Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
SFRS4	6429	broad.mit.edu	37	1	29475178	29475178	+	Missense_Mutation	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:29475178G>C	uc001bro.2	-	6	1602	c.1229C>G	c.(1228-1230)TCC>TGC	p.S410C	SFRS4_uc010ofy.1_3'UTR	NM_005626	NP_005617	Q08170	SRSF4_HUMAN	splicing factor, arginine/serine-rich 4	410	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|RNA binding				0		Colorectal(325;0.00161)|Breast(348;0.0364)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0529)|Lung NSC(340;0.0654)|all_lung(284;0.074)|Ovarian(437;0.104)|Medulloblastoma(700;0.151)		Colorectal(126;1.01e-07)|COAD - Colon adenocarcinoma(152;6.21e-06)|STAD - Stomach adenocarcinoma(196;0.0196)|BRCA - Breast invasive adenocarcinoma(304;0.0531)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.138)		CTTTGACACGGAGCGGGATGG	0.448			NA											9	58					0	0	0.069234	0	0
TOE1	114034	broad.mit.edu	37	1	45808791	45808791	+	Missense_Mutation	SNP	A	A	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:45808791A>C	uc009vxq.2	+	8	1533	c.950A>C	c.(949-951)CAG>CCG	p.Q317P	MUTYH_uc001cno.2_5'Flank|MUTYH_uc001cnk.2_5'Flank|MUTYH_uc010oll.1_5'Flank|MUTYH_uc001cnm.2_5'Flank|MUTYH_uc001cnl.2_5'Flank|MUTYH_uc009vxp.2_5'Flank|MUTYH_uc001cnn.2_5'Flank|TOE1_uc001cnq.3_RNA|TOE1_uc010olm.1_Missense_Mutation_p.Q237P|TOE1_uc001cnr.3_RNA	NM_025077	NP_079353	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	317	C3H1-type.					nuclear speck|nucleolus	nucleic acid binding|zinc ion binding			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)					CAGTGTCCTCAGTCTCACGAT	0.552			NA											6	99					0	0	0.02938	0	0
IFI44L	10964	broad.mit.edu	37	1	79101124	79101124	+	Missense_Mutation	SNP	A	A	T	rs149877350		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:79101124A>T	uc010oro.1	+	5	1005	c.826A>T	c.(826-828)ATG>TTG	p.M276L	IFI44L_uc010orp.1_Missense_Mutation_p.M13L|IFI44L_uc010orq.1_Missense_Mutation_p.M13L	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	276						cytoplasm					0						AGGACTGTGCATGGATGACAT	0.373			NA											42	621					0	0	0.048971	0	0
PRG4	10216	broad.mit.edu	37	1	186277099	186277099	+	Missense_Mutation	SNP	G	G	A	rs143599637	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:186277099G>A	uc001gru.3	+	7	2299	c.2248G>A	c.(2248-2250)GCT>ACT	p.A750T	PRG4_uc001grt.3_Missense_Mutation_p.A709T|PRG4_uc009wyl.2_Missense_Mutation_p.A657T|PRG4_uc009wym.2_Missense_Mutation_p.A616T|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	750	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|47; approximate.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						TGACAAGCCCGCTCCAACTAC	0.607			NA											4	15					0	0	0.014758	0	0
LAMB3	3914	broad.mit.edu	37	1	209797336	209797336	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:209797336G>C	uc001hhg.2	-	14	2376	c.1986C>G	c.(1984-1986)CTC>CTG	p.L662L	LAMB3_uc009xco.2_Silent_p.L662L|LAMB3_uc001hhh.2_Silent_p.L662L|LAMB3_uc010psl.1_RNA|hsa-mir-4260|MI0015859_5'Flank	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	662	Domain II.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GCAGGCCCTGGAGAGTTCGCC	0.532			NA											12	34					0	0	0.024245	0	0
KCNH1	3756	broad.mit.edu	37	1	211280627	211280627	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:211280627C>T	uc001hib.2	-	2	342	c.172G>A	c.(172-174)GCA>ACA	p.A58T	KCNH1_uc001hic.2_Missense_Mutation_p.A58T	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	58	Cytoplasmic (Potential).|PAS.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ATCACTTCTGCCCTGTGATAG	0.388			NA											51	99					0	0	0.048971	0	0
TLR5	7100	broad.mit.edu	37	1	223283837	223283837	+	Missense_Mutation	SNP	T	T	C	rs5744177	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:223283837T>C	uc001hnv.1	-	4	2983	c.2537A>G	c.(2536-2538)GAC>GGC	p.D846G	TLR5_uc001hnw.1_Missense_Mutation_p.D846G	NM_003268	NP_003259	O60602	TLR5_HUMAN	toll-like receptor 5 precursor	846	Cytoplasmic (Potential).		Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1).		cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of toll-like receptor signaling pathway	integral to membrane|plasma membrane	interleukin-1 receptor binding|transmembrane receptor activity			ovary(2)|lung(1)|skin(1)	4				GBM - Glioblastoma multiforme(131;0.0851)		AATGTTATTGTCTTTCTTCTT	0.378			NA											5	94					0	0	0.021553	0	0
RYR2	6262	broad.mit.edu	37	1	237777703	237777703	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:237777703C>T	uc001hyl.1	+	37	5395	c.5275C>T	c.(5275-5277)CCA>TCA	p.P1759S		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1759	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTCCCTCAGGCCACGGATGCA	0.512			NA											33	299					0	0	0.086207	0	0
ST8SIA6	338596	broad.mit.edu	37	10	17363049	17363049	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:17363049C>A	uc001ipd.2	-	8	1025	c.1025G>T	c.(1024-1026)GGA>GTA	p.G342V	ST8SIA6_uc010qce.1_RNA	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	342	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						GGGCCAGAATCCATACAGCTT	0.433			NA											131	271					9.59235e-44	1.07688e-43	0.048971	1	0
MAP3K8	1326	broad.mit.edu	37	10	30748249	30748249	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:30748249G>C	uc001ivi.1	+	8	1788	c.1092G>C	c.(1090-1092)CTG>CTC	p.L364L	MAP3K8_uc009xlf.1_Silent_p.L364L|MAP3K8_uc001ivj.1_Silent_p.L364L	NM_005204	NP_005195	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase	364	Protein kinase.				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			breast(3)|central_nervous_system(1)	4		Prostate(175;0.151)				TGAGAGAGCTGATAGAAGCTT	0.527			NA											7	92					0	0	0.038147	0	0
MAP3K8	1326	broad.mit.edu	37	10	30748321	30748321	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:30748321G>C	uc001ivi.1	+	8	1860	c.1164G>C	c.(1162-1164)CTG>CTC	p.L388L	MAP3K8_uc009xlf.1_Silent_p.L388L|MAP3K8_uc001ivj.1_Silent_p.L388L	NM_005204	NP_005195	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase	388	Protein kinase.				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			breast(3)|central_nervous_system(1)	4		Prostate(175;0.151)				ATGAGGCCCTGAACCCGCCCA	0.567			NA											7	57					0	0	0.038147	0	0
FAM178A	55719	broad.mit.edu	37	10	102690783	102690783	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:102690783C>T	uc001krt.3	+	9	2926	c.2384C>T	c.(2383-2385)TCT>TTT	p.S795F	FAM178A_uc001krs.2_Missense_Mutation_p.S795F	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	795											0						TTCCTTACGTCTGCTTATCAC	0.368			NA											24	268					0	0	0.045705	0	0
COL17A1	1308	broad.mit.edu	37	10	105801076	105801076	+	Missense_Mutation	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:105801076G>T	uc001kxr.2	-	38	2801	c.2632C>A	c.(2632-2634)CCC>ACC	p.P878T		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	878	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGCCTCGGGGTCCTGGTGGG	0.647			NA											6	45					1.26484e-09	1.4067e-09	0.038147	1	0
PNLIPRP3	119548	broad.mit.edu	37	10	118228714	118228714	+	Silent	SNP	T	T	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr10:118228714T>C	uc001lcl.3	+	9	1046	c.945T>C	c.(943-945)TGT>TGC	p.C315C		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	315					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		GCTTCTTTTGTTCCAAAGAAG	0.313			NA											24	140					0	0	0.045705	0	0
NLRP10	338322	broad.mit.edu	37	11	7981660	7981660	+	Missense_Mutation	SNP	T	T	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:7981660T>C	uc001mfv.1	-	2	1516	c.1499A>G	c.(1498-1500)GAG>GGG	p.E500G		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	500							ATP binding	p.E500D(1)		lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCCTTTACCTCCAGCAGCCT	0.493			NA											8	147					0	0	0.080935	0	0
HSD17B12	51144	broad.mit.edu	37	11	43819909	43819909	+	Missense_Mutation	SNP	A	A	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:43819909A>T	uc001mxq.3	+	4	558	c.323A>T	c.(322-324)GAC>GTC	p.D108V		NM_016142	NP_057226	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	108					long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0						ATTGCTGTTGACTTTGCATCA	0.368	Ovarian(58;548 1143 13948 16572 34258)		NA											97	227					0	0	0.048971	0	0
OR5L2	26338	broad.mit.edu	37	11	55594807	55594807	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:55594807C>T	uc001nhy.1	+	1	113	c.113C>T	c.(112-114)ACG>ATG	p.T38M		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TATGGAGTCACGTTGTTAGCC	0.502			NA								HNSCC(27;0.073)			26	815					0	0	0.0918	0	0
AHNAK	79026	broad.mit.edu	37	11	62298621	62298621	+	Missense_Mutation	SNP	G	G	A	rs148272375		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:62298621G>A	uc001ntl.2	-	5	3568	c.3268C>T	c.(3268-3270)CCA>TCA	p.P1090S	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1090					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TCTATCTTTGGTGCAGAGATA	0.468			NA											6	145					0	0	0.02938	0	0
KIF5A	3798	broad.mit.edu	37	12	57975228	57975228	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:57975228C>A	uc001sor.1	+	25	2994	c.2786C>A	c.(2785-2787)GCA>GAA	p.A929E	KIF5A_uc010srr.1_Missense_Mutation_p.A840E	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	929	Globular.				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						CACTACCCAGCATCCTCACCC	0.552			NA											16	60					4.96729e-08	5.423e-08	0.049695	1	0
PRKAB1	5564	broad.mit.edu	37	12	120110257	120110257	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:120110257C>A	uc009zwu.2	+	3	414	c.311C>A	c.(310-312)CCC>CAC	p.P104H	PRKAB1_uc001txg.2_Missense_Mutation_p.P104H	NM_006253	NP_006244	Q9Y478	AAKB1_HUMAN	AMP-activated protein kinase beta 1	104					cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol					0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Adenosine monophosphate(DB00131)|Metformin(DB00331)	AGTAAACTTCCCCTCACCAGA	0.463			NA											4	29					4.096e-09	4.51319e-09	0.021553	1	0
C12orf43	64897	broad.mit.edu	37	12	121448918	121448918	+	Missense_Mutation	SNP	T	T	A	rs112728225	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:121448918T>A	uc001tzh.1	-	2	200	c.177A>T	c.(175-177)CAA>CAT	p.Q59H	C12orf43_uc009zxa.1_Missense_Mutation_p.Q59H|C12orf43_uc010szo.1_Missense_Mutation_p.Q17H|C12orf43_uc010szp.1_Missense_Mutation_p.Q59H|C12orf43_uc001tzi.1_Missense_Mutation_p.Q59H	NM_022895	NP_075046	Q96C57	CL043_HUMAN	hypothetical protein LOC64897	59											0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGAGGCTCGGTTGGGAGGTTG	0.274			NA											4	89					0	0	0.02938	0	0
GPR133	283383	broad.mit.edu	37	12	131471727	131471727	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:131471727C>T	uc001uit.3	+	6	1137	c.578C>T	c.(577-579)CCG>CTG	p.P193L	GPR133_uc010tbm.1_Missense_Mutation_p.P225L	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	193	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ACCTCTGATCCGAGTGGAAAA	0.512			NA											6	106					0	0	0.02938	0	0
C14orf45	80127	broad.mit.edu	37	14	74495917	74495917	+	Missense_Mutation	SNP	A	A	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr14:74495917A>G	uc010tup.1	+	3	439	c.316A>G	c.(316-318)ACA>GCA	p.T106A	C14orf45_uc001xpm.1_5'Flank	NM_025057	NP_079333	Q8ND07	CN045_HUMAN	hypothetical protein LOC80127	106	Potential.										0				BRCA - Breast invasive adenocarcinoma(234;0.00351)		ATTAAATGAAACAAAGGAAAA	0.358			NA											3	17					0	0	0.014758	0	0
KCNK13	56659	broad.mit.edu	37	14	90650622	90650622	+	Nonsense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr14:90650622C>T	uc001xye.1	+	2	944	c.502C>T	c.(502-504)CGA>TGA	p.R168*		NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	168	Cytoplasmic (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				GCTCCGGAGACGAGGGGCCCT	0.612			NA											14	67					0	0	0.038395	0	0
THBS1	7057	broad.mit.edu	37	15	39881468	39881468	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:39881468C>T	uc001zkh.2	+	12	2018	c.1839C>T	c.(1837-1839)CCC>CCT	p.P613P	THBS1_uc010bbi.2_Silent_p.P85P	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	613	EGF-like 2; calcium-binding (Potential).				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	ACACGGACCCCGGCTACAACT	0.562			NA											14	68					0	0	0.020292	0	0
MAP1A	4130	broad.mit.edu	37	15	43818488	43818488	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:43818488C>A	uc001zrt.2	+	4	5284	c.4817C>A	c.(4816-4818)GCC>GAC	p.A1606D		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1606						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AAGGTCAAGGCCATGGAAGAG	0.512			NA											6	46					0.00198382	0.00201773	0.02938	1	0
MYO5A	4644	broad.mit.edu	37	15	52643464	52643464	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:52643464G>A	uc002aby.2	-	28	4080	c.3836C>T	c.(3835-3837)GCC>GTC	p.A1279V	MYO5A_uc002abx.3_Missense_Mutation_p.A1279V|MYO5A_uc010ugd.1_Missense_Mutation_p.A31V|MYO5A_uc002aca.1_Missense_Mutation_p.A31V|MYO5A_uc002acb.1_Missense_Mutation_p.A31V|MYO5A_uc002acc.1_Missense_Mutation_p.A31V	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	1279					actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GGGTTGGATGGCCTCTTTCTG	0.512			NA											5	25					0	0	0.014758	0	0
UNC45A	55898	broad.mit.edu	37	15	91485697	91485697	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:91485697C>T	uc002bqg.2	+	7	1058	c.718C>T	c.(718-720)CGG>TGG	p.R240W	UNC45A_uc002bqd.2_Missense_Mutation_p.R225W|UNC45A_uc010uqo.1_Missense_Mutation_p.R232W|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Missense_Mutation_p.R240W	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	240					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ACTGGGAACTCGGCGAGTAGT	0.562			NA											4	30					0	0	0.021553	0	0
TTC23	64927	broad.mit.edu	37	15	99696405	99696405	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr15:99696405C>A	uc002bur.2	-	11	1622	c.1091G>T	c.(1090-1092)GGA>GTA	p.G364V	TTC23_uc002bus.2_Missense_Mutation_p.G364V|TTC23_uc002but.2_Missense_Mutation_p.G364V|TTC23_uc002buu.2_Missense_Mutation_p.G364V|TTC23_uc002buv.2_Missense_Mutation_p.G364V|TTC23_uc002bux.2_Missense_Mutation_p.G364V|TTC23_uc002buw.2_Missense_Mutation_p.G364V|TTC23_uc010boq.2_RNA|TTC23_uc002buy.2_Missense_Mutation_p.G364V|TTC23_uc010bor.2_Missense_Mutation_p.G364V|TTC23_uc002buz.2_Missense_Mutation_p.G364V	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	364	TPR 4.						binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			CAGGTCTGCTCCTCCCAGGAG	0.577			NA											7	43					0.000157383	0.000161454	0.038147	1	0
GPR139	124274	broad.mit.edu	37	16	20043736	20043736	+	Missense_Mutation	SNP	A	A	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr16:20043736A>T	uc002dgu.1	-	2	545	c.383T>A	c.(382-384)ATC>AAC	p.I128N	GPR139_uc010vaw.1_Missense_Mutation_p.I35N	NM_001002911	NP_001002911	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	128	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(2)	2						GCAGACAGCGATATACCTGTC	0.507			NA											90	407					0	0	0.048971	0	0
SPIRE2	84501	broad.mit.edu	37	16	89911744	89911744	+	Missense_Mutation	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr16:89911744G>T	uc002foz.1	+	2	311	c.259G>T	c.(259-261)GTC>TTC	p.V87F	SPIRE2_uc010civ.1_Missense_Mutation_p.V2F|SPIRE2_uc010ciw.1_Missense_Mutation_p.V87F	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	87	KIND.				transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TGCAACCATGGTCGTGCCACT	0.468			NA											4	28					3.59834e-05	3.7235e-05	0.021553	1	0
GSG2	83903	broad.mit.edu	37	17	3628194	3628194	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:3628194G>A	uc002fwp.2	+	1	998	c.965G>A	c.(964-966)CGC>CAC	p.R322H	ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	NM_031965	NP_114171	Q8TF76	HASP_HUMAN	haspin	322					cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity				0						CCCAAGGGCCGCATTGTGCCA	0.582			NA											3	18					0	0	0.004672	0	0
USP6	9098	broad.mit.edu	37	17	5041502	5041502	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:5041502G>A	uc002gau.1	+	21	3242	c.1012G>A	c.(1012-1014)GTG>ATG	p.V338M	USP6_uc002gav.1_Missense_Mutation_p.V338M|USP6_uc010ckz.1_Translation_Start_Site|uc002gbd.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	338					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CGATGACACCGTGCTCAAGCA	0.582			NA	T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								7	43					0	0	0.058154	0	0
CCDC144A	9720	broad.mit.edu	37	17	16612580	16612580	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:16612580C>T	uc002gqk.1	+	5	1285	c.1209C>T	c.(1207-1209)TGC>TGT	p.C403C	CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_5'Flank	NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	403											0						AATTAGACTGCGACAATGATA	0.358			NA											68	50					0	0	0.048971	0	0
CYTSB	92521	broad.mit.edu	37	17	20108150	20108150	+	Nonsense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:20108150C>G	uc002gwq.2	+	4	933	c.788C>G	c.(787-789)TCA>TGA	p.S263*	CYTSB_uc010cqx.2_Nonsense_Mutation_p.S263*|CYTSB_uc002gwr.2_Nonsense_Mutation_p.S263*|CYTSB_uc002gws.2_Nonsense_Mutation_p.S263*|CYTSB_uc002gwv.2_Nonsense_Mutation_p.S182*|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Nonsense_Mutation_p.S39*|CYTSB_uc002gwt.2_Nonsense_Mutation_p.S182*|CYTSB_uc002gwu.2_Nonsense_Mutation_p.S182*	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b	263	Ser-rich.					nucleus					0						TCCCCAAATTCAGAAGGGGCA	0.488			NA											7	218					0	0	0.058154	0	0
KLHL10	317719	broad.mit.edu	37	17	40004382	40004382	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:40004382G>A	uc010cxr.2	+	5	1792	c.1650G>A	c.(1648-1650)AAG>AAA	p.K550K	KLHL10_uc010wfw.1_Silent_p.K462K	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN	kelch-like 10	550	Kelch 6.					cytoplasm				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		Breast(137;0.000162)				ATGATGAAAAGACCGATGAGT	0.463			NA											12	117					0	0	0.09319	0	0
MYOM1	8736	broad.mit.edu	37	18	3102545	3102545	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr18:3102545C>G	uc002klp.2	-	23	3836	c.3502G>C	c.(3502-3504)GAG>CAG	p.E1168Q	MYOM1_uc002klq.2_Missense_Mutation_p.E1072Q	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1168	Ig-like C2-type 3.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CAGGAGAACTCGGACTTTGGA	0.413			NA											79	259					0	0	0.048971	0	0
Unknown	0	broad.mit.edu	37	19	9801053	9801053	+	Missense_Mutation	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:9801053G>C	uc010xkx.1	-	3	1437	c.814C>G	c.(814-816)CGT>GGT	p.R272G						RecName: Full=Zinc finger protein 562;												NA						TGTTTACTACGATAGGAAGAA	0.393			NA											8	130					0	0	0.058154	0	0
ELOF1	84337	broad.mit.edu	37	19	11665121	11665121	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:11665121C>T	uc002mse.1	-	2	106	c.42G>A	c.(40-42)AAG>AAA	p.K14K	ELOF1_uc002msd.1_Silent_p.K35K	NM_032377	NP_115753	P60002	ELOF1_HUMAN	elongation factor 1 homolog (ELF1, S.	14					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0						CTGTCATCTTCTTCTTGGGAG	0.552			NA											15	61					0	0	0.043863	0	0
LYL1	4066	broad.mit.edu	37	19	13211508	13211508	+	Silent	SNP	C	C	T	rs142687463	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:13211508C>T	uc002mwi.2	-	3	751	c.390G>A	c.(388-390)AAG>AAA	p.K130K		NM_005583	NP_005574	P12980	LYL1_HUMAN	lymphoblastic leukemia derived sequence 1	130					B cell differentiation|blood vessel maturation|definitive hemopoiesis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			TTGGTCTCCGCTTCAACCGGC	0.562			NA	T	TRB@	T-ALL								7	59					0	0	0.047766	0	0
ANKRD27	84079	broad.mit.edu	37	19	33140660	33140660	+	Silent	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:33140660G>T	uc002ntn.1	-	3	297	c.141C>A	c.(139-141)ATC>ATA	p.I47I	ANKRD27_uc002nto.1_Silent_p.I47I	NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	47					early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					AAGTAGACTGGATGCTGCTCG	0.448			NA											9	113					7.48243e-07	8.09463e-07	0.058154	1	0
TEX101	83639	broad.mit.edu	37	19	43922153	43922153	+	Missense_Mutation	SNP	C	C	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:43922153C>A	uc010xwo.1	+	5	710	c.515C>A	c.(514-516)ACT>AAT	p.T172N	TEX101_uc002owk.2_Missense_Mutation_p.T190N	NM_001130011	NP_001123483	Q9BY14	TX101_HUMAN	testis expressed 101 isoform 2	172						anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)				CTTGAGATCACTGGAGGTAAA	0.483			NA											15	182					8.34094e-07	8.86224e-07	0.049695	1	0
ERCC2	2068	broad.mit.edu	37	19	45860756	45860756	+	Missense_Mutation	SNP	G	G	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:45860756G>T	uc002pbj.2	-	14	1400	c.1353C>A	c.(1351-1353)TTC>TTA	p.F451L	ERCC2_uc002pbh.2_Missense_Mutation_p.F14L|ERCC2_uc002pbi.2_Missense_Mutation_p.F144L|ERCC2_uc010ejz.2_Missense_Mutation_p.F373L|ERCC2_uc002pbk.2_Missense_Mutation_p.F427L	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent	451	Mediates interaction with MMS19.				cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		TGACAGACTGGAAACGCTCAA	0.642			NA	Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				13	22					3.52763e-06	3.71494e-06	0.0333	1	0
ZNF671	79891	broad.mit.edu	37	19	58232868	58232868	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:58232868C>T	uc002qpz.3	-	4	685	c.586G>A	c.(586-588)GCA>ACA	p.A196T	ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_Missense_Mutation_p.A119T|ZNF671_uc010yhf.1_Missense_Mutation_p.A98T	NM_024833	NP_079109	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	196	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTTCCACATGCCCCACACAAG	0.488			NA											6	69					0	0	0.021553	0	0
SLC8A1	6546	broad.mit.edu	37	2	40366566	40366566	+	Missense_Mutation	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:40366566G>C	uc002rrx.2	-	9	2544	c.2520C>G	c.(2518-2520)TTC>TTG	p.F840L	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.F835L|SLC8A1_uc002rrz.2_Missense_Mutation_p.F827L|SLC8A1_uc002rsa.2_Missense_Mutation_p.F804L|SLC8A1_uc002rsd.3_Missense_Mutation_p.F804L	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	840	Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAAGTGCGACGAACACGACTG	0.463			NA											41	72					0	0	0.045515	0	0
PKP4	8502	broad.mit.edu	37	2	159499085	159499085	+	Nonsense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:159499085C>T	uc002tzv.2	+	11	2043	c.1783C>T	c.(1783-1785)CGA>TGA	p.R595*	PKP4_uc002tzt.1_Nonsense_Mutation_p.R447*|PKP4_uc002tzu.2_Nonsense_Mutation_p.R595*|PKP4_uc002tzw.2_Nonsense_Mutation_p.R595*|PKP4_uc002tzx.2_Nonsense_Mutation_p.R252*|PKP4_uc002tzy.1_Nonsense_Mutation_p.R253*|PKP4_uc002tzz.1_Nonsense_Mutation_p.R593*|PKP4_uc002uaa.2_Nonsense_Mutation_p.R447*	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	595	ARM 3.				cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						TGGTGCCCTTCGAAACCTCGT	0.418			NA								HNSCC(62;0.18)			10	302					0	0	0.080935	0	0
XRCC5	7520	broad.mit.edu	37	2	216983788	216983788	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:216983788C>T	uc002vfy.2	+	5	531	c.391C>T	c.(391-393)CAT>TAT	p.H131Y	XRCC5_uc002vfz.2_Missense_Mutation_p.H17Y	NM_021141	NP_066964	P13010	XRCC5_HUMAN	ATP-dependent DNA helicase II	131					double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding			lung(1)|kidney(1)	2		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TGAGAAGAGGCATATTGAAAT	0.343			NA						Direct_reversal_of_damage|NHEJ					13	149					0	0	0.024245	0	0
FAM110A	83541	broad.mit.edu	37	20	826325	826325	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:826325C>T	uc002wef.1	+	2	1214	c.878C>T	c.(877-879)GCT>GTT	p.A293V	FAM110A_uc002weg.1_Missense_Mutation_p.A293V|FAM110A_uc002weh.1_Missense_Mutation_p.A293V|FAM110A_uc010fzz.2_RNA	NM_001042353	NP_001035812	Q9BQ89	F110A_HUMAN	hypothetical protein LOC83541	293						microtubule organizing center|spindle pole	protein binding				0						AGCCCAGCAGCTGAAGGCTAG	0.627			NA											6	18					0	0	0.047766	0	0
PROKR2	128674	broad.mit.edu	37	20	5294752	5294752	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:5294752G>A	uc010zqw.1	-	1	264	c.264C>T	c.(262-264)ACC>ACT	p.T88T	PROKR2_uc010zqx.1_Silent_p.T88T|PROKR2_uc010zqy.1_Silent_p.T88T|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	88	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TGAGCAGATTGGTGAGGTTGC	0.557			NA								HNSCC(71;0.22)			5	73					0	0	0.021553	0	0
SFRS6	6431	broad.mit.edu	37	20	42089474	42089474	+	Missense_Mutation	SNP	A	A	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:42089474A>G	uc010zwg.1	+	6	976	c.806A>G	c.(805-807)TAT>TGT	p.Y269C	SFRS6_uc002xki.2_Missense_Mutation_p.Y140C|SFRS6_uc002xkk.2_Intron	NM_006275	NP_006266	Q13247	SRSF6_HUMAN	arginine/serine-rich splicing factor 6	269	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AAGGATGAGTATGAGAAATCT	0.453			NA											4	52					0	0	0.009096	0	0
CABLES2	81928	broad.mit.edu	37	20	60966358	60966358	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr20:60966358C>G	uc002ycv.2	-	9	1250	c.1243G>C	c.(1243-1245)GCT>CCT	p.A415P		NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	415					cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ATCTTGGCAGCCAGCAGCACG	0.627			NA											5	17					0	0	0.014758	0	0
LARGE	9215	broad.mit.edu	37	22	33777944	33777944	+	Silent	SNP	G	G	A	rs144216539	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr22:33777944G>A	uc003and.3	-	10	1671	c.1092C>T	c.(1090-1092)ACC>ACT	p.T364T	LARGE_uc011amd.1_Silent_p.T163T|LARGE_uc003ane.3_Silent_p.T364T|LARGE_uc010gwp.2_Silent_p.T364T|LARGE_uc011ame.1_Silent_p.T296T|LARGE_uc011amf.1_Silent_p.T364T|LARGE_uc010gwq.1_RNA	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase	364	Lumenal (Potential).				glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				GCTCGGAGCGGGTGTGGTCTG	0.552	Colon(70;397 1175 4573 19089 45288)		NA											5	98					0	0	0.02938	0	0
IQSEC1	9922	broad.mit.edu	37	3	12977661	12977661	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:12977661C>T	uc003bxt.2	-	3	906	c.897G>A	c.(895-897)TCG>TCA	p.S299S	IQSEC1_uc003bxu.3_Silent_p.S177S|IQSEC1_uc011auw.1_Silent_p.S285S	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	299					regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						CATCACTGTACGAGGCCGTCA	0.687			NA											4	14					0	0	0.02938	0	0
ZNF860	344787	broad.mit.edu	37	3	32031055	32031055	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:32031055C>T	uc011axg.1	+	2	1033	c.484C>T	c.(484-486)CAT>TAT	p.H162Y		NM_001137674	NP_001131146	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	162					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTTTCATTCGCATCTTCCTGA	0.413			NA											10	172					0	0	0.09319	0	0
ZNF860	344787	broad.mit.edu	37	3	32031135	32031135	+	Silent	SNP	A	A	G	rs6419811	by1000genomes	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:32031135A>G	uc011axg.1	+	2	1113	c.564A>G	c.(562-564)TCA>TCG	p.S188S		NM_001137674	NP_001131146	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	188					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATGCTTCCTCAGTTCTAACGT	0.358			NA											4	78					0	0	0.014758	0	0
MAP4	4134	broad.mit.edu	37	3	47958078	47958078	+	Silent	SNP	G	G	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:47958078G>C	uc003csb.2	-	7	1765	c.1239C>G	c.(1237-1239)CTC>CTG	p.L413L	MAP4_uc003csc.3_Silent_p.L413L|MAP4_uc011bbf.1_Silent_p.L390L|MAP4_uc003csf.3_Silent_p.L430L	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1	413	17 X 14 AA tandem repeats.|9.				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)		CTATTTCTGAGAGTAATACCA	0.463			NA											6	198					0	0	0.038147	0	0
TWF2	11344	broad.mit.edu	37	3	52269072	52269072	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:52269072G>A	uc003ddd.2	-	2	227	c.76C>T	c.(76-78)CGG>TGG	p.R26W	TWF2_uc010hmc.2_Missense_Mutation_p.R26W	NM_007284	NP_009215	Q6IBS0	TWF2_HUMAN	twinfilin-like protein	26	ADF-H 1.					cytoskeleton|perinuclear region of cytoplasm	actin binding|ATP binding			stomach(1)|ovary(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TTGATGAGCCGCACAGAGCCA	0.582			NA											3	21					0	0	0.004672	0	0
BOC	91653	broad.mit.edu	37	3	112998717	112998717	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:112998717G>A	uc003dzx.2	+	13	2688	c.2067G>A	c.(2065-2067)GAG>GAA	p.E689E	BOC_uc003dzy.2_Silent_p.E689E|BOC_uc003dzz.2_Silent_p.E690E|BOC_uc003eab.2_Silent_p.E390E|BOC_uc003eac.2_Silent_p.E4E	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	689	Fibronectin type-III 2.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			TGCTGGGGGAGAGCGAGCCCA	0.602			NA											4	34					0	0	0.021553	0	0
PLA1A	51365	broad.mit.edu	37	3	119328403	119328403	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:119328403G>A	uc003ecu.2	+	4	581	c.542G>A	c.(541-543)GGC>GAC	p.G181D	PLA1A_uc003ecv.2_Missense_Mutation_p.G165D|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.G8D	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	181					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CTCTTCGGAGGCCAGCTGGGA	0.537			NA											46	179					0	0	0.048971	0	0
JMY	133746	broad.mit.edu	37	5	78602256	78602256	+	Missense_Mutation	SNP	A	A	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:78602256A>C	uc003kfx.3	+	7	2460	c.1940A>C	c.(1939-1941)GAA>GCA	p.E647A	JMY_uc003kfw.1_Missense_Mutation_p.E293A	NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	647					'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		ATTGAAGATGAATATAGAACC	0.303			NA											22	453					0	0	0.050027	0	0
PCDHB8	56128	broad.mit.edu	37	5	140558166	140558166	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:140558166G>A	uc011dai.1	+	1	737	c.551G>A	c.(550-552)CGC>CAC	p.R184H	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	184	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTCCTCACCCGCAAACGCAGT	0.483			NA											9	25					0	0	0.080935	0	0
GEMIN5	25929	broad.mit.edu	37	5	154270922	154270922	+	Silent	SNP	A	A	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:154270922A>G	uc003lvx.3	-	26	4224	c.4141T>C	c.(4141-4143)TTG>CTG	p.L1381L	GEMIN5_uc011ddk.1_Silent_p.L1380L	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5	1381	Potential.				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATTTCTGCCAAGGTCTCTTGG	0.453			NA											17	134					0	0	0.049695	0	0
PRSS16	10279	broad.mit.edu	37	6	27215709	27215709	+	Missense_Mutation	SNP	G	G	C	rs114674760	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:27215709G>C	uc003nja.2	+	2	131	c.119G>C	c.(118-120)AGC>ACC	p.S40T	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Missense_Mutation_p.S40T|PRSS16_uc010jqq.1_5'Flank|PRSS16_uc010jqr.1_5'Flank|PRSS16_uc003njc.1_5'Flank	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	40					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						TTTCAGGAGAGCTCTGCCCAG	0.642	NSCLC(178;1118 2105 17078 23587 44429)		NA											7	105					0	0	0.058154	0	0
CYP21A2	1589	broad.mit.edu	37	6	31975129	31975129	+	Silent	SNP	T	T	C	rs113153064		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:31975129T>C	uc010jtp.2	+	8	940	c.822T>C	c.(820-822)TCT>TCC	p.S274S	CYP21A2_uc011dpb.1_Silent_p.S244S			P08686	CP21A_HUMAN	SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;	273					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						AAGAGGGCTCTGGACAGCTCC	0.607	Melanoma(174;1669 1998 3915 34700 46447)		NA											3	12					0	0	0.004672	0	0
UHRF1BP1	54887	broad.mit.edu	37	6	34826855	34826855	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:34826855C>T	uc003oju.3	+	14	2956	c.2722C>T	c.(2722-2724)CTA>TTA	p.L908L	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	908										ovary(3)	3						AGATTCAGAGCTATCTCCTTC	0.527			NA											4	72					0	0	0.009096	0	0
THEMIS	387357	broad.mit.edu	37	6	128134143	128134143	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:128134143C>G	uc003qbi.2	-	5	1962	c.1643G>C	c.(1642-1644)AGC>ACC	p.S548T	THEMIS_uc010kfa.2_Missense_Mutation_p.S451T|THEMIS_uc011ebt.1_Missense_Mutation_p.S548T|THEMIS_uc010kfb.2_Missense_Mutation_p.S513T	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	548					negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						TGAGGCTGAGCTTTCATATCT	0.463			NA											42	143					0	0	0.104719	0	0
SAMD3	154075	broad.mit.edu	37	6	130465801	130465801	+	Missense_Mutation	SNP	A	A	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:130465801A>C	uc003qbv.2	-	13	1753	c.1427T>G	c.(1426-1428)TTT>TGT	p.F476C	SAMD3_uc003qbx.2_Missense_Mutation_p.F476C|SAMD3_uc003qbw.2_Missense_Mutation_p.F476C	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform	476										ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		CTCAATCCTAAATACATGAAA	0.418			NA											10	346					0	0	0.020292	0	0
FUCA2	2519	broad.mit.edu	37	6	143823616	143823616	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:143823616C>T	uc003qjm.2	-	4	931	c.839G>A	c.(838-840)CGT>CAT	p.R280H	FUCA2_uc003qjn.2_Missense_Mutation_p.R34H	NM_032020	NP_114409	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma precursor	280					fucose metabolic process	extracellular region	alpha-L-fucosidase activity|cation binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		TGGGTTATAACGATCACTGCA	0.468			NA											14	322					0	0	0.024245	0	0
PMS2	5395	broad.mit.edu	37	7	6045634	6045634	+	Missense_Mutation	SNP	T	T	C	rs63750123	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr7:6045634T>C	uc003spl.2	-	2	139	c.52A>G	c.(52-54)ATT>GTT	p.I18V	PMS2_uc003spj.2_5'Flank|PMS2_uc003spk.2_5'UTR|PMS2_uc011jwl.1_Intron|PMS2_uc010ktg.2_5'UTR|PMS2_uc010kte.2_Missense_Mutation_p.I18V|PMS2_uc010ktf.1_Missense_Mutation_p.I18V	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	18					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		TTCCGATCAATAGGTTTGATG	0.418			NA	Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				7	170					0	0	0.038147	0	0
EGFR	1956	broad.mit.edu	37	7	55259515	55259515	+	Missense_Mutation	SNP	T	T	G	rs121434568		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr7:55259515T>G	uc003tqk.2	+	21	2819	c.2573T>G	c.(2572-2574)CTG>CGG	p.L858R	EGFR_uc010kzg.1_Missense_Mutation_p.L813R|EGFR_uc011kco.1_Missense_Mutation_p.L805R|uc003tqo.2_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	858	Cytoplasmic (Potential).|Protein kinase.		L -> R (found in a lung cancer sample; somatic mutation; constitutively activated enzyme with strongly increased kinase activity).|L -> M (found in a lung cancer sample).		activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.L858R(3429)|p.L858L(4)|p.L858M(4)|p.L858Q(3)|p.L858A(2)|p.L858W(1)|p.L858P(1)|p.L858K(1)|p.L858G(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GATTTTGGGCTGGCCAAACTG	0.537		L858R(NCIH1975_LUNG)	8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			109	312					0	0	0.048971	0	0
FLNC	2318	broad.mit.edu	37	7	128480629	128480629	+	Missense_Mutation	SNP	G	G	A	rs34932223		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr7:128480629G>A	uc003vnz.3	+	10	1786	c.1577G>A	c.(1576-1578)CGG>CAG	p.R526Q	FLNC_uc003voa.3_Missense_Mutation_p.R526Q	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	526	Filamin 3.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						GTGAAGGTGCGGGAGGCTGGG	0.612			NA											5	35					0	0	0.021553	0	0
PPP2CB	5516	broad.mit.edu	37	8	30655229	30655229	+	Silent	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:30655229G>A	uc003xik.2	-	4	589	c.354C>T	c.(352-354)CAC>CAT	p.H118H		NM_004156	NP_004147	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta	118		Proton donor (By similarity).			protein dephosphorylation	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex|spindle pole	metal ion binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	GTCGGCTTTCGTGATTTCCTC	0.363			NA											3	43					0	0	0.014758	0	0
POTEA	340441	broad.mit.edu	37	8	43197329	43197329	+	Splice_Site	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:43197329G>A	uc003xpz.1	+	11	1262	c.1219_splice	c.e11-1	p.V407_splice	POTEA_uc003xqa.1_Splice_Site_p.V361_splice	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2											ovary(1)	1						TTATCTTACAGGTCAAAAGCC	0.318			NA											66	193					0	0	0.048971	0	0
PXDNL	137902	broad.mit.edu	37	8	52359654	52359654	+	Missense_Mutation	SNP	C	C	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:52359654C>G	uc003xqu.3	-	12	1536	c.1435G>C	c.(1435-1437)GCA>CCA	p.A479P		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	479	Ig-like C2-type 3.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCGTGCTGTGCTGCACGGTCA	0.463			NA											46	429					0	0	0.048971	0	0
OTUD6B	51633	broad.mit.edu	37	8	92090700	92090700	+	Silent	SNP	T	T	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:92090700T>C	uc003yeu.3	+	4	621	c.522T>C	c.(520-522)GCT>GCC	p.A174A	OTUD6B_uc011lgh.1_Silent_p.A43A	NM_016023	NP_057107	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	144										ovary(2)|lung(1)	3			BRCA - Breast invasive adenocarcinoma(11;0.0187)			TATTGGCAGCTAGACAGTTAG	0.398			NA											3	30					0	0	0.009096	0	0
GPR172A	79581	broad.mit.edu	37	8	145583657	145583657	+	Missense_Mutation	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr8:145583657C>T	uc003zcc.1	+	3	662	c.505C>T	c.(505-507)CGC>TGC	p.R169C	FBXL6_uc003zbz.2_5'Flank|FBXL6_uc003zca.2_5'Flank|FBXL6_uc003zcb.2_5'Flank|FBXL6_uc010mfx.2_5'Flank|GPR172A_uc003zcd.1_Missense_Mutation_p.R169C|GPR172A_uc003zce.1_Missense_Mutation_p.R169C|GPR172A_uc010mfy.1_Missense_Mutation_p.R169C|GPR172A_uc003zcf.1_Missense_Mutation_p.R169C|GPR172A_uc011llc.1_Missense_Mutation_p.R81C	NM_024531	NP_078807	Q9HAB3	RFT3_HUMAN	G protein-coupled receptor 172A precursor	169						integral to plasma membrane	receptor activity|riboflavin transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.43e-40)|Epithelial(56;1.48e-39)|all cancers(56;1.49e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GGGTGTGGGCCGCCTCGAGTG	0.662			NA											3	5					0	0	0.004672	0	0
FAM75A6	389730	broad.mit.edu	37	9	43625382	43625382	+	Missense_Mutation	SNP	G	G	A	rs143826416	by1000genomes	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:43625382G>A	uc011lrb.1	-	4	3334	c.3305C>T	c.(3304-3306)CCT>CTT	p.P1102L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	1102						integral to membrane					0						CTTGTGAATAGGGGGAAACAT	0.483			NA											4	34					0	0	0.047766	0	0
FAM75A6	389730	broad.mit.edu	37	9	43627428	43627428	+	Missense_Mutation	SNP	G	G	A	rs11261835	by1000genomes	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:43627428G>A	uc011lrb.1	-	4	1288	c.1259C>T	c.(1258-1260)CCC>CTC	p.P420L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	420						integral to membrane					0						GTGCAGAGAGGGGAGGCCCCA	0.498			NA											7	39					0	0	0.105934	0	0
DBC1	1620	broad.mit.edu	37	9	121930416	121930416	+	Missense_Mutation	SNP	C	C	T	rs141766717	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:121930416C>T	uc004bkc.2	-	8	1688	c.1232G>A	c.(1231-1233)CGG>CAG	p.R411Q		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	411					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						CACGCAGCTCCGCTGGCTCTC	0.597			NA											9	11					0	0	0.069234	0	0
TOR1A	1861	broad.mit.edu	37	9	132585013	132585013	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:132585013C>T	uc004byl.2	-	2	368	c.291G>A	c.(289-291)ACG>ACA	p.T97T	TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Silent_p.T97T	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	97					chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)				GCAGGGAGAGCGTGAGAGGTT	0.473			NA											6	77					0	0	0.021553	0	0
NOTCH1	4851	broad.mit.edu	37	9	139397707	139397707	+	Silent	SNP	G	G	A	rs10521	by1000genomes	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr9:139397707G>A	uc004chz.2	-	27	5094	c.5094C>T	c.(5092-5094)GAC>GAT	p.D1698D	NOTCH1_uc004cia.1_Silent_p.D928D	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1698	Extracellular (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.D1699D(11)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ATGCGGCCACGTCGGTGGCAC	0.632			NA	T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			2	3					0	0	0.004672	0	0
REPS2	9185	broad.mit.edu	37	X	17073016	17073016	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chrX:17073016G>A	uc004cxv.1	+	8	1228	c.1057G>A	c.(1057-1059)GGC>AGC	p.G353S	REPS2_uc004cxw.1_Missense_Mutation_p.G352S|REPS2_uc011miw.1_Missense_Mutation_p.G212S	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	353	EH 2.				epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					TCGGAAGAACGGCTACCCATT	0.512			NA											8	156					0	0	0.047766	0	0
ERCC6L	54821	broad.mit.edu	37	X	71427306	71427306	+	Silent	SNP	C	C	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chrX:71427306C>T	uc004eaq.1	-	2	1408	c.1311G>A	c.(1309-1311)GAG>GAA	p.E437E	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.E314E	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	437					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)					AATCTTCCCCCTCATTTCCAT	0.423			NA											31	611					0	0	0.104719	0	0
HTATSF1	27336	broad.mit.edu	37	X	135592250	135592250	+	Missense_Mutation	SNP	G	G	A			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chrX:135592250G>A	uc004ezw.2	+	9	1356	c.934G>A	c.(934-936)GAT>AAT	p.D312N	HTATSF1_uc004ezx.2_Missense_Mutation_p.D312N	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	312	RRM 2.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GAGGCACCCAGATGGTGTGGC	0.398			NA											36	400					0	0	0.09836	0	0
CSMD2	114784	broad.mit.edu	37	1	34401515	34401515	+	Frame_Shift_Del	DEL	G	G	-	rs150564422	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:34401515delG	uc001bxn.1	-	4	467	c.438delC	c.(436-438)CCCfs	p.P146fs	CSMD2_uc001bxm.1_Frame_Shift_Del_p.P186fs	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	146	Sushi 1.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGATGCCATTGGGCAGCCTCC	0.612			NA											8	2109	---	---	---	---	NA	NA	NA	NA	NA
SPRR3	6707	broad.mit.edu	37	1	152975806	152975829	+	In_Frame_Del	DEL	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	-	rs72704847	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	-	-	CCAGGCTACACCAAGGTCCCTGAA	CCAGGCTACACCAAGGTCCCTGAA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:152975806_152975829delCCAGGCTACACCAAGGTCCCTGAA	uc001fax.3	+	3	460_483	c.310_333delCCAGGCTACACCAAGGTCCCTGAA	c.(310-333)CCAGGCTACACCAAGGTCCCTGAAdel	p.PGYTKVPE104del	SPRR3_uc001faz.3_In_Frame_Del_p.PGYTKVPE104del|SPRR3_uc001fay.2_In_Frame_Del_p.PGYTKVPE96del	NM_005416	NP_005407	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	104_111	9.|14 X 8 AA approximate tandem repeats.				keratinization|peptide cross-linking|wound healing	cytoplasm	protein binding|structural molecule activity			skin(1)	1	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTCCCTGAGCCAGGCTACACCAAGGTCCCTGAACCAGGCAGCA	0.567			NA											53	303	---	---	---	---	NA	NA	NA	NA	NA
HAX1	10456	broad.mit.edu	37	1	154246356	154246357	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr1:154246356_154246357insG	uc001fes.2	+	3	584_585	c.423_424insG	c.(421-426)TTTGGGfs	p.F141fs	HAX1_uc001fet.2_Frame_Shift_Ins_p.F93fs|HAX1_uc010peo.1_Frame_Shift_Ins_p.F149fs|HAX1_uc009wou.2_Frame_Shift_Ins_p.F66fs|HAX1_uc009wov.2_Frame_Shift_Ins_p.F115fs	NM_006118	NP_006109	O00165	HAX1_HUMAN	HCLS1 associated protein X-1 isoform a	141_142	Involved in HCLS1 binding.					actin cytoskeleton|cytoplasmic membrane-bounded vesicle|lamellipodium|mitochondrion|nuclear membrane|sarcoplasmic reticulum|soluble fraction	interleukin-1 binding|protein N-terminus binding				0	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCAGGATCTTTGGGGGGGTCTT	0.554			NA							Kostmann_syndrome				8	230	---	---	---	---	NA	NA	NA	NA	NA
ROBO4	54538	broad.mit.edu	37	11	124765393	124765394	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:124765393_124765394insC	uc001qbg.2	-	6	1135_1136	c.995_996insG	c.(994-996)GGCfs	p.G332fs	ROBO4_uc010sas.1_Frame_Shift_Ins_p.G187fs|ROBO4_uc001qbh.2_Frame_Shift_Ins_p.G222fs|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	332	Fibronectin type-III 1.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TGCTGTCAGGGCCTCGAGCCCG	0.609			NA											7	166	---	---	---	---	NA	NA	NA	NA	NA
ACRV1	56	broad.mit.edu	37	11	125550635	125550645	+	Frame_Shift_Del	DEL	CCAAGCAGATA	CCAAGCAGATA	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	CCAAGCAGATA	CCAAGCAGATA	-	-	CCAAGCAGATA	CCAAGCAGATA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr11:125550635_125550645delCCAAGCAGATA	uc001qcs.2	-	1	298_308	c.31_41delTATCTGCTTGG	c.(31-42)TATCTGCTTGGAfs	p.Y11fs	ACRV1_uc001qck.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcl.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcm.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcn.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qco.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcp.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcq.2_Frame_Shift_Del_p.Y11fs|ACRV1_uc001qcr.2_Frame_Shift_Del_p.Y11fs	NM_001612	NP_001603	P26436	ASPX_HUMAN	acrosomal vesicle protein 1 isoform a precursor	11_14					multicellular organismal development	acrosomal vesicle					0	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0179)|Lung NSC(97;0.0185)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0713)		TCTGGCAGATCCAAGCAGATAAAGACTCATT	0.469			NA											93	539	---	---	---	---	NA	NA	NA	NA	NA
FOXM1	2305	broad.mit.edu	37	12	2977901	2977910	+	Frame_Shift_Del	DEL	GGTCTCGAAG	GGTCTCGAAG	-	rs148573089		TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	GGTCTCGAAG	GGTCTCGAAG	-	-	GGTCTCGAAG	GGTCTCGAAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr12:2977901_2977910delGGTCTCGAAG	uc001qlf.2	-	4	930_939	c.665_674delCTTCGAGACC	c.(664-675)CCTTCGAGACCAfs	p.P222fs	FOXM1_uc001qle.2_Frame_Shift_Del_p.P222fs|FOXM1_uc001qlg.2_Frame_Shift_Del_p.P222fs|FOXM1_uc009zea.2_Frame_Shift_Del_p.P221fs|FOXM1_uc009zeb.2_Frame_Shift_Del_p.P221fs	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2	222_225					cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GGACGCTGATGGTCTCGAAGGCTCCTCAAC	0.505			NA											8	155	---	---	---	---	NA	NA	NA	NA	NA
SIPA1L1	26037	broad.mit.edu	37	14	72165808	72165809	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr14:72165808_72165809insG	uc001xms.2	+	11	3833_3834	c.3485_3486insG	c.(3484-3486)GTGfs	p.V1162fs	SIPA1L1_uc001xmt.2_Frame_Shift_Ins_p.V1162fs|SIPA1L1_uc001xmu.2_Frame_Shift_Ins_p.V1162fs|SIPA1L1_uc001xmv.2_Frame_Shift_Ins_p.V1162fs|SIPA1L1_uc010ttm.1_Frame_Shift_Ins_p.V637fs	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	1162					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ACTGGTTCTGTGGGGGGCACTT	0.495			NA											8	486	---	---	---	---	NA	NA	NA	NA	NA
NOMO1	23420	broad.mit.edu	37	16	14980694	14980695	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr16:14980694_14980695insC	uc002dcv.2	+	28	3365_3366	c.3299_3300insC	c.(3298-3300)TTCfs	p.F1100fs		NM_014287	NP_055102	Q15155	NOMO1_HUMAN	nodal modulator 1 precursor	1100	Extracellular (Potential).					integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1						TTCTTCCATTTCCCCCCACTGC	0.475			NA											7	721	---	---	---	---	NA	NA	NA	NA	NA
GPATCH8	23131	broad.mit.edu	37	17	42476034	42476035	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr17:42476034_42476035insG	uc002igw.1	-	8	3474_3475	c.3410_3411insC	c.(3409-3411)CCAfs	p.P1137fs	GPATCH8_uc002igv.1_Frame_Shift_Ins_p.P1059fs|GPATCH8_uc010wiz.1_Frame_Shift_Ins_p.P1059fs	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1137						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TGCCAAGAGATGGGGGGAGCTT	0.554			NA											9	634	---	---	---	---	NA	NA	NA	NA	NA
U2AF2	11338	broad.mit.edu	37	19	56171936	56171937	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr19:56171936_56171937insC	uc002qlu.2	+	4	1340_1341	c.285_286insC	c.(283-288)CCACCCfs	p.P95fs	U2AF2_uc002qlt.2_Frame_Shift_Ins_p.P95fs	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2	95_96				P->G: Decreases affinity for UAF1 by 2 orders of magnitude.	mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GGGACGTGCCACCCCCAGGCTT	0.634			NA											7	117	---	---	---	---	NA	NA	NA	NA	NA
ASXL2	55252	broad.mit.edu	37	2	25966872	25966873	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:25966872_25966873insG	uc002rgs.2	-	12	2554_2555	c.2333_2334insC	c.(2332-2334)CCAfs	p.P778fs	ASXL2_uc002rgt.1_Frame_Shift_Ins_p.P518fs	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	778					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGAGGCACTGGGGGGGTTTG	0.554			NA											7	135	---	---	---	---	NA	NA	NA	NA	NA
TTN	7273	broad.mit.edu	37	2	179535845	179535845	+	Frame_Shift_Del	DEL	A	A	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:179535845delA	uc010zfg.1	-	151	31601	c.31377delT	c.(31375-31377)GTTfs	p.V10459fs	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.V7120fs|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_5'UTR	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11386							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCGAGGAACAACTTTAGTGG	0.353			NA											48	87	---	---	---	---	NA	NA	NA	NA	NA
KIAA1486	57624	broad.mit.edu	37	2	226447378	226447379	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr2:226447378_226447379insC	uc002voe.2	+	4	1420_1421	c.1245_1246insC	c.(1243-1248)CCACCCfs	p.P415fs	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Frame_Shift_Ins_p.P185fs	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	415_416	Pro-rich.									ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		CGTCGCCCCCACCCCCGTCTAC	0.678			NA											2	4	---	---	---	---	NA	NA	NA	NA	NA
SH3BGR	6450	broad.mit.edu	37	21	40834329	40834330	+	Frame_Shift_Ins	INS	-	-	T			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr21:40834329_40834330insT	uc002yya.2	+	2	317_318	c.263_264insT	c.(262-264)GGTfs	p.G88fs	SH3BGR_uc002yxz.2_5'UTR	NM_007341	NP_031367	P55822	SH3BG_HUMAN	SH3-binding domain and glutamic acid-rich	88					protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		GAAGTAGTGGGTTTTTTGGAAG	0.342			NA											7	191	---	---	---	---	NA	NA	NA	NA	NA
SERPIND1	3053	broad.mit.edu	37	22	21138419	21138420	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr22:21138419_21138420insG	uc002ztb.1	+	3	1116_1117	c.1049_1050insG	c.(1048-1050)GTGfs	p.V350fs	PI4KA_uc002zsz.3_Intron|SERPIND1_uc002ztc.2_Frame_Shift_Ins_p.V378fs	NM_000185	NP_000176	P05546	HEP2_HUMAN	heparin cofactor II precursor	350					blood coagulation|chemotaxis|regulation of proteolysis	extracellular region	heparin binding|serine-type endopeptidase inhibitor activity				0	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)	CTGGAATACGTGGGGGGCATCA	0.54			NA									OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	401	---	---	---	---	NA	NA	NA	NA	NA
UBA7	7318	broad.mit.edu	37	3	49846857	49846860	+	Frame_Shift_Del	DEL	TGTT	TGTT	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	TGTT	TGTT	-	-	TGTT	TGTT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:49846857_49846860delTGTT	uc003cxr.2	-	17	2297_2300	c.2126_2129delAACA	c.(2125-2130)AAACAGfs	p.K709fs		NM_003335	NP_003326	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	709_710					ISG15-protein conjugation|negative regulation of type I interferon production	cytosol	ATP binding|ISG15 activating enzyme activity|ligase activity			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTGGGGACACTGTTTGGGACCTGA	0.564			NA											7	45	---	---	---	---	NA	NA	NA	NA	NA
PFN2	5217	broad.mit.edu	37	3	149684345	149684346	+	Frame_Shift_Ins	INS	-	-	GACA			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr3:149684345_149684346insGACA	uc003ext.1	-	3	451_452	c.353_354insTGTC	c.(352-354)GGGfs	p.G118fs	PFN2_uc003exs.1_Intron|PFN2_uc003exu.1_Intron|PFN2_uc011bnu.1_Intron	NM_053024	NP_444252	P35080	PROF2_HUMAN	profilin 2 isoform a	118					actin cytoskeleton organization|regulation of actin polymerization or depolymerization	actin cytoskeleton|cytoplasm	actin binding|phosphatidylinositol-4,5-bisphosphate binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CTCCATGGACCCCTTCTTTTCC	0.396			NA											18	206	---	---	---	---	NA	NA	NA	NA	NA
APBB2	323	broad.mit.edu	37	4	41015705	41015706	+	Frame_Shift_Ins	INS	-	-	G			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr4:41015705_41015706insG	uc003gvl.2	-	6	1359_1360	c.729_730insC	c.(727-732)ACCGACfs	p.T243fs	APBB2_uc003gvm.2_Frame_Shift_Ins_p.T243fs|APBB2_uc003gvn.2_Frame_Shift_Ins_p.T243fs|APBB2_uc011byt.1_Frame_Shift_Ins_p.T226fs	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	243_244					cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						AGTGCACAGTCGGTTTTGGCCC	0.579	Ovarian(3;20 75 16686 49997)		NA											9	1229	---	---	---	---	NA	NA	NA	NA	NA
FYB	2533	broad.mit.edu	37	5	39203039	39203040	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr5:39203039_39203040insC	uc003jls.2	-	1	90_91	c.23_24insG	c.(22-24)GGCfs	p.G8fs	FYB_uc003jlt.2_Frame_Shift_Ins_p.G8fs|FYB_uc003jlu.2_Frame_Shift_Ins_p.G8fs|FYB_uc011cpl.1_Frame_Shift_Ins_p.G18fs	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	8					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			CTGTCGGGTTGCCCCCCGTGTT	0.446			NA											7	326	---	---	---	---	NA	NA	NA	NA	NA
NCR3	259197	broad.mit.edu	37	6	31557857	31557858	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	CA	CA	-	-	CA	CA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:31557857_31557858delCA	uc003nuv.2	-	2	353_354	c.89_90delTG	c.(88-90)CTGfs	p.L30fs	NCR3_uc003nuw.2_Frame_Shift_Del_p.L30fs|NCR3_uc003nux.1_Frame_Shift_Del_p.L30fs	NM_147130	NP_667341	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3	30	Ig-like.|Extracellular (Potential).				cell recognition|immune response|inflammatory response|positive regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2						AGGATCCTTCCAGGGTACGAAT	0.579			NA											50	246	---	---	---	---	NA	NA	NA	NA	NA
ALDH8A1	64577	broad.mit.edu	37	6	135253995	135253996	+	Frame_Shift_Ins	INS	-	-	C			TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:135253995_135253996insC	uc003qew.2	-	5	820_821	c.767_768insG	c.(766-768)GGCfs	p.G256fs	ALDH8A1_uc003qex.2_Frame_Shift_Ins_p.G256fs|ALDH8A1_uc010kgh.2_Frame_Shift_Ins_p.G88fs|ALDH8A1_uc011ecx.1_Frame_Shift_Ins_p.G206fs	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1	256					retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CAGGATTCTTGCCCCCCAGCTC	0.619			NA											7	247	---	---	---	---	NA	NA	NA	NA	NA
NOX3	50508	broad.mit.edu	37	6	155750039	155750040	+	Frame_Shift_Ins	INS	-	-	G	rs79326507	byFrequency	TCGA-67-3772-01A-01W-0928-08	TCGA-67-3772-10A-01W-0928-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	09226bc4-0202-4405-b3c9-208e8ffb7408	e21e8eca-7af6-43a3-90e3-73df460655fa	g.chr6:155750039_155750040insG	uc003qqm.2	-	9	1136_1137	c.1033_1034insC	c.(1033-1035)CAGfs	p.Q345fs		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	345	Extracellular (Potential).|FAD-binding FR-type.						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AAAGTCCTCCTGGGGGGCAGAG	0.614			NA											7	286	---	---	---	---	NA	NA	NA	NA	NA
