type.			ED -> VV (in Ref. 2; AAC51340).	cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGGCCTACCTCGCACACAGTG	0.652			NA	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybsyndrome				30	124					0	0	0.010818	0	0
CREBBP	1387	broad.mit.edu	37	16	3789613	3789613	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:3789613C>G	uc002cvv.2	-	25	4450	c.4246G>C	c.(4246-4248)GAA>CAA	p.E1416Q	CREBBP_uc002cvw.2_Missense_Mutation_p.E1378Q	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1416	Cys/His-rich.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GAGCCGTATTCTTGGACGTGC	0.493			NA	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybsyndrome				11	42					0	0	0.028581	0	0
ITGAL	3683	broad.mit.edu	37	16	30490717	30490717	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:30490717G>A	uc002dyi.3	+	6	687	c.511G>A	c.(511-513)GAA>AAA	p.E171K	ITGAL_uc010veu.1_Intron|ITGAL_uc002dyj.3_Intron|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	171	VWFA.|Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	GCAGCCAGATGAATTTCAGAA	0.388	NSCLC(110;1462 1641 3311 33990 49495)		NA											5	41					0	0	0.02938	0	0
SRCAP	10847	broad.mit.edu	37	16	30732535	30732535	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:30732535G>A	uc002dze.1	+	21	3664	c.3279G>A	c.(3277-3279)CTG>CTA	p.L1093L	SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Silent_p.L950L|SRCAP_uc010bzz.1_Silent_p.L663L	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1093	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			TGGGGGTCCTGAGTGGGACCT	0.602			NA											21	107					0	0	0.030593	0	0
ZNF267	10308	broad.mit.edu	37	16	31927690	31927690	+	Missense_Mutation	SNP	G	G	A	rs146914846	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:31927690G>A	uc002ecs.3	+	4	2329	c.2120G>A	c.(2119-2121)CGG>CAG	p.R707Q		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	707	C2H2-type 14.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						ACTACACATCGGAGAAGTCAT	0.433			NA											3	77					0	0	0.014758	0	0
RPGRIP1L	23322	broad.mit.edu	37	16	53636079	53636079	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:53636079C>T	uc002ehp.2	-	27	3921	c.3857G>A	c.(3856-3858)GGT>GAT	p.G1286D	RPGRIP1L_uc002eho.3_Missense_Mutation_p.G1206D|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.G1240D|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.G1252D	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	1286					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				AATACCTTCACCATCTGCTCG	0.443			NA											14	38					0	0	0.007413	0	0
FHOD1	29109	broad.mit.edu	37	16	67267932	67267932	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:67267932C>T	uc002esl.2	-	13	1786	c.1674G>A	c.(1672-1674)CTG>CTA	p.L558L	FHOD1_uc010ced.2_Silent_p.L365L|FHOD1_uc010vjh.1_Silent_p.L218L	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	558	FH1.				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding			breast(2)|ovary(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		ACTCTACATTCAGCATGTCCT	0.617			NA											8	67					0	0	0.00308	0	0
FANCA	2175	broad.mit.edu	37	16	89815072	89815072	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr16:89815072C>T	uc002fou.1	-	33	3385	c.3343G>A	c.(3343-3345)GAG>AAG	p.E1115K	FANCA_uc010vpn.1_Missense_Mutation_p.E1115K|FANCA_uc010vpo.1_Missense_Mutation_p.E201K	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	1115					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CCTACCATCTCAGAGTTGACC	0.602			NA	D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	FanconAnemia				3	27					0	0	0.004672	0	0
VPS53	55275	broad.mit.edu	37	17	556535	556535	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:556535C>T	uc002frn.2	-	7	751	c.604G>A	c.(604-606)GAA>AAA	p.E202K	VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Missense_Mutation_p.E202K|VPS53_uc002frl.2_RNA|VPS53_uc002frm.2_Missense_Mutation_p.E173K|VPS53_uc002fro.2_5'UTR|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759	Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 isoform 2	202					protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		GTTTACCTTTCGGAAAGCTGC	0.483			NA											4	110					0	0	0.009096	0	0
GEMIN4	50628	broad.mit.edu	37	17	650277	650277	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:650277G>A	uc002frs.1	-	2	1125	c.1006C>T	c.(1006-1008)CGC>TGC	p.R336C	GEMIN4_uc010vqa.1_3'UTR	NM_015721	NP_056536	P57678	GEMI4_HUMAN	gemin 4	336					rRNA processing|spliceosomal snRNP assembly	Cajal body|cytosol|nucleolus|small nuclear ribonucleoprotein complex|spliceosomal complex	protein binding			ovary(2)|kidney(1)|skin(1)	4		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TGGCTGCTGCGGAGCACGGCC	0.632			NA											7	41					0	0	0.02938	0	0
SERPINF2	5345	broad.mit.edu	37	17	1657465	1657465	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:1657465G>C	uc002ftk.1	+	10	1190	c.1113G>C	c.(1111-1113)CAG>CAC	p.Q371H	SERPINF2_uc010vqr.1_Missense_Mutation_p.Q307H	NM_000934	NP_000925	P08697	A2AP_HUMAN	alpha-2-antiplasmin isoform a precursor	371					acute-phase response|fibrinolysis|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Streptokinase(DB00086)	TCTCCGAGCAGAGCCTGGTGG	0.677			NA											11	75					0	0	0.013537	0	0
TP53	7157	broad.mit.edu	37	17	7578507	7578507	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:7578507G>T	uc002gim.2	-	5	617	c.423C>A	c.(421-423)TGC>TGA	p.C141*	TP53_uc002gig.1_Nonsense_Mutation_p.C141*|TP53_uc002gih.2_Nonsense_Mutation_p.C141*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.C9*|TP53_uc010cng.1_Nonsense_Mutation_p.C9*|TP53_uc002gii.1_Nonsense_Mutation_p.C9*|TP53_uc010cnh.1_Nonsense_Mutation_p.C141*|TP53_uc010cni.1_Nonsense_Mutation_p.C141*|TP53_uc002gij.2_Nonsense_Mutation_p.C141*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.C48*|TP53_uc002gio.2_Nonsense_Mutation_p.C9*|TP53_uc010vug.1_Nonsense_Mutation_p.C102*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	141	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		C -> A (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C141Y(61)|p.C141*(11)|p.C141R(10)|p.C141W(10)|p.0?(7)|p.C141C(4)|p.C141F(4)|p.C141fs*29(3)|p.N131fs*27(2)|p.C141S(2)|p.C141fs*8(2)|p.L137_W146del10(1)|p.K139fs*4(1)|p.C141fs*34(1)|p.C141fs*30(1)|p.A138_V143delAKTCPV(1)|p.A138_P142delAKTCP(1)|p.C141A(1)|p.C141G(1)|p.C141_P142insXX(1)|p.K139_C141>N(1)|p.C141fs*5(1)|p.P142del(1)|p.P142fs*7(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCTGCACAGGGCAGGTCTTGG	0.577	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			10	39					2.27111e-07	2.42725e-07	0.013537	1	0
MYH13	8735	broad.mit.edu	37	17	10248849	10248849	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:10248849C>A	uc002gmk.1	-	14	1438	c.1348G>T	c.(1348-1350)GAC>TAC	p.D450Y	MYH13_uc010vvf.1_Missense_Mutation_p.D125Y	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	450	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TGCTTGGTGTCCAGCTGCTGG	0.512			NA											45	93					5.39261e-20	6.02704e-20	0.01441	1	0
KRTAP4-4	84616	broad.mit.edu	37	17	39316759	39316759	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:39316759T>C	uc002hwc.2	-	1	225	c.185A>G	c.(184-186)CAC>CGC	p.H62R		NM_032524	NP_115913	Q9BYR3	KRA44_HUMAN	keratin associated protein 4.4	62	9.|26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		Missing (in allele KAP4.13).|Missing (in allele KAP4.4-v1).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GCAGCTGGGGTGGCAGCAGGT	0.662			NA											4	112					0	0	0.02938	0	0
TMEM106A	113277	broad.mit.edu	37	17	41365217	41365217	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:41365217G>A	uc002idn.1	+	3	394	c.157G>A	c.(157-159)GAT>AAT	p.D53N	TMEM106A_uc010why.1_Missense_Mutation_p.D5N|TMEM106A_uc010cze.1_Missense_Mutation_p.D53N|TMEM106A_uc010whz.1_Missense_Mutation_p.D53N	NM_145041	NP_659478	Q96A25	T106A_HUMAN	transmembrane protein 106A	53						integral to membrane					0		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		AGGAACTGCTGATGCCAGCTT	0.552			NA											12	116					0	0	0.006122	0	0
MSI2	124540	broad.mit.edu	37	17	55478817	55478817	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:55478817C>T	uc002iuz.1	+	6	563	c.390C>T	c.(388-390)TTC>TTT	p.F130F	MSI2_uc010wnm.1_Silent_p.F108F|MSI2_uc002iva.2_Silent_p.F126F	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a	130	RRM 2.					cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		AGCAATATTTCGAGCAGTTTG	0.488			NA	T	HOXA9	CML								20	61					0	0	0.027356	0	0
STRADA	92335	broad.mit.edu	37	17	61781922	61781922	+	Silent	SNP	G	G	A	rs147552949		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:61781922G>A	uc002jbm.2	-	11	1038	c.879C>T	c.(877-879)AAC>AAT	p.N293N	STRADA_uc002jbn.2_Silent_p.N235N|STRADA_uc002jbo.2_Silent_p.N256N|STRADA_uc002jbp.2_Silent_p.N256N|STRADA_uc002jbq.2_Silent_p.N235N|STRADA_uc010wpq.1_Silent_p.N249N|STRADA_uc010wpr.1_Silent_p.N264N|STRADA_uc010ddw.2_Silent_p.N264N|STRADA_uc002jbr.2_3'UTR	NM_001003787	NP_001003787	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha isoform 1	293	Protein kinase.				activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|kinase binding|protein kinase activity			ovary(1)	1						GCACTGTGCCGTTCAGTTTCT	0.632			NA											21	74					0	0	0.021523	0	0
SLC9A3R1	9368	broad.mit.edu	37	17	72759559	72759559	+	Silent	SNP	C	C	T	rs147104235	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr17:72759559C>T	uc002jlo.2	+	3	880	c.657C>T	c.(655-657)ATC>ATT	p.I219I	SLC9A3R1_uc002jln.1_RNA|SLC9A3R1_uc002jlp.2_Silent_p.I63I	NM_004252	NP_004243	O14745	NHRF1_HUMAN	sodium/hydrogen exchanger regulatory factor 1	219	PDZ 2.				apoptosis|bile acid secretion|glutathione transport|microvillus assembly|negative regulation of cell proliferation|negative regulation of ERK1 and ERK2 cascade|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|protein complex assembly|regulation of protein kinase activity|regulation of sodium:hydrogen antiporter activity|renal absorption|Wnt receptor signaling pathway	actin cytoskeleton|apical plasma membrane|centrosome|endomembrane system|filopodium|intracellular membrane-bounded organelle|microvillus membrane|ruffle	beta-2 adrenergic receptor binding|beta-catenin binding|chloride channel regulator activity|growth factor receptor binding|PDZ domain binding|phosphatase binding|protein self-association				0						TGTCCGCCATCAGGGCTGGCG	0.607			NA											8	23					0	0	0.008291	0	0
ROCK1	6093	broad.mit.edu	37	18	18586533	18586533	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr18:18586533C>G	uc002kte.2	-	16	2605	c.1664G>C	c.(1663-1665)AGG>ACG	p.R555T		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	555	Interaction with FHOD1.|Potential.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					CGATTCTGTCCTAAGTAAGTC	0.348			NA											12	45					0	0	0.010729	0	0
SLC14A2	8170	broad.mit.edu	37	18	43216966	43216966	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr18:43216966C>A	uc010dnj.2	+	7	983	c.662C>A	c.(661-663)TCT>TAT	p.S221Y	SLC14A2_uc002lbb.2_Missense_Mutation_p.S221Y|SLC14A2_uc002lbe.2_Missense_Mutation_p.S221Y	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	221	Helical; (Potential).					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						CCAGTTCTTTCTAGTGCCTTG	0.517			NA											42	154					6.4308e-24	7.23465e-24	0.01441	1	0
LINGO3	645191	broad.mit.edu	37	19	2290251	2290251	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:2290251C>G	uc010dsx.1	-	2	1653	c.1525G>C	c.(1525-1527)GAG>CAG	p.E509Q	SPPL2B_uc010dsw.1_Intron|uc002lvo.1_5'UTR	NM_001101391	NP_001094861	P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	509	Extracellular (Potential).					integral to membrane					0						TTGTGGGCCTCGCCCGGGGTC	0.726			NA											4	26					0	0	0.021553	0	0
MRPL4	51073	broad.mit.edu	37	19	10369342	10369342	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:10369342C>T	uc002mnm.2	+	9	874	c.720C>T	c.(718-720)TTC>TTT	p.F240F	MRPL4_uc002mnn.2_Silent_p.F240F|MRPL4_uc002mno.2_Silent_p.F240F	NM_146387	NP_666499	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4 isoform a	240					translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		TTAAGACCTTCAACTTGATCC	0.567			NA											10	82					0	0	0.010729	0	0
QTRT1	81890	broad.mit.edu	37	19	10823678	10823678	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:10823678G>A	uc002mpr.2	+	9	1046	c.1021G>A	c.(1021-1023)GCG>ACG	p.A341T	DNM2_uc010dxk.2_5'Flank	NM_031209	NP_112486	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	341					queuosine biosynthetic process	mitochondrion|nucleus|ribosome	metal ion binding|queuine tRNA-ribosyltransferase activity			skin(1)	1			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CAACACGGCCGCGCTGCACCA	0.682			NA											7	23					0	0	0.008291	0	0
DCAF15	90379	broad.mit.edu	37	19	14070103	14070103	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:14070103C>A	uc002mxt.2	+	7	1037	c.1031C>A	c.(1030-1032)CCT>CAT	p.P344H	DCAF15_uc002mxu.2_5'Flank	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	344										central_nervous_system(1)	1						GAAGCCCGGCCTGCCCTGTGC	0.701			NA											3	25					0.00909568	0.00936965	0.009096	1	0
TSHZ3	57616	broad.mit.edu	37	19	31770038	31770038	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:31770038C>T	uc002nsy.3	-	2	726	c.661G>A	c.(661-663)GCT>ACT	p.A221T		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	221	C2H2-type 1.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					TCGTAGGCAGCGCTGCAGTCC	0.602			NA											14	146					0	0	0.007413	0	0
MAP4K1	11184	broad.mit.edu	37	19	39103253	39103253	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:39103253G>A	uc002oix.1	-	9	771	c.663C>T	c.(661-663)CTC>CTT	p.L221L	MAP4K1_uc002oiy.1_Silent_p.L221L|MAP4K1_uc010xug.1_5'UTR	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	221	Protein kinase.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CTGCCTACCTGAGAGGGTGCA	0.607			NA											13	29					0	0	0.028581	0	0
PRX	57716	broad.mit.edu	37	19	40902612	40902612	+	Silent	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:40902612C>G	uc002onr.2	-	7	1916	c.1647G>C	c.(1645-1647)CCG>CCC	p.P549P	PRX_uc002onq.2_Silent_p.P410P|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	549	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].|18.				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding	p.P549P(1)		ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGACACTTTCGGCAGCTGTA	0.577			NA											3	172					0	0	0.014758	0	0
ZNF649	65251	broad.mit.edu	37	19	52394652	52394652	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:52394652C>T	uc002pxy.2	-	5	1005	c.737G>A	c.(736-738)AGG>AAG	p.R246K	ZNF577_uc010ydf.1_5'Flank	NM_023074	NP_075562	Q9BS31	ZN649_HUMAN	zinc finger protein 649	246	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		GAGCCTGTACCTCTTGTAGAA	0.502			NA											3	104					0	0	0.004672	0	0
KIR3DL1	3811	broad.mit.edu	37	19	55340825	55340825	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:55340825G>T	uc002qhk.3	+	7	1073	c.1010G>T	c.(1009-1011)AGA>ATA	p.R337I	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR3DL1_uc010yfn.1_Missense_Mutation_p.R262I|KIR3DL1_uc010esf.2_Missense_Mutation_p.R242I|KIR3DL1_uc010yfo.1_Missense_Mutation_p.R279I|KIR3DL1_uc002qhl.3_Intron	NM_013289	NP_037421	P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three	337	Extracellular (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		GGTAACCCCAGACACCTGCAC	0.333			NA											10	80					0.00010058	0.000106168	0.013537	1	0
NLRP8	126205	broad.mit.edu	37	19	56466501	56466501	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:56466501G>A	uc002qmh.2	+	3	1148	c.1077G>A	c.(1075-1077)ACG>ACA	p.T359T	NLRP8_uc010etg.2_Silent_p.T359T	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	359	NACHT.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GGTTTAATACGATGGAAAAAA	0.453			NA											28	60					0	0	0.015359	0	0
USP34	9736	broad.mit.edu	37	2	61484020	61484020	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:61484020C>T	uc002sbe.2	-	47	6136	c.6114G>A	c.(6112-6114)ATG>ATA	p.M2038I	USP34_uc002sbf.2_Missense_Mutation_p.M188I	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	2038					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AAATGTTCTTCATATCAGCCA	0.289			NA											5	48					0	0	0.014758	0	0
FBXO41	150726	broad.mit.edu	37	2	73493698	73493698	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:73493698C>T	uc002sjb.1	-	3	1201	c.1201G>A	c.(1201-1203)GAG>AAG	p.E401K		NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41	340	Potential.					intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3						AGCTGCCGCTCGGCACGGTCA	0.701			NA											4	26					0	0	0.009096	0	0
SNRNP200	23020	broad.mit.edu	37	2	96964614	96964614	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:96964614C>T	uc002svu.2	-	7	907	c.821G>A	c.(820-822)CGT>CAT	p.R274H		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	274						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						ATCATAGAAACGACTGAGCTG	0.438			NA											35	78					0	0	0.015359	0	0
UGGT1	56886	broad.mit.edu	37	2	128870740	128870740	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:128870740A>T	uc002tps.2	+	6	782	c.604A>T	c.(604-606)ATT>TTT	p.I202F	UGGT1_uc010fme.1_Missense_Mutation_p.I77F|UGGT1_uc002tpr.2_Missense_Mutation_p.I178F	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	202					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						CTACTCTGAGATTGGCTCTGA	0.343			NA											27	63					0	0	0.027356	0	0
LOC401010	401010	broad.mit.edu	37	2	132200935	132200935	+	Missense_Mutation	SNP	C	C	T	rs71345556	by1000genomes	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:132200935C>T	uc002tst.2	-	1	1533	c.1067G>A	c.(1066-1068)AGT>AAT	p.S356N		NR_002826				SubName: Full=cDNA FLJ12694 fis, clone NT2RP1000358, highly similar to Homo sapiens mRNA; cDNA DKFZp564C186 (from clone DKFZp564C186);												0						CAGGTTGACACTGGACAGCTT	0.597			NA											3	16					0	0	0.004672	0	0
NCKAP5	344148	broad.mit.edu	37	2	133541671	133541671	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:133541671C>T	uc002ttp.2	-	14	3087	c.2713G>A	c.(2713-2715)GAC>AAC	p.D905N	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	905							protein binding				0						TCTCCACTGTCACTAGACTCA	0.647			NA											26	53					0	0	0.009535	0	0
XIRP2	129446	broad.mit.edu	37	2	168105622	168105622	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:168105622C>G	uc002udx.2	+	8	7738	c.7720C>G	c.(7720-7722)CAA>GAA	p.Q2574E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.Q2399E|XIRP2_uc010fpq.2_Missense_Mutation_p.Q2352E|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2399					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TGTTAAAACTCAAAGCCAAAA	0.333			NA											15	54					0	0	0.0333	0	0
HDLBP	3069	broad.mit.edu	37	2	242187753	242187753	+	Missense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:242187753C>A	uc002waz.2	-	13	1751	c.1523G>T	c.(1522-1524)CGT>CTT	p.R508L	HDLBP_uc002wba.2_Missense_Mutation_p.R508L|HDLBP_uc002wbb.2_Missense_Mutation_p.R460L	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	508	KH 5.				cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		ATCCTTGGTACGCTCATTTTC	0.458			NA											24	72					2.44723e-14	2.69985e-14	0.024334	1	0
GAL3ST2	64090	broad.mit.edu	37	2	242741340	242741340	+	Silent	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:242741340A>G	uc002wcj.1	+	3	395	c.264A>G	c.(262-264)TCA>TCG	p.S88S		NM_022134	NP_071417	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	88	Lumenal (Potential).				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CCGCCGGCTCACGCGTCCACC	0.642			NA											7	78					0	0	0.006214	0	0
SLC4A11	83959	broad.mit.edu	37	20	3211402	3211402	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:3211402C>T	uc002wig.2	-	10	1354	c.1306G>A	c.(1306-1308)GCG>ACG	p.A436T	SLC4A11_uc010zqe.1_Missense_Mutation_p.A463T|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.A420T	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	436	Helical; (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						GCCAGGGGCGCGGTGGTCAGC	0.682	NSCLC(190;922 2139 10266 10292 38692)		NA											3	38					0	0	0.004672	0	0
ANKRD5	63926	broad.mit.edu	37	20	10030698	10030698	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:10030698C>G	uc002wno.2	+	7	1874	c.1481C>G	c.(1480-1482)TCA>TGA	p.S494*	uc002wnn.1_Intron|ANKRD5_uc002wnp.2_Nonsense_Mutation_p.S494*|ANKRD5_uc010gbz.2_Nonsense_Mutation_p.S305*	NM_022096	NP_071379	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	494							calcium ion binding			ovary(1)|breast(1)	2						AAGGTATTTTCAAACATTAAT	0.383			NA											10	100					0	0	0.008291	0	0
CSRP2BP	57325	broad.mit.edu	37	20	18142502	18142502	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:18142502G>C	uc002wqj.2	+	6	1343	c.721G>C	c.(721-723)GAG>CAG	p.E241Q	CSRP2BP_uc002wqk.2_Missense_Mutation_p.E113Q|CSRP2BP_uc010zru.1_Missense_Mutation_p.E112Q	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	241					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						CATTACTGTTGAGGGACTTAG	0.308			NA											20	85					0	0	0.014323	0	0
SALL4	57167	broad.mit.edu	37	20	50407635	50407635	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:50407635C>G	uc002xwh.3	-	2	1488	c.1387G>C	c.(1387-1389)GAC>CAC	p.D463H	SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	463					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TCTATGGGGTCAGGTACAGAG	0.532			NA											23	127					0	0	0.01892	0	0
LAMA5	3911	broad.mit.edu	37	20	60907449	60907449	+	Silent	SNP	G	G	A	rs142357165		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr20:60907449G>A	uc002ycq.2	-	28	3598	c.3531C>T	c.(3529-3531)GCC>GCT	p.A1177A		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1177	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTGCCTGTTCGGCTGTGAGCC	0.627			NA											9	109					0	0	0.006214	0	0
KCNJ15	3772	broad.mit.edu	37	21	39671975	39671975	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr21:39671975G>A	uc002ywv.2	+	4	1094	c.792G>A	c.(790-792)CTG>CTA	p.L264L	KCNJ15_uc002yww.2_Silent_p.L264L|KCNJ15_uc002ywx.2_Silent_p.L264L	NM_002243	NP_002234	Q99712	IRK15_HUMAN	potassium inwardly-rectifying channel J15	264	Cytoplasmic (By similarity).				synaptic transmission	integral to plasma membrane	inward rectifier potassium channel activity			ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	6						CGAGCCCCCTGAGAGACCTCA	0.547			NA											12	30					0	0	0.016723	0	0
SEPT5	5413	broad.mit.edu	37	22	19709227	19709227	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:19709227G>A	uc002zpv.1	+	9	907	c.782G>A	c.(781-783)CGG>CAG	p.R261Q	SEPT5_uc002zpw.1_RNA|SEPT5_uc002zpx.1_RNA|SEPT5_uc002zpy.1_5'UTR|SEPT5_uc002zpz.1_5'Flank	NM_002688	NP_002679	Q99719	SEPT5_HUMAN	septin 5	261					cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity			lung(1)	1	Colorectal(54;0.0993)					CAGCGGGTCCGGGGCCGACTG	0.677			NA											27	82					0	0	0.012213	0	0
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	G	A	rs146546850	byFrequency	TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			NA	F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				3	37					0	0	0.004482	0	0
TIMP3	7078	broad.mit.edu	37	22	33255201	33255201	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:33255201C>T	uc003anb.2	+	5	1659	c.473C>T	c.(472-474)ACT>ATT	p.T158I	SYN3_uc003amx.2_Intron|SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_000362	NP_000353	P35625	TIMP3_HUMAN	tissue inhibitor of metalloproteinase 3	158	Mediates interaction with EFEMP1.				negative regulation of membrane protein ectodomain proteolysis|visual perception		metal ion binding|metalloendopeptidase inhibitor activity|protein binding			lung(1)	1						TGCTTTGTGACTTCCAAGAAC	0.542			NA											72	61					0	0	0.01441	0	0
MCM5	4174	broad.mit.edu	37	22	35817407	35817407	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:35817407C>T	uc003anu.3	+	15	2023	c.1929C>T	c.(1927-1929)CTC>CTT	p.L643L	MCM5_uc010gwr.2_Silent_p.L452L|MCM5_uc003anv.3_Silent_p.L600L|MCM5_uc003anw.1_Silent_p.L427L	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	643					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						CCCTGCGGCTCTTCCAAGTGT	0.612			NA											46	121					0	0	0.01441	0	0
TRIOBP	11078	broad.mit.edu	37	22	38154137	38154137	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:38154137G>C	uc003atr.2	+	16	6476	c.6205G>C	c.(6205-6207)GAG>CAG	p.E2069Q	TRIOBP_uc003atu.2_Missense_Mutation_p.E1897Q|TRIOBP_uc003atv.2_Missense_Mutation_p.E356Q|TRIOBP_uc003atw.2_Missense_Mutation_p.E356Q|TRIOBP_uc003atx.1_5'UTR|TRIOBP_uc010gxh.2_5'UTR	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	2069	Potential.				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CGAGGCACTGGAGAAGGAGGT	0.662			NA											7	26					0	0	0.006214	0	0
APOBEC3A	200315	broad.mit.edu	37	22	39357577	39357577	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr22:39357577G>A	uc003awn.2	+	3	530	c.360G>A	c.(358-360)GTG>GTA	p.V120V	APOBEC3A_uc011aob.1_Silent_p.V102V|APOBEC3A_uc011aoc.1_Silent_p.V120V	NM_145699	NP_663745	P31941	ABC3A_HUMAN	phorbolin 1	120					cellular response to xenobiotic stimulus|defense response to virus|DNA cytosine deamination|DNA demethylation|innate immune response|negative regulation of transposition|negative regulation of viral genome replication	cytoplasm|nucleus	cytidine deaminase activity|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					ACACACACGTGAGACTGCGTA	0.572			NA											46	131					0	0	0.01441	0	0
MLH1	4292	broad.mit.edu	37	3	37081768	37081768	+	Silent	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:37081768C>G	uc003cgl.2	+	14	1710	c.1650C>G	c.(1648-1650)CTC>CTG	p.L550L	MLH1_uc011aye.1_Silent_p.L309L|MLH1_uc011ayb.1_Silent_p.L309L|MLH1_uc010hge.2_Silent_p.L550L|MLH1_uc003cgn.3_Silent_p.L309L|MLH1_uc011ayc.1_Silent_p.L452L|MLH1_uc011ayd.1_Silent_p.L309L|MLH1_uc003cgo.2_Silent_p.L309L|MLH1_uc010hgj.1_Silent_p.L192L|MLH1_uc010hgk.2_Silent_p.L192L|MLH1_uc010hgl.1_Silent_p.L125L|MLH1_uc010hgn.2_Silent_p.L192L|MLH1_uc010hgm.2_Intron|MLH1_uc010hgo.2_Intron|MLH1_uc010hgp.2_5'Flank|MLH1_uc010hgq.2_5'Flank	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	550	Interaction with EXO1.		L -> P (in HNPCC2).		mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						TATACCTTCTCAACACCACCA	0.463			1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				13	51					0	0	0.007413	0	0
ITGA9	3680	broad.mit.edu	37	3	37565099	37565099	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:37565099C>T	uc003chd.2	+	12	1377	c.1324C>T	c.(1324-1326)CCT>TCT	p.P442S	ITGA9_uc003chc.2_Missense_Mutation_p.P442S	NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor	442	Extracellular (Potential).|Potential.|FG-GAP 7.				axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		AAATGGCTATCCTGGTAAGCT	0.383			NA											7	65					0	0	0.00308	0	0
GORASP1	64689	broad.mit.edu	37	3	39139759	39139759	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:39139759C>T	uc003ciw.1	-	9	1389	c.1291G>A	c.(1291-1293)GAC>AAC	p.D431N	GORASP1_uc003civ.1_RNA|GORASP1_uc003cix.1_RNA|GORASP1_uc003ciy.1_RNA|GORASP1_uc011ayw.1_Missense_Mutation_p.D336N|GORASP1_uc003ciz.1_Missense_Mutation_p.D276N	NM_031899	NP_114105	Q9BQQ3	GORS1_HUMAN	Golgi reassembly stacking protein 1	431					mitotic prophase|protein transport	cytosol|Golgi apparatus|membrane				ovary(2)|central_nervous_system(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GCCTGGCTGTCCAGCCCCTCA	0.607			NA											20	47					0	0	0.012319	0	0
BOC	91653	broad.mit.edu	37	3	112991470	112991470	+	Nonsense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:112991470C>G	uc003dzx.2	+	7	1502	c.881C>G	c.(880-882)TCA>TGA	p.S294*	BOC_uc003dzy.2_Nonsense_Mutation_p.S294*|BOC_uc003dzz.2_Nonsense_Mutation_p.S294*|BOC_uc003eab.2_5'UTR	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	294	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			GAGGAGGACTCAGGCACCTAC	0.617			NA											15	47					0	0	0.024245	0	0
C3orf15	89876	broad.mit.edu	37	3	119434438	119434438	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:119434438C>T	uc003ede.3	+	6	607	c.530C>T	c.(529-531)TCT>TTT	p.S177F	C3orf15_uc003edc.2_Missense_Mutation_p.S177F|C3orf15_uc010hqy.1_Missense_Mutation_p.S177F|C3orf15_uc010hqz.2_Missense_Mutation_p.S115F|C3orf15_uc011bjd.1_Missense_Mutation_p.S51F|C3orf15_uc011bje.1_Missense_Mutation_p.S157F|C3orf15_uc010hra.1_5'UTR	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	177						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		CCTCCTACTTCTACTAAGCAC	0.368			NA											37	175					0	0	0.01441	0	0
ZBBX	79740	broad.mit.edu	37	3	167023506	167023506	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:167023506G>C	uc003fep.2	-	17	1973	c.1650C>G	c.(1648-1650)ATC>ATG	p.I550M	ZBBX_uc011bpc.1_Missense_Mutation_p.I550M|ZBBX_uc003feq.2_Missense_Mutation_p.I521M	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	550						intracellular	zinc ion binding			ovary(2)	2						AGGATTCTTTGATGTCTTGAG	0.343			NA											16	31					0	0	0.006122	0	0
MCCC1	56922	broad.mit.edu	37	3	182738007	182738007	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:182738007C>G	uc003fle.2	-	17	2025	c.1888G>C	c.(1888-1890)GAC>CAC	p.D630H	MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.D513H|MCCC1_uc003flg.2_Missense_Mutation_p.D521H|MCCC1_uc011bqp.1_Missense_Mutation_p.D583H	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	630	Biotinyl-binding.				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	ACTGGAATGTCAATCTCAATA	0.378			NA											6	46					0	0	0.02938	0	0
MUC4	4585	broad.mit.edu	37	3	195508133	195508133	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr3:195508133G>A	uc011bto.1	-	3	10394	c.9934C>T	c.(9934-9936)CCT>TCT	p.P3312S	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAACAGGGGTGGCGTGA	0.592			NA											3	7					0	0	0.009096	0	0
HTT	3064	broad.mit.edu	37	4	3179079	3179079	+	Missense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:3179079G>T	uc011bvq.1	+	35	4579	c.4434G>T	c.(4432-4434)TTG>TTT	p.L1478F		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1476					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCTTTGTATTGAAACAGTTTG	0.299			NA											8	18					3.86212e-05	4.102e-05	0.008291	1	0
EVC	2121	broad.mit.edu	37	4	5754640	5754640	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:5754640G>A	uc003gil.1	+	9	1360	c.1176G>A	c.(1174-1176)GAG>GAA	p.E392E	EVC_uc003gim.1_RNA|CRMP1_uc003gin.1_Intron	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	392					muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)				TCCAGGAGGAGACCAGGTGCC	0.627			NA											14	38					0	0	0.007413	0	0
TAPT1	202018	broad.mit.edu	37	4	16188416	16188416	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:16188416C>T	uc010ied.1	-	6	915	c.834G>A	c.(832-834)ATG>ATA	p.M278I	TAPT1_uc011bxd.1_Intron|TAPT1_uc011bxe.1_Missense_Mutation_p.M167I	NM_153365	NP_699196	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation	278						integral to membrane	growth hormone-releasing hormone receptor activity				0						TATTAGACATCATGATAGTAA	0.318			NA											4	28					0	0	0.021553	0	0
ARAP2	116984	broad.mit.edu	37	4	36189162	36189162	+	Missense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:36189162G>C	uc003gsq.1	-	8	1927	c.1589C>G	c.(1588-1590)TCT>TGT	p.S530C	ARAP2_uc003gsr.1_Missense_Mutation_p.S530C	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	530	PH 1.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TGATATAGCAGAAAGGGGAAT	0.308			NA											16	34					0	0	0.012319	0	0
MUC7	4589	broad.mit.edu	37	4	71346978	71346978	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:71346978T>C	uc011cat.1	+	4	805	c.517T>C	c.(517-519)TCT>CCT	p.S173P	MUC7_uc011cau.1_Missense_Mutation_p.S173P|MUC7_uc003hfj.2_Missense_Mutation_p.S173P|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	173	1.|Thr-rich.					extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			ACCCACACCTTCTGCAACTAC	0.522			NA											3	158					0	0	0.009096	0	0
ART3	419	broad.mit.edu	37	4	76997033	76997033	+	Splice_Site	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:76997033G>C	uc003hjo.2	+	2	111	c.-8_splice	c.e2-1		ART3_uc003hji.2_Splice_Site|ART3_uc003hjj.2_Splice_Site|ART3_uc003hjk.2_Splice_Site|ART3_uc010ija.1_Splice_Site|ART3_uc003hjn.2_Splice_Site|ART3_uc003hjp.2_5'Flank|ART3_uc010ijb.2_5'Flank|ART3_uc003hjq.2_5'Flank	NM_001130016	NP_001123488	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3 isoform a						protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity			ovary(2)	2			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTTTAATTTAGAAGAGAAAAA	0.358			NA											4	56					0	0	0.014758	0	0
FRAS1	80144	broad.mit.edu	37	4	79362436	79362436	+	Nonsense_Mutation	SNP	G	G	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:79362436G>T	uc003hlb.2	+	41	6090	c.5650G>T	c.(5650-5652)GAG>TAG	p.E1884*	FRAS1_uc003hkw.2_Nonsense_Mutation_p.E1884*|FRAS1_uc010ijj.1_Nonsense_Mutation_p.E304*	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	1883	CSPG 7.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGGCTGCATTGAGAACACAGG	0.453			NA											6	6					0.00116845	0.00122579	0.021553	1	0
PITX2	5308	broad.mit.edu	37	4	111542381	111542381	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:111542381G>A	uc003iad.2	-	4	911	c.329C>T	c.(328-330)CCG>CTG	p.P110L	PITX2_uc003iac.2_Missense_Mutation_p.P117L|PITX2_uc003iae.2_Missense_Mutation_p.P64L|PITX2_uc010iml.2_Intron|PITX2_uc003iaf.2_Missense_Mutation_p.P110L|PITX2_uc003iag.1_Missense_Mutation_p.P117L	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	110	Homeobox.		P -> L (in RIEG1).|P -> R (in RIEG1).		determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GGACATGTCCGGGTAGCGGTT	0.622			NA											8	30					0	0	0.004482	0	0
PHF17	79960	broad.mit.edu	37	4	129793167	129793167	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr4:129793167A>T	uc003igk.2	+	11	2559	c.2279A>T	c.(2278-2280)CAG>CTG	p.Q760L	PHF17_uc003igl.2_Missense_Mutation_p.Q748L|PHF17_uc011cgy.1_Missense_Mutation_p.Q760L	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	760					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0						GGGGAACGGCAGCAGCAGGGA	0.532			NA											3	24					0	0	0.004672	0	0
DNAJC21	134218	broad.mit.edu	37	5	34954703	34954703	+	Missense_Mutation	SNP	C	C	T	rs141076061		TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:34954703C>T	uc003jjc.2	+	12	1707	c.1480C>T	c.(1480-1482)CGG>TGG	p.R494W	DNAJC21_uc003jjb.2_Missense_Mutation_p.R539W	NM_001012339	NP_001012339	Q5F1R6	DJC21_HUMAN	DnaJ homology subfamily A member 5 isoform 2	494	C2H2-type 2.				protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			ATTTCCATCTCGGAATAAACT	0.388			NA											11	132					0	0	0.016723	0	0
RICTOR	253260	broad.mit.edu	37	5	38950389	38950389	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:38950389C>G	uc003jlp.2	-	31	3585	c.3561G>C	c.(3559-3561)AAG>AAC	p.K1187N	RICTOR_uc003jlo.2_Missense_Mutation_p.K1187N|RICTOR_uc010ivf.2_Missense_Mutation_p.K902N	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1187					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					TACCAAAATTCTTGGTGAATT	0.363			NA											24	176					0	0	0.01892	0	0
RHOBTB3	22836	broad.mit.edu	37	5	95099311	95099311	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:95099311A>G	uc003klm.2	+	7	1685	c.1148A>G	c.(1147-1149)AAA>AGA	p.K383R		NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3	383					retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TGCATTTTAAAAACACCAGGA	0.328			NA											8	38					0	0	0.006214	0	0
PCDH1	5097	broad.mit.edu	37	5	141244682	141244682	+	Nonsense_Mutation	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr5:141244682G>C	uc003llq.2	-	3	1331	c.1214C>G	c.(1213-1215)TCA>TGA	p.S405*	PCDH1_uc003llp.2_Nonsense_Mutation_p.S405*|PCDH1_uc011dbf.1_Nonsense_Mutation_p.S383*	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	405	Extracellular (Potential).|Cadherin 4.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		CACATCCTCTGAGATGTTAGC	0.557	Ovarian(132;1609 1739 4190 14731 45037)		NA											6	89					0	0	0.021553	0	0
NEDD9	4739	broad.mit.edu	37	6	11190841	11190841	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr6:11190841C>G	uc003mzv.2	-	5	1428	c.1261G>C	c.(1261-1263)GAG>CAG	p.E421Q	NEDD9_uc010joz.2_Missense_Mutation_p.E421Q|NEDD9_uc003mzw.3_Missense_Mutation_p.E275Q	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	421					actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			ACACCCATCTCAAGGGCCTGC	0.532			NA											10	54					0	0	0.010729	0	0
MDC1	9656	broad.mit.edu	37	6	30672941	30672941	+	Missense_Mutation	SNP	T	T	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr6:30672941T>C	uc003nrg.3	-	10	4459	c.4019A>G	c.(4018-4020)CAA>CGA	p.Q1340R	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.Q947R	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1340	Pro-rich.|Interaction with the PRKDC complex.				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						GGTGACAGGTTGGTCTGTGGA	0.537			NA						Other_conserved_DNA_damage_response_genes					4	252					0	0	0.00308	0	0
SHPRH	257218	broad.mit.edu	37	6	146276084	146276084	+	Silent	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr6:146276084A>T	uc003qlf.2	-	2	774	c.375T>A	c.(373-375)CCT>CCA	p.P125P	SHPRH_uc003qld.2_Silent_p.P125P|SHPRH_uc003qle.2_Silent_p.P125P|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Intron|SHPRH_uc003qlk.1_Silent_p.P125P	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	125					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		AACTCTGTGCAGGAAGAAGCT	0.338			NA											11	24					0	0	0.016723	0	0
MAD1L1	8379	broad.mit.edu	37	7	1997277	1997277	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:1997277C>T	uc003slh.1	-	16	1849	c.1583G>A	c.(1582-1584)CGG>CAG	p.R528Q	MAD1L1_uc003sle.1_Missense_Mutation_p.R257Q|MAD1L1_uc003slf.1_Missense_Mutation_p.R528Q|MAD1L1_uc003slg.1_Missense_Mutation_p.R528Q|MAD1L1_uc010ksh.1_Missense_Mutation_p.R528Q|MAD1L1_uc003sli.1_Missense_Mutation_p.R436Q|MAD1L1_uc010ksi.1_Missense_Mutation_p.R481Q|MAD1L1_uc010ksj.2_Missense_Mutation_p.R528Q	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	528	Necessary for interaction with NEK2.|Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CAGAGCTCGCCGCTCCAGCTG	0.637			NA											14	96					0	0	0.0333	0	0
RADIL	55698	broad.mit.edu	37	7	4917450	4917450	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:4917450G>A	uc003snj.1	-	2	494	c.321C>T	c.(319-321)GCC>GCT	p.A107A	RADIL_uc003sng.1_RNA|RADIL_uc011jwd.1_RNA	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	107	Ras-associating.				cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CGTACTGGCCGGCCTGCCTGG	0.692			NA											12	88					0	0	0.010729	0	0
ADAM22	53616	broad.mit.edu	37	7	87778374	87778374	+	Splice_Site	SNP	T	T	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:87778374T>A	uc003ujn.2	+	18	1645	c.1566_splice	c.e18+2	p.Q522_splice	ADAM22_uc003ujk.1_Splice_Site_p.Q522_splice|ADAM22_uc003ujl.1_Splice_Site_p.Q522_splice|ADAM22_uc003ujm.2_Splice_Site_p.Q522_splice|ADAM22_uc003ujo.2_Splice_Site_p.Q522_splice|ADAM22_uc003ujp.1_Splice_Site_p.Q574_splice	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TCAAGCCAGGTAATTTACAAA	0.388			NA											3	28					0	0	0.004672	0	0
ZNF789	285989	broad.mit.edu	37	7	99084102	99084102	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:99084102C>G	uc003uqq.1	+	5	488	c.269C>G	c.(268-270)TCT>TGT	p.S90C	ZNF789_uc010lfw.1_5'UTR|ZNF789_uc003uqr.1_Missense_Mutation_p.S32C	NM_213603	NP_998768	Q5FWF6	ZN789_HUMAN	zinc finger protein 789 isoform 1	90					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TGGCTAGGTTCTGAAGCCAGA	0.373			NA											4	13					0	0	0.021553	0	0
FOXP2	93986	broad.mit.edu	37	7	114268618	114268618	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:114268618G>A	uc003vhb.2	+	4	656	c.282G>A	c.(280-282)ATG>ATA	p.M94I	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.M119I|FOXP2_uc003vha.2_Missense_Mutation_p.M2I|FOXP2_uc011kmu.1_Missense_Mutation_p.M94I|FOXP2_uc011kmv.1_Missense_Mutation_p.M94I|FOXP2_uc010ljz.1_Missense_Mutation_p.M2I|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Missense_Mutation_p.M94I|FOXP2_uc003vgw.2_Missense_Mutation_p.M119I|FOXP2_uc003vgx.2_Missense_Mutation_p.M94I|FOXP2_uc003vhd.2_Missense_Mutation_p.M94I|FOXP2_uc003vhc.2_Missense_Mutation_p.M119I	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	94	Gln-rich.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						TGGCCATGATGACTCCCCAGG	0.468			NA											10	162					0	0	0.016723	0	0
PTPRZ1	5803	broad.mit.edu	37	7	121652803	121652803	+	Missense_Mutation	SNP	A	A	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr7:121652803A>G	uc003vjy.2	+	12	4098	c.3703A>G	c.(3703-3705)ATG>GTG	p.M1235V	PTPRZ1_uc003vjz.2_Intron|PTPRZ1_uc011knt.1_Intron	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,	1235	Extracellular (Potential).				central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						AAGTGAAAACATGCTGCACTC	0.393			NA											9	130					0	0	0.004482	0	0
POLR2K	5440	broad.mit.edu	37	8	101163574	101163575	+	Splice_Site	DNP	GG	GG	AC			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	GG	GG	-	-	GG	GG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:101163574_101163575GG>AC	uc003yjf.2	+	2	100	c.-8_splice	c.e2-1			NM_005034	NP_005025	P53803	RPAB4_HUMAN	DNA directed RNA polymerase II polypeptide K						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TGTGATTTCAGGGGCTAACAAT	0.416			NA											11	69					0	0	0.004672	0	0
POLR2K	5440	broad.mit.edu	37	8	101164063	101164063	+	Missense_Mutation	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:101164063G>A	uc003yjf.2	+	3	181	c.73G>A	c.(73-75)GAA>AAA	p.E25K		NM_005034	NP_005025	P53803	RPAB4_HUMAN	DNA directed RNA polymerase II polypeptide K	25	C4-type (Potential).				mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.59e-09)|all cancers(13;1.74e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			GTGTCACACAGAAAATGAAAT	0.294			NA											4	18					0	0	0.009096	0	0
MTSS1	9788	broad.mit.edu	37	8	125577908	125577908	+	Silent	SNP	G	G	C			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:125577908G>C	uc003yrk.2	-	9	1353	c.819C>G	c.(817-819)GTC>GTG	p.V273V	NDUFB9_uc011lim.1_Intron|MTSS1_uc011lin.1_Silent_p.V7V|MTSS1_uc011lio.1_Silent_p.V163V|MTSS1_uc003yri.2_Silent_p.V73V|MTSS1_uc003yrj.2_Silent_p.V273V|MTSS1_uc003yrl.2_Silent_p.V277V	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	273	Ser-rich.				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CTCACCTGCAGACACTGGACT	0.507	Esophageal Squamous(160;622 1893 3862 8546 12509)		NA											13	39					0	0	0.024245	0	0
GRIN3A	116443	broad.mit.edu	37	9	104433325	104433325	+	Missense_Mutation	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:104433325C>T	uc004bbp.1	-	3	1970	c.1369G>A	c.(1369-1371)GTC>ATC	p.V457I	GRIN3A_uc004bbq.1_Missense_Mutation_p.V457I	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	457	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	TCTGAGCTGACGATGGTGGAA	0.478			NA											40	148					0	0	0.01441	0	0
TLR4	7099	broad.mit.edu	37	9	120475322	120475322	+	Missense_Mutation	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:120475322T>G	uc004bjz.2	+	3	1207	c.916T>G	c.(916-918)TGT>GGT	p.C306G	TLR4_uc004bka.2_Missense_Mutation_p.C266G|TLR4_uc004bkb.2_Missense_Mutation_p.C106G	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	306	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						CTTATTTAATTGTTTGACAAA	0.338			NA											12	55					0	0	0.020292	0	0
SLC25A25	114789	broad.mit.edu	37	9	130868088	130868088	+	Silent	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:130868088C>A	uc004bte.2	+	6	755	c.726C>A	c.(724-726)CTC>CTA	p.L242L	SLC25A25_uc004btb.2_Silent_p.L276L|SLC25A25_uc004btc.2_Silent_p.L262L|SLC25A25_uc004btd.2_Silent_p.L274L|SLC25A25_uc004btf.2_Silent_p.L139L	NM_052901	NP_443133	Q6KCM7	SCMC2_HUMAN	solute carrier family 25, member 25 isoform a	242	Solcar 1.|Mitochondrial matrix (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding				0						CCAGGTCACTCTGGCGGGGCA	0.577			NA											15	76					6.31663e-08	6.79335e-08	0.024245	1	0
NUP188	23511	broad.mit.edu	37	9	131721149	131721149	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:131721149C>G	uc004bws.1	+	7	463	c.441C>G	c.(439-441)TTC>TTG	p.F147L		NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	147					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						TCACTTACTTCCAAGATGAAA	0.308			NA											3	28					0	0	0.009096	0	0
NTNG2	84628	broad.mit.edu	37	9	135073778	135073778	+	Silent	SNP	C	C	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:135073778C>T	uc004cbh.2	+	3	1415	c.639C>T	c.(637-639)TTC>TTT	p.F213F		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	213	Laminin N-terminal.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		ACGTGCGCTTCGAGGTGCGGG	0.667			NA											9	37					0	0	0.006214	0	0
ANAPC2	29882	broad.mit.edu	37	9	140077680	140077680	+	Missense_Mutation	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr9:140077680C>G	uc004clr.1	-	6	1256	c.1183G>C	c.(1183-1185)GAC>CAC	p.D395H	ANAPC2_uc004clq.1_Missense_Mutation_p.D251H	NM_013366	NP_037498	Q9UJX6	ANC2_HUMAN	anaphase-promoting complex subunit 2	395					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cyclin catabolic process|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of synapse maturation|positive regulation of synaptic plasticity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination|regulation of cyclin-dependent protein kinase activity	anaphase-promoting complex|cytosol|nucleoplasm	ubiquitin protein ligase binding|ubiquitin-protein ligase activity			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGATGATGTCACACGTGTTG	0.617			NA											39	139					0	0	0.010771	0	0
Unknown	0	broad.mit.edu	37	X	80185639	80185639	+	Missense_Mutation	SNP	A	A	T			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:80185639A>T	uc004eec.1	+	1	712	c.538A>T	c.(538-540)AGT>TGT	p.S180C						SubName: Full=cDNA FLJ16670 fis, clone THYMU3001133, highly similar to Voltage-dependent anion-selective channel protein 1; SubName: Full=Voltage-dependent anion channel 1, isoform CRA_a;												NA						AGCAGGAAACAGTAACACGCG	0.493			NA											16	96					0	0	0.008871	0	0
FAM122C	159091	broad.mit.edu	37	X	133941655	133941655	+	Silent	SNP	T	T	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:133941655T>G	uc004exz.1	+	1	432	c.27T>G	c.(25-27)GGT>GGG	p.G9G	FAM122C_uc010nru.1_Silent_p.G45G|FAM122C_uc004exw.2_Silent_p.G9G|FAM122C_uc004exx.2_RNA|FAM122C_uc011mvq.1_RNA|FAM122C_uc004exy.1_Silent_p.G9G	NM_138819	NP_620174	Q6P4D5	F222C_HUMAN	hypothetical protein LOC159091	9											0	Acute lymphoblastic leukemia(192;0.000127)					TGAAACTAGGTTTCAAGTCGC	0.522			NA											18	125					0	0	0.01892	0	0
MAGEC1	9947	broad.mit.edu	37	X	140994960	140994960	+	Silent	SNP	G	G	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:140994960G>A	uc004fbt.2	+	4	2056	c.1770G>A	c.(1768-1770)CTG>CTA	p.L590L	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	590							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					AGGACTCCCTGTCTCCTCACT	0.567			NA								HNSCC(15;0.026)			7	481					0	0	0.00308	0	0
MTMR1	8776	broad.mit.edu	37	X	149901147	149901147	+	Nonsense_Mutation	SNP	C	C	A			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:149901147C>A	uc004fei.2	+	9	1136	c.1001C>A	c.(1000-1002)TCA>TAA	p.S334*	MTMR1_uc011mya.1_Nonsense_Mutation_p.S240*|MTMR1_uc004feg.1_Nonsense_Mutation_p.S334*|MTMR1_uc004feh.1_Nonsense_Mutation_p.S342*|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_RNA	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	334	Myotubularin phosphatase.					plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					AACGCACAGTCACACAAGCTT	0.423			NA											9	54					4.68919e-08	5.07501e-08	0.008291	1	0
F8	2157	broad.mit.edu	37	X	154197823	154197823	+	Silent	SNP	C	C	G			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chrX:154197823C>G	uc004fmt.2	-	7	963	c.792G>C	c.(790-792)CTG>CTC	p.L264L		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	264	Plastocyanin-like 2.|F5/8 type A 1.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGCATCCAATCAGACCTGTAA	0.418			NA											27	67					0	0	0.034045	0	0
CD37	951	broad.mit.edu	37	19	49841253	49841253	+	Frame_Shift_Del	DEL	G	G	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr19:49841253delG	uc002pnd.2	+	5	535	c.414delG	c.(412-414)GCGfs	p.A138fs	uc002pnb.1_Intron|CD37_uc002pnc.2_RNA|CD37_uc010yam.1_Frame_Shift_Del_p.A138fs|CD37_uc010yan.1_Frame_Shift_Del_p.A70fs|CD37_uc002pnf.3_Frame_Shift_Del_p.A110fs|CD37_uc002pne.2_Frame_Shift_Del_p.A70fs	NM_001774	NP_001765	P11049	CD37_HUMAN	CD37 antigen isoform A	138	Extracellular (Potential).					integral to membrane					0		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		AGGAGACCGCGGCCGAGGAGA	0.632			NA											17	49	---	---	---	---	NA	NA	NA	NA	NA
ALS2CR11	151254	broad.mit.edu	37	2	202352352	202352352	+	Frame_Shift_Del	DEL	T	T	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:202352352delT	uc002uye.2	-	15	1903	c.1855delA	c.(1855-1857)ATTfs	p.I619fs	ALS2CR11_uc002uyf.2_Frame_Shift_Del_p.I1816fs|ALS2CR11_uc010fti.2_3'UTR	NM_152525	NP_689738	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	619										large_intestine(1)|ovary(1)|skin(1)	3						CCTCTTTTAATTTTTTTTGGC	0.323			NA											7	55	---	---	---	---	NA	NA	NA	NA	NA
NBEAL1	65065	broad.mit.edu	37	2	204030880	204030882	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	AAG	AAG	-	-	AAG	AAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr2:204030880_204030882delAAG	uc002uzt.3	+	36	5969_5971	c.5636_5638delAAG	c.(5635-5640)AAAGAA>AAA	p.E1881del	NBEAL1_uc002uzs.3_In_Frame_Del_p.E591del	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	1881							binding			ovary(1)|skin(1)	2						AGTGATGAGAAAGAAGAACAGGA	0.281			NA											15	33	---	---	---	---	NA	NA	NA	NA	NA
LRRC14	9684	broad.mit.edu	37	8	145746499	145746502	+	Frame_Shift_Del	DEL	TGAG	TGAG	-			TCGA-55-7726-01A-11D-2167-08	TCGA-55-7726-10A-01D-2167-08	TGAG	TGAG	-	-	TGAG	TGAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	8928b562-7e58-4619-868f-5be53aeec89f	5f0443ea-b942-439d-bd2e-f2a7b8e6b678	g.chr8:145746499_145746502delTGAG	uc003zdk.1	+	4	1265_1268	c.1119_1122delTGAG	c.(1117-1122)ACTGAGfs	p.T373fs	LRRC14_uc003zdl.1_Frame_Shift_Del_p.T373fs|LRRC14_uc003zdo.2_5'Flank	NM_014665	NP_055480	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	373_374	LRR 4.										0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGGAGCTGACTGAGTGTCAGCTCG	0.593			NA											10	50	---	---	---	---	NA	NA	NA	NA	NA
