Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	pox	qox	pox_cutoff	isArtifactMode	oxoGCut
PLCH2	9651	broad.mit.edu	37	1	2435767	2435767	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:2435767C>T	uc001aji.1	+	22	3640	c.3366C>T	c.(3364-3366)TCC>TCT	p.S1122S	PLCH2_uc010nyz.1_3'UTR|PLCH2_uc009vle.1_Silent_p.S874S|PLCH2_uc001ajj.1_3'UTR|PLCH2_uc001ajk.1_3'UTR|PLCH2_uc001ajl.1_5'UTR	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	1122					intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CCGTGTACTCCGATGCCACGG	0.662			NA											10	18					0	0	0.013537	0	0
EIF3I	8668	broad.mit.edu	37	1	32696570	32696570	+	Missense_Mutation	SNP	G	G	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:32696570G>C	uc001bur.3	+	11	1379	c.846G>C	c.(844-846)AAG>AAC	p.K282N	EIF3I_uc009vuc.2_Missense_Mutation_p.K282N|EIF3I_uc001bus.2_Missense_Mutation_p.K234N	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,	282						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				GAAGAGTCAAGGGTCACTTTG	0.468	Colon(102;1138 2140 2180 17876)		NA											17	36					0	0	0.006122	0	0
ST6GALNAC5	81849	broad.mit.edu	37	1	77510125	77510125	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:77510125C>T	uc001dhi.2	+	3	673	c.498C>T	c.(496-498)ACC>ACT	p.T166T	ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	NM_030965	NP_112227	Q9BVH7	SIA7E_HUMAN	sialyltransferase 7E	166	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2						GCCAGGGCACCGTGTTCATCT	0.637			NA											21	63					0	0	0.016522	0	0
NBPF10	100132406	broad.mit.edu	37	1	145296448	145296448	+	Missense_Mutation	SNP	T	T	A	rs4996268	by1000genomes	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:145296448T>A	uc001end.3	+	3	405	c.370T>A	c.(370-372)TAT>AAT	p.Y124N	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.Y124N|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	124											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CCGCTCATTGTATGAGCATCT	0.562			NA											8	312					0	0	0.004482	0	0
TCHH	7062	broad.mit.edu	37	1	152084627	152084627	+	Missense_Mutation	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:152084627C>G	uc001ezp.2	-	2	1066	c.1066G>C	c.(1066-1068)GAG>CAG	p.E356Q	TCHH_uc009wne.1_Missense_Mutation_p.E356Q	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	356	1-4.|5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ctctcctcctcctgctcgcgc	0			NA											3	84					0	0	0.014758	0	0
LCE2C	353140	broad.mit.edu	37	1	152648696	152648696	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:152648696G>A	uc001fah.2	+	2	260	c.205G>A	c.(205-207)GGT>AGT	p.G69S		NM_178429	NP_848516	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	69	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTGGGGCTGGTGGCTGCTC	0.667			NA											8	117					0	0	0.004482	0	0
NUF2	83540	broad.mit.edu	37	1	163298697	163298697	+	Missense_Mutation	SNP	A	A	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:163298697A>C	uc001gcq.1	+	5	637	c.337A>C	c.(337-339)AAA>CAA	p.K113Q	NUF2_uc001gcp.2_Missense_Mutation_p.K113Q|NUF2_uc001gcr.1_Missense_Mutation_p.K113Q|NUF2_uc009wvc.1_Missense_Mutation_p.K113Q	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	113	Interaction with the N-terminus of NDC80.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					TCTATGTCCAAGTAAGTGAGA	0.323			NA											7	59					0	0	0.004482	0	0
NAV1	89796	broad.mit.edu	37	1	201778380	201778380	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:201778380C>T	uc001gwu.2	+	20	4634	c.4287C>T	c.(4285-4287)ATC>ATT	p.I1429I	NAV1_uc001gwx.2_Silent_p.I1038I	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1432					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						CGCAGCACATCATCAAAGGGG	0.517			NA											47	101					0	0	0.01441	0	0
TRAF5	7188	broad.mit.edu	37	1	211526711	211526711	+	Nonsense_Mutation	SNP	A	A	T	rs141533849	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:211526711A>T	uc001hih.2	+	2	190	c.130A>T	c.(130-132)AAA>TAA	p.K44*	TRAF5_uc001hii.2_Nonsense_Mutation_p.K44*|TRAF5_uc010psx.1_Nonsense_Mutation_p.K44*|TRAF5_uc010psy.1_Nonsense_Mutation_p.K44*|TRAF5_uc001hij.2_Nonsense_Mutation_p.K44*	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	44					apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		AGAGCGCTACAAATGTGCCTT	0.567			NA											14	91					0	0	0.028581	0	0
C1orf35	79169	broad.mit.edu	37	1	228290021	228290021	+	Missense_Mutation	SNP	G	G	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:228290021G>C	uc001hrx.2	-	5	531	c.437C>G	c.(436-438)TCT>TGT	p.S146C	C1orf35_uc009xew.2_RNA	NM_024319	NP_077295	Q9BU76	MMTA2_HUMAN	hypothetical protein LOC79169	146											0		Prostate(94;0.0488)				CGTGAACACAGACAGCCCCAG	0.706			NA											5	32					0	0	0.02938	0	0
RYR2	6262	broad.mit.edu	37	1	237753108	237753108	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:237753108G>A	uc001hyl.1	+	30	3734	c.3614G>A	c.(3613-3615)TGT>TAT	p.C1205Y		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1205	Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATACCTGTGTGTAGCCTTGGA	0.388			NA											5	51					0	0	0.021553	0	0
OR2W5	441932	broad.mit.edu	37	1	247655175	247655175	+	Missense_Mutation	SNP	T	T	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:247655175T>A	uc001icz.1	+	1	746	c.746T>A	c.(745-747)CTC>CAC	p.L249H		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	249					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CACAGTGGTCTCTCTCTTCTA	0.537			NA											53	117					0	0	0.01441	0	0
LOC653544	653544	broad.mit.edu	37	10	135491107	135491107	+	Missense_Mutation	SNP	G	G	A	rs138808999	by1000genomes	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr10:135491107G>A	uc010qvi.1	+	1	829	c.718G>A	c.(718-720)GCC>ACC	p.A240T		NM_001127389	NP_001120861	F5GZ66	F5GZ66_HUMAN	double homeobox, 4-like	240						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CTCGTGGGTCGCCTTCGCCCA	0.771			NA											3	7					0	0	0.00308	0	0
OR5D16	390144	broad.mit.edu	37	11	55606597	55606597	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:55606597C>A	uc010rio.1	+	1	370	c.370C>A	c.(370-372)CAC>AAC	p.H124N		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				GGCCTATGACCACTTTGTGGC	0.438			NA											27	67					1.77063e-15	2.10263e-15	0.027356	1	0
KIAA1377	57562	broad.mit.edu	37	11	101868365	101868365	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:101868365C>A	uc001pgm.2	+	11	3615	c.3345C>A	c.(3343-3345)GAC>GAA	p.D1115E	KIAA1377_uc001pgn.2_Missense_Mutation_p.D1071E|KIAA1377_uc010run.1_Missense_Mutation_p.D916E	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	1115							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GCTGCAGAGACAAGAGATAAT	0.428			NA											17	49					3.6726e-16	4.40712e-16	0.021523	1	0
CCDC15	80071	broad.mit.edu	37	11	124873844	124873844	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:124873844G>T	uc001qbm.3	+	12	2555	c.2296G>T	c.(2296-2298)GAT>TAT	p.D766Y		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	766						centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		TAAAGAAGAAGATAAGAAAGA	0.358			NA											3	10					2.56e-06	2.9184e-06	0.009096	1	0
DDX25	29118	broad.mit.edu	37	11	125788530	125788530	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr11:125788530G>A	uc001qcz.3	+	10	1187	c.1046G>A	c.(1045-1047)CGA>CAA	p.R349Q	DDX25_uc010sbk.1_Missense_Mutation_p.R349Q	NM_013264	NP_037396	Q9UHL0	DDX25_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 25	349	Helicase C-terminal.				mRNA export from nucleus|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|nucleus	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0021)|all_lung(97;0.0203)|Lung NSC(97;0.0203)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.14e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.046)		TAGACTCGTCGAAACGCTAAG	0.537			NA											18	22					0	0	0.010504	0	0
CAPRIN2	65981	broad.mit.edu	37	12	30881636	30881636	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:30881636G>A	uc001rji.1	-	8	2479	c.1728C>T	c.(1726-1728)AGC>AGT	p.S576S	CAPRIN2_uc001rjf.1_Silent_p.S373S|CAPRIN2_uc001rjg.1_Silent_p.S243S|CAPRIN2_uc001rjh.1_Silent_p.S576S|CAPRIN2_uc001rjj.1_Silent_p.S243S|CAPRIN2_uc001rjk.3_Silent_p.S576S|CAPRIN2_uc001rjl.3_Silent_p.S576S|CAPRIN2_uc001rjm.1_Silent_p.S243S|CAPRIN2_uc001rjn.1_Silent_p.S243S	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	576					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TTGGTATGAGGCTTGCTGTAG	0.428			NA											59	44					0	0	0.01441	0	0
TMBIM4	51643	broad.mit.edu	37	12	66531832	66531832	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:66531832C>T	uc001stc.2	-	7	701	c.625G>A	c.(625-627)GAG>AAG	p.E209K	LLPH_uc010ssx.1_RNA|TMBIM4_uc001std.2_Missense_Mutation_p.E178K|TMBIM4_uc009zqr.2_Missense_Mutation_p.E256K|TMBIM4_uc001ste.2_RNA|TMBIM4_uc001stf.2_3'UTR|TMBIM4_uc009zqs.2_3'UTR	NM_016056	NP_057140	Q9HC24	TMBI4_HUMAN	transmembrane BAX inhibitor motif containing 4	209	Helical; (Potential).					integral to membrane	protein binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(28;0.0745)		AATACGTACTCTTCAGGTGAC	0.413			NA											17	188					0	0	0.008871	0	0
LRRC10	376132	broad.mit.edu	37	12	70004144	70004144	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:70004144G>A	uc001svc.2	-	1	799	c.475C>T	c.(475-477)CTG>TTG	p.L159L		NM_201550	NP_963844	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	159	LRR 5.					nucleus					0	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TGGCCTGGCAGCAAACGCAGG	0.622			NA											3	77					0	0	0.004672	0	0
NAP1L1	4673	broad.mit.edu	37	12	76447587	76447587	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:76447587A>G	uc001sxw.2	-	9	1145	c.733T>C	c.(733-735)TTT>CTT	p.F245L	NAP1L1_uc001sxv.2_Missense_Mutation_p.F203L|NAP1L1_uc001sxz.2_Missense_Mutation_p.F176L|NAP1L1_uc001sxx.2_Missense_Mutation_p.F245L|NAP1L1_uc001sxy.2_Missense_Mutation_p.F182L|NAP1L1_uc010sty.1_Missense_Mutation_p.F202L|NAP1L1_uc010stz.1_Missense_Mutation_p.F62L|NAP1L1_uc010sua.1_Missense_Mutation_p.F245L|NAP1L1_uc001syb.2_Missense_Mutation_p.F245L|NAP1L1_uc001sya.2_Missense_Mutation_p.F203L|NAP1L1_uc001syc.2_Missense_Mutation_p.F256L	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	245					DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				TCAAAAGAAAAGGGATCAGAA	0.318			NA											3	101					0	0	0.004672	0	0
E2F7	144455	broad.mit.edu	37	12	77436892	77436892	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:77436892C>A	uc001sym.3	-	7	1312	c.1076G>T	c.(1075-1077)CGT>CTT	p.R359L		NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	359	Potential.				cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						GGCTGGTTTACGACCTCGCTC	0.463			NA											27	272					2.12542e-12	2.49791e-12	0.030593	1	0
PLEKHG7	440107	broad.mit.edu	37	12	93155572	93155572	+	Missense_Mutation	SNP	T	T	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:93155572T>A	uc001tcj.2	+	9	975	c.745T>A	c.(745-747)TTC>ATC	p.F249I		NM_001004330	NP_001004330	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G	249	PH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1						CTTCAATGATTTCCTCTTAGT	0.333			NA											8	9					0	0	0.006214	0	0
UBE3B	89910	broad.mit.edu	37	12	109972426	109972426	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:109972426C>T	uc001top.2	+	28	3649	c.3046C>T	c.(3046-3048)CGG>TGG	p.R1016W	UBE3B_uc001toq.2_Missense_Mutation_p.R1016W|UBE3B_uc001tos.2_Missense_Mutation_p.R443W|UBE3B_uc001tot.2_Missense_Mutation_p.R134W|UBE3B_uc010sxp.1_3'UTR	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1016	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						CAGCGTCCTCCGGGGCTTCTT	0.632			NA											6	22					0	0	0.02938	0	0
TRPM1	4308	broad.mit.edu	37	15	31362264	31362264	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:31362264G>A	uc001zfm.2	-	3	311	c.183C>T	c.(181-183)TTC>TTT	p.F61F	TRPM1_uc010azy.2_5'Flank|TRPM1_uc001zfl.2_5'Flank|TRPM1_uc001zfn.3_Silent_p.F61F|uc010ubn.1_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	61	Extracellular (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CGCCACCCTGGAATTCAAGAA	0.507			NA											12	490					0	0	0.020292	0	0
IVD	3712	broad.mit.edu	37	15	40703778	40703778	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:40703778A>G	uc001zls.3	+	6	918	c.584A>G	c.(583-585)AAC>AGC	p.N195S	IVD_uc001zlq.2_Missense_Mutation_p.N165S	NM_002225	NP_002216	P26440	IVD_HUMAN	isovaleryl Coenzyme A dehydrogenase isoform 1	192					leucine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|isovaleryl-CoA dehydrogenase activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)		CTGAATGGCAACAAGTTCTGG	0.522	GBM(31;293 617 7486 32527 34655)		NA											40	21					0	0	0.01441	0	0
GATM	2628	broad.mit.edu	37	15	45660357	45660357	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:45660357A>G	uc001zvc.2	-	4	915	c.586T>C	c.(586-588)TAC>CAC	p.Y196H	GATM_uc001zvb.2_Missense_Mutation_p.Y67H|GATM_uc010uev.1_Missense_Mutation_p.Y249H	NM_001482	NP_001473	P50440	GATM_HUMAN	L-arginine:glycine amidinotransferase precursor	196					creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)	ATTGACCTGTACGCTCGGTAC	0.493			NA											20	21					0	0	0.021523	0	0
WASH3P	374666	broad.mit.edu	37	15	102515282	102515282	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr15:102515282G>A	uc002cdi.2	+	9	1926	c.506G>A	c.(505-507)CGC>CAC	p.R169H	WASH3P_uc002cdl.2_Missense_Mutation_p.R169H|WASH3P_uc002cdk.2_RNA|WASH3P_uc002cdp.2_Missense_Mutation_p.R169H|WASH3P_uc010bpo.2_RNA|WASH3P_uc002cdq.2_RNA|WASH3P_uc002cdr.2_RNA	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0						GAGTCCATCCGCCAAGCTGGG	0.652			NA											8	6					0	0	0.006214	0	0
ERN2	10595	broad.mit.edu	37	16	23722327	23722327	+	Missense_Mutation	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:23722327T>C	uc002dma.3	-	2	419	c.250A>G	c.(250-252)AGG>GGG	p.R84G	ERN2_uc010bxp.2_Missense_Mutation_p.R84G|ERN2_uc010bxq.1_5'UTR	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	36	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TTCTCTGGCCTGAGAGTATGA	0.582			NA											3	67					0	0	0.014758	0	0
CHST4	10164	broad.mit.edu	37	16	71570803	71570803	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:71570803G>T	uc002fan.2	+	2	404	c.223G>T	c.(223-225)GCC>TCC	p.A75S	CHST4_uc002fao.2_Missense_Mutation_p.A75S	NM_005769	NP_005760	Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	75	Lumenal (Potential).				cell-cell signaling|immune response|inflammatory response|N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity				0						GATGGAGCCCGCCTGGCACGT	0.587			NA											13	46					6.31663e-08	7.27369e-08	0.024245	1	0
OSGIN1	29948	broad.mit.edu	37	16	83998759	83998759	+	Missense_Mutation	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:83998759C>G	uc002fha.2	+	7	1213	c.830C>G	c.(829-831)TCC>TGC	p.S277C	OSGIN1_uc002fhb.2_Missense_Mutation_p.S194C|OSGIN1_uc002fhc.2_Missense_Mutation_p.S194C	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	277					cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						AACTTTGTGTCCGGTGCTGTA	0.642			NA											20	99					0	0	0.014323	0	0
ATP1B2	482	broad.mit.edu	37	17	7558889	7558889	+	Silent	SNP	C	C	T	rs35919584		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:7558889C>T	uc002gif.1	+	6	1237	c.654C>T	c.(652-654)CCC>CCT	p.P218P		NM_001678	NP_001669	P14415	AT1B2_HUMAN	Na+/K+ -ATPase beta 2 subunit	218	Extracellular (Potential).				ATP biosynthetic process|blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|sodium:potassium-exchanging ATPase activity	p.0?(2)|p.?(1)		central_nervous_system(1)|pancreas(1)	2		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)		TCATGTTCCCCGCCAACGGCA	0.587			NA											5	57					0	0	0.021553	0	0
TP53	7157	broad.mit.edu	37	17	7577130	7577130	+	Missense_Mutation	SNP	A	A	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:7577130A>C	uc002gim.2	-	8	1002	c.808T>G	c.(808-810)TTT>GTT	p.F270V	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.F270V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.F138V|TP53_uc010cng.1_Missense_Mutation_p.F138V|TP53_uc002gii.1_Missense_Mutation_p.F138V|TP53_uc010cnh.1_Missense_Mutation_p.F270V|TP53_uc010cni.1_Missense_Mutation_p.F270V|TP53_uc002gij.2_Missense_Mutation_p.F270V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	270	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		F -> L (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).|F -> C (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.F270L(22)|p.F270C(15)|p.F270V(8)|p.0?(7)|p.F270S(7)|p.F270Y(5)|p.F270I(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGCACCTCAAAGCTGTTCCGT	0.537	Pancreas(47;798 1329 9957 10801)		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumensyndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			5	5					0	0	0.014758	0	0
RASL10B	91608	broad.mit.edu	37	17	34062322	34062322	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:34062322G>A	uc002hju.2	+	2	485	c.119G>A	c.(118-120)CGC>CAC	p.R40H		NM_033315	NP_201572	Q96S79	RSLAB_HUMAN	RAS-like, family 10, member B precursor	40	Small GTPase-like.|Effector region (By similarity).				small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			lung(2)|breast(2)	4				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACCGCCCGCCGCCTTTACCTG	0.632			NA											22	33					0	0	0.01892	0	0
FASN	2194	broad.mit.edu	37	17	80041455	80041455	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:80041455A>G	uc002kdu.2	-	31	5396	c.5279T>C	c.(5278-5280)TTG>TCG	p.L1760S	FASN_uc002kdv.1_5'Flank	NM_004104	NP_004095	P49327	FAS_HUMAN	fatty acid synthase	1760	Enoyl reductase (By similarity).				energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|pantothenate metabolic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	cytosol|Golgi apparatus|melanosome|plasma membrane	3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity|3-oxoacyl-[acyl-carrier-protein] synthase activity|[acyl-carrier-protein] S-acetyltransferase activity|[acyl-carrier-protein] S-malonyltransferase activity|acyl carrier activity|cofactor binding|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity|myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity|phosphopantetheine binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)|Pyrazinamide(DB00339)	GTGCGTAGCCAAGCACCTCAC	0.622	Colon(59;314 1043 11189 28578 32273)		NA											9	11					0	0	0.004482	0	0
GATA6	2627	broad.mit.edu	37	18	19751577	19751577	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr18:19751577G>A	uc002ktt.1	+	2	737	c.472G>A	c.(472-474)GGT>AGT	p.G158S	GATA6_uc002ktu.1_Missense_Mutation_p.G158S	NM_005257	NP_005248	Q92908	GATA6_HUMAN	GATA binding protein 6	158					blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	p.G158S(1)		central_nervous_system(3)	3	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			CTCCAGCCAGGGTCCGGCCGC	0.602	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)		NA											6	11					0	0	0.021553	0	0
C19orf21	126353	broad.mit.edu	37	19	758028	758028	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:758028G>A	uc002lpo.2	+	2	1165	c.1082G>A	c.(1081-1083)CGT>CAT	p.R361H		NM_173481	NP_775752	Q8IVT2	CS021_HUMAN	hypothetical protein LOC126353	361										upper_aerodigestive_tract(1)	1		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGACACAGCGTGAGGAAGAC	0.701			NA											5	10					0	0	0.014758	0	0
CLEC4M	10332	broad.mit.edu	37	19	7831630	7831630	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:7831630C>A	uc002mih.2	+	6	922	c.804C>A	c.(802-804)GAC>GAA	p.D268E	CLEC4M_uc010xjv.1_3'UTR|CLEC4M_uc002mhy.2_3'UTR|CLEC4M_uc010xjw.1_Missense_Mutation_p.D224E|CLEC4M_uc010dvt.2_Missense_Mutation_p.D245E|CLEC4M_uc010dvs.2_Missense_Mutation_p.D267E|CLEC4M_uc010xjx.1_Missense_Mutation_p.D240E|CLEC4M_uc002mhz.2_Missense_Mutation_p.D199E|CLEC4M_uc002mic.2_Missense_Mutation_p.D263E|CLEC4M_uc002mia.2_Missense_Mutation_p.D155E	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	291	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						ACTGGCACGACTCCGTCACCG	0.597			NA											23	73					6.07407e-21	7.36643e-21	0.034045	1	0
ZNF492	57615	broad.mit.edu	37	19	22847796	22847796	+	Missense_Mutation	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:22847796T>C	uc002nqw.3	+	4	1569	c.1325T>C	c.(1324-1326)ATT>ACT	p.I442T		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	442	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				CATAAGGTAATTCATACTGGA	0.368			NA											3	98					0	0	0.014758	0	0
ZNF536	9745	broad.mit.edu	37	19	31039823	31039823	+	Missense_Mutation	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:31039823C>G	uc002nsu.1	+	4	3435	c.3297C>G	c.(3295-3297)CAC>CAG	p.H1099Q	ZNF536_uc010edd.1_Missense_Mutation_p.H1099Q	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1099					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GGACCGGCCACGTGGACCCTG	0.542			NA											26	12					0	0	0.009535	0	0
PRODH2	58510	broad.mit.edu	37	19	36303099	36303099	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr19:36303099G>A	uc002obx.1	-	4	693	c.675C>T	c.(673-675)CCC>CCT	p.P225P		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	225					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCCAGGCTGGGGGGCTCCA	0.672			NA											3	81					0	0	0.009096	0	0
XPO1	7514	broad.mit.edu	37	2	61726958	61726958	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:61726958G>A	uc002sbj.2	-	7	1208	c.480C>T	c.(478-480)AGC>AGT	p.S160S	XPO1_uc010fcl.2_Silent_p.S156S|XPO1_uc010ypn.1_Silent_p.S156S|XPO1_uc002sbk.2_5'UTR	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1	160	Necessary for HTLV-1 Rex-mediated mRNA export.				intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AGAGACTTTCGCTGGTCCTAC	0.358			NA											18	52					0	0	0.010504	0	0
RGPD3	653489	broad.mit.edu	37	2	107040265	107040265	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:107040265C>T	uc010ywi.1	-	20	4215	c.4158G>A	c.(4156-4158)CAG>CAA	p.Q1386Q		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1386	RanBD1 2.				intracellular transport		binding			ovary(1)	1						TATCATAATTCTGTAAAATCT	0.343			NA											23	193					0	0	0.030593	0	0
MTX2	10651	broad.mit.edu	37	2	177191598	177191598	+	Missense_Mutation	SNP	T	T	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:177191598T>A	uc002ukx.2	+	5	489	c.254T>A	c.(253-255)CTT>CAT	p.L85H	MTX2_uc002ukw.2_Missense_Mutation_p.L75H	NM_006554	NP_006545	O75431	MTX2_HUMAN	metaxin 2	85					protein targeting to mitochondrion	mitochondrial outer membrane				ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)			GTATCAGAACTTGGTCCAATA	0.284			NA											3	51					0	0	0.009096	0	0
TTN	7273	broad.mit.edu	37	2	179484783	179484783	+	Missense_Mutation	SNP	A	A	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:179484783A>T	uc010zfg.1	-	198	38881	c.38657T>A	c.(38656-38658)CTG>CAG	p.L12886Q	TTN_uc010zfh.1_Missense_Mutation_p.L6581Q|TTN_uc010zfi.1_Missense_Mutation_p.L6514Q|TTN_uc010zfj.1_Missense_Mutation_p.L6389Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13813							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCATCATCCAGCCTGCAATC	0.368			NA											10	32					0	0	0.010729	0	0
CYP27A1	1593	broad.mit.edu	37	2	219677417	219677417	+	Silent	SNP	C	C	T	rs143600636	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:219677417C>T	uc002viz.3	+	4	1223	c.789C>T	c.(787-789)CCC>CCT	p.P263P		NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,	263					bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	GGACTCGCCCCGTGCTGCCTT	0.567			NA											43	308					0	0	0.01441	0	0
AGAP1	116987	broad.mit.edu	37	2	236626271	236626271	+	Missense_Mutation	SNP	A	A	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr2:236626271A>T	uc002vvs.2	+	3	888	c.293A>T	c.(292-294)CAG>CTG	p.Q98L	AGAP1_uc002vvt.2_Missense_Mutation_p.Q98L	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1	98	Small GTPase-like.				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						ACATATGTCCAGGAGGAGTCT	0.453			NA											22	35					0	0	0.021523	0	0
TMPRSS3	64699	broad.mit.edu	37	21	43803247	43803247	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr21:43803247G>A	uc002zbb.2	-	8	878	c.677C>T	c.(676-678)TCG>TTG	p.S226L	TMPRSS3_uc002zay.2_5'UTR|TMPRSS3_uc002zaz.2_Missense_Mutation_p.S99L|TMPRSS3_uc002zba.2_Missense_Mutation_p.S99L|TMPRSS3_uc002zbc.2_Missense_Mutation_p.S226L|TMPRSS3_uc002zbd.2_Missense_Mutation_p.S226L	NM_024022	NP_076927	P57727	TMPS3_HUMAN	transmembrane protease, serine 3 isoform 1	226	Peptidase S1.|Extracellular (Potential).				cellular sodium ion homeostasis|proteolysis	endoplasmic reticulum membrane|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity|sodium channel regulator activity			ovary(2)|breast(1)	3						GGGCCACTGCGAGAGCAAGGA	0.597			NA											7	26					0	0	0.006214	0	0
CBS	875	broad.mit.edu	37	21	44479397	44479397	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr21:44479397C>T	uc002zcu.2	-	13	1407	c.1162G>A	c.(1162-1164)GAC>AAC	p.D388N	CBS_uc002zcs.1_Missense_Mutation_p.D283N|CBS_uc002zct.2_Missense_Mutation_p.D388N|CBS_uc002zcw.3_Missense_Mutation_p.D388N|CBS_uc002zcv.2_Missense_Mutation_p.D388N|CBS_uc002zcx.2_Missense_Mutation_p.D7N	NM_000071	NP_000062	P35520	CBS_HUMAN	cystathionine-beta-synthase	388					cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)	ATCCACCTGTCGCTCAGGAAC	0.687			NA											17	29					0	0	0.010504	0	0
TRIOBP	11078	broad.mit.edu	37	22	38150920	38150920	+	Nonsense_Mutation	SNP	C	C	T	rs142929031		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr22:38150920C>T	uc003atr.2	+	13	5687	c.5416C>T	c.(5416-5418)CAG>TAG	p.Q1806*	TRIOBP_uc003atu.2_Nonsense_Mutation_p.Q1634*|TRIOBP_uc003atv.2_Nonsense_Mutation_p.Q93*|TRIOBP_uc003atw.2_Nonsense_Mutation_p.Q93*|TRIOBP_uc003atx.1_5'Flank|TRIOBP_uc010gxh.2_5'Flank	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1806	PH.				actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CTCTACTTCGCAGTGGAAGAA	0.527			NA											5	21					0	0	0.02938	0	0
ATP2B2	491	broad.mit.edu	37	3	10491052	10491052	+	Missense_Mutation	SNP	C	C	T	rs149328739		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:10491052C>T	uc003bvt.2	-	2	615	c.176G>A	c.(175-177)CGC>CAC	p.R59H	ATP2B2_uc003bvv.2_Missense_Mutation_p.R59H|ATP2B2_uc003bvw.2_Missense_Mutation_p.R59H|ATP2B2_uc010hdp.2_Missense_Mutation_p.R59H	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	59	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding	p.R59C(1)		ovary(3)|skin(2)|central_nervous_system(1)	6						GGTTTTGAGGCGCCGGCAGAT	0.562	Ovarian(125;1619 1709 15675 19819 38835)		NA											4	37					0	0	0.009096	0	0
EAF1	85403	broad.mit.edu	37	3	15473685	15473685	+	Missense_Mutation	SNP	A	A	G	rs17857248		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:15473685A>G	uc003bzu.2	+	3	513	c.290A>G	c.(289-291)TAT>TGT	p.Y97C	EAF1_uc011avq.1_Intron	NM_033083	NP_149074	Q96JC9	EAF1_HUMAN	ELL associated factor 1	97				Y -> F (in Ref. 2; AAH41329).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cajal body|nuclear speck	protein binding			central_nervous_system(1)	1						ACTGGTGAATATGTGCTGGAA	0.418			NA											60	80					0	0	0.01441	0	0
RAD54L2	23132	broad.mit.edu	37	3	51671500	51671500	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:51671500C>T	uc011bdt.1	+	10	1788	c.1663C>T	c.(1663-1665)CTG>TTG	p.L555L	RAD54L2_uc003dbh.2_Silent_p.L146L|RAD54L2_uc011bdu.1_Silent_p.L249L|RAD54L2_uc003dbj.2_5'UTR	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2	555	LXXLL motif 1.					nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GCACAGTCTTCTGGAGGGCTT	0.542			NA											13	16					0	0	0.024245	0	0
FAM19A1	407738	broad.mit.edu	37	3	68055862	68055862	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:68055862C>A	uc003dnd.2	+	2	309	c.93C>A	c.(91-93)TTC>TTA	p.F31L	FAM19A1_uc003dne.2_Missense_Mutation_p.F31L|FAM19A1_uc003dng.2_Missense_Mutation_p.F31L|FAM19A1_uc003dnf.1_RNA	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine	31						endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		AGCACACTTTCCAGCAGCATC	0.498			NA											52	100					3.36121e-32	4.16497e-32	0.01441	1	0
SEC22A	26984	broad.mit.edu	37	3	122964752	122964752	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:122964752A>G	uc003ege.2	+	5	627	c.548A>G	c.(547-549)CAG>CGG	p.Q183R	SEC22A_uc003egf.2_Missense_Mutation_p.Q183R	NM_012430	NP_036562	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A	183	Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)		CCAGCTCACCAGCGACTGGAA	0.373			NA											68	126					0	0	0.01441	0	0
ARMC8	25852	broad.mit.edu	37	3	137942330	137942330	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:137942330C>T	uc003esa.1	+	5	619	c.252C>T	c.(250-252)GTC>GTT	p.V84V	ARMC8_uc003erw.2_Silent_p.V84V|ARMC8_uc003erx.2_Silent_p.V84V|ARMC8_uc003ery.2_Silent_p.V56V|ARMC8_uc003erz.2_Silent_p.V56V|ARMC8_uc011bmf.1_Silent_p.V98V|ARMC8_uc011bmg.1_Silent_p.V98V|ARMC8_uc011bmh.1_Silent_p.V56V|ARMC8_uc003esb.1_Silent_p.V56V	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2	98	ARM 2.						binding				0						AAAACAATGTCAAGTCTCTAC	0.418			NA											17	99					0	0	0.006122	0	0
XRN1	54464	broad.mit.edu	37	3	142116274	142116274	+	Nonsense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:142116274G>A	uc003eus.2	-	20	2303	c.2236C>T	c.(2236-2238)CAG>TAG	p.Q746*	XRN1_uc010huu.2_Nonsense_Mutation_p.Q212*|XRN1_uc003eut.2_Nonsense_Mutation_p.Q746*|XRN1_uc003euu.2_Nonsense_Mutation_p.Q746*|XRN1_uc003euv.1_Nonsense_Mutation_p.Q607*	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	746					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						TAAAGCTTCTGTGTTCCTGGA	0.353			NA											6	30					0	0	0.00308	0	0
TRIM59	286827	broad.mit.edu	37	3	160155919	160155919	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:160155919G>A	uc003fdm.2	-	3	1248	c.1053C>T	c.(1051-1053)CAC>CAT	p.H351H	IFT80_uc003fda.2_Intron	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	351						integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGGTTATGATGTGTTGGTTGA	0.284			NA											16	26					0	0	0.006122	0	0
USP13	8975	broad.mit.edu	37	3	179478937	179478937	+	Silent	SNP	C	C	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:179478937C>G	uc003fkh.2	+	17	2067	c.1986C>G	c.(1984-1986)GCC>GCG	p.A662A		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	662	UBA 1.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding	p.A662A(1)		ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TGCAGCTGGCCGAGATGGGTT	0.498			NA											11	147					0	0	0.020292	0	0
ECE2	9718	broad.mit.edu	37	3	184009886	184009886	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:184009886G>A	uc003fni.3	+	19	2550	c.2512G>A	c.(2512-2514)GAG>AAG	p.E838K	ECE2_uc003fnl.3_Missense_Mutation_p.E766K|ECE2_uc003fnm.3_Missense_Mutation_p.E720K|ECE2_uc003fnk.3_Missense_Mutation_p.E691K	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	838	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GAGCTCTCACGAGGGGCTGGT	0.667			NA											12	56					0	0	0.013537	0	0
C3orf59	151963	broad.mit.edu	37	3	192516439	192516440	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	GC	GC	-	-	GC	GC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:192516439_192516440GC>AT	uc011bsp.1	-	2	1532_1533	c.1211_1212GC>AT	c.(1210-1212)CGC>CAT	p.R404H		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	404											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		CCGGGTCTGAGCGCACAGAGGA	0.574			NA											5	38					0	0	0.004672	0	0
ATP13A4	84239	broad.mit.edu	37	3	193182868	193182868	+	Missense_Mutation	SNP	G	G	A	rs148750067		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:193182868G>A	uc003ftd.2	-	12	1430	c.1322C>T	c.(1321-1323)GCG>GTG	p.A441V	ATP13A4_uc003fte.1_Missense_Mutation_p.A441V|ATP13A4_uc011bsr.1_5'UTR|ATP13A4_uc010hzi.2_RNA|ATP13A4_uc003ftf.3_Missense_Mutation_p.A147V	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	441	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CGGAGGAACCGCAATTGTGAT	0.448			NA											28	28					0	0	0.015359	0	0
ARAP2	116984	broad.mit.edu	37	4	36149176	36149176	+	Nonsense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr4:36149176C>A	uc003gsq.1	-	18	3531	c.3193G>T	c.(3193-3195)GAG>TAG	p.E1065*		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1065	PH 4.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TTACTTAGCTCTTGCAGTCTT	0.388			NA											12	27					3.27435e-08	3.80894e-08	0.020292	1	0
UGT2B28	54490	broad.mit.edu	37	4	70152481	70152481	+	Silent	SNP	A	A	G	rs141618560		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr4:70152481A>G	uc003hej.2	+	3	884	c.882A>G	c.(880-882)GAA>GAG	p.E294E	UGT2B28_uc010ihr.2_Silent_p.E294E	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	294					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	AAATGGAGGAATTTGTACAGA	0.393			NA											4	103					0	0	0.021553	0	0
GC	2638	broad.mit.edu	37	4	72634047	72634047	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr4:72634047C>T	uc003hge.2	-	3	385	c.232G>A	c.(232-234)GGG>AGG	p.G78R	GC_uc003hgd.2_5'UTR|GC_uc010iie.2_Missense_Mutation_p.G78R|GC_uc010iif.2_Missense_Mutation_p.G97R	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	78	Albumin 1.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	GGGTCAGCCCCTTCCGCACAG	0.527			NA											4	33					0	0	0.009096	0	0
ADCY2	108	broad.mit.edu	37	5	7757636	7757636	+	Nonsense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:7757636G>A	uc003jdz.1	+	16	2098	c.2031G>A	c.(2029-2031)TGG>TGA	p.W677*	ADCY2_uc011cmo.1_Nonsense_Mutation_p.W497*	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	677					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						ACCGCCCCTGGCCACGGATCT	0.507			NA											22	63					0	0	0.014323	0	0
SEMA5A	9037	broad.mit.edu	37	5	9063108	9063108	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:9063108G>A	uc003jek.2	-	18	3121	c.2409C>T	c.(2407-2409)GGC>GGT	p.G803G		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	803	TSP type-1 5.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						GGTTCCGAATGCCCCTGCTGC	0.582			NA											10	57					0	0	0.016723	0	0
PCDHB2	56133	broad.mit.edu	37	5	140475890	140475890	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:140475890G>T	uc003lil.2	+	1	1654	c.1516G>T	c.(1516-1518)GTC>TTC	p.V506F	PCDHB2_uc003lim.1_Missense_Mutation_p.V167F	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	506	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCTCCCTGGTCTCCATCAA	0.701			NA											25	184					1.56442e-22	1.91767e-22	0.012213	1	0
PCDHB10	56126	broad.mit.edu	37	5	140572437	140572437	+	Silent	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:140572437G>T	uc003lix.2	+	1	486	c.312G>T	c.(310-312)CTG>CTT	p.L104L		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	104	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGTATGCTGTATTTCCAAA	0.443			NA											7	25					5.01169e-05	5.60131e-05	0.0333	1	0
NMUR2	56923	broad.mit.edu	37	5	151784061	151784061	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:151784061G>A	uc003luv.2	-	1	780	c.614C>T	c.(613-615)ACG>ATG	p.T205M		NM_020167	NP_064552	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	205	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity	p.T205M(1)		ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CTTGATGACCGTACAGGTGGC	0.542			NA											7	258					0	0	0.004482	0	0
GEMIN5	25929	broad.mit.edu	37	5	154306962	154306962	+	Missense_Mutation	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr5:154306962T>C	uc003lvx.3	-	7	1146	c.1063A>G	c.(1063-1065)ACA>GCA	p.T355A	GEMIN5_uc011ddk.1_Missense_Mutation_p.T354A	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5	355	WD 6.				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCATTGATGTAGAAAGTAAT	0.393			NA											11	43					0	0	0.024245	0	0
ZKSCAN3	80317	broad.mit.edu	37	6	28333829	28333829	+	Missense_Mutation	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:28333829G>T	uc003nle.3	+	6	1600	c.1384G>T	c.(1384-1386)GCC>TCC	p.A462S	ZKSCAN3_uc010jrc.2_Missense_Mutation_p.A462S|ZKSCAN3_uc003nlf.3_Missense_Mutation_p.A314S|uc010jrd.2_5'Flank	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	462				QGEAWKSRMESQLENVETPMS -> TGRGWKVGWKASWKML KLPCP (in Ref. 5; AAB16813).	positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						GCAGGGAGAGGCCTGGAAAAG	0.438			NA											12	22					0.000219431	0.000242866	0.020292	1	0
MDC1	9656	broad.mit.edu	37	6	30673003	30673003	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:30673003G>A	uc003nrg.3	-	10	4397	c.3957C>T	c.(3955-3957)GTC>GTT	p.V1319V	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Silent_p.V926V	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1319	Pro-rich.|Interaction with the PRKDC complex.			Missing (in Ref. 2; CAH18685).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						CAGGGGTCTTGACAGAGGACA	0.592			NA						Other_conserved_DNA_damage_response_genes					5	229					0	0	0.014758	0	0
MDC1	9656	broad.mit.edu	37	6	30673738	30673738	+	Missense_Mutation	SNP	G	G	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:30673738G>C	uc003nrg.3	-	10	3662	c.3222C>G	c.(3220-3222)ATC>ATG	p.I1074M	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.I681M	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1074	Pro-rich.			Missing (in Ref. 2; CAH18685).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						CGGTTGGCTTGATAGAAGGTA	0.537			NA						Other_conserved_DNA_damage_response_genes					4	156					0	0	0.014758	0	0
ZNF318	24149	broad.mit.edu	37	6	43306956	43306956	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:43306956C>T	uc003oux.2	-	10	4858	c.4780G>A	c.(4780-4782)GGT>AGT	p.G1594S	ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1594					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GCCAATGGACCACCACTTAGC	0.493			NA											3	64					0	0	0.009096	0	0
SLC35B2	347734	broad.mit.edu	37	6	44222572	44222572	+	Silent	SNP	G	G	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:44222572G>T	uc003oxd.2	-	4	1306	c.1170C>A	c.(1168-1170)GTC>GTA	p.V390V	SLC35B2_uc011dvt.1_Silent_p.V293V|SLC35B2_uc011dvu.1_Silent_p.V257V	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2	390	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCACCACAGTGACAGTGTGGC	0.602			NA											8	52					0.00621372	0.00662022	0.006214	1	0
CDC5L	988	broad.mit.edu	37	6	44390472	44390472	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:44390472C>T	uc003oxl.2	+	10	1589	c.1330C>T	c.(1330-1332)CTT>TTT	p.L444F		NM_001253	NP_001244	Q99459	CDC5L_HUMAN	CDC5-like	444	Interaction with PPP1R8.				cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|cytoplasm|nuclear speck|nucleolus	DNA binding|RNA binding			lung(3)|ovary(1)|kidney(1)|skin(1)	6	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TAGAACTCCTCTTCGAGACAA	0.448			NA											4	150					0	0	0.021553	0	0
RFX6	222546	broad.mit.edu	37	6	117199104	117199104	+	Silent	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr6:117199104C>A	uc003pxm.2	+	2	432	c.369C>A	c.(367-369)CTC>CTA	p.L123L		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	123					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						AGACACAGCTCACGCTGCAGT	0.478			NA											6	19					0.00198382	0.00215386	0.02938	1	0
OCM	654231	broad.mit.edu	37	7	5922210	5922210	+	Missense_Mutation	SNP	T	T	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:5922210T>G	uc003spe.3	+	2	240	c.148T>G	c.(148-150)TTC>GTC	p.F50V		NM_001097622	NP_001091091	P0CE72	ONCO_HUMAN	oncomodulin	50	EF-hand 1.						calcium ion binding				0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		TGTTTTCCGGTTCATAGACAA	0.507			NA											11	206					0	0	0.008291	0	0
THSD7A	221981	broad.mit.edu	37	7	11486888	11486888	+	Silent	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:11486888A>G	uc003ssf.3	-	12	3021	c.2769T>C	c.(2767-2769)GGT>GGC	p.G923G		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	923	TSP type-1 9.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCCTAACTGCACCACAGTCTC	0.502			NA								HNSCC(18;0.044)			16	50					0	0	0.008871	0	0
DNAH11	8701	broad.mit.edu	37	7	21730401	21730401	+	Silent	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:21730401A>G	uc003svc.2	+	36	5995	c.5964A>G	c.(5962-5964)GAA>GAG	p.E1988E		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1988	AAA 1 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTCTTGGGGAAGCTATCACAC	0.363			NA							Kartagener_syndrome				46	265					0	0	0.01441	0	0
NOD1	10392	broad.mit.edu	37	7	30494771	30494771	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:30494771C>T	uc003tav.2	-	5	881	c.358G>A	c.(358-360)GTG>ATG	p.V120M	NOD1_uc010kvs.2_Missense_Mutation_p.V120M	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	120					activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						GTGTTGACCACGACTTTGCTC	0.617			NA											5	163					0	0	0.021553	0	0
PGAM2	5224	broad.mit.edu	37	7	44102401	44102401	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:44102401C>T	uc003tjs.2	-	3	759	c.724G>A	c.(724-726)GCC>ACC	p.A242T		NM_000290	NP_000281	P15259	PGAM2_HUMAN	phosphoglycerate mutase 2	242					gluconeogenesis|glycolysis|striated muscle contraction	cytosol	2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity				0						GCCTCCATGGCCTTCCGCACC	0.622			NA											18	63					0	0	0.012319	0	0
SEMA3A	10371	broad.mit.edu	37	7	83591024	83591024	+	Missense_Mutation	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:83591024A>G	uc003uhz.2	-	17	2294	c.1979T>C	c.(1978-1980)CTT>CCT	p.L660P		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	660	Ig-like C2-type.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						TACCTTAAGAAGAGTTTGTAT	0.428			NA											46	12					0	0	0.01441	0	0
PDAP1	11333	broad.mit.edu	37	7	99002494	99002494	+	Silent	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:99002494C>T	uc003uqe.2	-	2	217	c.96G>A	c.(94-96)CAG>CAA	p.Q32Q		NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1	32					cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CCCTGGCCTTCTGCTTCTCAG	0.607			NA											8	33					0	0	0.008291	0	0
MLL3	58508	broad.mit.edu	37	7	151932943	151932943	+	Missense_Mutation	SNP	A	A	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:151932943A>C	uc003wla.2	-	16	2947	c.2728T>G	c.(2728-2730)TCA>GCA	p.S910A	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	910					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTCAGCTTTGACCTGCCTCGG	0.483	Colon(68;14 1149 1884 27689 34759)		NA	N		medulloblastoma								5	137					0	0	0.02938	0	0
CSMD1	64478	broad.mit.edu	37	8	3245155	3245155	+	Silent	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:3245155G>A	uc011kwk.1	-	18	3036	c.2646C>T	c.(2644-2646)AAC>AAT	p.N882N	CSMD1_uc011kwj.1_Silent_p.N274N|CSMD1_uc003wqe.2_Silent_p.N38N	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	882	Extracellular (Potential).|Sushi 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCGATGGCCGTTCACAGGGA	0.562			NA											6	2					0	0	0.02938	0	0
VDAC3	7419	broad.mit.edu	37	8	42262390	42262390	+	Silent	SNP	A	A	G			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:42262390A>G	uc011lct.1	+	9	851	c.708A>G	c.(706-708)AAA>AAG	p.K236K	VDAC3_uc003xpc.2_Silent_p.K237K	NM_005662	NP_005653	Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3 isoform b	236	Beta stranded; (By similarity).				adenine transport	mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			upper_aerodigestive_tract(1)	1	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	CTTAGGCTAAAGTAAATAATG	0.378			NA											29	109					0	0	0.012213	0	0
ZNF704	619279	broad.mit.edu	37	8	81733777	81733777	+	Missense_Mutation	SNP	A	A	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:81733777A>T	uc003yby.1	-	2	285	c.53T>A	c.(52-54)ATG>AAG	p.M18K		NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	18						intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			TTGATGAGACATTTTTTTACC	0.418			NA											36	273					0	0	0.036044	0	0
C8orf47	203111	broad.mit.edu	37	8	99102050	99102050	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:99102050G>A	uc003yih.1	+	2	953	c.805G>A	c.(805-807)GAA>AAA	p.E269K		NM_173549	NP_775820	Q6P6B1	CH047_HUMAN	hypothetical protein LOC203111	269	Glu-rich.										0	Breast(36;2.31e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			TGTAACACCAGAAGTATTGGA	0.443			NA											7	76					0	0	0.00308	0	0
C9orf131	138724	broad.mit.edu	37	9	35045640	35045640	+	Missense_Mutation	SNP	C	C	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:35045640C>A	uc003zvw.2	+	2	3043	c.3014C>A	c.(3013-3015)CCC>CAC	p.P1005H	C9orf131_uc003zvu.2_Missense_Mutation_p.P957H|C9orf131_uc003zvv.2_Missense_Mutation_p.P932H|C9orf131_uc003zvx.2_Missense_Mutation_p.P970H	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	1005											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			ACTGCTCTTCCCCAGCTGCTT	0.592			NA											10	38					0.000673444	0.000738198	0.008291	1	0
Unknown	0	broad.mit.edu	37	9	90749711	90749711	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:90749711G>A	uc011lti.1	-	1	190	c.161C>T	c.(160-162)CCA>CTA	p.P54L						SubName: Full=cDNA FLJ59639;												NA						TGGTGAGGGTGGGTTGTCACA	0.473			NA											6	39					0	0	0.02938	0	0
TTF1	7270	broad.mit.edu	37	9	135266209	135266209	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:135266209C>T	uc004cbl.2	-	7	2049	c.1997G>A	c.(1996-1998)CGT>CAT	p.R666H	TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Missense_Mutation_p.R151H	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase	666	Myb-like 2.				negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CCAAGCACCACGATTTCTTTC	0.368			NA											18	44					0	0	0.016522	0	0
ADAMTS13	11093	broad.mit.edu	37	9	136313805	136313805	+	Silent	SNP	T	T	C			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	T	T	-	-	T	T	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:136313805T>C	uc004cdv.3	+	22	3261	c.2817T>C	c.(2815-2817)CCT>CCC	p.P939P	ADAMTS13_uc004cdp.3_Silent_p.P166P|ADAMTS13_uc004cdt.1_Silent_p.P939P|ADAMTS13_uc004cdu.1_Silent_p.P908P|ADAMTS13_uc004cdw.3_Silent_p.P939P|ADAMTS13_uc004cdx.3_Silent_p.P908P|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Silent_p.P609P	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	939	TSP type-1 5.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CAAGCAAGCCTGGGAGCCGGC	0.642			NA											11	23					0	0	0.010729	0	0
ARHGAP6	395	broad.mit.edu	37	X	11206861	11206861	+	Missense_Mutation	SNP	C	C	T			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chrX:11206861C>T	uc004cup.1	-	4	1937	c.1064G>A	c.(1063-1065)CGG>CAG	p.R355Q	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.R355Q|ARHGAP6_uc004cum.1_Missense_Mutation_p.R152Q|ARHGAP6_uc004cun.1_Missense_Mutation_p.R175Q|ARHGAP6_uc010neb.1_Missense_Mutation_p.R177Q|ARHGAP6_uc011mif.1_Missense_Mutation_p.R152Q	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	355					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CCTCCTAGCCCGAGGAGCCGG	0.478			NA											13	61					0	0	0.020292	0	0
TKTL1	8277	broad.mit.edu	37	X	153539342	153539342	+	Missense_Mutation	SNP	G	G	A			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	G	G	-	-	G	G	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chrX:153539342G>A	uc004fkg.2	+	4	692	c.506G>A	c.(505-507)TGC>TAC	p.C169Y	TKTL1_uc011mzl.1_Missense_Mutation_p.C163Y|TKTL1_uc011mzm.1_Intron|TKTL1_uc004fkh.2_Missense_Mutation_p.C113Y	NM_012253	NP_036385	P51854	TKTL1_HUMAN	transketolase-like 1 isoform a	169					glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity			ovary(3)|skin(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCGAGCACTGCATAAACATC	0.507			NA											3	82					0	0	0.004672	0	0
HRNR	388697	broad.mit.edu	37	1	152188597	152188597	+	Frame_Shift_Del	DEL	C	C	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr1:152188597delC	uc001ezt.1	-	3	5584	c.5508delG	c.(5506-5508)GGGfs	p.G1836fs		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1836	20.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGAACCGGACCCATGTCGGC	0.612			NA											21	174	---	---	---	---	NA	NA	NA	NA	NA
FGD6	55785	broad.mit.edu	37	12	95486540	95486542	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	ACA	ACA	-	-	ACA	ACA	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr12:95486540_95486542delACA	uc001tdp.3	-	16	3904_3906	c.3680_3682delTGT	c.(3679-3684)ATGTGT>AGT	p.1227_1228MC>S	FGD6_uc009zsx.2_In_Frame_Del_p.360_361MC>S|FGD6_uc001tdq.1_In_Frame_Del_p.263_264MC>S	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1227_1228	FYVE-type.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						CAGATCATACACATTGTGGCTCT	0.488			NA											17	43	---	---	---	---	NA	NA	NA	NA	NA
EDC4	23644	broad.mit.edu	37	16	67913767	67913769	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	CAG	CAG	-	-	CAG	CAG	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr16:67913767_67913769delCAG	uc002eur.2	+	16	2002_2004	c.1836_1838delCAG	c.(1834-1839)CCCAGC>CCC	p.S617del	EDC4_uc010cer.2_In_Frame_Del_p.S236del|EDC4_uc010vkg.1_In_Frame_Del_p.S549del|EDC4_uc002eus.2_In_Frame_Del_p.S347del|EDC4_uc002eut.1_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	617	Ser-rich.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTGCCTCTCCcagcagcagcagc	0.453			NA											7	95	---	---	---	---	NA	NA	NA	NA	NA
SLC26A11	284129	broad.mit.edu	37	17	78201649	78201651	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	TGC	TGC	-	-	TGC	TGC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr17:78201649_78201651delTGC	uc002jyb.1	+	7	895_897	c.626_628delTGC	c.(625-630)ATGCTG>ATG	p.L213del	SLC26A11_uc002jyc.1_In_Frame_Del_p.L213del|SLC26A11_uc002jyd.1_In_Frame_Del_p.L213del|SLC26A11_uc010dhv.1_In_Frame_Del_p.L213del	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11	213	Helical; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGTCTGCATGCTGCTGCTGCT	0.675			NA											7	305	---	---	---	---	NA	NA	NA	NA	NA
SETD2	29072	broad.mit.edu	37	3	47164506	47164507	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	TC	TC	-	-	TC	TC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr3:47164506_47164507delTC	uc003cqs.2	-	3	1672_1673	c.1619_1620delGA	c.(1618-1620)CGAfs	p.R540fs	SETD2_uc003cqv.2_Frame_Shift_Del_p.R529fs	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	540					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATGACCCTCGTCGGAATCCCAG	0.356			NA	N|F|S|Mis		clear cell renal carcinoma								102	62	---	---	---	---	NA	NA	NA	NA	NA
C7orf16	10842	broad.mit.edu	37	7	31735179	31735179	+	Frame_Shift_Del	DEL	A	A	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:31735179delA	uc003tcl.2	+	3	337	c.179delA	c.(178-180)CAAfs	p.Q60fs	C7orf16_uc011kaf.1_Intron	NM_006658	NP_006649	O96001	GSUB_HUMAN	G-substrate isoform 1	60					behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction				ovary(2)|central_nervous_system(1)	3			GBM - Glioblastoma multiforme(11;0.216)			GAGTCAGACCAAAAAAAACCA	0.438			NA											8	357	---	---	---	---	NA	NA	NA	NA	NA
EGFR	1956	broad.mit.edu	37	7	55241679	55241681	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	AAC	AAC	-	-	AAC	AAC	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:55241679_55241681delAAC	uc003tqk.2	+	18	2373_2375	c.2127_2129delAAC	c.(2125-2130)GAAACT>GAT	p.709_710ET>D	EGFR_uc010kzg.1_In_Frame_Del_p.664_665ET>D|EGFR_uc011kco.1_In_Frame_Del_p.656_657ET>D	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	709_710	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.E709K(17)|p.E709A(11)|p.E709G(7)|p.E709V(5)|p.E709_T710>D(5)|p.E709H(2)|p.E709_T710>G(1)|p.E709_T710>A(1)|p.E709fs*1(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCTTGAAGGAAACTGAATTCAAA	0.567			8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			95	79	---	---	---	---	NA	NA	NA	NA	NA
SRRM3	222183	broad.mit.edu	37	7	75915108	75915108	+	Frame_Shift_Del	DEL	C	C	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:75915108delC	uc010ldi.2	+	16	2119	c.1910delC	c.(1909-1911)ACCfs	p.T637fs	SRRM3_uc003uet.1_Frame_Shift_Del_p.T93fs	NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0						CCCTCGAGGACCCCCAGTCCC	0.577			NA											2	4	---	---	---	---	NA	NA	NA	NA	NA
DTX2	113878	broad.mit.edu	37	7	76112249	76112249	+	Frame_Shift_Del	DEL	A	A	-	rs147779783	byFrequency	TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	A	A	-	-	A	A	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr7:76112249delA	uc003uff.3	+	5	1249	c.693delA	c.(691-693)CCAfs	p.P231fs	DTX2_uc011kgk.1_Frame_Shift_Del_p.P140fs|DTX2_uc003ufg.3_Frame_Shift_Del_p.P231fs|DTX2_uc003ufh.3_Frame_Shift_Del_p.P231fs|DTX2_uc003ufj.3_Frame_Shift_Del_p.P231fs	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a	231					Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						AGCACCCCCCACACAGGACCG	0.657			NA											10	558	---	---	---	---	NA	NA	NA	NA	NA
TSNARE1	203062	broad.mit.edu	37	8	143310866	143310868	+	In_Frame_Del	DEL	GAT	GAT	-	rs142964918		TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	GAT	GAT	-	-	GAT	GAT	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr8:143310866_143310868delGAT	uc003ywk.2	-	13	1637_1639	c.1519_1521delATC	c.(1519-1521)ATCdel	p.I507del	TSNARE1_uc011lju.1_In_Frame_Del_p.I506del|TSNARE1_uc003ywj.2_In_Frame_Del_p.I508del	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	507	Poly-Ile.|Helical; (Potential).				vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CAGAGGTGGCGATGATGATGATG	0.414			NA											7	139	---	---	---	---	NA	NA	NA	NA	NA
TDRD7	23424	broad.mit.edu	37	9	100190916	100190916	+	Frame_Shift_Del	DEL	C	C	-			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	C	C	-	-	C	C	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chr9:100190916delC	uc004axj.2	+	2	394	c.169delC	c.(169-171)CCAfs	p.P57fs	TDRD7_uc011lux.1_Intron	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	57	Lotus/OST-HTH 1.				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				GAGAAGTGTGCCAGCAGTGGT	0.473			NA											22	73	---	---	---	---	NA	NA	NA	NA	NA
MAGEC1	9947	broad.mit.edu	37	X	140994939	140994940	+	In_Frame_Ins	INS	-	-	CCT			TCGA-69-7760-01A-11D-2167-08	TCGA-69-7760-10A-01D-2167-08	-	-	-	-	-	-	Unknown	Untested	Somatic	Unspecified	WXS	none	NA	NA	Illumina HiSeq	719ff71f-ec25-4f7a-9c83-b85faf121efc	7fc52bed-2a79-47f5-94db-6310e7fd3814	g.chrX:140994939_140994940insCCT	uc004fbt.2	+	4	2035_2036	c.1749_1750insCCT	c.(1747-1752)insCCT	p.584_585insP	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	584_585							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTCAGAGCCCTCAGGGGGA	0.584			NA								HNSCC(15;0.026)			8	637	---	---	---	---	NA	NA	NA	NA	NA
