#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCF7L2	6934	hgsc.bcm.edu	37	10	114901049	114901050	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr10:114901049_114901050insA	ENST00000355995.4	+	6	1166_1167	c.659_660insA	c.(658-663)ttaccafs	p.P221fs	TCF7L2_ENST00000534894.1_Frame_Shift_Ins_p.P221fs|TCF7L2_ENST00000543371.1_Frame_Shift_Ins_p.P221fs|TCF7L2_ENST00000369397.4_Frame_Shift_Ins_p.P198fs|TCF7L2_ENST00000536810.1_Frame_Shift_Ins_p.P221fs|TCF7L2_ENST00000352065.5_Frame_Shift_Ins_p.P198fs|TCF7L2_ENST00000369389.1_5'Flank|TCF7L2_ENST00000545257.1_Frame_Shift_Ins_p.P221fs|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000349937.2_Frame_Shift_Ins_p.P221fs|TCF7L2_ENST00000355717.4_Frame_Shift_Ins_p.P245fs|TCF7L2_ENST00000538897.1_Frame_Shift_Ins_p.P221fs|TCF7L2_ENST00000369395.1_Frame_Shift_Ins_p.P246fs			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	221	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P221fs*107(1)|p.P198fs*107(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CCTCCACACTTACCAGCCGACG	0.589			T	VTI1A	colorectal																																p.L197fs			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.590_591insA	10						.																																			114891040	SO:0001589	frameshift_variant	6934	exon5			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.660dupA	10.37:g.114901050_114901050dupA	ENSP00000348274:p.Pro221fs		114891039	NM_001198528	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Frame_Shift_Ins	INS	ENST00000355995.4	37																																																																																					0.589	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
C10orf120	399814	hgsc.bcm.edu	37	10	124459193	124459193	+	Silent	SNP	A	A	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr10:124459193A>T	ENST00000329446.4	-	1	145	c.114T>A	c.(112-114)tcT>tcA	p.S38S		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	38								p.S38S(1)		endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				CCTGAAAGGAAGAGTTGGTAT	0.443																																					p.S38S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T114A	10						.						126.0	113.0	117.0					10																	124459193		2203	4300	6503	124449183	SO:0001819	synonymous_variant	399814	exon1				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.114T>A	10.37:g.124459193A>T			124449183	NM_001010912	B2RU17	Silent	SNP	ENST00000329446.4	37	CCDS31302.1	.	.	.	.	.	.	.	.	.	.	A	4.833	0.154868	0.09236	.	.	ENSG00000183559	ENST00000432000	.	.	.	4.29	-0.95	0.10372	.	.	.	.	.	T	0.30947	0.0781	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30650	-0.9971	4	.	.	.	-0.0053	7.499	0.27507	0.5942:0.0:0.4058:0.0	.	.	.	.	H	31	.	.	L	-	2	0	C10orf120	124449183	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.401000	0.07232	-0.268000	0.09312	-0.290000	0.09829	CTT		0.443	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050803.1	NM_001010912	
USP28	57646	hgsc.bcm.edu	37	11	113674554	113674554	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:113674554G>A	ENST00000003302.4	-	22	2772	c.2704C>T	c.(2704-2706)Ctc>Ttc	p.L902F	USP28_ENST00000545540.1_Missense_Mutation_p.L745F|USP28_ENST00000544967.1_Missense_Mutation_p.L578F|USP28_ENST00000260188.5_Missense_Mutation_p.L870F	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	902					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L902F(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CCTGTTAGGAGATACACAGAC	0.353																																					p.L902F	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2704T	11						.						103.0	102.0	102.0					11																	113674554		2201	4296	6497	113179764	SO:0001583	missense	57646	exon22			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2704C>T	11.37:g.113674554G>A	ENSP00000003302:p.Leu902Phe		113179764	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815807	0.90790	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	T;T;T;T	0.58210	0.86;0.94;0.35;0.94	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.69378	0.3104	L	0.47016	1.485	0.80722	D	1	D;D;D	0.89917	1.0;0.974;1.0	D;P;D	0.91635	0.998;0.677;0.999	T	0.69281	-0.5186	10	0.72032	D	0.01	-15.1787	20.2617	0.98447	0.0:0.0:1.0:0.0	.	745;902;578	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	F	902;870;578;745	ENSP00000003302:L902F;ENSP00000260188:L870F;ENSP00000442431:L578F;ENSP00000444991:L745F	ENSP00000003302:L902F	L	-	1	0	USP28	113179764	1.000000	0.71417	0.962000	0.40283	0.982000	0.71751	7.400000	0.79949	2.793000	0.96121	0.655000	0.94253	CTC		0.353	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
CXCR5	643	hgsc.bcm.edu	37	11	118764840	118764840	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:118764840A>T	ENST00000292174.4	+	2	763	c.587A>T	c.(586-588)aAc>aTc	p.N196I	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	196					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)	p.N196I(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		GGCCATCACAACAACTCCCTG	0.567																																					p.N151I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A452T	11						.						75.0	62.0	67.0					11																	118764840		2200	4295	6495	118270050	SO:0001583	missense	643	exon1			X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.587A>T	11.37:g.118764840A>T	ENSP00000292174:p.Asn196Ile		118270050	NM_032966	Q14811	Missense_Mutation	SNP	ENST00000292174.4	37	CCDS8402.1	.	.	.	.	.	.	.	.	.	.	A	11.17	1.559880	0.27827	.	.	ENSG00000160683	ENST00000292174	T	0.72615	-0.67	3.96	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.513580	0.17725	U	0.164100	T	0.69106	0.3074	L	0.29908	0.895	0.43924	D	0.996577	D	0.71674	0.998	D	0.68943	0.961	T	0.63625	-0.6595	10	0.18710	T	0.47	.	6.153	0.20322	0.8383:0.0:0.1617:0.0	.	196	P32302	CXCR5_HUMAN	I	196	ENSP00000292174:N196I	ENSP00000292174:N196I	N	+	2	0	CXCR5	118270050	0.626000	0.27120	0.731000	0.30826	0.181000	0.23173	4.114000	0.57858	1.649000	0.50652	0.260000	0.18958	AAC		0.567	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389309.1	NM_001716	
MRGPRX2	117194	hgsc.bcm.edu	37	11	19076997	19076997	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:19076997C>T	ENST00000329773.2	-	2	1040	c.953G>A	c.(952-954)cGt>cAt	p.R318H		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	318					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)	p.R318H(1)		NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGTGCCCTGACGGAAGCATCC	0.557																																					p.R318H	GBM(198;1966 2199 4849 37227 49954)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G953A	11						.						64.0	65.0	65.0					11																	19076997		2199	4293	6492	19033573	SO:0001583	missense	117194	exon2				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.953G>A	11.37:g.19076997C>T	ENSP00000333800:p.Arg318His		19033573	NM_054030	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	ENST00000329773.2	37	CCDS7847.1	.	.	.	.	.	.	.	.	.	.	.	11.30	1.598442	0.28445	.	.	ENSG00000183695	ENST00000329773	T	0.06218	3.33	4.71	2.81	0.32909	.	1.118960	0.06776	N	0.784366	T	0.05502	0.0145	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38001	-0.9681	10	0.49607	T	0.09	.	7.7248	0.28753	0.0:0.19:0.6313:0.1787	.	318	Q96LB1	MRGX2_HUMAN	H	318	ENSP00000333800:R318H	ENSP00000333800:R318H	R	-	2	0	MRGPRX2	19033573	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.732000	0.04904	0.882000	0.36016	-0.171000	0.13296	CGT		0.557	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387819.1	NM_054030	
E2F8	79733	hgsc.bcm.edu	37	11	19251430	19251430	+	Silent	SNP	C	C	T	rs140189421	byFrequency	TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:19251430C>T	ENST00000527884.1	-	10	1696	c.1464G>A	c.(1462-1464)ccG>ccA	p.P488P	RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Silent_p.P488P	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	488					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P488P(1)		breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGATGAGGGACGGTGCTGTCA	0.592													C|||	5	0.000998403	0.0	0.0014	5008	,	,		16089	0.0		0.003	False		,,,				2504	0.001				p.P488P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1464A	11						.	C		4,4394	8.1+/-20.4	0,4,2195	123.0	131.0	128.0		1464	-5.9	0.0	11	dbSNP_134	128	17,8569	13.3+/-46.6	0,17,4276	no	coding-synonymous	E2F8	NM_024680.2		0,21,6471	TT,TC,CC		0.198,0.091,0.1617		488/868	19251430	21,12963	2199	4293	6492	19208006	SO:0001819	synonymous_variant	79733	exon10				CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.1464G>A	11.37:g.19251430C>T			19208006	NM_024680	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Silent	SNP	ENST00000527884.1	37	CCDS7849.1																																																																																				0.592	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387830.1	NM_024680	
WT1	7490	hgsc.bcm.edu	37	11	32421575	32421575	+	Silent	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:32421575G>A	ENST00000379079.2	-	6	654	c.381C>T	c.(379-381)taC>taT	p.Y127Y	WT1_ENST00000448076.3_Silent_p.Y339Y|WT1_ENST00000332351.3_Silent_p.Y339Y|WT1_ENST00000530998.1_Silent_p.Y110Y	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	271					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E272fs*5(1)|p.Y271Y(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TATCGCTCTCGTACCCTGTGC	0.522			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.Y127Y		yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	.	2	Substitution - coding silent(1)|Insertion - Frameshift(1)	large_intestine(1)|kidney(1)	c.C381T	11	GRCh37	CM952245	WT1	M		.						249.0	210.0	223.0					11																	32421575		2202	4299	6501	32378151	SO:0001819	synonymous_variant	7490	exon6	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.381C>T	11.37:g.32421575G>A			32378151	NM_001198551	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000379079.2	37	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	G	7.368	0.626271	0.14257	.	.	ENSG00000184937	ENST00000527882	.	.	.	5.98	-6.17	0.02091	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2127	0.86935	0.6937:0.0:0.3063:0.0	.	.	.	.	X	30	.	.	R	-	1	2	WT1	32378151	0.965000	0.33210	0.790000	0.31976	0.796000	0.44982	0.107000	0.15375	-1.253000	0.02488	0.650000	0.86243	CGA		0.522	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
MS4A5	64232	hgsc.bcm.edu	37	11	60197173	60197173	+	Missense_Mutation	SNP	C	C	T	rs34799130	byFrequency	TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:60197173C>T	ENST00000300190.2	+	1	112	c.26C>T	c.(25-27)cCg>cTg	p.P9L	MS4A5_ENST00000534071.1_3'UTR	NM_023945.2	NP_076434.2	Q9H3V2	MS4A5_HUMAN	membrane-spanning 4-domains, subfamily A, member 5	9						integral component of membrane (GO:0016021)		p.P9L(1)		large_intestine(7)|lung(7)|ovary(1)|skin(1)	16						GCACACAGTCCGGTGTTTCTG	0.423													C|||	74	0.0147764	0.0295	0.0043	5008	,	,		19704	0.002		0.0	False		,,,				2504	0.0307				p.P9L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C26T	11						.	C	LEU/PRO	116,4290	89.2+/-127.9	2,112,2089	117.0	117.0	117.0		26	4.7	0.2	11	dbSNP_126	117	1,8599		0,1,4299	yes	missense	MS4A5	NM_023945.2	98	2,113,6388	TT,TC,CC		0.0116,2.6328,0.8996	probably-damaging	9/201	60197173	117,12889	2203	4300	6503	59953749	SO:0001583	missense	64232	exon1			AB013103	CCDS7987.1	11q12	2008-03-25			ENSG00000166930	ENSG00000166930			13374	protein-coding gene	gene with protein product		606499				11245982, 11401424	Standard	NM_023945		Approved	CD20L2	uc001npo.3	Q9H3V2	OTTHUMG00000167613	ENST00000300190.2:c.26C>T	11.37:g.60197173C>T	ENSP00000300190:p.Pro9Leu		59953749	NM_023945	Q9BZH1	Missense_Mutation	SNP	ENST00000300190.2	37	CCDS7987.1	12	0.005494505494505495	9	0.018292682926829267	3	0.008287292817679558	0	0.0	0	0.0	C	22.0	4.236109	0.79800	0.026328	1.16E-4	ENSG00000166930	ENST00000300190	T	0.13307	2.6	4.66	4.66	0.58398	.	0.773994	0.12613	N	0.453732	T	0.10337	0.0253	L	0.36672	1.1	0.20489	N	0.999891	D	0.89917	1.0	D	0.70227	0.968	T	0.03008	-1.1083	10	0.66056	D	0.02	-11.3906	13.2445	0.60016	0.0:1.0:0.0:0.0	rs34799130	9	Q9H3V2	MS4A5_HUMAN	L	9	ENSP00000300190:P9L	ENSP00000300190:P9L	P	+	2	0	MS4A5	59953749	0.119000	0.22226	0.158000	0.22627	0.662000	0.39071	3.127000	0.50484	2.578000	0.87016	0.467000	0.42956	CCG		0.423	MS4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395392.1		
OR8B4	283162	hgsc.bcm.edu	37	11	124294082	124294082	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr11:124294082G>T	ENST00000356130.3	-	1	707	c.686C>A	c.(685-687)tCt>tAt	p.S229Y		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S229Y(1)		endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GCCCTCTGCAGAAGGAATACA	0.438																																					p.S229Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C686A	11						.						78.0	72.0	74.0					11																	124294082		2201	4299	6500	123799292	SO:0001583	missense	283162	exon1			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.686C>A	11.37:g.124294082G>T	ENSP00000348449:p.Ser229Tyr		123799292	NM_001005196	B2RNF8|Q6IFQ7	Missense_Mutation	SNP	ENST00000356130.3	37	CCDS31710.1	.	.	.	.	.	.	.	.	.	.	g	15.71	2.913426	0.52439	.	.	ENSG00000198657	ENST00000356130	T	0.00337	8.05	4.14	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000088	T	0.01421	0.0046	H	0.96015	3.755	0.29995	N	0.816578	D	0.89917	1.0	D	0.79108	0.992	T	0.02925	-1.1093	10	0.72032	D	0.01	.	17.3176	0.87228	0.0:0.0:1.0:0.0	.	229	Q96RC9	OR8B4_HUMAN	Y	229	ENSP00000348449:S229Y	ENSP00000348449:S229Y	S	-	2	0	OR8B4	123799292	0.055000	0.20627	0.995000	0.50966	0.901000	0.52897	2.163000	0.42377	2.610000	0.88304	0.655000	0.94253	TCT		0.438	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
CCDC91	55297	hgsc.bcm.edu	37	12	28459710	28459710	+	Silent	SNP	A	A	G			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr12:28459710A>G	ENST00000545336.1	+	8	722	c.303A>G	c.(301-303)tcA>tcG	p.S101S	CCDC91_ENST00000306172.5_Silent_p.S71S|CCDC91_ENST00000539107.1_Silent_p.S101S|CCDC91_ENST00000381256.1_Silent_p.S101S|CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000381259.1_Silent_p.S101S			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	101					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S101S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					TGGATATCTCACTTTTTCCAT	0.348																																					p.S101S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A303G	12						.						85.0	88.0	87.0					12																	28459710		2203	4299	6502	28350977	SO:0001819	synonymous_variant	55297	exon4			AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.303A>G	12.37:g.28459710A>G			28350977	NM_018318	B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Silent	SNP	ENST00000545336.1	37	CCDS8716.1																																																																																				0.348	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402447.1	NM_018318	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45693604	45693604	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr14:45693604G>A	ENST00000310806.4	-	11	2644	c.2186C>T	c.(2185-2187)tCt>tTt	p.S729F		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	729					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.S729F(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TTCAAGGTTAGATATTTTTAT	0.318																																					p.S729F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2186T	14						.						68.0	70.0	69.0					14																	45693604		2203	4300	6503	44763354	SO:0001583	missense	55320	exon11			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2186C>T	14.37:g.45693604G>A	ENSP00000309790:p.Ser729Phe		44763354	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	ENST00000310806.4	37	CCDS9684.1	.	.	.	.	.	.	.	.	.	.	G	2.872	-0.233674	0.05983	.	.	ENSG00000129534	ENST00000310806	T	0.17528	2.27	5.72	2.88	0.33553	.	0.817444	0.11446	N	0.563318	T	0.14700	0.0355	L	0.36672	1.1	0.09310	N	1	B	0.29805	0.257	B	0.26969	0.075	T	0.17501	-1.0367	10	0.56958	D	0.05	-0.015	10.609	0.45410	0.0735:0.2515:0.675:0.0	.	729	Q6P0N0	M18BP_HUMAN	F	729	ENSP00000309790:S729F	ENSP00000309790:S729F	S	-	2	0	MIS18BP1	44763354	0.138000	0.22547	0.001000	0.08648	0.009000	0.06853	1.657000	0.37366	0.140000	0.18849	-1.872000	0.00552	TCT		0.318	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11725301	11725301	+	Silent	SNP	A	A	G			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr17:11725301A>G	ENST00000262442.4	+	46	8840	c.8772A>G	c.(8770-8772)gaA>gaG	p.E2924E	DNAH9_ENST00000454412.2_Silent_p.E2924E	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2924	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.E2924E(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGAGGAATGAAGTCAAGAGCC	0.463																																					p.E2924E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A8772G	17						.						84.0	77.0	79.0					17																	11725301		2203	4300	6503	11666026	SO:0001819	synonymous_variant	1770	exon46			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.8772A>G	17.37:g.11725301A>G			11666026	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																				0.463	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
ANKRD40	91369	hgsc.bcm.edu	37	17	48777056	48777056	+	Missense_Mutation	SNP	G	G	A	rs185905249		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr17:48777056G>A	ENST00000285243.6	-	3	751	c.482C>T	c.(481-483)cCt>cTt	p.P161L	Y_RNA_ENST00000364470.1_RNA	NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	161	Pro-rich.							p.P161L(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			AAGCAATGGAGGTGAGCCATC	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		16765	0.001		0.0	False		,,,				2504	0.0				p.P161L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C482T	17						.						59.0	67.0	65.0					17																	48777056		2203	4300	6503	46132055	SO:0001583	missense	91369	exon3			BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.482C>T	17.37:g.48777056G>A	ENSP00000285243:p.Pro161Leu		46132055	NM_052855	Q96E32	Missense_Mutation	SNP	ENST00000285243.6	37	CCDS11572.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	4.710	0.131969	0.08981	.	.	ENSG00000154945	ENST00000285243	T	0.23950	1.88	4.54	2.55	0.30701	.	0.444056	0.24105	N	0.041517	T	0.11024	0.0269	N	0.12182	0.205	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.12142	-1.0559	10	0.35671	T	0.21	-1.3393	2.6978	0.05140	0.3325:0.0:0.4648:0.2028	.	161	Q6AI12	ANR40_HUMAN	L	161	ENSP00000285243:P161L	ENSP00000285243:P161L	P	-	2	0	ANKRD40	46132055	0.011000	0.17503	0.454000	0.27019	0.236000	0.25371	1.052000	0.30429	1.263000	0.44181	0.650000	0.86243	CCT		0.592	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368201.2	NM_052855	
SCPEP1	59342	hgsc.bcm.edu	37	17	55058472	55058472	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr17:55058472G>A	ENST00000262288.3	+	2	161	c.106G>A	c.(106-108)Ggc>Agc	p.G36S	SCPEP1_ENST00000571898.1_3'UTR|RP5-1107A17.4_ENST00000572877.1_RNA	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1	36					negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)	p.G36S(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					CACAGAGGAGGGCAAGGAAGT	0.488																																					p.G36S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G106A	17						.						122.0	100.0	107.0					17																	55058472		2203	4300	6503	52413471	SO:0001583	missense	59342	exon2			AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.106G>A	17.37:g.55058472G>A	ENSP00000262288:p.Gly36Ser		52413471	NM_021626	Q96A94|Q9H3F0	Missense_Mutation	SNP	ENST00000262288.3	37	CCDS11593.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387829	0.61956	.	.	ENSG00000121064	ENST00000262288	T	0.43688	0.94	5.84	4.87	0.63330	.	0.444283	0.25332	N	0.031426	T	0.33702	0.0872	L	0.51853	1.615	0.34270	D	0.680921	B	0.29378	0.243	B	0.27262	0.078	T	0.43196	-0.9406	10	0.21014	T	0.42	-25.108	8.9092	0.35543	0.08:0.191:0.729:0.0	.	36	Q9HB40	RISC_HUMAN	S	36	ENSP00000262288:G36S	ENSP00000262288:G36S	G	+	1	0	SCPEP1	52413471	0.980000	0.34600	0.957000	0.39632	0.366000	0.29705	1.765000	0.38481	1.482000	0.48325	0.655000	0.94253	GGC		0.488	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440622.1	NM_021626	
RPE65	6121	hgsc.bcm.edu	37	1	68910558	68910558	+	Missense_Mutation	SNP	C	C	T	rs61752870		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr1:68910558C>T	ENST00000262340.5	-	4	307	c.254G>A	c.(253-255)cGc>cAc	p.R85H		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	85			R -> H (in RP20; uncertain pathological significance). {ECO:0000269|PubMed:11095629}.		cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)	p.R85H(1)		central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						AGCATCAGTGCGGATGAACCT	0.458																																					p.R85H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G254A	1	GRCh37	CM005348	RPE65	M	rs61752870	.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	72.0	64.0	67.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	254	5.0	1.0	1	dbSNP_129	67	0,8600		0,0,4300	no	missense	RPE65	NM_000329.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	85/534	68910558	1,13005	2203	4300	6503	68683146	SO:0001583	missense	6121	exon4			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.254G>A	1.37:g.68910558C>T	ENSP00000262340:p.Arg85His		68683146	NM_000329	A8K1L0|Q5T9U3	Missense_Mutation	SNP	ENST00000262340.5	37	CCDS643.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130505	0.77549	2.27E-4	0.0	ENSG00000116745	ENST00000262340	D	0.95588	-3.75	5.03	5.03	0.67393	.	0.212817	0.46758	D	0.000264	D	0.92662	0.7668	M	0.79805	2.47	0.58432	D	0.999999	P	0.46952	0.887	B	0.31495	0.131	D	0.94072	0.7336	10	0.59425	D	0.04	-0.0031	18.5413	0.91029	0.0:1.0:0.0:0.0	rs61752870	85	Q16518	RPE65_HUMAN	H	85	ENSP00000262340:R85H	ENSP00000262340:R85H	R	-	2	0	RPE65	68683146	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.645000	0.54389	2.615000	0.88500	0.655000	0.94253	CGC		0.458	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
DPYD	1806	hgsc.bcm.edu	37	1	97544573	97544573	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr1:97544573G>A	ENST00000370192.3	-	23	3137	c.3037C>T	c.(3037-3039)Cca>Tca	p.P1013S		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	1013					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.P1013S(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CCTCTCTTTGGTTCATAAGGT	0.443																																					p.P1013S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3037T	1						.						238.0	220.0	226.0					1																	97544573		2203	4300	6503	97317161	SO:0001583	missense	1806	exon23			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.3037C>T	1.37:g.97544573G>A	ENSP00000359211:p.Pro1013Ser		97317161	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638102	0.87760	.	.	ENSG00000188641	ENST00000370192	D	0.91792	-2.91	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.88894	0.6561	M	0.68317	2.08	0.80722	D	1	P	0.38048	0.616	B	0.34452	0.183	D	0.89670	0.3883	10	0.52906	T	0.07	-9.9722	19.6731	0.95918	0.0:0.0:1.0:0.0	.	1013	Q12882	DPYD_HUMAN	S	1013	ENSP00000359211:P1013S	ENSP00000359211:P1013S	P	-	1	0	DPYD	97317161	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.813000	0.99286	2.735000	0.93741	0.561000	0.74099	CCA		0.443	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
PRG4	10216	hgsc.bcm.edu	37	1	186276284	186276286	+	In_Frame_Del	DEL	CTC	CTC	-	rs200031345|rs145095882|rs143141440	byFrequency	TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	CTC	CTC	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr1:186276284_186276286delCTC	ENST00000445192.2	+	7	1478_1480	c.1433_1435delCTC	c.(1432-1437)actccc>acc	p.P479del	PRG4_ENST00000367483.4_In_Frame_Del_p.P438del|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_In_Frame_Del_p.P386del|PRG4_ENST00000367486.3_In_Frame_Del_p.P436del	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	479	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.P479delP(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GCACCCACCACTCCCAAAGAGCC	0.65																																					p.385_386del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.1154_1156del	1						.		,,,	348,3912		14,320,1796					,,,	-1.4	0.0			89	1023,7215		71,881,3167	no	coding,coding,coding,coding	PRG4	NM_005807.3,NM_001127710.1,NM_001127709.1,NM_001127708.1	,,,	85,1201,4963	A1A1,A1R,RR		12.4181,8.169,10.9698	,,,	,,,		1371,11127				184542909	SO:0001651	inframe_deletion	10216	exon5			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1433_1435delCTC	1.37:g.186276284_186276286delCTC	ENSP00000399679:p.Pro479del		184542907	NM_001127709	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	In_Frame_Del	DEL	ENST00000445192.2	37	CCDS1369.1																																																																																				0.650	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
C4BPA	722	hgsc.bcm.edu	37	1	207287484	207287484	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr1:207287484C>T	ENST00000367070.3	+	3	376	c.182C>T	c.(181-183)cCg>cTg	p.P61L		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	61	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)	p.P61L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						TTTGCTGCCCCGATGGATATT	0.468																																					p.P61L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C182T	1						.						196.0	178.0	184.0					1																	207287484		2203	4300	6503	205354107	SO:0001583	missense	722	exon3			M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.182C>T	1.37:g.207287484C>T	ENSP00000356037:p.Pro61Leu		205354107	NM_000715	Q5VVQ8	Missense_Mutation	SNP	ENST00000367070.3	37	CCDS1477.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137057	0.56936	.	.	ENSG00000123838	ENST00000367070;ENST00000421786	T;T	0.64803	-0.12;-0.12	5.25	3.39	0.38822	Complement control module (2);Sushi/SCR/CCP (3);	0.244990	0.29376	N	0.012321	T	0.57814	0.2079	L	0.41573	1.285	0.09310	N	0.999997	D	0.60575	0.988	P	0.55455	0.776	T	0.48647	-0.9017	10	0.08599	T	0.76	.	8.3139	0.32088	0.0:0.8217:0.0:0.1783	.	61	P04003	C4BPA_HUMAN	L	61	ENSP00000356037:P61L;ENSP00000403386:P61L	ENSP00000356037:P61L	P	+	2	0	C4BPA	205354107	0.000000	0.05858	0.008000	0.14137	0.001000	0.01503	0.309000	0.19332	0.911000	0.36747	-0.150000	0.13652	CCG		0.468	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088089.3		
HMGXB4	10042	hgsc.bcm.edu	37	22	35661430	35661430	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr22:35661430C>T	ENST00000216106.5	+	5	1177	c.1049C>T	c.(1048-1050)gCc>gTc	p.A350V	HMGXB4_ENST00000444518.2_Missense_Mutation_p.A241V	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	350					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)	p.A350V(1)		breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGACTTTCTGCCGTGCCAGTG	0.512																																					p.A350V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1049T	22						.						95.0	97.0	96.0					22																	35661430		2203	4300	6503	33991430	SO:0001583	missense	10042	exon5			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1049C>T	22.37:g.35661430C>T	ENSP00000216106:p.Ala350Val		33991430	NM_001003681	O75672|O75673|Q9UMT5	Missense_Mutation	SNP	ENST00000216106.5	37	CCDS33641.1	.	.	.	.	.	.	.	.	.	.	C	2.139	-0.397253	0.04899	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.46063	0.88;2.2;0.89;2.2	5.22	1.98	0.26296	.	1.792470	0.01925	N	0.040780	T	0.28001	0.0690	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.25882	-1.0119	10	0.46703	T	0.11	4.1168	9.2195	0.37368	0.0:0.7812:0.0:0.2188	.	350	Q9UGU5	HMGX4_HUMAN	V	241;241;241;350	ENSP00000401658:A241V;ENSP00000398302:A241V;ENSP00000415500:A241V;ENSP00000216106:A350V	ENSP00000216106:A350V	A	+	2	0	HMGXB4	33991430	0.009000	0.17119	0.000000	0.03702	0.095000	0.18619	2.436000	0.44819	0.347000	0.23924	0.650000	0.86243	GCC		0.512	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
SIDT1	54847	hgsc.bcm.edu	37	3	113329934	113329934	+	Silent	SNP	C	C	T	rs145430934	byFrequency	TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr3:113329934C>T	ENST00000264852.4	+	18	2526	c.1800C>T	c.(1798-1800)agC>agT	p.S600S	SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_Silent_p.S600S	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	600					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.S600S(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TCAATGCCAGCGCCTACTCTG	0.577													C|||	4	0.000798722	0.0	0.0	5008	,	,		16525	0.004		0.0	False		,,,				2504	0.0				p.S600S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1800T	3						.	C		1,4405	2.1+/-5.4	0,1,2202	187.0	160.0	169.0		1800	-2.5	1.0	3	dbSNP_134	169	0,8600		0,0,4300	no	coding-synonymous	SIDT1	NM_017699.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		600/828	113329934	1,13005	2203	4300	6503	114812624	SO:0001819	synonymous_variant	54847	exon18			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1800C>T	3.37:g.113329934C>T			114812624	NM_017699	Q17RR4	Silent	SNP	ENST00000264852.4	37	CCDS2974.1																																																																																				0.577	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
IGSF11	152404	hgsc.bcm.edu	37	3	118624539	118624539	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr3:118624539G>A	ENST00000393775.2	-	5	912	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W	IGSF11_ENST00000489689.1_Missense_Mutation_p.R203W|IGSF11_ENST00000441144.2_Missense_Mutation_p.R202W|IGSF11_ENST00000491903.1_Missense_Mutation_p.R203W|IGSF11_ENST00000354673.2_Missense_Mutation_p.R202W|IGSF11_ENST00000425327.2_Missense_Mutation_p.R202W	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	203	Ig-like C2-type.				cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R202W(2)|p.R203W(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CTGATGTTCCGGATGGTGACT	0.473																																					p.R202W												.	.	3	Substitution - Missense(3)	breast(2)|large_intestine(1)	c.C604T	3						.						108.0	104.0	105.0					3																	118624539		2203	4300	6503	120107229	SO:0001583	missense	152404	exon7			AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.607C>T	3.37:g.118624539G>A	ENSP00000377370:p.Arg203Trp		120107229	NM_152538	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	ENST00000393775.2	37	CCDS46891.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958571	0.74016	.	.	ENSG00000144847	ENST00000425327;ENST00000393775;ENST00000489689;ENST00000354673;ENST00000441144;ENST00000491903	T;T;D;T;D;T	0.84298	3.99;3.99;-1.83;3.99;-1.79;3.99	5.22	4.35	0.52113	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.158514	0.53938	N	0.000045	D	0.88451	0.6440	L	0.56199	1.76	0.44295	D	0.997164	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.71656	0.962;0.96;0.941;0.962;0.974	D	0.88339	0.2973	10	0.72032	D	0.01	.	8.1314	0.31029	0.0761:0.0:0.6718:0.252	.	203;202;202;203;203	C9JBA5;Q5DX21-3;Q5DX21-2;C9JMW0;Q5DX21	.;.;.;.;IGS11_HUMAN	W	202;203;203;202;202;203	ENSP00000406092:R202W;ENSP00000377370:R203W;ENSP00000420486:R203W;ENSP00000346700:R202W;ENSP00000401240:R202W;ENSP00000417413:R203W	ENSP00000346700:R202W	R	-	1	2	IGSF11	120107229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.290000	0.59019	1.573000	0.49748	0.655000	0.94253	CGG		0.473	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2		
GOLGB1	2804	hgsc.bcm.edu	37	3	121411009	121411009	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr3:121411009T>C	ENST00000340645.5	-	14	7312	c.7187A>G	c.(7186-7188)cAa>cGa	p.Q2396R	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Q2401R	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2396					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.Q2396R(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AATAGCTACTTGGATTGCCTC	0.423																																					p.Q2396R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A7187G	3						.						85.0	86.0	86.0					3																	121411009		2203	4300	6503	122893699	SO:0001583	missense	2804	exon14			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.7187A>G	3.37:g.121411009T>C	ENSP00000341848:p.Gln2396Arg		122893699	NM_004487	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	9.799	1.179999	0.21787	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.14144	2.53;2.53	5.9	4.7	0.59300	.	0.343560	0.25324	N	0.031487	T	0.15565	0.0375	L	0.44542	1.39	0.22982	N	0.998477	P;D;D	0.53312	0.949;0.958;0.959	P;P;B	0.53649	0.461;0.731;0.331	T	0.17684	-1.0361	10	0.16896	T	0.51	.	4.3299	0.11059	0.2141:0.0931:0.0:0.6928	.	2401;2401;2396	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	R	2396;2401	ENSP00000341848:Q2396R;ENSP00000377275:Q2401R	ENSP00000341848:Q2396R	Q	-	2	0	GOLGB1	122893699	0.001000	0.12720	1.000000	0.80357	0.790000	0.44656	0.872000	0.28037	2.254000	0.74563	0.460000	0.39030	CAA		0.423	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
ARPP21	10777	hgsc.bcm.edu	37	3	35780947	35780947	+	Missense_Mutation	SNP	G	G	A	rs151173813	byFrequency	TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr3:35780947G>A	ENST00000187397.4	+	17	2239	c.1783G>A	c.(1783-1785)Gcc>Acc	p.A595T	ARPP21_ENST00000337271.5_Missense_Mutation_p.A576T|ARPP21_ENST00000417925.1_Missense_Mutation_p.A596T|ARPP21_ENST00000444190.1_Missense_Mutation_p.A576T|ARPP21_ENST00000458225.1_Missense_Mutation_p.A596T	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	595	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.A595T(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CTATGTAATCGCCTCTACAGG	0.627													G|||	7	0.00139776	0.0	0.0029	5008	,	,		15714	0.0		0.003	False		,,,				2504	0.002				p.A595T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1783A	3						.	G	THR/ALA	3,4403	6.2+/-15.9	0,3,2200	58.0	59.0	58.0		1783	4.1	0.4	3	dbSNP_134	58	37,8563	25.7+/-73.6	0,37,4263	yes	missense	ARPP21	NM_016300.4	58	0,40,6463	AA,AG,GG		0.4302,0.0681,0.3076	benign	595/813	35780947	40,12966	2203	4300	6503	35755951	SO:0001583	missense	10777	exon17			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1783G>A	3.37:g.35780947G>A	ENSP00000187397:p.Ala595Thr		35755951	NM_016300	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	5	0.0022893772893772895	0	0.0	2	0.0055248618784530384	0	0.0	3	0.00395778364116095	G	11.71	1.719677	0.30503	6.81E-4	0.004302	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.96	4.14	0.48551	.	0.068903	0.56097	N	0.000036	T	0.19127	0.0459	L	0.31476	0.935	0.31779	N	0.631164	B;B;B;B	0.32543	0.067;0.375;0.011;0.067	B;B;B;B	0.28385	0.023;0.089;0.006;0.023	T	0.19418	-1.0306	10	0.12103	T	0.63	-7.922	10.8408	0.46715	0.1502:0.0:0.8498:0.0	.	596;118;595;576	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	T	596;576;576;595;596	ENSP00000414351:A596T;ENSP00000337792:A576T;ENSP00000405276:A576T;ENSP00000187397:A595T;ENSP00000412326:A596T	ENSP00000187397:A595T	A	+	1	0	ARPP21	35755951	1.000000	0.71417	0.406000	0.26421	0.573000	0.36030	4.374000	0.59543	1.499000	0.48617	0.655000	0.94253	GCC		0.627	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
CHCHD6	84303	hgsc.bcm.edu	37	3	126676391	126676391	+	Silent	SNP	C	C	T	rs1071658		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr3:126676391C>T	ENST00000290913.3	+	7	792	c.699C>T	c.(697-699)caC>caT	p.H233H	CHCHD6_ENST00000508789.1_Silent_p.H234H	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6	233					cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.H233H(1)		endometrium(2)|large_intestine(3)|lung(3)	8						GCGCCGCCCACAAGGTAAGGC	0.602																																					p.H233H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C699T	3						.						32.0	23.0	26.0					3																	126676391		2193	4291	6484	128159081	SO:0001819	synonymous_variant	84303	exon7			BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.699C>T	3.37:g.126676391C>T			128159081	NM_032343	D6R9U0|D6RIB4|H8Y0Y7	Silent	SNP	ENST00000290913.3	37	CCDS3041.1	.	.	.	.	.	.	.	.	.	.	C	6.701	0.497937	0.12762	.	.	ENSG00000159685	ENST00000513253	.	.	.	4.22	2.08	0.27032	.	.	.	.	.	T	0.54224	0.1845	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50857	-0.8778	4	.	.	.	-9.0088	7.1958	0.25851	0.1676:0.5365:0.2959:0.0	.	.	.	.	I	164	.	.	T	+	2	0	CHCHD6	128159081	0.995000	0.38212	0.994000	0.49952	0.667000	0.39255	0.454000	0.21827	1.914000	0.55421	0.467000	0.42956	ACA		0.602	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356432.1	NM_032343	
MTTP	4547	hgsc.bcm.edu	37	4	100532497	100532497	+	Missense_Mutation	SNP	C	C	T	rs148696330		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr4:100532497C>T	ENST00000265517.5	+	14	2079	c.1876C>T	c.(1876-1878)Cgt>Tgt	p.R626C	MTTP_ENST00000511045.1_Missense_Mutation_p.R653C|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Missense_Mutation_p.R626C			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	626	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)	p.R626C(1)|p.R626S(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	AGGTAGTCCCCGTTCGGCATC	0.443																																					p.R626C												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1876T	4						.	C	CYS/ARG	0,4406		0,0,2203	229.0	215.0	220.0		1876	4.7	0.1	4	dbSNP_134	220	1,8599	1.2+/-3.3	0,1,4299	yes	missense	MTTP	NM_000253.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	626/895	100532497	1,13005	2203	4300	6503	100751520	SO:0001583	missense	4547	exon15				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1876C>T	4.37:g.100532497C>T	ENSP00000265517:p.Arg626Cys		100751520	NM_000253	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	ENST00000265517.5	37	CCDS3651.1	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345403	0.41498	0.0	1.16E-4	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.62788	-0.0;0.01;0.01	5.62	4.7	0.59300	Lipid transport protein, N-terminal (1);	0.300723	0.38548	N	0.001652	T	0.35422	0.0931	N	0.08118	0	0.09310	N	0.999999	P;D	0.56968	0.807;0.978	B;B	0.36989	0.238;0.232	T	0.26849	-1.0091	10	0.56958	D	0.05	-29.3378	8.1716	0.31258	0.0:0.6198:0.2805:0.0997	.	653;626	E9PBP6;P55157	.;MTP_HUMAN	C	653;626;626	ENSP00000427679:R653C;ENSP00000400821:R626C;ENSP00000265517:R626C	ENSP00000265517:R626C	R	+	1	0	MTTP	100751520	0.017000	0.18338	0.062000	0.19696	0.003000	0.03518	1.337000	0.33862	1.229000	0.43630	0.655000	0.94253	CGT		0.443	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
APC	324	hgsc.bcm.edu	37	5	112173429	112173429	+	Nonsense_Mutation	SNP	C	C	G	rs137854570		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr5:112173429C>G	ENST00000457016.1	+	16	2518	c.2138C>G	c.(2137-2139)tCa>tGa	p.S713*	APC_ENST00000257430.4_Nonsense_Mutation_p.S713*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.S713*			P25054	APC_HUMAN	adenomatous polyposis coli	713	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S713*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTCATTCATTCAAAGCACAAA	0.448		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S695X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C2084G	5	GRCh37	CM910032	APC	M	rs137854570	.						109.0	100.0	103.0					5																	112173429		2202	4300	6502	112201328	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2138C>G	5.37:g.112173429C>G	ENSP00000413133:p.Ser713*		112201328	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.146713	0.97324	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.17	6.17	0.99709	.	0.058606	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.279	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	713;695;713;713;713	.	ENSP00000257430:S713X	S	+	2	0	APC	112201328	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	TCA		0.448	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ZNF608	57507	hgsc.bcm.edu	37	5	124080180	124080180	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr5:124080180T>C	ENST00000306315.5	-	1	938	c.503A>G	c.(502-504)aAt>aGt	p.N168S	ZNF608_ENST00000504926.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	168							metal ion binding (GO:0046872)	p.N168S(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCTGGTACTATTGCTGTTTGG	0.622																																					p.N168S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A503G	5						.						48.0	53.0	51.0					5																	124080180		2203	4300	6503	124108079	SO:0001583	missense	57507	exon1			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.503A>G	5.37:g.124080180T>C	ENSP00000307746:p.Asn168Ser		124108079	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.746876	0.00669	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.42131	0.98	4.76	0.788	0.18601	.	0.657055	0.14012	N	0.347362	T	0.24044	0.0582	L	0.29908	0.895	0.34397	D	0.694884	B	0.02656	0.0	B	0.06405	0.002	T	0.33854	-0.9852	10	0.07990	T	0.79	-3.4663	7.2493	0.26140	0.0:0.0741:0.2745:0.6514	.	168	Q9ULD9	ZN608_HUMAN	S	168	ENSP00000307746:N168S	ENSP00000307746:N168S	N	-	2	0	ZNF608	124108079	0.982000	0.34865	0.039000	0.18376	0.129000	0.20672	0.749000	0.26320	-0.034000	0.13713	-0.313000	0.08912	AAT		0.622	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
SEMA5A	9037	hgsc.bcm.edu	37	5	9122872	9122872	+	Silent	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr5:9122872G>A	ENST00000382496.5	-	14	2342	c.1677C>T	c.(1675-1677)gcC>gcT	p.A559A		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	559	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)	p.A559A(1)		biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						AGGATCCCACGGCGCTGCCAT	0.632																																					p.A559A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1677T	5						.						59.0	61.0	60.0					5																	9122872		2203	4300	6503	9175872	SO:0001819	synonymous_variant	9037	exon14			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1677C>T	5.37:g.9122872G>A			9175872	NM_003966	D3DTC6|O60408|Q1RLL9	Silent	SNP	ENST00000382496.5	37	CCDS3875.1																																																																																				0.632	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
AGXT2	64902	hgsc.bcm.edu	37	5	35014171	35014171	+	Silent	SNP	G	G	A	rs116605914	byFrequency	TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr5:35014171G>A	ENST00000231420.6	-	10	1217	c.1017C>T	c.(1015-1017)caC>caT	p.H339H		NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	339					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)	p.H339H(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	GCAGGACATCGTGGGTTTGGA	0.507													G|||	3	0.000599042	0.0008	0.0	5008	,	,		19243	0.0		0.002	False		,,,				2504	0.0				p.H339H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1017T	5						.	G		1,4405	2.1+/-5.4	0,1,2202	145.0	122.0	130.0		1017	-8.9	0.0	5	dbSNP_132	130	27,8573	19.2+/-60.6	0,27,4273	no	coding-synonymous	AGXT2	NM_031900.3		0,28,6475	AA,AG,GG		0.314,0.0227,0.2153		339/515	35014171	28,12978	2203	4300	6503	35049928	SO:0001819	synonymous_variant	64902	exon10			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.1017C>T	5.37:g.35014171G>A			35049928	NM_031900	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	ENST00000231420.6	37	CCDS3908.1																																																																																				0.507	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207574.2	NM_031900	
PCDHA5	56143	hgsc.bcm.edu	37	5	140202400	140202400	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr5:140202400C>T	ENST00000529859.1	+	1	1040	c.1040C>T	c.(1039-1041)cCa>cTa	p.P347L	PCDHA5_ENST00000529619.1_Missense_Mutation_p.P347L|PCDHA5_ENST00000378126.3_Missense_Mutation_p.P347L|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	347	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P347L(2)|p.P347Q(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATAATACCCCAGAGATGGCC	0.453																																					p.P347L												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.C1040T	5						.						80.0	74.0	76.0					5																	140202400		2203	4300	6503	140182584	SO:0001583	missense	56143	exon1			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1040C>T	5.37:g.140202400C>T	ENSP00000436557:p.Pro347Leu		140182584	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969672	0.74246	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	D;D;D	0.88124	-2.34;-2.34;-2.34	3.97	3.97	0.46021	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.96950	0.9004	H	0.99900	4.915	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99441	1.0938	9	0.87932	D	0	.	16.4	0.83637	0.0:1.0:0.0:0.0	.	347;347;347	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	L	347	ENSP00000433416:P347L;ENSP00000436557:P347L;ENSP00000367366:P347L	ENSP00000367366:P347L	P	+	2	0	PCDHA5	140182584	1.000000	0.71417	0.417000	0.26559	0.986000	0.74619	7.812000	0.86109	1.900000	0.55004	0.655000	0.94253	CCA		0.453	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
UNC5A	90249	hgsc.bcm.edu	37	5	176295869	176295869	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr5:176295869C>T	ENST00000329542.4	+	5	899	c.625C>T	c.(625-627)Cga>Tga	p.R209*	UNC5A_ENST00000261961.3_Nonsense_Mutation_p.R169*	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	209	Ig-like C2-type.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R209*(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTGGTGGTGCGACAGGCCCG	0.662																																					p.R209X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C625T	5						.						91.0	69.0	76.0					5																	176295869		2203	4299	6502	176228475	SO:0001587	stop_gained	90249	exon5			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.625C>T	5.37:g.176295869C>T	ENSP00000332737:p.Arg209*		176228475	NM_133369	B2RXE6|Q8TF26|Q96GP4	Nonsense_Mutation	SNP	ENST00000329542.4	37	CCDS34299.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.000354|8.000354	0.98602|0.98602	.|.	.|.	ENSG00000113763|ENSG00000113763	ENST00000509580|ENST00000329542;ENST00000261961	.|.	.|.	.|.	4.52|4.52	4.52|4.52	0.55395|0.55395	.|.	.|0.095070	.|0.45361	.|D	.|0.000370	T|.	0.26376|.	0.0644|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.27839|.	-1.0062|.	3|.	.|0.02654	.|T	.|1	-14.733|-14.733	11.3407|11.3407	0.49531|0.49531	0.3186:0.6814:0.0:0.0|0.3186:0.6814:0.0:0.0	.|.	.|.	.|.	.|.	V|X	174|209;169	.|.	.|ENSP00000261961:R169X	A|R	+|+	2|1	0|2	UNC5A|UNC5A	176228475|176228475	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.176000|2.176000	0.42500|0.42500	2.068000|2.068000	0.61886|0.61886	0.561000|0.561000	0.74099|0.74099	GCG|CGA		0.662	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	
HSPA1L	3305	hgsc.bcm.edu	37	6	31779179	31779179	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr6:31779179C>A	ENST00000375654.4	-	2	760	c.571G>T	c.(571-573)Ggt>Tgt	p.G191C	HSPA1L_ENST00000417199.3_Missense_Mutation_p.G191C	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	191					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.G191C(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TCTCCTTGACCTCCTTTATCT	0.453																																					p.G191C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G571T	6						.						100.0	89.0	92.0					6																	31779179		2203	4300	6503	31887158	SO:0001583	missense	3305	exon2			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.571G>T	6.37:g.31779179C>A	ENSP00000364805:p.Gly191Cys		31887158	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	6.318	0.426862	0.11987	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.01034	5.42;5.42	4.66	1.59	0.23543	.	.	.	.	.	T	0.02688	0.0081	H	0.95365	3.66	0.09310	N	1	D	0.55172	0.97	P	0.61658	0.892	T	0.22521	-1.0214	9	0.48119	T	0.1	.	8.2366	0.31629	0.0:0.697:0.0:0.303	.	191	P34931	HS71L_HUMAN	C	191;191;136;81	ENSP00000364805:G191C;ENSP00000387691:G191C	ENSP00000364804:G136C	G	-	1	0	HSPA1L	31887158	0.191000	0.23288	0.022000	0.16811	0.658000	0.38924	1.678000	0.37586	0.548000	0.28955	0.460000	0.39030	GGT		0.453	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
ZNF318	24149	hgsc.bcm.edu	37	6	43306183	43306187	+	Frame_Shift_Del	DEL	TACTT	TACTT	-			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	TACTT	TACTT	TACTT	-	TACTT	TACTT	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr6:43306183_43306187delTACTT	ENST00000361428.2	-	10	5626_5630	c.5549_5553delAAGTA	c.(5548-5553)aaagtafs	p.KV1850fs	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1850					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.K1850fs*24(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			ATTTGATCACTACTTTACTTGGAGT	0.4																																					p.1850_1851del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.5549_5553del	6						.																																			43414165	SO:0001589	frameshift_variant	24149	exon10			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.5549_5553delAAGTA	6.37:g.43306188_43306192delTACTT	ENSP00000354964:p.Lys1850fs		43414161	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Frame_Shift_Del	DEL	ENST00000361428.2	37	CCDS4895.2																																																																																				0.400	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
TAS2R5	54429	hgsc.bcm.edu	37	7	141490397	141490397	+	Missense_Mutation	SNP	G	G	A	rs142235954		TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr7:141490397G>A	ENST00000247883.4	+	1	381	c.236G>A	c.(235-237)cGc>cAc	p.R79H		NM_018980.2	NP_061853.1	Q9NYW4	TA2R5_HUMAN	taste receptor, type 2, member 5	79					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.R79H(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9	Melanoma(164;0.0171)					CGTTGGCTTCGCTATCTTAGT	0.507																																					p.R79H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G236A	7						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	76.0	77.0		236	-7.9	0.0	7	dbSNP_134	77	0,8600		0,0,4300	no	missense	TAS2R5	NM_018980.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	79/300	141490397	1,13005	2203	4300	6503	141136866	SO:0001583	missense	54429	exon1			AF227132	CCDS5869.1	7q31.3-q32	2012-08-22			ENSG00000127366	ENSG00000127366		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14912	protein-coding gene	gene with protein product		605062					Standard	NM_018980		Approved	T2R5	uc003vwr.1	Q9NYW4	OTTHUMG00000157632	ENST00000247883.4:c.236G>A	7.37:g.141490397G>A	ENSP00000247883:p.Arg79His		141136866	NM_018980	Q645W0|Q75MV7	Missense_Mutation	SNP	ENST00000247883.4	37	CCDS5869.1	.	.	.	.	.	.	.	.	.	.	G	7.008	0.556251	0.13436	2.27E-4	0.0	ENSG00000127366	ENST00000247883	T	0.00824	5.65	4.46	-7.93	0.01156	.	.	.	.	.	T	0.00754	0.0025	N	0.25890	0.77	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.45702	-0.9243	9	0.51188	T	0.08	.	6.9954	0.24779	0.6225:0.0:0.1491:0.2284	.	79	Q9NYW4	TA2R5_HUMAN	H	79	ENSP00000247883:R79H	ENSP00000247883:R79H	R	+	2	0	TAS2R5	141136866	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-1.024000	0.03603	-1.779000	0.01280	-0.291000	0.09656	CGC		0.507	TAS2R5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349283.1		
MFHAS1	9258	hgsc.bcm.edu	37	8	8747632	8747632	+	Silent	SNP	G	G	C			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chr8:8747632G>C	ENST00000276282.6	-	1	3523	c.2937C>G	c.(2935-2937)acC>acG	p.T979T		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	979								p.T979T(1)		endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GAATGTGCACGGTGTAGTGCA	0.488																																					p.T979T	Melanoma(103;1201 2045 17515 28966)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2937G	8						.						113.0	99.0	104.0					8																	8747632		2203	4300	6503	8785042	SO:0001819	synonymous_variant	9258	exon1			AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.2937C>G	8.37:g.8747632G>C			8785042	NM_004225	Q96CI0	Silent	SNP	ENST00000276282.6	37	CCDS34844.1																																																																																				0.488	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
OCRL	4952	hgsc.bcm.edu	37	X	128691337	128691337	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chrX:128691337A>G	ENST00000371113.4	+	5	439	c.274A>G	c.(274-276)Aga>Gga	p.R92G	OCRL_ENST00000486673.1_3'UTR|OCRL_ENST00000357121.5_Missense_Mutation_p.R92G	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	92	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.R92G(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						GGACTGGATCAGAGAGCGCCG	0.428																																					p.R92G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A274G	X						.						89.0	85.0	86.0					X																	128691337		2203	4300	6503	128519018	SO:0001583	missense	4952	exon5			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.274A>G	X.37:g.128691337A>G	ENSP00000360154:p.Arg92Gly		128519018	NM_001587	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	A	11.26	1.585569	0.28268	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.94046	-3.34;-3.34	5.57	1.85	0.25348	.	0.591091	0.17807	N	0.161345	T	0.79724	0.4495	N	0.04508	-0.205	0.25112	N	0.990706	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.66304	-0.5957	10	0.23302	T	0.38	.	3.0202	0.06073	0.5182:0.0:0.2906:0.1913	.	92;92	Q01968-2;Q01968	.;OCRL_HUMAN	G	92	ENSP00000360154:R92G;ENSP00000349635:R92G	ENSP00000349635:R92G	R	+	1	2	OCRL	128519018	0.700000	0.27796	1.000000	0.80357	0.993000	0.82548	0.551000	0.23361	0.241000	0.21283	0.486000	0.48141	AGA		0.428	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
CXorf67	340602	hgsc.bcm.edu	37	X	51150965	51150965	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chrX:51150965C>A	ENST00000342995.2	+	1	1199	c.1097C>A	c.(1096-1098)gCt>gAt	p.A366D				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	366	Ser-rich.							p.A366D(1)		breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						TCTGGGTCAGCTGATGAGAAT	0.617																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	X						.						49.0	40.0	43.0					X																	51150965		2203	4300	6503	51167705	SO:0001583	missense	340602	.			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.1097C>A	X.37:g.51150965C>A	ENSP00000342680:p.Ala366Asp		51167705	.		Missense_Mutation	SNP	ENST00000342995.2	37		.	.	.	.	.	.	.	.	.	.	c	13.12	2.142050	0.37825	.	.	ENSG00000187690	ENST00000342995	T	0.46819	0.86	3.23	-1.3	0.09259	.	1.346720	0.05438	N	0.547139	T	0.49270	0.1547	.	.	.	0.09310	N	1	D	0.58268	0.982	P	0.53450	0.726	T	0.46803	-0.9165	9	0.30078	T	0.28	-4.2905	8.1607	0.31196	0.1598:0.3776:0.4626:0.0	.	366	Q86X51	CX067_HUMAN	D	366	ENSP00000342680:A366D	ENSP00000342680:A366D	A	+	2	0	CXorf67	51167705	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.050000	0.03510	-0.412000	0.07519	0.597000	0.82753	GCT		0.617	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_203407	
CYLC1	1538	hgsc.bcm.edu	37	X	83128113	83128113	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chrX:83128113A>G	ENST00000329312.4	+	4	434	c.397A>G	c.(397-399)Aaa>Gaa	p.K133E		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	133					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K132E(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AGATTCCAAGAAAAAAGGAGG	0.323																																					p.K133E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A397G	X						.						25.0	22.0	23.0					X																	83128113		2195	4296	6491	83014769	SO:0001583	missense	1538	exon4			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.397A>G	X.37:g.83128113A>G	ENSP00000331556:p.Lys133Glu		83014769	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	a	5.208	0.223955	0.09863	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.41400	1.0	4.67	0.985	0.19779	.	.	.	.	.	T	0.19525	0.0469	N	0.12746	0.255	0.09310	N	1	B;B	0.19331	0.035;0.035	B;B	0.19391	0.025;0.025	T	0.30707	-0.9969	9	0.08599	T	0.76	-0.2071	5.9568	0.19277	0.6429:0.0:0.3571:0.0	.	133;133	P35663;F5H4V5	CYLC1_HUMAN;.	E	133	ENSP00000331556:K133E	ENSP00000331556:K133E	K	+	1	0	CYLC1	83014769	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.314000	0.19432	-0.020000	0.14032	0.486000	0.48141	AAA		0.323	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
DIAPH2	1730	hgsc.bcm.edu	37	X	96502815	96502815	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chrX:96502815G>A	ENST00000324765.8	+	23	3168	c.2821G>A	c.(2821-2823)Gat>Aat	p.D941N	DIAPH2_ENST00000373049.4_Missense_Mutation_p.D941N|DIAPH2_ENST00000373054.4_Missense_Mutation_p.D937N|DIAPH2_ENST00000373061.3_Missense_Mutation_p.D941N|DIAPH2_ENST00000355827.4_Missense_Mutation_p.D941N			O60879	DIAP2_HUMAN	diaphanous-related formin 2	941	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)	p.D941N(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AAATCAACACGATAAGTTTGT	0.353																																					p.D941N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2821A	X						.						149.0	125.0	133.0					X																	96502815		2203	4299	6502	96389471	SO:0001583	missense	1730	exon23			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2821G>A	X.37:g.96502815G>A	ENSP00000321348:p.Asp941Asn		96389471	NM_006729	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134506	0.77662	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.66	5.66	0.87406	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.74642	0.3743	M	0.87827	2.91	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.79165	-0.1916	10	0.87932	D	0	.	19.0056	0.92849	0.0:0.0:1.0:0.0	.	941;941	O60879;O60879-2	DIAP2_HUMAN;.	N	941;937;941;941;941;948	ENSP00000362152:D941N;ENSP00000362145:D937N;ENSP00000348082:D941N;ENSP00000362140:D941N;ENSP00000321348:D941N	ENSP00000321348:D941N	D	+	1	0	DIAPH2	96389471	1.000000	0.71417	0.963000	0.40424	0.504000	0.33889	9.041000	0.93788	2.523000	0.85059	0.594000	0.82650	GAT		0.353	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
ATP11C	286410	hgsc.bcm.edu	37	X	138908951	138908951	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2692-01A-01W-0831-10	TCGA-AF-2692-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	88efe19b-b28e-47c6-a3e2-631755629880	a7cba55c-dc39-41d1-b5fc-a704b5dbb460	g.chrX:138908951C>T	ENST00000327569.3	-	2	166	c.68G>A	c.(67-69)cGc>cAc	p.R23H	ATP11C_ENST00000361648.2_Missense_Mutation_p.R23H|ATP11C_ENST00000370543.1_Missense_Mutation_p.R23H|ATP11C_ENST00000359686.2_Missense_Mutation_p.R23H|ATP11C_ENST00000370557.1_Missense_Mutation_p.R20H	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	23					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R23H(1)		breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					AAACACTGTGCGTGTGCCAAC	0.388																																					p.R23H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G68A	X						.						138.0	114.0	122.0					X																	138908951		2203	4300	6503	138736617	SO:0001583	missense	286410	exon2			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.68G>A	X.37:g.138908951C>T	ENSP00000332756:p.Arg23His		138736617	NM_001010986	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789372	0.90367	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.83216	0.5206	M	0.92691	3.335	0.53005	D	0.999966	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87329	0.2323	10	0.87932	D	0	.	14.6521	0.68805	0.0:1.0:0.0:0.0	.	23;23	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	H	20;23;23;23;23	ENSP00000359588:R20H;ENSP00000355165:R23H;ENSP00000332756:R23H;ENSP00000359574:R23H;ENSP00000352715:R23H	ENSP00000332756:R23H	R	-	2	0	ATP11C	138736617	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.969000	0.76092	2.430000	0.82344	0.544000	0.68410	CGC		0.388	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
