#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TLX1	3195	broad.mit.edu	37	10	102893953	102893953	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr10:102893953C>T	ENST00000370196.6	+	2	2632	c.590C>T	c.(589-591)aCg>aTg	p.T197M	TLX1_ENST00000467928.2_Missense_Mutation_p.T197M|TLX1_ENST00000533319.1_3'UTR|RP11-31L23.3_ENST00000411459.1_RNA			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	197					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T197M(1)		breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		CAGAACCGGACGCCCCCCAAG	0.627			T	"""TRB@, TRD@"""	T-ALL																																p.T197M			Dom	yes		10	10q24	3195	""" T-cell leukemia, homeobox 1 (HOX11)"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C590T	10						.						51.0	52.0	52.0					10																	102893953		2200	4299	6499	102883943	SO:0001583	missense	3195	exon2			M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.590C>T	10.37:g.102893953C>T	ENSP00000359215:p.Thr197Met		102883943	NM_001195517	A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Missense_Mutation	SNP	ENST00000370196.6	37	CCDS7510.1	.	.	.	.	.	.	.	.	.	.	C	35	5.416598	0.96092	.	.	ENSG00000107807	ENST00000370196;ENST00000463716;ENST00000467928	D;D	0.95788	-3.73;-3.81	5.85	5.85	0.93711	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97598	0.9213	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97672	1.0167	10	0.66056	D	0.02	.	20.1775	0.98187	0.0:1.0:0.0:0.0	.	197	P31314	TLX1_HUMAN	M	197;209;197	ENSP00000359215:T197M;ENSP00000434914:T197M	ENSP00000359215:T197M	T	+	2	0	TLX1	102883943	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.759000	0.85235	2.771000	0.95319	0.561000	0.74099	ACG		0.627	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051193.3	NM_005521	
TACC2	10579	broad.mit.edu	37	10	123846509	123846509	+	Silent	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr10:123846509G>T	ENST00000369005.1	+	4	4834	c.4494G>T	c.(4492-4494)ctG>ctT	p.L1498L	TACC2_ENST00000334433.3_Silent_p.L1498L|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515273.1_Silent_p.L1498L|TACC2_ENST00000515603.1_Silent_p.L1498L|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000453444.2_Silent_p.L1498L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1498					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)	p.L1498L(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ACAAGCTTCTGGGTCCAGCAG	0.602																																					p.L1498L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4494T	10						.						45.0	45.0	45.0					10																	123846509		2203	4300	6503	123836499	SO:0001819	synonymous_variant	10579	exon4			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.4494G>T	10.37:g.123846509G>T			123836499	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	37	CCDS7626.1																																																																																				0.602	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
ADAM12	8038	broad.mit.edu	37	10	127824202	127824202	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr10:127824202G>A	ENST00000368679.4	-	5	685	c.376C>T	c.(376-378)Cgg>Tgg	p.R126W	ADAM12_ENST00000368676.4_Missense_Mutation_p.R126W	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	126					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.R126W(2)		biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GAATATCCCCGTACATGTCCA	0.473																																					p.R126W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C376T	10						.						149.0	114.0	126.0					10																	127824202		2203	4300	6503	127814192	SO:0001583	missense	8038	exon5			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.376C>T	10.37:g.127824202G>A	ENSP00000357668:p.Arg126Trp		127814192	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725479	0.68959	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.06849	3.25;3.25;3.25	4.17	4.17	0.49024	Peptidase M12B, propeptide (1);	0.430200	0.22565	N	0.058411	T	0.22126	0.0533	M	0.70787	2.145	0.20821	N	0.999849	D;D;D;D;D	0.67145	0.996;0.995;0.995;0.995;0.989	P;P;P;P;P	0.56916	0.809;0.711;0.711;0.711;0.72	T	0.02326	-1.1176	10	0.87932	D	0	.	13.7996	0.63192	0.0:0.0:1.0:0.0	.	123;123;126;123;126	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	W	126;126;123	ENSP00000357668:R126W;ENSP00000357665:R126W;ENSP00000391268:R123W	ENSP00000357665:R126W	R	-	1	2	ADAM12	127814192	0.995000	0.38212	0.236000	0.24074	0.087000	0.18053	4.273000	0.58914	2.158000	0.67659	0.491000	0.48974	CGG		0.473	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
MYO3A	53904	broad.mit.edu	37	10	26241162	26241162	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr10:26241162G>T	ENST00000265944.5	+	3	289	c.123G>T	c.(121-123)aaG>aaT	p.K41N	MYO3A_ENST00000376302.1_Missense_Mutation_p.K41N|MYO3A_ENST00000543632.1_Missense_Mutation_p.K41N|MYO3A_ENST00000376301.1_Missense_Mutation_p.K41N	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	41	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K41N(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TATTGAATAAGAAAAATGGCC	0.313																																					p.K41N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G123T	10						.						62.0	67.0	65.0					10																	26241162		2203	4298	6501	26281168	SO:0001583	missense	53904	exon3			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.123G>T	10.37:g.26241162G>T	ENSP00000265944:p.Lys41Asn		26281168	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033313	0.75504	.	.	ENSG00000095777	ENST00000265944;ENST00000376302;ENST00000543632;ENST00000376301	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	6.01	6.01	0.97437	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042794	0.85682	D	0.000000	T	0.81380	0.4810	M	0.63843	1.955	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.927;0.988	D;D;P;D	0.87578	0.996;0.998;0.759;0.948	T	0.79401	-0.1819	10	0.49607	T	0.09	.	20.5041	0.99208	0.0:0.0:1.0:0.0	.	41;41;41;41	F5H0U9;Q0VD65;Q8NEV4;Q4G0X2	.;.;MYO3A_HUMAN;.	N	41	ENSP00000265944:K41N;ENSP00000365479:K41N;ENSP00000445909:K41N;ENSP00000365478:K41N	ENSP00000265944:K41N	K	+	3	2	MYO3A	26281168	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.879000	0.56138	2.855000	0.98099	0.536000	0.68110	AAG		0.313	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
JMJD1C	221037	broad.mit.edu	37	10	64973553	64973553	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr10:64973553G>A	ENST00000399262.2	-	8	2592	c.2374C>T	c.(2374-2376)Cac>Tac	p.H792Y	JMJD1C_ENST00000399251.1_Missense_Mutation_p.H573Y|JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000542921.1_Missense_Mutation_p.H610Y|JMJD1C_ENST00000402544.1_Missense_Mutation_p.H573Y	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	792					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.H792Y(1)|p.H573Y(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					AAATGAGGGTGATGAACAGCA	0.507																																					p.H573Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1717T	10						.						87.0	82.0	84.0					10																	64973553		2146	4253	6399	64643559	SO:0001583	missense	221037	exon5			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.2374C>T	10.37:g.64973553G>A	ENSP00000382204:p.His792Tyr		64643559	NM_004241	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.612177	0.66672	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.73	5.73	0.89815	.	0.052068	0.85682	D	0.000000	T	0.72087	0.3417	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.77557	0.99;0.99	T	0.72940	-0.4139	10	0.72032	D	0.01	-8.2269	19.9036	0.96999	0.0:0.0:1.0:0.0	.	792;610	Q15652;A0T124	JHD2C_HUMAN;.	Y	792;573;573;610	ENSP00000382204:H792Y;ENSP00000384990:H573Y;ENSP00000382195:H573Y;ENSP00000444682:H610Y	ENSP00000382195:H573Y	H	-	1	0	JMJD1C	64643559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.096000	0.94182	2.706000	0.92434	0.655000	0.94253	CAC		0.507	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
C10orf90	118611	broad.mit.edu	37	10	128114641	128114641	+	Silent	SNP	C	C	T	rs200783026		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr10:128114641C>T	ENST00000284694.7	-	8	2100	c.1980G>A	c.(1978-1980)ccG>ccA	p.P660P	C10orf90_ENST00000454341.1_Silent_p.P563P|C10orf90_ENST00000356858.3_Silent_p.P613P|C10orf90_ENST00000480379.1_Silent_p.P64P|C10orf90_ENST00000544758.1_Silent_p.P757P	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	660	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.P660P(2)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TTTTAACTTCCGGCAAGTTAT	0.453													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20975	0.0		0.0	False		,,,				2504	0.0				p.P660P												.	.	2	Substitution - coding silent(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.G1980A	10						.						96.0	95.0	96.0					10																	128114641		2203	4300	6503	128104631	SO:0001819	synonymous_variant	118611	exon8			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1980G>A	10.37:g.128114641C>T			128104631	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	ENST00000284694.7	37	CCDS31310.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.752	1.167857	0.21621	.	.	ENSG00000154493	ENST00000424927	.	.	.	4.8	-8.71	0.00848	.	.	.	.	.	T	0.32496	0.0831	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.41088	-0.9528	4	.	.	.	-19.2912	1.1129	0.01708	0.2405:0.1406:0.1778:0.4411	.	.	.	.	Q	203	.	.	R	-	2	0	C10orf90	128104631	0.198000	0.23374	0.712000	0.30502	0.996000	0.88848	-0.765000	0.04730	-1.469000	0.01890	0.655000	0.94253	CGG		0.453	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
GRIA4	2893	broad.mit.edu	37	11	105623916	105623916	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:105623916T>A	ENST00000530497.1	+	3	457	c.457T>A	c.(457-459)Tgt>Agt	p.C153S	GRIA4_ENST00000393125.2_Missense_Mutation_p.C153S|GRIA4_ENST00000393127.2_Missense_Mutation_p.C153S|GRIA4_ENST00000525187.1_Missense_Mutation_p.C153S|GRIA4_ENST00000428631.2_Missense_Mutation_p.C153S|GRIA4_ENST00000282499.5_Missense_Mutation_p.C153S			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	153					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.C153S(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		CGAATGGAACTGTTTTGTCTT	0.433																																					p.C153S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T457A	11						.						148.0	129.0	136.0					11																	105623916		2202	4299	6501	105129126	SO:0001583	missense	2893	exon4			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.457T>A	11.37:g.105623916T>A	ENSP00000435775:p.Cys153Ser		105129126	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.332138	0.41297	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	T;T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;-1.45;-1.45	5.51	3.17	0.36434	Extracellular ligand-binding receptor (1);	0.342781	0.29362	N	0.012367	T	0.49047	0.1534	N	0.01874	-0.695	0.28672	N	0.905573	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.31861	-0.9928	10	0.22706	T	0.39	.	1.9833	0.03431	0.2321:0.2391:0.0:0.5289	.	153;153;183;153	P48058;G3V164;Q59GL7;Q86XE8	GRIA4_HUMAN;.;.;.	S	153	ENSP00000376833:C153S;ENSP00000282499:C153S;ENSP00000376835:C153S;ENSP00000415551:C153S;ENSP00000432443:C153S;ENSP00000435775:C153S;ENSP00000432180:C153S	ENSP00000282499:C153S	C	+	1	0	GRIA4	105129126	0.992000	0.36948	1.000000	0.80357	0.993000	0.82548	1.083000	0.30815	0.892000	0.36259	0.533000	0.62120	TGT		0.433	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
CWF19L2	143884	broad.mit.edu	37	11	107263597	107263597	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:107263597G>A	ENST00000282251.5	-	11	1669	c.1642C>T	c.(1642-1644)Ctt>Ttt	p.L548F	CWF19L2_ENST00000433523.1_Missense_Mutation_p.L548F	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	548							catalytic activity (GO:0003824)	p.L394F(1)		endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		GTTCTGACAAGGATTACTTCT	0.338																																					p.L548F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1642T	11						.						100.0	95.0	97.0					11																	107263597		2201	4298	6499	106768807	SO:0001583	missense	143884	exon11			AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.1642C>T	11.37:g.107263597G>A	ENSP00000282251:p.Leu548Phe		106768807	NM_152434	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	ENST00000282251.5	37	CCDS8336.2	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590972	0.86851	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	T;T	0.36520	1.25;1.25	6.16	6.16	0.99307	.	0.064941	0.64402	D	0.000006	T	0.65544	0.2701	M	0.84846	2.72	0.58432	D	0.999999	D	0.71674	0.998	D	0.69307	0.963	T	0.68127	-0.5491	10	0.72032	D	0.01	-13.2786	18.3537	0.90348	0.0:0.0:1.0:0.0	.	548	Q2TBE0	C19L2_HUMAN	F	548	ENSP00000282251:L548F;ENSP00000387533:L548F	ENSP00000282251:L548F	L	-	1	0	CWF19L2	106768807	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.066000	0.76734	2.937000	0.99478	0.650000	0.86243	CTT		0.338	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434	
DSCAML1	57453	broad.mit.edu	37	11	117332233	117332233	+	Silent	SNP	C	C	T	rs572641245	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:117332233C>T	ENST00000321322.6	-	18	3526	c.3525G>A	c.(3523-3525)ccG>ccA	p.P1175P	DSCAML1_ENST00000527706.1_Silent_p.P905P	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1115	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.P1175P(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGGTGCTGCGCGGGGGCTCTG	0.627													C|||	4	0.000798722	0.0	0.0058	5008	,	,		17297	0.0		0.0	False		,,,				2504	0.0				p.P1175P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3525A	11						.						73.0	74.0	74.0					11																	117332233		2201	4296	6497	116837443	SO:0001819	synonymous_variant	57453	exon18				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3525G>A	11.37:g.117332233C>T			116837443	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	ENST00000321322.6	37	CCDS8384.1																																																																																				0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
COPB1	1315	broad.mit.edu	37	11	14515886	14515886	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:14515886C>T	ENST00000249923.3	-	3	491	c.191G>A	c.(190-192)cGt>cAt	p.R64H	PSMA1_ENST00000555531.1_3'UTR|COPB1_ENST00000439561.2_Missense_Mutation_p.R64H|PSMA1_ENST00000419365.2_3'UTR	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	64					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.R64H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TAGCACAAAACGAATGATGGT	0.363																																					p.R64H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G191A	11						.						106.0	104.0	104.0					11																	14515886		2200	4294	6494	14472462	SO:0001583	missense	1315	exon3			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.191G>A	11.37:g.14515886C>T	ENSP00000249923:p.Arg64His		14472462	NM_016451	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	C	35	5.521894	0.96416	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234;ENST00000529866;ENST00000534771	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	5.58	5.58	0.84498	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.63438	0.2511	H	0.94423	3.535	0.80722	D	1	D	0.69078	0.997	D	0.65010	0.931	T	0.74728	-0.3567	10	0.87932	D	0	-5.1216	19.5796	0.95461	0.0:1.0:0.0:0.0	.	64	P53618	COPB_HUMAN	H	64	ENSP00000249923:R64H;ENSP00000397873:R64H;ENSP00000436383:R64H;ENSP00000431530:R64H;ENSP00000436401:R64H	ENSP00000249923:R64H	R	-	2	0	COPB1	14472462	1.000000	0.71417	0.987000	0.45799	0.999000	0.98932	7.818000	0.86416	2.624000	0.88883	0.655000	0.94253	CGT		0.363	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
SOX6	55553	broad.mit.edu	37	11	16007817	16007817	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:16007817G>A	ENST00000352083.6	-	15	2193	c.2116C>T	c.(2116-2118)Cgg>Tgg	p.R706W	SOX6_ENST00000528252.1_Missense_Mutation_p.R679W|SOX6_ENST00000527619.1_Missense_Mutation_p.R682W|SOX6_ENST00000316399.6_Missense_Mutation_p.R686W|SOX6_ENST00000528429.1_Missense_Mutation_p.R706W|SOX6_ENST00000396356.3_Missense_Mutation_p.R686W			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	706					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R686W(2)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TCCCCAATCCGAAGCTTTTTG	0.478																																					p.R686W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2056T	11						.						214.0	202.0	206.0					11																	16007817		2200	4294	6494	15964393	SO:0001583	missense	55553	exon15			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.2116C>T	11.37:g.16007817G>A	ENSP00000339876:p.Arg706Trp		15964393	NM_033326	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37		.	.	.	.	.	.	.	.	.	.	G	28.7	4.941914	0.92526	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.79621	0.4477	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.995	T	0.81965	-0.0691	10	0.87932	D	0	.	19.6107	0.95606	0.0:0.0:1.0:0.0	.	686;706;682	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	W	686;706;686;679;682;706	ENSP00000324948:R686W;ENSP00000339876:R706W;ENSP00000379644:R686W;ENSP00000432134:R679W;ENSP00000434455:R682W;ENSP00000433233:R706W	ENSP00000324948:R686W	R	-	1	2	SOX6	15964393	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.029000	0.88807	2.648000	0.89879	0.655000	0.94253	CGG		0.478	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	
SOX6	55553	broad.mit.edu	37	11	16208370	16208370	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:16208370G>T	ENST00000352083.6	-	5	744	c.667C>A	c.(667-669)Caa>Aaa	p.Q223K	SOX6_ENST00000528252.1_Missense_Mutation_p.Q223K|SOX6_ENST00000527619.1_Missense_Mutation_p.Q226K|SOX6_ENST00000316399.6_Missense_Mutation_p.Q223K|SOX6_ENST00000528429.1_Missense_Mutation_p.Q223K|SOX6_ENST00000396356.3_Missense_Mutation_p.Q223K			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	223	Gln-rich.				astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q223K(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						TGCTGCCGTTGTTTCTCAATT	0.522																																					p.Q223K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C667A	11						.						208.0	195.0	200.0					11																	16208370		2200	4294	6494	16164946	SO:0001583	missense	55553	exon5			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.667C>A	11.37:g.16208370G>T	ENSP00000339876:p.Gln223Lys		16164946	NM_033326	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	ENST00000352083.6	37		.	.	.	.	.	.	.	.	.	.	G	27.1	4.800870	0.90538	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.99121	-5.41;-5.35;-5.41;-5.45;-5.45;-5.35	5.73	5.73	0.89815	.	0.055575	0.85682	D	0.000000	D	0.99278	0.9748	M	0.82193	2.58	0.80722	D	1	D;P;P	0.63046	0.992;0.855;0.917	P;P;D	0.63488	0.798;0.474;0.915	D	0.99589	1.0975	10	0.87932	D	0	.	19.8956	0.96956	0.0:0.0:1.0:0.0	.	223;223;226	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	K	223;223;223;223;226;223	ENSP00000324948:Q223K;ENSP00000339876:Q223K;ENSP00000379644:Q223K;ENSP00000432134:Q223K;ENSP00000434455:Q226K;ENSP00000433233:Q223K	ENSP00000324948:Q223K	Q	-	1	0	SOX6	16164946	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.708000	0.92522	0.563000	0.77884	CAA		0.522	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000386811.1	NM_033326	
OR4C15	81309	broad.mit.edu	37	11	55322396	55322396	+	Missense_Mutation	SNP	G	G	T	rs193168035	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:55322396G>T	ENST00000314644.2	+	1	614	c.614G>T	c.(613-615)gGc>gTc	p.G205V		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G205V(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TGGACAGGGGGCCTCTTGCAT	0.468										HNSCC(20;0.049)																											p.G205V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G614T	11						.						93.0	89.0	90.0					11																	55322396		2201	4296	6497	55078972	SO:0001583	missense	81309	exon1			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.614G>T	11.37:g.55322396G>T	ENSP00000324958:p.Gly205Val		55078972	NM_001001920	Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	37	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.224451	0.39300	.	.	ENSG00000181939	ENST00000314644	T	0.39056	1.1	5.12	5.12	0.69794	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.70168	0.3193	M	0.88906	2.99	0.40906	D	0.984193	D	0.89917	1.0	D	0.97110	1.0	T	0.77008	-0.2747	9	0.87932	D	0	.	16.0842	0.81025	0.0:0.0:1.0:0.0	.	151	Q8NGM1	OR4CF_HUMAN	V	205	ENSP00000324958:G205V	ENSP00000324958:G205V	G	+	2	0	OR4C15	55078972	0.966000	0.33281	0.956000	0.39512	0.484000	0.33280	1.919000	0.40015	2.665000	0.90641	0.385000	0.25706	GGC		0.468	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
OR8H1	219469	broad.mit.edu	37	11	56058005	56058005	+	Silent	SNP	G	G	A	rs374019056		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:56058005G>A	ENST00000313022.2	-	1	561	c.534C>T	c.(532-534)tgC>tgT	p.C178C		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.C178C(1)		NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					GAGACGTGTCGCAGAAAAAGT	0.438																																					p.C178C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C534T	11						.	G		0,4402		0,0,2201	115.0	104.0	108.0		534	1.4	0.9	11		108	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	OR8H1	NM_001005199.1		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		178/312	56058005	1,12993	2201	4296	6497	55814581	SO:0001819	synonymous_variant	219469	exon1			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.534C>T	11.37:g.56058005G>A			55814581	NM_001005199	B2RNI7|Q6IFC5	Silent	SNP	ENST00000313022.2	37	CCDS31526.1																																																																																				0.438	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199	
OR5A2	219981	broad.mit.edu	37	11	59190126	59190126	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:59190126G>T	ENST00000302040.4	-	1	323	c.301C>A	c.(301-303)Cag>Aag	p.Q101K		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q101K(1)		large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						ACAAAGTACTGAGTGGCACAG	0.512																																					p.Q101K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C301A	11						.						81.0	78.0	79.0					11																	59190126		2201	4295	6496	58946702	SO:0001583	missense	219981	exon1			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.301C>A	11.37:g.59190126G>T	ENSP00000303834:p.Gln101Lys		58946702	NM_001001954	B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	ENST00000302040.4	37	CCDS31560.1	.	.	.	.	.	.	.	.	.	.	G	37	6.089241	0.97271	.	.	ENSG00000172324	ENST00000302040	T	0.00462	7.26	5.47	5.47	0.80525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33553	U	0.004785	T	0.03136	0.0092	H	0.97732	4.065	0.43499	D	0.995742	D	0.69078	0.997	D	0.81914	0.995	T	0.02505	-1.1149	10	0.72032	D	0.01	.	17.1743	0.86837	0.0:0.0:1.0:0.0	.	101	Q8NGI9	OR5A2_HUMAN	K	101	ENSP00000303834:Q101K	ENSP00000303834:Q101K	Q	-	1	0	OR5A2	58946702	1.000000	0.71417	0.200000	0.23457	0.887000	0.51463	6.298000	0.72763	2.740000	0.93945	0.585000	0.79938	CAG		0.512	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394552.1	NM_001001954	
ZP1	22917	broad.mit.edu	37	11	60640728	60640728	+	Silent	SNP	C	C	T	rs151198562		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:60640728C>T	ENST00000278853.5	+	7	1206	c.1206C>T	c.(1204-1206)ccC>ccT	p.P402P		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	402	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)		p.P402P(1)		breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TGACCCAGCCCGGCCCCCTGC	0.602																																					p.P402P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1206T	11						.																																			60397304	SO:0001819	synonymous_variant	22917	exon7			BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1206C>T	11.37:g.60640728C>T			60397304	NM_207341		Silent	SNP	ENST00000278853.5	37	CCDS31572.1																																																																																				0.602	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396329.1	NM_207341	
DAGLA	747	broad.mit.edu	37	11	61505220	61505220	+	Missense_Mutation	SNP	G	G	A	rs377269260		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:61505220G>A	ENST00000257215.5	+	15	1692	c.1576G>A	c.(1576-1578)Gtc>Atc	p.V526I		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	526					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.V526I(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CAAAGACCTCGTCCCCAGGTG	0.622																																					p.V526I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1576A	11						.	G	ILE/VAL	1,4403	2.1+/-5.4	0,1,2201	142.0	116.0	125.0		1576	4.1	0.9	11		125	0,8598		0,0,4299	no	missense	DAGLA	NM_006133.2	29	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	526/1043	61505220	1,13001	2202	4299	6501	61261796	SO:0001583	missense	747	exon15			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1576G>A	11.37:g.61505220G>A	ENSP00000257215:p.Val526Ile		61261796	NM_006133	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	37	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	g	12.54	1.967413	0.34754	2.27E-4	0.0	ENSG00000134780	ENST00000257215	T	0.37752	1.18	4.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.56001	0.1956	L	0.59912	1.85	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.58020	-0.7710	10	0.45353	T	0.12	-32.4334	16.7773	0.85555	0.0:0.0:1.0:0.0	.	526	Q9Y4D2	DGLA_HUMAN	I	526	ENSP00000257215:V526I	ENSP00000257215:V526I	V	+	1	0	DAGLA	61261796	1.000000	0.71417	0.943000	0.38184	0.144000	0.21451	9.352000	0.97076	2.036000	0.60181	0.299000	0.19835	GTC		0.622	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
INTS4	92105	broad.mit.edu	37	11	77612476	77612476	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:77612476G>A	ENST00000534064.1	-	18	2253	c.2219C>T	c.(2218-2220)aCt>aTt	p.T740I	AAMDC_ENST00000532481.1_Intron|INTS4_ENST00000535943.1_Missense_Mutation_p.T115I	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	740					snRNA processing (GO:0016180)	integrator complex (GO:0032039)		p.T740I(1)	INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			CCCTCGTGTAGTTCGTGCTGT	0.413																																					p.T740I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2219T	11						.						214.0	192.0	199.0					11																	77612476		2200	4292	6492	77290124	SO:0001583	missense	92105	exon18			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.2219C>T	11.37:g.77612476G>A	ENSP00000434466:p.Thr740Ile		77290124	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765153	0.49574	.	.	ENSG00000149262	ENST00000534064;ENST00000535943	.	.	.	4.64	4.64	0.57946	.	0.169167	0.51477	D	0.000085	T	0.28599	0.0708	N	0.08118	0	0.42164	D	0.991612	P	0.48911	0.917	B	0.41135	0.348	T	0.09465	-1.0673	9	0.21014	T	0.42	-11.1084	16.2184	0.82243	0.0:0.0:1.0:0.0	.	740	Q96HW7	INT4_HUMAN	I	740;115	.	ENSP00000434466:T740I	T	-	2	0	INTS4	77290124	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.769000	0.74985	2.572000	0.86782	0.460000	0.39030	ACT		0.413	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
TMEM25	84866	broad.mit.edu	37	11	118403707	118403707	+	Missense_Mutation	SNP	C	C	T	rs75184401		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr11:118403707C>T	ENST00000313236.5	+	4	511	c.458C>T	c.(457-459)gCc>gTc	p.A153V	TMEM25_ENST00000524725.1_Missense_Mutation_p.A153V|TMEM25_ENST00000533102.1_Missense_Mutation_p.A153V|TMEM25_ENST00000442938.2_Missense_Mutation_p.A153V|TMEM25_ENST00000354064.7_Missense_Mutation_p.A49V|TMEM25_ENST00000529001.1_3'UTR|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000528578.1_RNA|RP11-770J1.3_ENST00000554407.1_RNA|RP11-770J1.3_ENST00000525992.2_RNA|RP11-770J1.3_ENST00000556583.1_RNA|TMEM25_ENST00000354284.4_Missense_Mutation_p.A153V|TMEM25_ENST00000359862.4_Missense_Mutation_p.A153V|TMEM25_ENST00000544878.1_Intron|TMEM25_ENST00000411589.2_Missense_Mutation_p.A153V	NM_032780.3	NP_116169.2	Q86YD3	TMM25_HUMAN	transmembrane protein 25	153						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A153V(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GTCCTGTTTGCCCTGGTGCGT	0.597																																					p.A153V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C458T	11						.						84.0	89.0	87.0					11																	118403707		2200	4295	6495	117908917	SO:0001583	missense	84866	exon4			AK075437	CCDS8398.1, CCDS44745.1, CCDS44746.1, CCDS44747.1, CCDS44748.1	11q23.3	2013-01-11			ENSG00000149582	ENSG00000149582		"""Immunoglobulin superfamily / C2-set domain containing"""	25890	protein-coding gene	gene with protein product		613934				15254712, 12975309	Standard	NM_001144034		Approved	FLJ14399	uc010rye.2	Q86YD3	OTTHUMG00000166339	ENST00000313236.5:c.458C>T	11.37:g.118403707C>T	ENSP00000315635:p.Ala153Val		117908917	NM_001144037	A8K8J4|B0YJA6|B0YJA7|B0YJA9|G5E9U4|Q6UW89|Q86UA7|Q8NBL5|Q96KA6|Q96MW9	Missense_Mutation	SNP	ENST00000313236.5	37	CCDS8398.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.296117|4.296117	0.81025|0.81025	.|.	.|.	ENSG00000149582|ENSG00000149582	ENST00000411589;ENST00000442938;ENST00000359862;ENST00000354284;ENST00000533137;ENST00000354064;ENST00000533102;ENST00000313236;ENST00000524725|ENST00000526973	T;T;T;T;T;T;T;T;T|.	0.31769|.	2.2;2.19;2.2;2.17;2.2;1.48;2.14;2.19;2.2|.	5.97|5.97	5.97|5.97	0.96955|0.96955	Immunoglobulin-like fold (1);|.	0.054186|.	0.64402|.	D|.	0.000001|.	T|T	0.45975|0.45975	0.1369|0.1369	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P;P;P;P;P;P;B;P|.	0.45715|.	0.533;0.787;0.787;0.865;0.663;0.714;0.211;0.607|.	B;B;B;P;B;B;B;B|.	0.46585|.	0.102;0.219;0.322;0.521;0.206;0.213;0.106;0.223|.	T|T	0.33879|0.33879	-0.9851|-0.9851	10|5	0.23891|.	T|.	0.37|.	-26.8481|-26.8481	8.7879|8.7879	0.34832|0.34832	0.0:0.8417:0.0:0.1583|0.0:0.8417:0.0:0.1583	.|.	153;153;153;153;153;153;49;153|.	Q86YD3;B7Z4E4;Q8NBL5;G5E9U4;Q86YD3-4;E9PKP3;Q86YD3-3;Q86YD3-2|.	TMM25_HUMAN;.;.;.;.;.;.;.|.	V|S	153;153;153;153;121;49;153;153;153|37	ENSP00000411882:A153V;ENSP00000416071:A153V;ENSP00000352924:A153V;ENSP00000346237:A153V;ENSP00000433938:A121V;ENSP00000278959:A49V;ENSP00000431548:A153V;ENSP00000315635:A153V;ENSP00000431205:A153V|.	ENSP00000315635:A153V|.	A|P	+|+	2|1	0|0	TMEM25|TMEM25	117908917|117908917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.311000|3.311000	0.51919|0.51919	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GCC|CCC		0.597	TMEM25-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389266.1	NM_032780	
TAS2R9	50835	broad.mit.edu	37	12	10962223	10962223	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:10962223T>C	ENST00000240691.2	-	1	544	c.452A>G	c.(451-453)gAt>gGt	p.D151G	TAS2R8_ENST00000240615.2_5'Flank	NM_023917.2	NP_076406.1	Q9NYW1	TA2R9_HUMAN	taste receptor, type 2, member 9	151					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	taste receptor activity (GO:0008527)	p.D151G(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						ATACCACATATCATCATTCTT	0.353																																					p.D151G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A452G	12						.						54.0	56.0	55.0					12																	10962223		2203	4300	6503	10853490	SO:0001583	missense	50835	exon1			AF227135	CCDS8633.1	12p13	2012-08-22			ENSG00000121381	ENSG00000121381		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14917	protein-coding gene	gene with protein product		604795				10761934, 10766242	Standard	NM_023917		Approved	T2R9, TRB6	uc001qyx.3	Q9NYW1	OTTHUMG00000168507	ENST00000240691.2:c.452A>G	12.37:g.10962223T>C	ENSP00000240691:p.Asp151Gly		10853490	NM_023917	Q502V7|Q50KT0|Q50KT1|Q645W9	Missense_Mutation	SNP	ENST00000240691.2	37	CCDS8633.1	.	.	.	.	.	.	.	.	.	.	T	8.559	0.877409	0.17395	.	.	ENSG00000121381	ENST00000240691	T	0.00724	5.78	4.33	-7.61	0.01299	GPCR, rhodopsin-like superfamily (1);	2.077890	0.03346	U	0.195499	T	0.00784	0.0026	L	0.28458	0.855	0.09310	N	1	B	0.21309	0.054	B	0.16289	0.015	T	0.36578	-0.9742	10	0.26408	T	0.33	.	11.3565	0.49620	0.1064:0.5951:0.0:0.2985	.	151	Q9NYW1	TA2R9_HUMAN	G	151	ENSP00000240691:D151G	ENSP00000240691:D151G	D	-	2	0	TAS2R9	10853490	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.162000	0.10012	-2.032000	0.00926	-2.057000	0.00402	GAT		0.353	TAS2R9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399933.1		
PIK3C2G	5288	broad.mit.edu	37	12	18762480	18762480	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:18762480C>A	ENST00000266497.5	+	29	4014	c.3976C>A	c.(3976-3978)Cca>Aca	p.P1326T	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.P1326T|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.P1367T			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1326					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.P1326T(1)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TGAGAAGTTTCCAGACAAGAA	0.353																																					p.P1326T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3976A	12						.						43.0	41.0	41.0					12																	18762480		1856	4097	5953	18653747	SO:0001583	missense	5288	exon30			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3976C>A	12.37:g.18762480C>A	ENSP00000266497:p.Pro1326Thr		18653747	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	C	4.585	0.108715	0.08780	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.60920	0.16;0.16;0.15	4.02	0.0809	0.14422	C2 calcium/lipid-binding domain, CaLB (1);	0.920458	0.08957	N	0.869228	T	0.26846	0.0657	N	0.03608	-0.345	0.19945	N	0.999947	B;B;B	0.10296	0.002;0.003;0.002	B;B;B	0.15052	0.005;0.012;0.005	T	0.22871	-1.0204	10	0.09590	T	0.72	-0.1118	4.9436	0.13978	0.0:0.3892:0.3979:0.2129	.	1366;1367;1326	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	T	1326;1326;1367	ENSP00000404845:P1326T;ENSP00000266497:P1326T;ENSP00000445381:P1367T	ENSP00000266497:P1326T	P	+	1	0	PIK3C2G	18653747	0.000000	0.05858	0.306000	0.25113	0.886000	0.51366	-1.104000	0.03326	0.007000	0.14760	-0.253000	0.11424	CCA		0.353	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
DDX11	1663	broad.mit.edu	37	12	31237922	31237922	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:31237922G>C	ENST00000407793.2	+	5	751	c.500G>C	c.(499-501)aGa>aCa	p.R167T	DDX11_ENST00000251758.5_Missense_Mutation_p.R167T|DDX11_ENST00000545668.1_Missense_Mutation_p.R167T|DDX11_ENST00000542838.1_Missense_Mutation_p.R167T|DDX11_ENST00000228264.6_Missense_Mutation_p.R141T|DDX11_ENST00000350437.4_Missense_Mutation_p.R167T	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	167	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R167T(11)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GAAGAAGAAAGAGAGAATCTC	0.612										Multiple Myeloma(12;0.14)																											p.R167T												.	.	11	Substitution - Missense(11)	lung(6)|kidney(2)|large_intestine(1)|prostate(1)|central_nervous_system(1)	c.G500C	12						.						18.0	20.0	19.0					12																	31237922		2203	4299	6502	31129189	SO:0001583	missense	1663	exon5			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.500G>C	12.37:g.31237922G>C	ENSP00000384703:p.Arg167Thr		31129189	NM_004399	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.810541	0.00600	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000251758;ENST00000228264;ENST00000438391;ENST00000415475;ENST00000545668;ENST00000350437	T;T;T;T;T;T;T;T	0.59224	4.17;4.17;4.17;4.17;0.28;4.17;4.17;4.17	3.87	0.233	0.15386	Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.241085	0.41938	N	0.000785	T	0.18635	0.0447	N	0.00841	-1.15	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.25779	-1.0122	10	0.12430	T	0.62	.	5.1988	0.15252	0.0:0.4995:0.1963:0.3042	.	167;167;167;167	B4DZY1;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	T	167;167;167;141;138;141;167;167	ENSP00000443426:R167T;ENSP00000384703:R167T;ENSP00000251758:R167T;ENSP00000228264:R141T;ENSP00000407646:R138T;ENSP00000406457:R141T;ENSP00000440402:R167T;ENSP00000309965:R167T	ENSP00000228264:R141T	R	+	2	0	DDX11	31129189	0.211000	0.23529	0.000000	0.03702	0.000000	0.00434	0.680000	0.25306	-0.264000	0.09365	-1.993000	0.00448	AGA		0.612	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
AMN1	196394	broad.mit.edu	37	12	31841957	31841957	+	Silent	SNP	T	T	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:31841957T>C	ENST00000281471.6	-	6	852	c.687A>G	c.(685-687)ggA>ggG	p.G229G	AMN1_ENST00000536761.1_Silent_p.G211G|AMN1_ENST00000542781.1_Silent_p.G29G|AMN1_ENST00000541931.1_Silent_p.G29G|AMN1_ENST00000537562.1_Silent_p.G211G	NM_001113402.1|NM_001278411.1|NM_001278412.1	NP_001106873.1|NP_001265340.1|NP_001265341.1	Q8IY45	AMN1_HUMAN	antagonist of mitotic exit network 1 homolog (S. cerevisiae)	229								p.G229G(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	7	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)			TCAAGGGGCATCCATGGAAGA	0.403																																					p.G229G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A687G	12						.						91.0	86.0	88.0					12																	31841957		1909	4129	6038	31733224	SO:0001819	synonymous_variant	196394	exon6				CCDS44858.1, CCDS61089.1	12p11.21	2010-07-19			ENSG00000151743	ENSG00000151743			27281	protein-coding gene	gene with protein product							Standard	NM_001113402		Approved		uc001rkq.4	Q8IY45	OTTHUMG00000169192	ENST00000281471.6:c.687A>G	12.37:g.31841957T>C			31733224	NM_001113402	B7Z7J3|Q6NVU4|Q86X98	Silent	SNP	ENST00000281471.6	37	CCDS44858.1																																																																																				0.403	AMN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402807.2	NR_004854	
KRT82	3888	broad.mit.edu	37	12	52788908	52788908	+	Missense_Mutation	SNP	C	C	T	rs149755657		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:52788908C>T	ENST00000257974.2	-	9	1470	c.1393G>A	c.(1393-1395)Gtc>Atc	p.V465I	RP3-416H24.4_ENST00000547174.1_RNA	NM_033033.3	NP_149022.3	Q9NSB4	KRT82_HUMAN	keratin 82	465	Tail.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.V465I(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	29				BRCA - Breast invasive adenocarcinoma(357;0.193)		CTCCTGAGGACGCCAGTGCTG	0.642																																					p.V465I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1393A	12						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	54.0	47.0	49.0		1393	0.9	0.0	12	dbSNP_134	49	0,8600		0,0,4300	no	missense	KRT82	NM_033033.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	465/514	52788908	1,13005	2203	4300	6503	51075175	SO:0001583	missense	3888	exon9			Y19207	CCDS8826.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000161850		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6459	protein-coding gene	gene with protein product	"""hard keratin type II 2"""	601078	"""keratin, hair, basic, 2"""	KRTHB2		2431943, 16831889	Standard	NM_033033		Approved	Hb-2	uc001sai.1	Q9NSB4	OTTHUMG00000169636	ENST00000257974.2:c.1393G>A	12.37:g.52788908C>T	ENSP00000257974:p.Val465Ile		51075175	NM_033033		Missense_Mutation	SNP	ENST00000257974.2	37	CCDS8826.1	.	.	.	.	.	.	.	.	.	.	C	0.918	-0.716728	0.03206	2.27E-4	0.0	ENSG00000161850	ENST00000257974	D	0.82344	-1.6	4.73	0.85	0.18980	.	1.675130	0.03601	N	0.233328	T	0.67097	0.2857	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.52756	-0.8533	10	0.22706	T	0.39	.	6.8571	0.24046	0.0:0.6053:0.0:0.3947	.	465	Q9NSB4	KRT82_HUMAN	I	465	ENSP00000257974:V465I	ENSP00000257974:V465I	V	-	1	0	KRT82	51075175	0.000000	0.05858	0.024000	0.17045	0.041000	0.13682	-1.471000	0.02344	-0.043000	0.13513	-0.258000	0.10820	GTC		0.642	KRT82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405189.1	NM_033033	
TESPA1	9840	broad.mit.edu	37	12	55356420	55356420	+	Missense_Mutation	SNP	G	G	A	rs148518799	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:55356420G>A	ENST00000449076.1	-	9	1394	c.1262C>T	c.(1261-1263)aCg>aTg	p.T421M	TESPA1_ENST00000316577.8_Missense_Mutation_p.T421M|TESPA1_ENST00000532804.1_Missense_Mutation_p.T283M|TESPA1_ENST00000524622.1_Missense_Mutation_p.T283M|TESPA1_ENST00000531122.1_Missense_Mutation_p.T283M|TESPA1_ENST00000524959.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	421					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.T283M(1)									ATGGGTTTCCGTATTGGTGGC	0.498													G|||	2	0.000399361	0.0008	0.0	5008	,	,		20022	0.001		0.0	False		,,,				2504	0.0				p.T421M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1262T	12						.	G	MET/THR,MET/THR	0,3924		0,0,1962	147.0	150.0	149.0		1262,1262	-2.7	0.0	12	dbSNP_134	149	2,8284		0,2,4141	yes	missense,missense	KIAA0748	NM_001098815.1,NM_001136030.1	81,81	0,2,6103	AA,AG,GG		0.0241,0.0,0.0164	benign,benign	421/522,421/522	55356420	2,12208	1962	4143	6105	53642687	SO:0001583	missense	9840	exon9			AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1262C>T	12.37:g.55356420G>A	ENSP00000400892:p.Thr421Met		53642687	NM_001098815	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	ENST00000449076.1	37	CCDS44913.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	1.146	-0.647973	0.03506	0.0	2.41E-4	ENSG00000135426	ENST00000524622;ENST00000528240;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.46819	0.86;0.86;0.87;0.87;0.86	3.92	-2.7	0.06004	.	1.095960	0.06924	N	0.809818	T	0.22360	0.0539	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17623	-1.0363	10	0.66056	D	0.02	-0.2781	1.1899	0.01862	0.4406:0.0968:0.1697:0.293	.	421	A2RU30	K0748_HUMAN	M	283;21;283;421;421;283	ENSP00000435622:T283M;ENSP00000432030:T283M;ENSP00000400892:T421M;ENSP00000312679:T421M;ENSP00000433098:T283M	ENSP00000312679:T421M	T	-	2	0	KIAA0748	53642687	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.240000	0.18042	-0.531000	0.06340	-2.158000	0.00328	ACG		0.498	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815	
MSRB3	253827	broad.mit.edu	37	12	65722310	65722310	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:65722310T>A	ENST00000355192.3	+	3	337	c.211T>A	c.(211-213)Ttt>Att	p.F71I	MSRB3_ENST00000308259.5_Missense_Mutation_p.F64I|MSRB3_ENST00000540804.1_Missense_Mutation_p.F71I|MSRB3_ENST00000535664.1_Missense_Mutation_p.F64I	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	71					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)	p.F64I(1)|p.F71I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		TATCAGTGCCTTTGAAGGAGA	0.269																																					p.F64I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T190A	12						.						116.0	118.0	118.0					12																	65722310		2203	4296	6499	64008577	SO:0001583	missense	253827	exon4			BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.211T>A	12.37:g.65722310T>A	ENSP00000347324:p.Phe71Ile		64008577	NM_001193461	B4DR19|B7ZAQ0|Q6UXS2	Missense_Mutation	SNP	ENST00000355192.3	37	CCDS8973.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.01|18.01	3.527491|3.527491	0.64860|0.64860	.|.	.|.	ENSG00000174099|ENSG00000174099	ENST00000355192;ENST00000308259;ENST00000540804;ENST00000535664;ENST00000538045;ENST00000535239|ENST00000541189;ENST00000446731	T;T;T;T;T;T|.	0.79749|.	-1.3;-1.3;-1.1;-1.3;-1.1;-1.3|.	5.22|5.22	5.22|5.22	0.72569|0.72569	Mss4-like (1);Methionine sulphoxide reductase B (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88865|0.88865	0.6553|0.6553	H|H	0.98542|0.98542	4.26|4.26	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.995|.	D;D|.	0.76575|.	0.981;0.988|.	D|D	0.93170|0.93170	0.6565|0.6565	9|5	.|.	.|.	.|.	.|.	15.3886|15.3886	0.74723|0.74723	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	71;64|.	Q8IXL7;Q8IXL7-2|.	MSRB3_HUMAN;.|.	I|H	71;64;71;64;64;64|79;22	ENSP00000347324:F71I;ENSP00000312274:F64I;ENSP00000437623:F71I;ENSP00000441650:F64I;ENSP00000442620:F64I;ENSP00000445843:F64I|.	.|.	F|L	+|+	1|2	0|0	MSRB3|MSRB3	64008577|64008577	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	6.757000|6.757000	0.74924|0.74924	2.106000|2.106000	0.64143|0.64143	0.455000|0.455000	0.32223|0.32223	TTT|CTT		0.269	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080	
NAV3	89795	broad.mit.edu	37	12	78415551	78415551	+	Silent	SNP	C	C	T	rs368619435		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:78415551C>T	ENST00000397909.2	+	9	2105	c.1932C>T	c.(1930-1932)acC>acT	p.T644T	NAV3_ENST00000266692.7_Silent_p.T644T|NAV3_ENST00000228327.6_Silent_p.T644T|NAV3_ENST00000536525.2_Silent_p.T644T			Q8IVL0	NAV3_HUMAN	neuron navigator 3	644						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.T644T(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ATGAAGGTACCGCTTTACCAT	0.408										HNSCC(70;0.22)																											p.T644T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1932T	12						.	C		0,4030		0,0,2015	108.0	109.0	108.0		1932	-2.3	1.0	12		108	1,8391		0,1,4195	no	coding-synonymous	NAV3	NM_014903.4		0,1,6210	TT,TC,CC		0.0119,0.0,0.0081		644/2364	78415551	1,12421	2015	4196	6211	76939682	SO:0001819	synonymous_variant	89795	exon9			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.1932C>T	12.37:g.78415551C>T			76939682	NM_014903	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37																																																																																					0.408	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
TMEM132D	121256	broad.mit.edu	37	12	129566495	129566495	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr12:129566495G>A	ENST00000422113.2	-	7	2058	c.1732C>T	c.(1732-1734)Cgg>Tgg	p.R578W	TMEM132D_ENST00000389441.4_Missense_Mutation_p.R116W	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	578					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.R578W(2)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GTCAGGACCCGCACCATGGCG	0.652																																					p.R578W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1732T	12						.						45.0	47.0	47.0					12																	129566495		2203	4299	6502	128132448	SO:0001583	missense	121256	exon7			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1732C>T	12.37:g.129566495G>A	ENSP00000408581:p.Arg578Trp		128132448	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787869	0.70337	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.55588	0.51;0.51	4.72	3.76	0.43208	.	0.101204	0.42964	D	0.000622	T	0.74741	0.3756	M	0.88105	2.93	0.44619	D	0.997599	D;D	0.89917	1.0;1.0	D;D	0.85130	0.984;0.997	T	0.79671	-0.1706	9	.	.	.	-44.7815	12.9732	0.58524	0.0:0.0:0.7201:0.2798	.	578;116	Q14C87;Q14C87-2	T132D_HUMAN;.	W	116;578	ENSP00000374092:R116W;ENSP00000408581:R578W	.	R	-	1	2	TMEM132D	128132448	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.775000	0.47702	2.149000	0.67028	0.561000	0.74099	CGG		0.652	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
TUBA3C	7278	broad.mit.edu	37	13	19752431	19752431	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr13:19752431G>A	ENST00000400113.3	-	3	434	c.330C>T	c.(328-330)atC>atT	p.I110I		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	110					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.I110I(2)		NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCTCCTTGCCGATGGTGTAAT	0.542																																					p.I110I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C330T	13						.						222.0	188.0	200.0					13																	19752431		2203	4300	6503	18650431	SO:0001819	synonymous_variant	7278	exon3			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.330C>T	13.37:g.19752431G>A			18650431	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000400113.3	37	CCDS9284.1																																																																																				0.542	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
RBM26	64062	broad.mit.edu	37	13	79932499	79932499	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr13:79932499C>A	ENST00000438737.2	-	11	2039	c.1599G>T	c.(1597-1599)aaG>aaT	p.K533N	RBM26_ENST00000438724.1_Missense_Mutation_p.K533N|RBM26_ENST00000267229.7_Missense_Mutation_p.K533N			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	533	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K533N(2)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		TAAGTTCAAGCTTGGTATTTT	0.328																																					p.K533N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1599T	13						.						78.0	82.0	81.0					13																	79932499		2202	4300	6502	78830500	SO:0001583	missense	64062	exon11			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.1599G>T	13.37:g.79932499C>A	ENSP00000387531:p.Lys533Asn		78830500	NM_022118	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	ENST00000438737.2	37		.	.	.	.	.	.	.	.	.	.	C	17.65	3.441065	0.63067	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	T;T	0.50813	0.73;0.73	5.14	2.7	0.31948	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	L	0.49640	1.575	0.58432	D	0.999996	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.994;0.996	T	0.53885	-0.8375	9	.	.	.	-22.9164	9.1056	0.36696	0.0:0.1511:0.0:0.8489	.	533;533;533	Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;RBM26_HUMAN;.	N	533;534;533;533	ENSP00000267229:K533N;ENSP00000390222:K533N	.	K	-	3	2	RBM26	78830500	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.763000	0.38461	0.893000	0.36288	-0.483000	0.04790	AAG		0.328	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4	NM_022118	
TPP2	7174	broad.mit.edu	37	13	103268839	103268839	+	Missense_Mutation	SNP	G	G	A	rs202026163		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr13:103268839G>A	ENST00000376065.4	+	4	520	c.484G>A	c.(484-486)Ggc>Agc	p.G162S	TPP2_ENST00000376052.3_Missense_Mutation_p.G162S	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	162	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.G162S(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGCCAACAACGGCTCTTCTCA	0.413																																					p.G162S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G484A	13						.						87.0	92.0	90.0					13																	103268839		2203	4300	6503	102066840	SO:0001583	missense	7174	exon4			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.484G>A	13.37:g.103268839G>A	ENSP00000365233:p.Gly162Ser		102066840	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	G	5.997	0.367897	0.11352	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.55	2.91	0.33838	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.356145	0.32459	N	0.006067	T	0.16428	0.0395	N	0.13043	0.29	0.26312	N	0.977801	B	0.02656	0.0	B	0.04013	0.001	T	0.26815	-1.0092	9	0.08381	T	0.77	.	6.7401	0.23431	0.1165:0.0:0.3537:0.5298	.	162	P29144	TPP2_HUMAN	S	162	.	ENSP00000365220:G162S	G	+	1	0	TPP2	102066840	0.996000	0.38824	0.304000	0.25085	0.959000	0.62525	3.295000	0.51794	0.633000	0.30452	0.585000	0.79938	GGC		0.413	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
NGB	58157	broad.mit.edu	37	14	77735634	77735634	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr14:77735634A>G	ENST00000298352.4	-	2	499	c.125T>C	c.(124-126)tTc>tCc	p.F42S		NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	42	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)	p.F42S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		GTTGTACTGGAAGAGGGGCAG	0.627																																					p.F42S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T125C	14						.						43.0	31.0	35.0					14																	77735634		2097	4097	6194	76805387	SO:0001583	missense	58157	exon2			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.125T>C	14.37:g.77735634A>G	ENSP00000298352:p.Phe42Ser		76805387	NM_021257		Missense_Mutation	SNP	ENST00000298352.4	37	CCDS9856.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082876	0.76642	.	.	ENSG00000165553	ENST00000298352	D	0.99850	-7.16	4.88	2.48	0.30137	Globin-like (1);Globin, structural domain (1);	0.100795	0.64402	D	0.000001	D	0.99576	0.9847	M	0.78637	2.42	0.49130	D	0.999754	D	0.65815	0.995	P	0.58873	0.847	D	0.99167	1.0863	10	0.87932	D	0	-31.1297	5.4088	0.16336	0.7296:0.1774:0.0929:0.0	.	42	Q9NPG2	NGB_HUMAN	S	42	ENSP00000298352:F42S	ENSP00000298352:F42S	F	-	2	0	NGB	76805387	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.237000	0.65360	0.230000	0.21059	0.459000	0.35465	TTC		0.627	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414194.1	NM_021257	
FURIN	5045	broad.mit.edu	37	15	91424578	91424579	+	Frame_Shift_Ins	INS	-	-	C	rs201334295		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr15:91424578_91424579insC	ENST00000268171.3	+	16	2134_2135	c.1855_1856insC	c.(1855-1857)gccfs	p.A619fs		NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	619					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q621fs*8(1)		breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TCCAGGGTTCGCCCCCCAAGTC	0.634																																					p.A619fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1855_1856insC	15						.																																			89225583	SO:0001589	frameshift_variant	5045	exon16			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1861dupC	15.37:g.91424584_91424584dupC	ENSP00000268171:p.Ala619fs		89225582	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Frame_Shift_Ins	INS	ENST00000268171.3	37	CCDS10364.1																																																																																				0.634	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
GJD2	57369	broad.mit.edu	37	15	35045073	35045073	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr15:35045073C>T	ENST00000290374.4	-	2	1048	c.572G>A	c.(571-573)aGg>aAg	p.R191K	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	191					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)	p.R191K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		GCCTTCCTGCCTTCTGAGCTT	0.478																																					p.R191K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G572A	15						.						131.0	138.0	136.0					15																	35045073		2201	4298	6499	32832365	SO:0001583	missense	57369	exon2			AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.572G>A	15.37:g.35045073C>T	ENSP00000290374:p.Arg191Lys		32832365	NM_020660	Q2M241|Q9P2R0	Missense_Mutation	SNP	ENST00000290374.4	37	CCDS10040.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214092	0.58452	.	.	ENSG00000159248	ENST00000290374	D	0.97976	-4.64	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.94742	0.8303	L	0.34521	1.04	0.80722	D	1	P	0.35612	0.512	B	0.35073	0.195	D	0.92756	0.6220	10	0.02654	T	1	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	191	Q9UKL4	CXD2_HUMAN	K	191	ENSP00000290374:R191K	ENSP00000290374:R191K	R	-	2	0	GJD2	32832365	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.818000	0.86416	2.890000	0.99128	0.650000	0.86243	AGG		0.478	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251875.2		
FBN1	2200	broad.mit.edu	37	15	48802322	48802322	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr15:48802322G>A	ENST00000316623.5	-	14	2088	c.1633C>T	c.(1633-1635)Cgc>Tgc	p.R545C		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	545	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		R -> C (in MFS). {ECO:0000269|PubMed:11700157, ECO:0000269|PubMed:9338581}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R545C(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTGATGCAGCGTCCATTATTG	0.358																																					p.R545C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1633T	15	GRCh37	CD040176|CM970507	FBN1	D|M		.						102.0	90.0	94.0					15																	48802322		2197	4296	6493	46589614	SO:0001583	missense	2200	exon14			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1633C>T	15.37:g.48802322G>A	ENSP00000325527:p.Arg545Cys		46589614	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	32	5.120406	0.94385	.	.	ENSG00000166147	ENST00000316623	D	0.92199	-2.99	5.5	5.5	0.81552	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96932	0.8998	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96721	0.9532	10	0.48119	T	0.1	.	18.3167	0.90224	0.0:0.0:1.0:0.0	.	545	P35555	FBN1_HUMAN	C	545	ENSP00000325527:R545C	ENSP00000325527:R545C	R	-	1	0	FBN1	46589614	1.000000	0.71417	0.861000	0.33841	0.946000	0.59487	7.939000	0.87685	2.736000	0.93811	0.591000	0.81541	CGC		0.358	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
SLTM	79811	broad.mit.edu	37	15	59186662	59186662	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr15:59186662C>T	ENST00000380516.2	-	10	1434	c.1347G>A	c.(1345-1347)gaG>gaA	p.E449E	SLTM_ENST00000536328.1_Silent_p.E18E|AC025918.2_ENST00000452467.1_RNA	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	449	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E449E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GTCCATGCAGCTCAGTGCGAT	0.418																																					p.E449E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1347A	15						.						147.0	136.0	139.0					15																	59186662		2192	4292	6484	56973954	SO:0001819	synonymous_variant	79811	exon10			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1347G>A	15.37:g.59186662C>T			56973954	NM_024755	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Silent	SNP	ENST00000380516.2	37	CCDS10168.2																																																																																				0.418	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157124.1	NM_024755	
ADAMTS7	11173	broad.mit.edu	37	15	79067099	79067099	+	Silent	SNP	G	G	C	rs142017909	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr15:79067099G>C	ENST00000388820.4	-	12	1953	c.1743C>G	c.(1741-1743)cgC>cgG	p.R581R	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	581	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R581R(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GGAAGCGCTTGCGCTCACCCA	0.647																																					p.R581R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1743G	15						.						69.0	79.0	76.0					15																	79067099		2196	4292	6488	76854154	SO:0001819	synonymous_variant	11173	exon12			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1743C>G	15.37:g.79067099G>C			76854154	NM_014272	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																				0.647	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
CDH3	1001	broad.mit.edu	37	16	68679313	68679315	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	CTC	CTC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr16:68679313_68679315delCTC	ENST00000264012.4	+	1	575_577	c.31_33delCTC	c.(31-33)ctcdel	p.L14del	CDH3_ENST00000581171.1_5'UTR|CDH3_ENST00000429102.2_In_Frame_Del_p.L14del|RP11-615I2.2_ENST00000562172.1_RNA	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	14					adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L11delL(1)|p.?(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TCTCGCGTCTCTCCTCCTTCTCC	0.719																																					p.11_11del												.	.	2	Unknown(1)|Deletion - In frame(1)	large_intestine(1)|breast(1)	c.31_33del	16						.			15,4249		7,1,2124						0.7	0.1			48	22,8232		9,4,4114	no	coding	CDH3	NM_001793.4		16,5,6238	A1A1,A1R,RR		0.2665,0.3518,0.2956				37,12481				67236816	SO:0001651	inframe_deletion	1001	exon1			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.31_33delCTC	16.37:g.68679316_68679318delCTC	ENSP00000264012:p.Leu14del		67236814	NM_001793	B2R6F4|Q05DI6	In_Frame_Del	DEL	ENST00000264012.4	37	CCDS10868.1																																																																																				0.719	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268896.2	NM_001793	
EXOC7	23265	broad.mit.edu	37	17	74085270	74085270	+	Missense_Mutation	SNP	C	C	T	rs372862629		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr17:74085270C>T	ENST00000335146.7	-	9	1239	c.1186G>A	c.(1186-1188)Gac>Aac	p.D396N	EXOC7_ENST00000589210.1_Missense_Mutation_p.D345N|EXOC7_ENST00000411744.2_Missense_Mutation_p.D337N|EXOC7_ENST00000467929.2_Missense_Mutation_p.D304N|EXOC7_ENST00000405575.4_Missense_Mutation_p.D368N|EXOC7_ENST00000332065.5_Missense_Mutation_p.D314N|EXOC7_ENST00000607838.1_Missense_Mutation_p.D368N			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	396					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)		p.D345N(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			ATCAGGGAGTCGAAGGTCTTC	0.632																																					p.D368N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1102A	17						.	C	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	88.0	95.0	93.0		1033,1186,1009,1102,940	5.0	0.9	17		93	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	EXOC7	NM_001013839.2,NM_001145297.2,NM_001145298.2,NM_001145299.2,NM_015219.3	23,23,23,23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	345/685,396/736,337/677,368/708,314/654	74085270	1,13005	2203	4300	6503	71596865	SO:0001583	missense	23265	exon9			BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1186G>A	17.37:g.74085270C>T	ENSP00000334100:p.Asp396Asn		71596865	NM_001145299	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	37	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	C	32	5.162196	0.94727	0.0	1.16E-4	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	4.98	4.98	0.66077	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;0.971;1.0;0.998;0.999;0.991;0.998	D;P;D;P;D;P;P	0.75484	0.928;0.484;0.986;0.865;0.939;0.732;0.863	T	0.71919	-0.4447	9	0.17369	T	0.5	-29.4878	18.2619	0.90038	0.0:1.0:0.0:0.0	.	337;368;304;304;396;314;345	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	N	314;234;368;396;345;304;337	.	ENSP00000333806:D314N	D	-	1	0	EXOC7	71596865	1.000000	0.71417	0.900000	0.35374	0.960000	0.62799	5.665000	0.68052	2.300000	0.77407	0.557000	0.71058	GAC		0.632	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
NTN1	9423	broad.mit.edu	37	17	9086250	9086250	+	Missense_Mutation	SNP	C	C	A	rs376278603		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr17:9086250C>A	ENST00000173229.2	+	5	1482	c.1375C>A	c.(1375-1377)Ccg>Acg	p.P459T	NTN1_ENST00000538852.1_Missense_Mutation_p.P459T|NTN1_ENST00000546090.1_Missense_Mutation_p.P459T	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	459					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.P459T(1)	NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						TGTAGCGCCGCCGACGACTGC	0.567																																					p.P459T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1375A	17						.	C	THR/PRO	0,4406		0,0,2203	96.0	104.0	101.0		1375	5.8	0.2	17		101	2,8598	2.2+/-6.3	0,2,4298	no	missense	NTN1	NM_004822.2	38	0,2,6501	AA,AC,CC		0.0233,0.0,0.0154	benign	459/605	9086250	2,13004	2203	4300	6503	9026975	SO:0001583	missense	9423	exon5			U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1375C>A	17.37:g.9086250C>A	ENSP00000173229:p.Pro459Thr		9026975	NM_004822	E9KL51	Missense_Mutation	SNP	ENST00000173229.2	37	CCDS11148.1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469735	0.26423	0.0	2.33E-4	ENSG00000065320	ENST00000173229;ENST00000538852;ENST00000546090;ENST00000436734	T;T;T;T	0.33654	1.4;1.4;1.4;2.84	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.37785	0.1016	M	0.67953	2.075	0.80722	D	1	B	0.26512	0.151	B	0.24269	0.052	T	0.37888	-0.9686	10	0.06625	T	0.88	.	20.1195	0.97955	0.0:1.0:0.0:0.0	.	459	O95631	NET1_HUMAN	T	459;459;459;79	ENSP00000173229:P459T;ENSP00000443259:P459T;ENSP00000441611:P459T;ENSP00000389375:P79T	ENSP00000173229:P459T	P	+	1	0	NTN1	9026975	1.000000	0.71417	0.192000	0.23308	0.025000	0.11179	7.016000	0.76393	2.759000	0.94783	0.650000	0.86243	CCG		0.567	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252583.1		
CYGB	114757	broad.mit.edu	37	17	74527682	74527682	+	Missense_Mutation	SNP	G	G	A	rs373180768		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr17:74527682G>A	ENST00000293230.5	-	2	597	c.235C>T	c.(235-237)Cgg>Tgg	p.R79W	PRCD_ENST00000592432.1_Intron|CYGB_ENST00000590175.1_Missense_Mutation_p.R14W|CYGB_ENST00000589342.1_Missense_Mutation_p.R79W|CYGB_ENST00000589145.1_Missense_Mutation_p.R14W|CYGB_ENST00000586160.1_5'Flank	NM_134268.4	NP_599030.1	Q8WWM9	CYGB_HUMAN	cytoglobin	79	Globin.				oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)|peroxidase activity (GO:0004601)	p.R79W(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)	7						GCGTGCTTCCGCAGCTGGGGG	0.607																																					p.R79W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C235T	17						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	64.0	64.0	64.0		235	5.4	1.0	17		64	0,8600		0,0,4300	no	missense	CYGB	NM_134268.3	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	79/191	74527682	1,13005	2203	4300	6503	72039277	SO:0001583	missense	114757	exon2			AJ315162	CCDS11746.1	17q25	2008-07-18				ENSG00000161544			16505	protein-coding gene	gene with protein product	"""stellate cell activation-associated protein"", ""histoglobin"""	608759				11919282	Standard	NM_134268		Approved	HGB, STAP	uc002jru.2	Q8WWM9		ENST00000293230.5:c.235C>T	17.37:g.74527682G>A	ENSP00000293230:p.Arg79Trp		72039277	NM_134268	Q541Y7|Q8N2X5	Missense_Mutation	SNP	ENST00000293230.5	37	CCDS11746.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288743	0.80914	2.27E-4	0.0	ENSG00000161544	ENST00000293230	D	0.93712	-3.27	5.4	5.4	0.78164	Globin-like (1);Globin, structural domain (1);	0.000000	0.85682	D	0.000000	D	0.97532	0.9192	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98252	1.0494	10	0.87932	D	0	-11.1779	19.1688	0.93569	0.0:0.0:1.0:0.0	.	79	Q8WWM9	CYGB_HUMAN	W	79	ENSP00000293230:R79W	ENSP00000293230:R79W	R	-	1	2	CYGB	72039277	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.182000	0.58310	2.536000	0.85505	0.462000	0.41574	CGG		0.607	CYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450590.1	NM_134268	
MIB1	57534	broad.mit.edu	37	18	19429197	19429197	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr18:19429197G>T	ENST00000261537.6	+	17	2698	c.2434G>T	c.(2434-2436)Gat>Tat	p.D812Y	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	812					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D812Y(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GATTAGTAATGATTCTGAAAC	0.348																																					p.D812Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2434T	18						.						200.0	200.0	200.0					18																	19429197		2203	4300	6503	17683195	SO:0001583	missense	57534	exon17			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2434G>T	18.37:g.19429197G>T	ENSP00000261537:p.Asp812Tyr		17683195	NM_020774	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	37	CCDS11871.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.900294	0.52227	.	.	ENSG00000101752	ENST00000261537	T	0.38240	1.15	5.33	5.33	0.75918	.	0.048325	0.85682	D	0.000000	T	0.41305	0.1153	N	0.08118	0	0.54753	D	0.999988	D	0.61697	0.99	D	0.70487	0.969	T	0.48328	-0.9045	10	0.36615	T	0.2	-20.6605	19.042	0.93004	0.0:0.0:1.0:0.0	.	812	Q86YT6	MIB1_HUMAN	Y	812	ENSP00000261537:D812Y	ENSP00000261537:D812Y	D	+	1	0	MIB1	17683195	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.391000	0.79828	2.494000	0.84150	0.585000	0.79938	GAT		0.348	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	
ACTL9	284382	broad.mit.edu	37	19	8807881	8807881	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr19:8807881G>A	ENST00000324436.3	-	1	1291	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R391C(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TGGAAGGCGCGCAGGGAGGCC	0.652																																					p.R391C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1171T	19						.						37.0	39.0	38.0					19																	8807881		2203	4299	6502	8668881	SO:0001583	missense	284382	exon1				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1171C>T	19.37:g.8807881G>A	ENSP00000316674:p.Arg391Cys		8668881	NM_178525	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	37	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	g	10.61	1.399657	0.25291	.	.	ENSG00000181786	ENST00000324436	T	0.08193	3.12	4.51	2.23	0.28157	.	0.317190	0.22565	N	0.058402	T	0.12220	0.0297	L	0.29908	0.895	0.35755	D	0.81972	D	0.76494	0.999	P	0.60886	0.88	T	0.17684	-1.0361	10	0.87932	D	0	.	6.1475	0.20293	0.0884:0.0:0.5749:0.3367	.	391	Q8TC94	ACTL9_HUMAN	C	391	ENSP00000316674:R391C	ENSP00000316674:R391C	R	-	1	0	ACTL9	8668881	0.013000	0.17824	0.431000	0.26735	0.759000	0.43091	0.742000	0.26216	0.564000	0.29238	0.457000	0.33378	CGC		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	NM_178525	
ZNF808	388558	broad.mit.edu	37	19	53050783	53050783	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr19:53050783G>A	ENST00000359798.4	+	4	262	c.82G>A	c.(82-84)Gat>Aat	p.D28N		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		GACTTTCAGGGATGTGGCTAT	0.413																																					p.D28N												.	.	0			c.G82A	19						.						119.0	127.0	124.0					19																	53050783		2203	4300	6503	57742595	SO:0001583	missense	388558	exon4			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.82G>A	19.37:g.53050783G>A	ENSP00000352846:p.Asp28Asn		57742595	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	37	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	16.81	3.226060	0.58668	.	.	ENSG00000198482	ENST00000359798;ENST00000465448;ENST00000461779;ENST00000461321	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	2.29	2.29	0.28610	Krueppel-associated box (4);	.	.	.	.	T	0.49012	0.1532	H	0.98866	4.355	0.23798	N	0.996816	D	0.89917	1.0	D	0.97110	1.0	T	0.50092	-0.8868	9	0.87932	D	0	.	11.2779	0.49178	0.0:0.0:1.0:0.0	.	28	Q8N4W9	ZN808_HUMAN	N	28	ENSP00000352846:D28N;ENSP00000419291:D28N;ENSP00000417727:D28N;ENSP00000418696:D28N	ENSP00000352846:D28N	D	+	1	0	ZNF808	57742595	0.997000	0.39634	0.050000	0.19076	0.255000	0.26057	4.374000	0.59543	1.090000	0.41315	0.174000	0.16983	GAT		0.413	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
MOV10	4343	broad.mit.edu	37	1	113235545	113235545	+	Silent	SNP	G	G	A	rs114735246	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:113235545G>A	ENST00000413052.2	+	7	1524	c.1134G>A	c.(1132-1134)acG>acA	p.T378T	MOV10_ENST00000369645.1_Silent_p.T378T|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369644.1_Silent_p.T322T|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000357443.2_Silent_p.T378T	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	378					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.T378T(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		GGCTGCTCACGCTGGAGGTCA	0.592																																					p.T378T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1134A	1						.						25.0	23.0	24.0					1																	113235545		2203	4300	6503	113037068	SO:0001819	synonymous_variant	4343	exon7			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1134G>A	1.37:g.113235545G>A			113037068	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	ENST00000413052.2	37	CCDS853.1																																																																																				0.592	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
FLG	2312	broad.mit.edu	37	1	152282954	152282954	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:152282954G>T	ENST00000368799.1	-	3	4443	c.4408C>A	c.(4408-4410)Cat>Aat	p.H1470N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1470	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H1470N(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGCTCATGGCGGGATCCT	0.572									Ichthyosis																												p.H1470N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4408A	1						.						287.0	276.0	280.0					1																	152282954		2203	4300	6503	150549578	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4408C>A	1.37:g.152282954G>T	ENSP00000357789:p.His1470Asn		150549578	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	4.371	0.068358	0.08436	.	.	ENSG00000143631	ENST00000368799	T	0.04015	3.73	3.61	1.69	0.24217	.	.	.	.	.	T	0.01454	0.0047	L	0.56769	1.78	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46541	-0.9184	9	0.16420	T	0.52	.	4.1035	0.10025	0.1236:0.0:0.646:0.2303	.	1470	P20930	FILA_HUMAN	N	1470	ENSP00000357789:H1470N	ENSP00000357789:H1470N	H	-	1	0	FLG	150549578	0.001000	0.12720	0.001000	0.08648	0.031000	0.12232	0.685000	0.25378	0.863000	0.35553	-0.255000	0.11280	CAT		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CEP350	9857	broad.mit.edu	37	1	180047703	180047703	+	Missense_Mutation	SNP	C	C	T	rs149801617	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:180047703C>T	ENST00000367607.3	+	29	6291	c.5873C>T	c.(5872-5874)tCc>tTc	p.S1958F		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1958					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S1958F(1)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TATGTACCATCCGAGTCTATA	0.443																																					p.S1958F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5873T	1						.	C	PHE/SER	0,4406		0,0,2203	60.0	59.0	60.0		5873	5.3	0.3	1	dbSNP_134	60	4,8596	3.7+/-12.6	0,4,4296	yes	missense	CEP350	NM_014810.4	155	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging	1958/3118	180047703	4,13002	2203	4300	6503	178314326	SO:0001583	missense	9857	exon29			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.5873C>T	1.37:g.180047703C>T	ENSP00000356579:p.Ser1958Phe		178314326	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281263	0.59758	0.0	4.65E-4	ENSG00000135837	ENST00000367607	T	0.54675	0.56	5.31	5.31	0.75309	.	0.313987	0.23063	N	0.052351	T	0.60971	0.2310	L	0.57536	1.79	0.25756	N	0.985002	D;P	0.53885	0.963;0.94	P;P	0.51266	0.642;0.664	T	0.57081	-0.7872	9	.	.	.	.	17.5204	0.87786	0.0:1.0:0.0:0.0	.	1958;1958	E7EU22;Q5VT06	.;CE350_HUMAN	F	1958	ENSP00000356579:S1958F	.	S	+	2	0	CEP350	178314326	0.442000	0.25633	0.278000	0.24718	0.392000	0.30506	2.535000	0.45685	2.649000	0.89929	0.591000	0.81541	TCC		0.443	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
ANGEL2	90806	broad.mit.edu	37	1	213181764	213181764	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:213181764C>G	ENST00000366962.3	-	3	584	c.430G>C	c.(430-432)Gaa>Caa	p.E144Q	ANGEL2_ENST00000360506.2_5'UTR|ANGEL2_ENST00000544555.1_5'UTR|ANGEL2_ENST00000535388.1_5'UTR|ANGEL2_ENST00000540642.1_Missense_Mutation_p.E18Q	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	144								p.E144Q(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		TTCGTTTTTTCTTTATCATGG	0.323																																					p.E144Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G430C	1						.						133.0	129.0	130.0					1																	213181764		2203	4300	6503	211248387	SO:0001583	missense	90806	exon3			AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.430G>C	1.37:g.213181764C>G	ENSP00000355929:p.Glu144Gln		211248387	NM_144567	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	ENST00000366962.3	37	CCDS1512.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.206721	0.39003	.	.	ENSG00000174606	ENST00000366962;ENST00000540642;ENST00000310246	T;T	0.30981	1.86;1.51	5.76	5.76	0.90799	.	0.597438	0.18263	N	0.146549	T	0.27098	0.0664	L	0.29908	0.895	0.80722	D	1	B;B;B	0.32968	0.068;0.392;0.041	B;B;B	0.36666	0.126;0.23;0.043	T	0.03910	-1.0993	10	0.24483	T	0.36	-7.6566	15.4858	0.75564	0.0:1.0:0.0:0.0	.	18;122;144	F5H476;Q96AL9;Q5VTE6	.;.;ANGE2_HUMAN	Q	144;18;122	ENSP00000355929:E144Q;ENSP00000446124:E18Q	ENSP00000309755:E122Q	E	-	1	0	ANGEL2	211248387	1.000000	0.71417	0.992000	0.48379	0.294000	0.27393	3.922000	0.56462	2.706000	0.92434	0.655000	0.94253	GAA		0.323	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089693.1	NM_144567	
ELAVL4	1996	broad.mit.edu	37	1	50666847	50666847	+	Silent	SNP	C	C	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:50666847C>A	ENST00000371823.4	+	7	1364	c.1140C>A	c.(1138-1140)tcC>tcA	p.S380S	ELAVL4_ENST00000448907.2_Silent_p.S369S|ELAVL4_ENST00000371827.1_Silent_p.S366S|ELAVL4_ENST00000371824.1_Silent_p.S366S|ELAVL4_ENST00000371819.1_Silent_p.S371S|ELAVL4_ENST00000371821.1_Silent_p.S385S|ELAVL4_ENST00000357083.4_Silent_p.S383S	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	380					mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.S380S(1)|p.S383S(1)		NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						CCCACAAGTCCTGAATTTCCC	0.443																																					p.S366S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1098A	1						.						20.0	20.0	20.0					1																	50666847		2195	4288	6483	50439434	SO:0001819	synonymous_variant	1996	exon7			AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.1140C>A	1.37:g.50666847C>A			50439434	NM_001144774	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Silent	SNP	ENST00000371823.4	37	CCDS553.1																																																																																				0.443	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000021712.1	NM_021952	
IFI44L	10964	broad.mit.edu	37	1	79093736	79093736	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:79093736C>T	ENST00000370751.5	+	2	315	c.136C>T	c.(136-138)Cgt>Tgt	p.R46C	IFI44L_ENST00000342282.3_Intron|IFI44L_ENST00000476521.1_Intron	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	46					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)		p.R7C(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						AAGATGCAGCCGTCAGGGATG	0.363																																					p.R46C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C136T	1						.						78.0	79.0	79.0					1																	79093736		2203	4300	6503	78866324	SO:0001583	missense	10964	exon2			AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.136C>T	1.37:g.79093736C>T	ENSP00000359787:p.Arg46Cys		78866324	NM_006820	Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	37	CCDS687.2	.	.	.	.	.	.	.	.	.	.	C	6.305	0.424379	0.11928	.	.	ENSG00000137959	ENST00000452835;ENST00000370751;ENST00000450498	T;T;T	0.32515	1.45;3.07;2.48	3.41	-6.83	0.01693	.	1.843670	0.03430	N	0.207711	T	0.02418	0.0074	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16512	-1.0400	10	0.35671	T	0.21	5.3548	0.8249	0.01118	0.4079:0.2237:0.113:0.2554	.	46	Q53G44	IF44L_HUMAN	C	46;46;23	ENSP00000409914:R46C;ENSP00000359787:R46C;ENSP00000400784:R23C	ENSP00000359787:R46C	R	+	1	0	IFI44L	78866324	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.650000	0.00203	-1.778000	0.01282	-0.718000	0.03613	CGT		0.363	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	
SPATA17	128153	broad.mit.edu	37	1	217804761	217804761	+	Missense_Mutation	SNP	T	T	C	rs143300149	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:217804761T>C	ENST00000366933.4	+	1	96	c.41T>C	c.(40-42)gTa>gCa	p.V14A	GPATCH2_ENST00000366934.3_5'Flank|GPATCH2_ENST00000366935.3_5'Flank	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	14						cytoplasm (GO:0005737)		p.V14A(1)		endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TCGTCGACTGTAGGAAATCAG	0.517																																					p.V14A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T41C	1						.	T	ALA/VAL	10,4396	16.8+/-37.8	0,10,2193	94.0	84.0	87.0		41	4.5	0.0	1	dbSNP_134	87	0,8600		0,0,4300	yes	missense	SPATA17	NM_138796.2	64	0,10,6493	CC,CT,TT		0.0,0.227,0.0769	benign	14/362	217804761	10,12996	2203	4300	6503	215871384	SO:0001583	missense	128153	exon1			AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.41T>C	1.37:g.217804761T>C	ENSP00000355900:p.Val14Ala		215871384	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	37	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.423711	0.43020	0.00227	0.0	ENSG00000162814	ENST00000366933	T	0.71817	-0.6	4.47	4.47	0.54385	.	1.635520	0.03548	N	0.225053	T	0.66944	0.2841	L	0.36672	1.1	0.09310	N	1	B	0.19817	0.039	B	0.19946	0.027	T	0.54576	-0.8273	10	0.66056	D	0.02	-0.0091	11.5437	0.50681	0.0:0.0:0.0:1.0	.	14	Q96L03	SPT17_HUMAN	A	14	ENSP00000355900:V14A	ENSP00000355900:V14A	V	+	2	0	SPATA17	215871384	0.007000	0.16637	0.010000	0.14722	0.069000	0.16628	1.921000	0.40035	2.003000	0.58678	0.533000	0.62120	GTA		0.517	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
C1orf35	79169	broad.mit.edu	37	1	228289097	228289099	+	In_Frame_Del	DEL	TTC	TTC	-	rs370819690		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	TTC	TTC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr1:228289097_228289099delTTC	ENST00000272139.4	-	7	843_845	c.609_611delGAA	c.(607-612)aagaaa>aaa	p.203_204KK>K	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	203	Lys-rich.						poly(A) RNA binding (GO:0044822)	p.K204delK(1)		large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				CTCTTTGTCTttcttcttcttct	0.517																																					p.203_204del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.609_611del	1						.																																			226355722	SO:0001651	inframe_deletion	79169	exon7			AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.609_611delGAA	1.37:g.228289106_228289108delTTC	ENSP00000272139:p.Lys204del		226355720	NM_024319	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	In_Frame_Del	DEL	ENST00000272139.4	37	CCDS1566.1																																																																																				0.517	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092245.1	NM_024319	
PDYN	5173	broad.mit.edu	37	20	1961096	1961096	+	Missense_Mutation	SNP	C	C	T	rs373922212		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr20:1961096C>T	ENST00000217305.2	-	4	863	c.638G>A	c.(637-639)cGc>cAc	p.R213H	PDYN_ENST00000539905.1_Missense_Mutation_p.R213H|PDYN_ENST00000540134.1_Missense_Mutation_p.R213H|RP4-684O24.5_ENST00000446562.1_RNA	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	213					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.R213H(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGACGAATGCGCCGCAAGAA	0.592																																					p.R213H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G638A	20						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	102.0	112.0	108.0		638,638,638,638,638	5.0	1.0	20		108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	PDYN	NM_001190892.1,NM_001190898.2,NM_001190899.2,NM_001190900.1,NM_024411.4	29,29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	213/255,213/255,213/255,213/255,213/255	1961096	1,13005	2203	4300	6503	1909096	SO:0001583	missense	5173	exon3				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.638G>A	20.37:g.1961096C>T	ENSP00000217305:p.Arg213His		1909096	NM_001190892	A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	37	CCDS13023.1	.	.	.	.	.	.	.	.	.	.	C	31	5.093258	0.94149	0.0	1.16E-4	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.83419	-1.72;-1.72;-1.72	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.92189	0.7523	M	0.89095	3.005	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.93235	0.6621	10	0.66056	D	0.02	-19.9746	15.8394	0.78835	0.0:1.0:0.0:0.0	.	213	P01213	PDYN_HUMAN	H	213	ENSP00000440185:R213H;ENSP00000442259:R213H;ENSP00000217305:R213H	ENSP00000217305:R213H	R	-	2	0	PDYN	1909096	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.347000	0.73004	2.603000	0.88011	0.313000	0.20887	CGC		0.592	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2		
SLC24A3	57419	broad.mit.edu	37	20	19665779	19665779	+	Silent	SNP	C	C	T	rs370751183		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr20:19665779C>T	ENST00000328041.6	+	12	1295	c.1098C>T	c.(1096-1098)aaC>aaT	p.N366N		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	366					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)	p.N366N(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CTTATACCAACGGGGAATCTG	0.517																																					p.N366N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1098T	20						.	C		2,4404	4.2+/-10.8	0,2,2201	84.0	84.0	84.0		1098	-0.6	1.0	20		84	0,8600		0,0,4300	no	coding-synonymous	SLC24A3	NM_020689.3		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		366/645	19665779	2,13004	2203	4300	6503	19613779	SO:0001819	synonymous_variant	57419	exon12			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1098C>T	20.37:g.19665779C>T			19613779	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Silent	SNP	ENST00000328041.6	37	CCDS13140.1																																																																																				0.517	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	
SSTR4	6754	broad.mit.edu	37	20	23016830	23016830	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr20:23016830A>T	ENST00000255008.3	+	1	774	c.710A>T	c.(709-711)aAg>aTg	p.K237M	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	237					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.K237M(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					ATCGTGGGCAAGATGCGCGCC	0.647																																					p.K237M	Esophageal Squamous(15;850 1104 16640)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A710T	20						.						78.0	86.0	83.0					20																	23016830		2172	4285	6457	22964830	SO:0001583	missense	6754	exon1				CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.710A>T	20.37:g.23016830A>T	ENSP00000255008:p.Lys237Met		22964830	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.179737	0.57800	.	.	ENSG00000132671	ENST00000255008	T	0.38887	1.11	3.6	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.082939	0.43416	U	0.000570	T	0.68476	0.3005	M	0.91090	3.175	0.44155	D	0.996957	D	0.76494	0.999	D	0.75484	0.986	T	0.75436	-0.3318	10	0.87932	D	0	.	11.1475	0.48438	1.0:0.0:0.0:0.0	.	237	P31391	SSR4_HUMAN	M	237	ENSP00000255008:K237M	ENSP00000255008:K237M	K	+	2	0	SSTR4	22964830	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.495000	0.60353	1.481000	0.48307	0.533000	0.62120	AAG		0.647	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
NFATC2	4773	broad.mit.edu	37	20	50048703	50048703	+	Missense_Mutation	SNP	C	C	T	rs553983994		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr20:50048703C>T	ENST00000396009.3	-	9	2842	c.2623G>A	c.(2623-2625)Gcc>Acc	p.A875T	NFATC2_ENST00000610033.1_Missense_Mutation_p.A656T|NFATC2_ENST00000609507.1_Missense_Mutation_p.A656T|NFATC2_ENST00000609943.1_Missense_Mutation_p.A855T|NFATC2_ENST00000414705.1_Missense_Mutation_p.A855T|NFATC2_ENST00000371564.3_Missense_Mutation_p.A875T	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	875					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A875T(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CCGTTTTTGGCGGCTCTTTGG	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16243	0.0		0.0	False		,,,				2504	0.0				p.A875T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2623A	20						.						97.0	97.0	97.0					20																	50048703		2203	4300	6503	49482110	SO:0001583	missense	4773	exon9			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2623G>A	20.37:g.50048703C>T	ENSP00000379330:p.Ala875Thr		49482110	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485399	0.44147	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.15139	2.45;2.46;2.46	5.42	3.5	0.40072	.	0.453535	0.24174	N	0.040870	T	0.09992	0.0245	L	0.36672	1.1	0.31734	N	0.636613	B;B;B;B	0.31859	0.343;0.291;0.011;0.343	B;B;B;B	0.18871	0.021;0.023;0.002;0.023	T	0.20472	-1.0274	10	0.16896	T	0.51	-11.7881	7.1212	0.25446	0.1376:0.7199:0.0:0.1426	.	855;855;875;875	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	T	875;875;855	ENSP00000360619:A875T;ENSP00000379330:A875T;ENSP00000396471:A855T	ENSP00000360619:A875T	A	-	1	0	NFATC2	49482110	0.784000	0.28713	0.998000	0.56505	0.970000	0.65996	0.888000	0.28268	0.667000	0.31107	-0.216000	0.12614	GCC		0.582	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
NCAM2	4685	broad.mit.edu	37	21	22656525	22656525	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr21:22656525C>T	ENST00000400546.1	+	3	391	c.142C>T	c.(142-144)Cct>Tct	p.P48S	NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000535285.1_Missense_Mutation_p.P73S|NCAM2_ENST00000486367.1_3'UTR	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	48	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P48S(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GATTGGTGAACCTGAAAGTAT	0.333																																					p.P48S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C142T	21						.						111.0	99.0	103.0					21																	22656525		1829	4076	5905	21578396	SO:0001583	missense	4685	exon3				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.142C>T	21.37:g.22656525C>T	ENSP00000383392:p.Pro48Ser		21578396	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290429	0.59976	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	T;T	0.41758	0.99;0.99	5.73	5.73	0.89815	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.097389	0.64402	D	0.000001	T	0.67344	0.2883	M	0.92784	3.345	0.45762	D	0.998658	D;P	0.56746	0.977;0.927	P;P	0.56960	0.81;0.743	T	0.74948	-0.3490	10	0.62326	D	0.03	-13.3019	14.1145	0.65144	0.0:0.8496:0.1504:0.0	.	73;48	B7Z841;O15394	.;NCAM2_HUMAN	S	48;73	ENSP00000383392:P48S;ENSP00000441887:P73S	ENSP00000383392:P48S	P	+	1	0	NCAM2	21578396	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.487000	0.35540	2.713000	0.92767	0.591000	0.81541	CCT		0.333	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
LSS	4047	broad.mit.edu	37	21	47611069	47611069	+	Silent	SNP	G	G	A	rs372838581		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr21:47611069G>A	ENST00000397728.3	-	22	2226	c.2148C>T	c.(2146-2148)ctC>ctT	p.L716L	AP001468.58_ENST00000415026.1_RNA|LSS_ENST00000457828.2_Silent_p.L636L|LSS_ENST00000522411.1_Silent_p.L705L|LSS_ENST00000356396.4_Silent_p.L716L	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	716					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)	p.L716L(1)		cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					AGAAGCGGCCGAGGGCCCAGA	0.562																																					p.L636L	Pancreas(114;955 2313 34923 50507)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1908T	21						.	G	,,,	0,4406		0,0,2203	99.0	98.0	98.0		2148,2115,1908,2148	-11.1	0.0	21		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LSS	NM_001001438.2,NM_001145436.1,NM_001145437.1,NM_002340.5	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	716/733,705/722,636/653,716/733	47611069	1,13005	2203	4300	6503	46435497	SO:0001819	synonymous_variant	4047	exon21			U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.2148C>T	21.37:g.47611069G>A			46435497	NM_001145437	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Silent	SNP	ENST00000397728.3	37	CCDS13733.1																																																																																				0.562	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
MED15	51586	broad.mit.edu	37	22	20920885	20920885	+	Silent	SNP	G	G	A	rs201812389		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr22:20920885G>A	ENST00000263205.7	+	7	891	c.822G>A	c.(820-822)ccG>ccA	p.P274P	MED15_ENST00000542773.1_Silent_p.P79P|MED15_ENST00000425759.2_Silent_p.P163P|MED15_ENST00000406969.1_Silent_p.P248P|MED15_ENST00000382974.2_Silent_p.P203P|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000541476.1_Silent_p.P248P|MED15_ENST00000292733.7_Silent_p.P274P	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	274	Pro-rich.			Missing (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P274P(2)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			AGCAGCCACCGATGCAGCAGC	0.647													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14998	0.0		0.0	False		,,,				2504	0.0				p.P274P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G822A	22						.						63.0	70.0	68.0					22																	20920885		2203	4299	6502	19250885	SO:0001819	synonymous_variant	51586	exon7			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.822G>A	22.37:g.20920885G>A			19250885	NM_001003891	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Silent	SNP	ENST00000263205.7	37	CCDS33602.1																																																																																				0.647	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889	
EDAR	10913	broad.mit.edu	37	2	109522822	109522822	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:109522822A>C	ENST00000258443.2	-	11	1396	c.966T>G	c.(964-966)atT>atG	p.I322M	EDAR_ENST00000376651.1_Missense_Mutation_p.I354M|EDAR_ENST00000409271.1_Missense_Mutation_p.I354M	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	322					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.I322M(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						TCCGGCTTTGAATCTGTGAAA	0.517																																					p.I322M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T966G	2						.						72.0	71.0	71.0					2																	109522822		2203	4300	6503	108889254	SO:0001583	missense	10913	exon11			AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.966T>G	2.37:g.109522822A>C	ENSP00000258443:p.Ile322Met		108889254	NM_022336	B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Missense_Mutation	SNP	ENST00000258443.2	37	CCDS2081.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.361360	0.24684	.	.	ENSG00000135960	ENST00000409271;ENST00000258443;ENST00000376651	D;D;D	0.92149	-2.98;-2.92;-2.98	5.39	3.09	0.35607	.	0.537275	0.19530	N	0.112073	D	0.90010	0.6881	M	0.67953	2.075	0.53688	D	0.999973	P;B	0.42409	0.779;0.435	P;B	0.45037	0.467;0.372	D	0.86274	0.1663	10	0.87932	D	0	-11.4592	2.46	0.04538	0.4277:0.0:0.2233:0.3491	.	354;322	E9PC98;Q9UNE0	.;EDAR_HUMAN	M	354;322;354	ENSP00000386371:I354M;ENSP00000258443:I322M;ENSP00000365839:I354M	ENSP00000258443:I322M	I	-	3	3	EDAR	108889254	1.000000	0.71417	0.999000	0.59377	0.186000	0.23388	1.086000	0.30853	0.385000	0.24970	0.379000	0.24179	ATT		0.517	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253595.1		
PTPN18	26469	broad.mit.edu	37	2	131128792	131128792	+	Silent	SNP	C	C	T	rs551564117		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:131128792C>T	ENST00000175756.5	+	12	1046	c.945C>T	c.(943-945)gaC>gaT	p.D315D	PTPN18_ENST00000347849.3_Silent_p.D208D	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	315					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.D315D(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					CACTCTACGACGATGCCCTCT	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16110	0.0		0.0	False		,,,				2504	0.0				p.D315D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C945T	2						.						92.0	88.0	89.0					2																	131128792		2203	4300	6503	130845262	SO:0001819	synonymous_variant	26469	exon12			X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.945C>T	2.37:g.131128792C>T			130845262	NM_014369	B4E1E6|Q53P42	Silent	SNP	ENST00000175756.5	37	CCDS2161.1																																																																																				0.617	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254523.2		
LRP1B	53353	broad.mit.edu	37	2	141359136	141359136	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:141359136G>T	ENST00000389484.3	-	42	7843	c.6872C>A	c.(6871-6873)tCa>tAa	p.S2291*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2291					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.S2291*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTGATGGATGAGGTGGTAGA	0.498										TSP Lung(27;0.18)																											p.S2291X	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C6872A	2						.						145.0	121.0	129.0					2																	141359136		2203	4300	6503	141075606	SO:0001587	stop_gained	53353	exon42			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6872C>A	2.37:g.141359136G>T	ENSP00000374135:p.Ser2291*		141075606	NM_018557	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	53	21.406506	0.99940	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7339	0.91746	0.0:0.0:1.0:0.0	.	.	.	.	X	2291;2229	.	ENSP00000374135:S2291X	S	-	2	0	LRP1B	141075606	1.000000	0.71417	0.995000	0.50966	0.880000	0.50808	7.836000	0.86788	2.491000	0.84063	0.561000	0.74099	TCA		0.498	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
ZEB2	9839	broad.mit.edu	37	2	145157726	145157726	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:145157726C>T	ENST00000558170.2	-	8	2212	c.1028G>A	c.(1027-1029)cGa>cAa	p.R343Q	ZEB2_ENST00000539609.3_Missense_Mutation_p.R319Q|ZEB2_ENST00000303660.4_Missense_Mutation_p.R343Q|ZEB2_ENST00000409487.3_Missense_Mutation_p.R343Q	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	343					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.R343Q(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		GTTTCTCATTCGGCCATTTAC	0.413																																					p.R319Q	Melanoma(33;1235 1264 5755 16332)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G956A	2						.						57.0	57.0	57.0					2																	145157726		2203	4300	6503	144874196	SO:0001583	missense	9839	exon7			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1028G>A	2.37:g.145157726C>T	ENSP00000454157:p.Arg343Gln		144874196	NM_001171653	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000892	0.74818	.	.	ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861	T;T;T;T;T	0.15834	2.4;2.39;2.39;2.57;2.57	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.40015	0.1100	L	0.49126	1.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.997;0.998	D;D;D;D	0.91635	0.999;0.987;0.968;0.992	T	0.08722	-1.0708	10	0.87932	D	0	-5.3533	19.7156	0.96119	0.0:1.0:0.0:0.0	.	319;208;342;343	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	Q	338;319;343;343;343;343	ENSP00000443792:R319Q;ENSP00000302501:R343Q;ENSP00000386854:R343Q;ENSP00000395496:R343Q;ENSP00000376601:R343Q	ENSP00000302501:R343Q	R	-	2	0	ZEB2	144874196	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.658000	0.90341	0.655000	0.94253	CGA		0.413	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
COBLL1	22837	broad.mit.edu	37	2	165555960	165555960	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:165555960C>G	ENST00000392717.2	-	12	1745	c.1741G>C	c.(1741-1743)Gac>Cac	p.D581H	COBLL1_ENST00000194871.6_Missense_Mutation_p.D609H|COBLL1_ENST00000409184.3_Missense_Mutation_p.D542H|COBLL1_ENST00000342193.4_Missense_Mutation_p.D543H|COBLL1_ENST00000375458.2_Missense_Mutation_p.D504H|COBLL1_ENST00000491126.2_5'Flank			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	581						extracellular vesicular exosome (GO:0070062)		p.D543H(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						CTTATACTGTCAACTACCTTC	0.353																																					p.D543H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1627C	2						.						221.0	211.0	215.0					2																	165555960		2203	4300	6503	165264206	SO:0001583	missense	22837	exon11			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1741G>C	2.37:g.165555960C>G	ENSP00000376478:p.Asp581His		165264206	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.	.	.	.	.	.	.	.	.	.	C	14.05	2.419938	0.42918	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	4.83	3.96	0.45880	.	0.095320	0.45126	D	0.000392	T	0.47414	0.1444	L	0.29908	0.895	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71656	0.947;0.947;0.974	T	0.27571	-1.0070	9	0.72032	D	0.01	-6.9244	8.2552	0.31751	0.0:0.7573:0.1563:0.0864	.	581;609;542	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	H	504;543;542;581;609	.	ENSP00000194871:D609H	D	-	1	0	COBLL1	165264206	0.895000	0.30542	0.018000	0.16275	0.001000	0.01503	2.111000	0.41883	1.160000	0.42584	-0.136000	0.14681	GAC		0.353	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
SCN9A	6335	broad.mit.edu	37	2	167163057	167163057	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:167163057T>C	ENST00000409435.1	-	3	429	c.430A>G	c.(430-432)Acc>Gcc	p.T144A	SCN9A_ENST00000303354.6_Missense_Mutation_p.T145A|SCN9A_ENST00000409672.1_Missense_Mutation_p.T144A|SCN9A_ENST00000375387.4_Missense_Mutation_p.T145A			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	144					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.T144A(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTATTCATGGTCATAAATATG	0.363																																					p.T144A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A430G	2						.						82.0	83.0	83.0					2																	167163057		1935	4186	6121	166871303	SO:0001583	missense	6335	exon4			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.430A>G	2.37:g.167163057T>C	ENSP00000386330:p.Thr144Ala		166871303	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	t	15.57	2.873121	0.51695	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3;-4.3;-4.3	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000004	D	0.96071	0.8720	L	0.45352	1.415	0.80722	D	1	P;B;B	0.35208	0.49;0.423;0.001	B;B;B	0.44044	0.209;0.439;0.006	D	0.95098	0.8228	10	0.29301	T	0.29	.	16.4447	0.83919	0.0:0.0:0.0:1.0	.	144;144;145	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	A	144;145;145;144;9;9	ENSP00000386306:T144A;ENSP00000364536:T145A;ENSP00000304748:T145A;ENSP00000386330:T144A;ENSP00000413212:T9A;ENSP00000393141:T9A	ENSP00000304748:T145A	T	-	1	0	SCN9A	166871303	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	8.040000	0.89188	2.284000	0.76573	0.528000	0.53228	ACC		0.363	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
LRP2	4036	broad.mit.edu	37	2	170066101	170066101	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:170066101A>G	ENST00000263816.3	-	38	6616	c.6331T>C	c.(6331-6333)Tgg>Cgg	p.W2111R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2111					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.W2111R(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAATCACACCAATAAATAAAG	0.398																																					p.W2111R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6331C	2						.						105.0	95.0	98.0					2																	170066101		2203	4300	6503	169774347	SO:0001583	missense	4036	exon38				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.6331T>C	2.37:g.170066101A>G	ENSP00000263816:p.Trp2111Arg		169774347	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551814	0.65311	.	.	ENSG00000081479	ENST00000263816	D	0.91843	-2.92	5.88	4.72	0.59763	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.96636	0.8902	M	0.92691	3.335	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.96662	0.9490	10	0.87932	D	0	.	11.7462	0.51821	0.9313:0.0:0.0687:0.0	.	2111	P98164	LRP2_HUMAN	R	2111	ENSP00000263816:W2111R	ENSP00000263816:W2111R	W	-	1	0	LRP2	169774347	1.000000	0.71417	0.998000	0.56505	0.475000	0.33008	9.281000	0.95811	1.042000	0.40150	0.533000	0.62120	TGG		0.398	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
SMARCAL1	50485	broad.mit.edu	37	2	217279945	217279945	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:217279945C>A	ENST00000357276.4	+	3	848	c.518C>A	c.(517-519)tCc>tAc	p.S173Y	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.S173Y|AC098820.2_ENST00000457694.1_RNA	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	173					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.S173Y(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCAAAGAGTTCCCAAGAGACA	0.507									Schimke Immuno-Osseous Dysplasia																												p.S173Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C518A	2						.						110.0	109.0	109.0					2																	217279945		2203	4300	6503	216988190	SO:0001583	missense	50485	exon3	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.518C>A	2.37:g.217279945C>A	ENSP00000349823:p.Ser173Tyr		216988190	NM_014140	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	9.989	1.230306	0.22542	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128	D;D;T;D	0.87491	-2.26;-2.26;1.21;-2.26	5.23	1.72	0.24424	.	0.823449	0.11058	N	0.604240	T	0.73606	0.3608	N	0.19112	0.55	0.09310	N	1	P	0.38582	0.638	B	0.34242	0.178	T	0.63695	-0.6579	10	0.52906	T	0.07	-0.4036	3.8125	0.08802	0.1558:0.5174:0.0:0.3268	.	173	Q9NZC9	SMAL1_HUMAN	Y	173;173;72;37	ENSP00000349823:S173Y;ENSP00000350940:S173Y;ENSP00000392997:S72Y;ENSP00000375974:S37Y	ENSP00000349823:S173Y	S	+	2	0	SMARCAL1	216988190	0.005000	0.15991	0.004000	0.12327	0.258000	0.26162	0.880000	0.28159	0.101000	0.17610	0.591000	0.81541	TCC		0.507	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
SLC4A3	6508	broad.mit.edu	37	2	220497093	220497093	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:220497093G>A	ENST00000358055.3	+	8	1582	c.1070G>A	c.(1069-1071)cGc>cAc	p.R357H	SLC4A3_ENST00000373762.3_Missense_Mutation_p.R384H|SLC4A3_ENST00000373760.2_Missense_Mutation_p.R357H|SLC4A3_ENST00000317151.3_Missense_Mutation_p.R357H|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000273063.6_Missense_Mutation_p.R384H			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	357					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.R384H(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGACGGAGCGCTGGGGGAAG	0.667																																					p.R357H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1070A	2						.						58.0	57.0	57.0					2																	220497093		2203	4300	6503	220205337	SO:0001583	missense	6508	exon8				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1070G>A	2.37:g.220497093G>A	ENSP00000350756:p.Arg357His		220205337	NM_005070	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	37	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	G	35	5.442946	0.96187	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151;ENST00000413743	T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	3.96	3.96	0.45880	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	T	0.80369	0.4610	M	0.90252	3.1	0.80722	D	1	P;P	0.41710	0.76;0.717	P;B	0.45406	0.479;0.347	D	0.85973	0.1478	10	0.66056	D	0.02	.	16.546	0.84445	0.0:0.0:1.0:0.0	.	357;384	P48751;P48751-3	B3A3_HUMAN;.	H	357;357;384;384;357;159	ENSP00000350756:R357H;ENSP00000362865:R357H;ENSP00000273063:R384H;ENSP00000362867:R384H;ENSP00000314006:R357H;ENSP00000414722:R159H	ENSP00000273063:R384H	R	+	2	0	SLC4A3	220205337	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.601000	0.98297	2.185000	0.69588	0.561000	0.74099	CGC		0.667	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
NYAP2	57624	broad.mit.edu	37	2	226516187	226516187	+	Missense_Mutation	SNP	C	C	T	rs568027472		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:226516187C>T	ENST00000272907.6	+	6	2281	c.1868C>T	c.(1867-1869)aCg>aTg	p.T623M		NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	623					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.T623M(1)									TCTGCGTCGACGTCAGGTGTG	0.498													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19906	0.0		0.0	False		,,,				2504	0.0				p.T623M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1868T	2						.						196.0	198.0	198.0					2																	226516187		2133	4253	6386	226224431	SO:0001583	missense	57624	exon6			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1868C>T	2.37:g.226516187C>T	ENSP00000272907:p.Thr623Met		226224431	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.182407	0.57800	.	.	ENSG00000144460	ENST00000272907	T	0.34859	1.34	5.92	5.02	0.67125	.	9.088210	0.00682	N	0.000686	T	0.55337	0.1914	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.17684	-1.0361	10	0.87932	D	0	-0.0062	16.2369	0.82380	0.1338:0.8662:0.0:0.0	.	137;623	Q9P242-3;Q9P242	.;K1486_HUMAN	M	623	ENSP00000272907:T623M	ENSP00000272907:T623M	T	+	2	0	KIAA1486	226224431	1.000000	0.71417	0.944000	0.38274	0.805000	0.45488	5.677000	0.68142	1.448000	0.47680	0.557000	0.71058	ACG		0.498	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
ALLC	55821	broad.mit.edu	37	2	3727534	3727534	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:3727534C>T	ENST00000252505.3	+	5	410	c.248C>T	c.(247-249)aCg>aTg	p.T83M		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	102					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.T83M(2)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCTTACTTCACGGGAGATTAC	0.532										HNSCC(21;0.051)																											p.T83M												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C248T	2						.						137.0	144.0	142.0					2																	3727534		2075	4214	6289	3705409	SO:0001583	missense	55821	exon5			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.248C>T	2.37:g.3727534C>T	ENSP00000252505:p.Thr83Met		3705409	NM_018436	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	ENST00000252505.3	37	CCDS46223.1	.	.	.	.	.	.	.	.	.	.	C	8.179	0.793502	0.16327	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.77	-3.07	0.05363	Allantoicase domain (1);Galactose-binding domain-like (1);	0.782013	0.12462	N	0.466774	T	0.31389	0.0795	M	0.64260	1.97	0.09310	N	1	P	0.52170	0.951	P	0.44696	0.458	T	0.18713	-1.0328	9	0.59425	D	0.04	-6.5612	4.4518	0.11624	0.2443:0.378:0.0:0.3777	.	102	Q8N6M5	ALLC_HUMAN	M	83	.	ENSP00000252505:T83M	T	+	2	0	ALLC	3705409	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.173000	0.09854	-0.616000	0.05671	-1.268000	0.01426	ACG		0.532	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
TET3	200424	broad.mit.edu	37	2	74328441	74328441	+	Missense_Mutation	SNP	G	G	A	rs201185906	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:74328441G>A	ENST00000409262.3	+	9	4121	c.4121G>A	c.(4120-4122)cGa>cAa	p.R1374Q		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1374					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.R651Q(1)|p.R1374Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGACGGCTGCGAGGCAAACCG	0.682													G|||	8	0.00159744	0.0061	0.0	5008	,	,		17849	0.0		0.0	False		,,,				2504	0.0				p.R1374Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4121A	2						.	G	GLN/ARG	17,3803		0,17,1893	24.0	30.0	28.0		4121	4.1	1.0	2		28	0,8238		0,0,4119	yes	missense	TET3	NM_144993.1	43	0,17,6012	AA,AG,GG		0.0,0.445,0.141	probably-damaging	1374/1661	74328441	17,12041	1910	4119	6029	74181949	SO:0001583	missense	200424	exon9				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.4121G>A	2.37:g.74328441G>A	ENSP00000386869:p.Arg1374Gln		74181949	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	10.96	1.498062	0.26861	0.00445	0.0	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.11277	2.79	5.08	4.13	0.48395	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.263863	0.26265	N	0.025375	T	0.07007	0.0178	L	0.36672	1.1	0.26915	N	0.966814	D	0.58268	0.982	P	0.48795	0.59	T	0.14868	-1.0457	10	0.13853	T	0.58	.	7.6298	0.28232	0.0:0.1647:0.6421:0.1932	.	1374	O43151	TET3_HUMAN	Q	1374	ENSP00000386869:R1374Q	ENSP00000233310:R1374Q	R	+	2	0	TET3	74181949	0.831000	0.29352	0.991000	0.47740	0.973000	0.67179	2.448000	0.44926	2.639000	0.89480	0.655000	0.94253	CGA		0.682	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
GIGYF2	26058	broad.mit.edu	37	2	233671231	233671231	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr2:233671231G>A	ENST00000409547.1	+	17	1981	c.1670G>A	c.(1669-1671)tGg>tAg	p.W557*	GIGYF2_ENST00000373566.3_Nonsense_Mutation_p.W579*|GIGYF2_ENST00000409480.1_Nonsense_Mutation_p.W579*|GIGYF2_ENST00000409451.3_Nonsense_Mutation_p.W578*|GIGYF2_ENST00000373563.4_Nonsense_Mutation_p.W557*|GIGYF2_ENST00000409196.3_Nonsense_Mutation_p.W551*|GIGYF2_ENST00000452341.2_Nonsense_Mutation_p.W388*	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	557	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.|Required for GRB10-binding. {ECO:0000250}.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.W557*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		ATGGCAGAATGGTTTCAGGCG	0.388																																					p.W551X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1652A	2						.						187.0	183.0	185.0					2																	233671231		2203	4300	6503	233379475	SO:0001587	stop_gained	26058	exon14			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1670G>A	2.37:g.233671231G>A	ENSP00000386537:p.Trp557*		233379475	NM_001103148	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Nonsense_Mutation	SNP	ENST00000409547.1	37	CCDS33401.1	.	.	.	.	.	.	.	.	.	.	G	41	8.991942	0.99029	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.9441	20.1551	0.98106	0.0:0.0:1.0:0.0	.	.	.	.	X	579;500;557;579;557;557;500;551;578;551;388	.	ENSP00000362664:W557X	W	+	2	0	GIGYF2	233379475	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.760000	0.94817	0.655000	0.94253	TGG		0.388	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
USP19	10869	broad.mit.edu	37	3	49153502	49153503	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:49153502_49153503insC	ENST00000398888.2	-	9	1463_1464	c.1145_1146insG	c.(1144-1146)ggcfs	p.G382fs	USP19_ENST00000453664.1_Frame_Shift_Ins_p.G473fs|USP19_ENST00000434032.2_Frame_Shift_Ins_p.G483fs|USP19_ENST00000398898.2_Frame_Shift_Ins_p.G420fs|USP19_ENST00000398896.1_Frame_Shift_Ins_p.G188fs|USP19_ENST00000417901.1_Frame_Shift_Ins_p.G483fs|USP19_ENST00000398892.3_Frame_Shift_Ins_p.G420fs|USP19_ENST00000488993.1_5'Flank	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	382	CS 2. {ECO:0000255|PROSITE- ProRule:PRU00547}.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)	p.L469fs*49(1)		NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGGCCTCCAGGCCCCCCCAGCG	0.599																																					p.G473fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1419_1420insG	3						.																																			49128507	SO:0001589	frameshift_variant	10869	exon10			AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1146dupG	3.37:g.49153509_49153509dupC	ENSP00000381863:p.Gly382fs		49128506	NM_001199162	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Frame_Shift_Ins	INS	ENST00000398888.2	37	CCDS43090.1																																																																																				0.599	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
SLC15A2	6565	broad.mit.edu	37	3	121634083	121634083	+	Missense_Mutation	SNP	C	C	T	rs371451053		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:121634083C>T	ENST00000489711.1	+	6	926	c.538C>T	c.(538-540)Cgg>Tgg	p.R180W	SLC15A2_ENST00000295605.2_Missense_Mutation_p.R149W	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	180					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)	p.R180W(1)		NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GGCAGAGGAACGGACTAGATA	0.458																																					p.R149W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C445T	3						.	C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	177.0	154.0	162.0		445,538	3.5	1.0	3		162	0,8600		0,0,4300	no	missense,missense	SLC15A2	NM_001145998.1,NM_021082.3	101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	149/699,180/730	121634083	1,13005	2203	4300	6503	123116773	SO:0001583	missense	6565	exon5			BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.538C>T	3.37:g.121634083C>T	ENSP00000417085:p.Arg180Trp		123116773	NM_001145998	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	37	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151922	0.38021	2.27E-4	0.0	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605;ENST00000469013	T;T;T	0.70282	-0.47;-0.47;-0.47	5.41	3.49	0.39957	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.83792	0.5331	M	0.89095	3.005	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	D	0.84877	0.0828	10	0.66056	D	0.02	-15.5201	8.4495	0.32862	0.1623:0.7517:0.0:0.086	.	149;180	B4E2A7;Q16348	.;S15A2_HUMAN	W	180;142;149;118	ENSP00000417085:R180W;ENSP00000295605:R149W;ENSP00000418704:R118W	ENSP00000295605:R149W	R	+	1	2	SLC15A2	123116773	1.000000	0.71417	1.000000	0.80357	0.186000	0.23388	1.812000	0.38952	1.526000	0.49068	-0.229000	0.12294	CGG		0.458	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
C3orf20	84077	broad.mit.edu	37	3	14724602	14724602	+	Missense_Mutation	SNP	C	C	T	rs370846039		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:14724602C>T	ENST00000253697.3	+	3	834	c.382C>T	c.(382-384)Cgc>Tgc	p.R128C	C3orf20_ENST00000435614.1_Missense_Mutation_p.R6C|C3orf20_ENST00000412910.1_Missense_Mutation_p.R6C	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	128						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R128C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						CCGTCAGGTGCGCACCCACCA	0.617																																					p.R6C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C16T	3						.	C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	56.0	54.0	55.0		16,16,382	-2.5	0.0	3		55	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	C3orf20	NM_001184957.1,NM_001184958.1,NM_032137.4	180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	6/783,6/783,128/905	14724602	1,13005	2203	4300	6503	14699606	SO:0001583	missense	84077	exon3			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.382C>T	3.37:g.14724602C>T	ENSP00000253697:p.Arg128Cys		14699606	NM_001184958	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	13.07	2.128011	0.37533	0.0	1.16E-4	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.08896	3.35;3.04;3.04	4.87	-2.48	0.06423	.	0.744664	0.11535	N	0.554290	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	P	0.45044	0.849	B	0.41723	0.365	T	0.31916	-0.9926	10	0.66056	D	0.02	-0.3814	0.4093	0.00438	0.279:0.2487:0.1263:0.3459	.	128	Q8ND61	CC020_HUMAN	C	128;6;6	ENSP00000253697:R128C;ENSP00000402933:R6C;ENSP00000396081:R6C	ENSP00000253697:R128C	R	+	1	0	C3orf20	14699606	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.103000	0.03329	-0.168000	0.10853	0.467000	0.42956	CGC		0.617	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
GALNT15	117248	broad.mit.edu	37	3	16216964	16216964	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:16216964C>T	ENST00000339732.5	+	1	809	c.306C>T	c.(304-306)ccC>ccT	p.P102P	GALNT15_ENST00000437509.1_Silent_p.P102P|GALNT15_ENST00000470031.1_3'UTR	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	102					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P102P(1)									TGGCCTTACCCCAGGCCAGAA	0.617																																					p.P102P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C306T	3						.						38.0	40.0	39.0					3																	16216964		2203	4300	6503	16191968	SO:0001819	synonymous_variant	117248	exon1			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.306C>T	3.37:g.16216964C>T			16191968	NM_054110	A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Silent	SNP	ENST00000339732.5	37	CCDS33711.1																																																																																				0.617	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346483.2	NM_054110	
CEP70	80321	broad.mit.edu	37	3	138216928	138216928	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:138216928G>A	ENST00000264982.3	-	17	1943	c.1677C>T	c.(1675-1677)caC>caT	p.H559H	CEP70_ENST00000542237.1_Silent_p.H539H|CEP70_ENST00000489254.1_Silent_p.H407H|CEP70_ENST00000484888.1_Silent_p.H559H	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	559					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.H559H(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						AAAATTCCTCGTGTTCTTCCA	0.333																																					p.H559H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1677T	3						.						110.0	105.0	107.0					3																	138216928		2203	4300	6503	139699618	SO:0001819	synonymous_variant	80321	exon17			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1677C>T	3.37:g.138216928G>A			139699618	NM_024491	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Silent	SNP	ENST00000264982.3	37	CCDS3102.1																																																																																				0.333	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491	
XIRP1	165904	broad.mit.edu	37	3	39229333	39229333	+	Missense_Mutation	SNP	C	C	T	rs370513707		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:39229333C>T	ENST00000340369.3	-	2	1832	c.1604G>A	c.(1603-1605)cGg>cAg	p.R535Q	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.R535Q	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	535	Interaction with CTNNB1. {ECO:0000250}.				cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)	p.R535Q(1)		breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GGTGATGCCCCGCACCACGTC	0.622																																					p.R535Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1604A	3						.	C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	64.0	61.0	62.0		1604,1604	4.3	1.0	3		62	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	XIRP1	NM_001198621.1,NM_194293.2	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	535/1122,535/1844	39229333	1,13005	2203	4300	6503	39204337	SO:0001583	missense	165904	exon2			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1604G>A	3.37:g.39229333C>T	ENSP00000343140:p.Arg535Gln		39204337	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007634	0.54361	0.0	1.16E-4	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.06768	3.26;3.63	5.17	4.3	0.51218	.	0.063724	0.64402	D	0.000009	T	0.08935	0.0221	M	0.66297	2.02	0.80722	D	1	P;P	0.42039	0.74;0.769	B;B	0.27608	0.075;0.081	T	0.08166	-1.0735	10	0.72032	D	0.01	.	11.6304	0.51171	0.0:0.913:0.0:0.087	.	535;535	Q702N8;Q702N8-2	XIRP1_HUMAN;.	Q	535	ENSP00000379550:R535Q;ENSP00000343140:R535Q	ENSP00000343140:R535Q	R	-	2	0	XIRP1	39204337	0.998000	0.40836	0.991000	0.47740	0.982000	0.71751	2.393000	0.44442	1.325000	0.45301	0.655000	0.94253	CGG		0.622	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
NSUN3	63899	broad.mit.edu	37	3	93802973	93802973	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:93802973T>G	ENST00000314622.4	+	3	356	c.145T>G	c.(145-147)Tgc>Ggc	p.C49G		NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	49							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.C49G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						ATCTCCATCATGCTGGCAATA	0.338																																					p.C49G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T145G	3						.						46.0	46.0	46.0					3																	93802973		2203	4300	6503	95285663	SO:0001583	missense	63899	exon3			BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.145T>G	3.37:g.93802973T>G	ENSP00000318986:p.Cys49Gly		95285663	NM_022072	Q6PG41|Q8IXG9|Q9H6M2	Missense_Mutation	SNP	ENST00000314622.4	37	CCDS2927.1	.	.	.	.	.	.	.	.	.	.	T	9.827	1.187291	0.21870	.	.	ENSG00000178694	ENST00000314622	T	0.21734	1.99	5.81	3.39	0.38822	.	0.290828	0.39985	N	0.001210	T	0.14056	0.0340	L	0.39898	1.24	0.09310	N	0.999995	B	0.20671	0.047	B	0.16722	0.016	T	0.32561	-0.9902	10	0.15066	T	0.55	-0.0942	6.5114	0.22224	0.0:0.0853:0.2912:0.6235	.	49	Q9H649	NSUN3_HUMAN	G	49	ENSP00000318986:C49G	ENSP00000318986:C49G	C	+	1	0	NSUN3	95285663	0.977000	0.34250	0.071000	0.20095	0.688000	0.40055	1.984000	0.40658	0.434000	0.26340	0.533000	0.62120	TGC		0.338	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352934.1	NM_022072	
OR5H2	79310	broad.mit.edu	37	3	98002174	98002174	+	Missense_Mutation	SNP	G	G	A	rs149368502		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:98002174G>A	ENST00000355273.2	+	1	443	c.443G>A	c.(442-444)cGg>cAg	p.R148Q	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R148Q(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						CTATGCATACGGCTGTTAGCC	0.363													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20735	0.0		0.0	False		,,,				2504	0.0				p.R148Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G443A	3						.	G	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	111.0	101.0	104.0		443	-2.0	0.0	3	dbSNP_134	104	0,8600		0,0,4300	no	missense	OR5H2	NM_001005482.1	43	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	148/315	98002174	3,13003	2203	4300	6503	99484864	SO:0001583	missense	79310	exon1				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.443G>A	3.37:g.98002174G>A	ENSP00000347418:p.Arg148Gln		99484864	NM_001005482	Q6IF87	Missense_Mutation	SNP	ENST00000355273.2	37	CCDS33801.1	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.613815	0.00835	6.81E-4	0.0	ENSG00000197938	ENST00000355273	T	0.00076	8.76	3.03	-2.05	0.07321	GPCR, rhodopsin-like superfamily (1);	0.989423	0.08190	N	0.984084	T	0.00039	0.0001	N	0.01284	-0.91	0.09310	N	1	B	0.24483	0.104	B	0.19391	0.025	T	0.00512	-1.1696	10	0.15499	T	0.54	.	8.2254	0.31566	0.5652:0.0:0.4348:0.0	.	148	Q8NGV7	OR5H2_HUMAN	Q	148	ENSP00000347418:R148Q	ENSP00000347418:R148Q	R	+	2	0	OR5H2	99484864	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.155000	0.00284	-0.441000	0.07201	-0.474000	0.04947	CGG		0.363	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2		
MAP3K13	9175	broad.mit.edu	37	3	185183578	185183578	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr3:185183578C>T	ENST00000265026.3	+	9	1766	c.1432C>T	c.(1432-1434)Cgg>Tgg	p.R478W	MAP3K13_ENST00000443863.1_Missense_Mutation_p.R334W|MAP3K13_ENST00000446828.1_Missense_Mutation_p.R271W|MAP3K13_ENST00000424227.1_Missense_Mutation_p.R478W|MAP3K13_ENST00000535426.1_Missense_Mutation_p.R334W	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.R478W(2)|p.R478R(1)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			GAAGCTTGAGCGGGCGAATAA	0.478																																					p.R478W												.	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	large_intestine(3)	c.C1432T	3						.						139.0	143.0	142.0					3																	185183578		2203	4300	6503	186666272	SO:0001583	missense	9175	exon9			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1432C>T	3.37:g.185183578C>T	ENSP00000265026:p.Arg478Trp		186666272	NM_004721		Missense_Mutation	SNP	ENST00000265026.3	37	CCDS3270.1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.873817	0.72180	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026;ENST00000420577	T;T;T;T;T;T	0.80566	-1.39;-1.35;-1.25;-1.25;-1.35;-1.05	4.97	2.95	0.34219	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000001	D	0.83243	0.5212	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.996;0.997	D	0.84993	0.0895	10	0.72032	D	0.01	.	13.4974	0.61434	0.3171:0.6829:0.0:0.0	.	334;271;478	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	W	271;478;334;334;478;223	ENSP00000411483:R271W;ENSP00000399910:R478W;ENSP00000409325:R334W;ENSP00000439257:R334W;ENSP00000265026:R478W;ENSP00000415712:R223W	ENSP00000265026:R478W	R	+	1	2	MAP3K13	186666272	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.491000	0.22419	2.309000	0.77851	0.655000	0.94253	CGG		0.478	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
ENPEP	2028	broad.mit.edu	37	4	111469392	111469392	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr4:111469392G>T	ENST00000265162.5	+	14	2403	c.2061G>T	c.(2059-2061)gaG>gaT	p.E687D		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	687					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.E687D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		AAAGGGAAGAGAATTTTTTAC	0.323																																					p.E687D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2061T	4						.						86.0	90.0	89.0					4																	111469392		2202	4300	6502	111688841	SO:0001583	missense	2028	exon14			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2061G>T	4.37:g.111469392G>T	ENSP00000265162:p.Glu687Asp		111688841	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	3.055	-0.194448	0.06259	.	.	ENSG00000138792	ENST00000265162	T	0.04758	3.56	5.65	-1.77	0.07982	.	0.823917	0.11230	N	0.585730	T	0.02455	0.0075	N	0.21545	0.675	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.48281	-0.9049	10	0.13470	T	0.59	.	2.1527	0.03804	0.5107:0.112:0.163:0.2144	.	687	Q07075	AMPE_HUMAN	D	687	ENSP00000265162:E687D	ENSP00000265162:E687D	E	+	3	2	ENPEP	111688841	0.000000	0.05858	0.000000	0.03702	0.299000	0.27559	-0.297000	0.08276	0.042000	0.15717	0.655000	0.94253	GAG		0.323	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
FAT4	79633	broad.mit.edu	37	4	126398366	126398366	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr4:126398366C>A	ENST00000394329.3	+	13	12363	c.12350C>A	c.(12349-12351)cCa>cAa	p.P4117Q	FAT4_ENST00000335110.5_Missense_Mutation_p.P2380Q	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4117	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P4117Q(2)|p.P4082Q(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCTCTAGAACCAATCCTTCAG	0.393																																					p.P4117Q												.	.	4	Substitution - Missense(4)	cervix(2)|large_intestine(2)	c.C12350A	4						.						167.0	172.0	170.0					4																	126398366		2203	4300	6503	126617816	SO:0001583	missense	79633	exon13			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12350C>A	4.37:g.126398366C>A	ENSP00000377862:p.Pro4117Gln		126617816	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316718	0.60524	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.76968	-1.06;-1.06	5.6	5.6	0.85130	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34314	U	0.004068	D	0.85323	0.5670	L	0.60067	1.865	0.58432	D	0.999997	D;D;P	0.55385	0.971;0.967;0.9	P;P;P	0.60012	0.718;0.867;0.718	D	0.85287	0.1065	10	0.54805	T	0.06	.	19.6182	0.95643	0.0:1.0:0.0:0.0	.	2380;4117;4117	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	Q	4117;2380	ENSP00000377862:P4117Q;ENSP00000335169:P2380Q	ENSP00000335169:P2380Q	P	+	2	0	FAT4	126617816	1.000000	0.71417	0.142000	0.22268	0.122000	0.20287	5.614000	0.67695	2.626000	0.88956	0.650000	0.86243	CCA		0.393	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
DCLK2	166614	broad.mit.edu	37	4	151119175	151119175	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr4:151119175C>G	ENST00000296550.7	+	4	1635	c.881C>G	c.(880-882)tCt>tGt	p.S294C	DCLK2_ENST00000506325.1_Missense_Mutation_p.S294C|DCLK2_ENST00000507694.1_3'UTR|DCLK2_ENST00000302176.8_Missense_Mutation_p.S294C	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	294	Ser-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.S294C(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CTGAAGTCATCTTATTCTCGA	0.398																																					p.S294C	GBM(195;186 2215 13375 16801 37459)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C881G	4						.						123.0	117.0	119.0					4																	151119175		2203	4300	6503	151338625	SO:0001583	missense	166614	exon4			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.881C>G	4.37:g.151119175C>G	ENSP00000296550:p.Ser294Cys		151338625	NM_001040260	C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	ENST00000296550.7	37	CCDS34076.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265673	0.80358	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.69435	-0.38;-0.38;-0.4	5.52	4.67	0.58626	Doublecortin domain (1);	0.059906	0.64402	D	0.000002	T	0.76407	0.3983	M	0.66939	2.045	0.46011	D	0.99881	P;D;P	0.65815	0.941;0.995;0.943	P;P;P	0.58970	0.849;0.847;0.711	T	0.76484	-0.2942	10	0.39692	T	0.17	.	14.6743	0.68967	0.1466:0.8534:0.0:0.0	.	294;294;294	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	C	294	ENSP00000296550:S294C;ENSP00000427235:S294C;ENSP00000303887:S294C	ENSP00000296550:S294C	S	+	2	0	DCLK2	151338625	0.984000	0.35163	0.996000	0.52242	0.995000	0.86356	4.752000	0.62176	1.316000	0.45131	0.643000	0.83706	TCT		0.398	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364952.1	NM_001040260	
SFRP2	6423	broad.mit.edu	37	4	154702786	154702786	+	Silent	SNP	C	C	T	rs143701440		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr4:154702786C>T	ENST00000274063.4	-	3	989	c.705G>A	c.(703-705)tcG>tcA	p.S235S		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	235	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S235S(1)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				GCCACAGCACCGATTTCTTCA	0.512																																					p.S235S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G705A	4						.	C		2,4404	4.2+/-10.8	0,2,2201	214.0	174.0	188.0		705	-8.1	0.7	4	dbSNP_134	188	0,8600		0,0,4300	no	coding-synonymous	SFRP2	NM_003013.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		235/296	154702786	2,13004	2203	4300	6503	154922236	SO:0001819	synonymous_variant	6423	exon3			AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.705G>A	4.37:g.154702786C>T			154922236	NM_003013	B3KQR2|O14778|Q9HAP5	Silent	SNP	ENST00000274063.4	37	CCDS34082.1																																																																																				0.512	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365296.1		
DCHS2	54798	broad.mit.edu	37	4	155156339	155156339	+	Silent	SNP	G	G	A	rs568618708	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr4:155156339G>A	ENST00000357232.4	-	25	8099	c.8100C>T	c.(8098-8100)gcC>gcT	p.A2700A		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2700					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A2700A(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGCTGTTTCGGCAGTCACCA	0.547													G|||	7	0.00139776	0.0008	0.0	5008	,	,		18801	0.0		0.0	False		,,,				2504	0.0061				p.A2700A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C8100T	4						.						86.0	75.0	79.0					4																	155156339		2203	4300	6503	155375789	SO:0001819	synonymous_variant	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8100C>T	4.37:g.155156339G>A			155375789	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																				0.547	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
APC	324	broad.mit.edu	37	5	112151204	112151204	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr5:112151204C>T	ENST00000457016.1	+	9	1227	c.847C>T	c.(847-849)Cga>Tga	p.R283*	APC_ENST00000257430.4_Nonsense_Mutation_p.R283*|APC_ENST00000508376.2_Nonsense_Mutation_p.R283*			P25054	APC_HUMAN	adenomatous polyposis coli	283	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R283*(11)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTCAACTACACGAATGGACCA	0.383		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R265X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	11	Substitution - Nonsense(11)	large_intestine(11)	c.C793T	5	GRCh37	CM920030	APC	M		.						108.0	98.0	102.0					5																	112151204		2202	4300	6502	112179103	SO:0001587	stop_gained	324	exon7	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.847C>T	5.37:g.112151204C>T	ENSP00000413133:p.Arg283*		112179103	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.381748	0.98786	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.11	4.22	0.49857	.	0.134048	0.50627	D	0.000103	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.044	12.9775	0.58546	0.2942:0.7058:0.0:0.0	.	.	.	.	X	283;265;283;283;283	.	ENSP00000257430:R283X	R	+	1	2	APC	112179103	1.000000	0.71417	0.953000	0.39169	0.976000	0.68499	5.216000	0.65246	1.244000	0.43870	0.650000	0.86243	CGA		0.383	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
LVRN	206338	broad.mit.edu	37	5	115298789	115298789	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr5:115298789C>T	ENST00000357872.4	+	1	599	c.475C>T	c.(475-477)Cgg>Tgg	p.R159W	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		159						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R159W(1)									CGCCGAGGTGCGGGGACCCCT	0.677																																					p.R159W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C475T	5						.						27.0	30.0	29.0					5																	115298789		2201	4299	6500	115326688	SO:0001583	missense	206338	exon1																														ENST00000357872.4:c.475C>T	5.37:g.115298789C>T	ENSP00000350541:p.Arg159Trp		115326688	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.315203	0.40996	.	.	ENSG00000172901	ENST00000357872	T	0.02944	4.1	4.77	2.93	0.34026	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.292930	0.05810	N	0.613772	T	0.02970	0.0088	L	0.28694	0.88	0.43047	D	0.994649	B	0.26081	0.141	B	0.22880	0.042	T	0.35549	-0.9784	10	0.36615	T	0.2	.	5.2309	0.15422	0.2033:0.6879:0.0:0.1088	.	159	Q6Q4G3	AMPQ_HUMAN	W	159	ENSP00000350541:R159W	ENSP00000350541:R159W	R	+	1	2	AC010282.1	115326688	0.618000	0.27051	0.719000	0.30619	0.927000	0.56198	0.799000	0.27028	0.398000	0.25338	0.650000	0.86243	CGG		0.677	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
CDH10	1008	broad.mit.edu	37	5	24537631	24537631	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr5:24537631G>A	ENST00000264463.4	-	3	891	c.384C>T	c.(382-384)cgC>cgT	p.R128R		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	128	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R128R(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TAGCTTGTGCGCGTAGAGTAT	0.413										HNSCC(23;0.051)																											p.R128R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C384T	5						.						158.0	146.0	150.0					5																	24537631		2203	4300	6503	24573388	SO:0001819	synonymous_variant	1008	exon3			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.384C>T	5.37:g.24537631G>A			24573388	NM_006727	Q9ULB3	Silent	SNP	ENST00000264463.4	37	CCDS3892.1																																																																																				0.413	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
NUP155	9631	broad.mit.edu	37	5	37307497	37307497	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr5:37307497C>T	ENST00000231498.3	-	25	3008	c.2805G>A	c.(2803-2805)acG>acA	p.T935T	NUP155_ENST00000513532.1_Silent_p.T871T|NUP155_ENST00000502533.1_5'UTR|NUP155_ENST00000381843.2_Silent_p.T876T	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	935					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)	p.T935T(1)		endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCTCTGCAGCCGTAAGAGAAA	0.398																																					p.T935T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2805A	5						.						94.0	87.0	90.0					5																	37307497		2203	4300	6503	37343254	SO:0001819	synonymous_variant	9631	exon25			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.2805G>A	5.37:g.37307497C>T			37343254	NM_153485	Q9UBE9|Q9UFL5	Silent	SNP	ENST00000231498.3	37	CCDS3921.1																																																																																				0.398	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
VCAN	1462	broad.mit.edu	37	5	82834175	82834175	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr5:82834175G>T	ENST00000265077.3	+	8	5918	c.5353G>T	c.(5353-5355)Gaa>Taa	p.E1785*	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Nonsense_Mutation_p.E798*|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1785	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.E1785*(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GTCTGAAAGGGAAATGACAGA	0.403																																					p.E798X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2392T	5						.						60.0	64.0	63.0					5																	82834175		2203	4299	6502	82869931	SO:0001587	stop_gained	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5353G>T	5.37:g.82834175G>T	ENSP00000265077:p.Glu1785*		82869931	NM_001164097	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	47	13.586169	0.99751	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	.	.	.	5.7	3.86	0.44501	.	0.295688	0.29438	N	0.012144	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	5.2013	0.15267	0.1717:0.0:0.6554:0.1729	.	.	.	.	X	1785;798;798	.	ENSP00000265077:E1785X	E	+	1	0	VCAN	82869931	0.207000	0.23482	0.005000	0.12908	0.064000	0.16182	1.172000	0.31908	1.362000	0.46000	0.655000	0.94253	GAA		0.403	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
PCDHB7	56129	broad.mit.edu	37	5	140552510	140552510	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr5:140552510C>T	ENST00000231137.3	+	1	268	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	32					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R32W(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAACCGCTTCGGTATTTTGT	0.522																																					p.R32W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C94T	5						.						149.0	136.0	140.0					5																	140552510		2203	4300	6503	140532694	SO:0001583	missense	56129	exon1			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.94C>T	5.37:g.140552510C>T	ENSP00000231137:p.Arg32Trp		140532694	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970935	0.34754	.	.	ENSG00000113212	ENST00000231137	T	0.33216	1.42	4.79	1.86	0.25419	Cadherin, N-terminal (1);	.	.	.	.	T	0.47581	0.1453	H	0.95328	3.655	0.09310	N	1	B	0.22604	0.072	B	0.24848	0.056	T	0.50206	-0.8855	9	0.72032	D	0.01	.	10.9176	0.47146	0.1372:0.5982:0.2646:0.0	.	32	Q9Y5E2	PCDB7_HUMAN	W	32	ENSP00000231137:R32W	ENSP00000231137:R32W	R	+	1	2	PCDHB7	140532694	0.000000	0.05858	0.427000	0.26684	0.654000	0.38779	1.016000	0.29976	0.134000	0.18681	-0.181000	0.13052	CGG		0.522	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
SOGA3	387104	broad.mit.edu	37	6	127834114	127834114	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:127834114A>T	ENST00000525778.1	-	4	2152	c.1407T>A	c.(1405-1407)aaT>aaA	p.N469K	SOGA3_ENST00000556132.1_Missense_Mutation_p.N469K|SOGA3_ENST00000368268.2_Missense_Mutation_p.N469K|SOGA3_ENST00000465909.2_Missense_Mutation_p.N469K|SOGA3_ENST00000481848.2_Missense_Mutation_p.N469K			Q5TF21	SOGA3_HUMAN	SOGA family member 3	469					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.N469K(1)									TCAGTTTCTCATTTTCATCTT	0.338																																					p.N469K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1407A	6						.						167.0	146.0	153.0					6																	127834114		1834	4093	5927	127875807	SO:0001583	missense	387104	exon4			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1407T>A	6.37:g.127834114A>T	ENSP00000434570:p.Asn469Lys		127875807	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	A	16.78	3.218996	0.58560	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.52	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.50820	0.1638	M	0.80982	2.52	0.54753	D	0.999988	P	0.51537	0.946	D	0.64506	0.926	T	0.55774	-0.8088	10	0.56958	D	0.05	-11.4719	9.7051	0.40211	0.859:0.0:0.141:0.0	.	469	Q5TF21	CF174_HUMAN	K	469	ENSP00000451768:N469K;ENSP00000357251:N469K;ENSP00000434570:N469K;ENSP00000435559:N469K	ENSP00000435559:N469K	N	-	3	2	C6orf174	127875807	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.423000	0.34837	1.033000	0.39918	0.533000	0.62120	AAT		0.338	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
BCLAF1	9774	broad.mit.edu	37	6	136588205	136588205	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:136588205C>G	ENST00000531224.1	-	11	2758	c.2506G>C	c.(2506-2508)Gat>Cat	p.D836H	BCLAF1_ENST00000353331.4_Intron|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000527759.1_Missense_Mutation_p.D834H|BCLAF1_ENST00000031135.9_Missense_Mutation_p.D54H|BCLAF1_ENST00000527536.1_Intron|BCLAF1_ENST00000530767.1_Missense_Mutation_p.D663H|BCLAF1_ENST00000392348.2_Intron	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	836					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.D836H(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TATTCTGGATCCCATTCCTCT	0.408																																					p.D836H	Colon(142;1534 1789 5427 7063 28491)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2506C	6						.						141.0	136.0	138.0					6																	136588205		2203	4300	6503	136629898	SO:0001583	missense	9774	exon11			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2506G>C	6.37:g.136588205C>G	ENSP00000435210:p.Asp836His		136629898	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.9|23.9	4.468880|4.468880	0.84533|0.84533	.|.	.|.	ENSG00000029363|ENSG00000029363	ENST00000531224;ENST00000530767;ENST00000527759;ENST00000031135|ENST00000534762	T;T;T;T|.	0.65732|.	1.46;1.34;1.45;-0.17|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.64402|.	D|.	0.000003|.	T|T	0.49898|0.49898	0.1584|0.1584	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;D;P|.	0.89917|.	1.0;1.0;0.821|.	D;D;P|.	0.83275|.	0.996;0.996;0.651|.	T|T	0.38478|0.38478	-0.9659|-0.9659	10|5	0.87932|.	D|.	0|.	-8.722|-8.722	20.3812|20.3812	0.98933|0.98933	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	834;836;663|.	Q9NYF8-2;Q9NYF8;Q9NYF8-4|.	.;BCLF1_HUMAN;.|.	H|A	836;663;834;54|102	ENSP00000435210:D836H;ENSP00000436501:D663H;ENSP00000434826:D834H;ENSP00000031135:D54H|.	ENSP00000031135:D54H|.	D|G	-|-	1|2	0|0	BCLAF1|BCLAF1	136629898|136629898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.672000|6.672000	0.74477|0.74477	2.821000|2.821000	0.97095|0.97095	0.650000|0.650000	0.86243|0.86243	GAT|GGA		0.408	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
KIAA1244	57221	broad.mit.edu	37	6	138607916	138607916	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:138607916G>A	ENST00000251691.4	+	16	2814	c.2648G>A	c.(2647-2649)cGa>cAa	p.R883Q		NM_020340.4	NP_065073.3			KIAA1244									p.R812Q(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CTGACTGGTCGAATGGCGGGG	0.557																																					p.R883Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2648A	6						.						115.0	121.0	119.0					6																	138607916		2203	4300	6503	138649609	SO:0001583	missense	57221	exon16			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.2648G>A	6.37:g.138607916G>A	ENSP00000251691:p.Arg883Gln		138649609	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729650	0.89390	.	.	ENSG00000112379	ENST00000251691	T	0.18338	2.22	5.25	5.25	0.73442	.	0.052856	0.64402	D	0.000001	T	0.27241	0.0668	M	0.62723	1.935	0.58432	D	0.999996	D	0.89917	1.0	P	0.59546	0.859	T	0.00412	-1.1755	10	0.33940	T	0.23	-23.4399	19.037	0.92983	0.0:0.0:1.0:0.0	.	883	Q5TH69	BIG3_HUMAN	Q	883	ENSP00000251691:R883Q	ENSP00000251691:R883Q	R	+	2	0	KIAA1244	138649609	1.000000	0.71417	0.732000	0.30844	0.634000	0.38068	9.017000	0.93651	2.738000	0.93877	0.655000	0.94253	CGA		0.557	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
HIST1H2AG	8969	broad.mit.edu	37	6	27100950	27100950	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:27100950C>T	ENST00000359193.2	+	1	119	c.100C>T	c.(100-102)Ctg>Ttg	p.L34L	HIST1H2BJ_ENST00000339812.2_5'Flank|HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000541790.1_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	34						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.L34L(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						AGTGCACCGCCTGCTCCGCAA	0.667																																					p.L34L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C100T	6						.						32.0	37.0	35.0					6																	27100950		2203	4300	6503	27208929	SO:0001819	synonymous_variant	8969	exon1			L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.100C>T	6.37:g.27100950C>T			27208929	NM_021064	P02261|Q2M1R2|Q76PA6	Silent	SNP	ENST00000359193.2	37	CCDS4619.1																																																																																				0.667	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
CPNE5	57699	broad.mit.edu	37	6	36714185	36714185	+	Silent	SNP	G	G	A	rs137962210	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:36714185G>A	ENST00000244751.2	-	16	1812	c.1188C>T	c.(1186-1188)caC>caT	p.H396H	CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_Silent_p.H104H	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	396	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.H396H(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GTGGGAACTCGTGGGACACTC	0.632													G|||	13	0.00259585	0.0098	0.0	5008	,	,		15828	0.0		0.0	False		,,,				2504	0.0				p.H396H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1188T	6						.	G		24,4382	31.7+/-61.6	0,24,2179	86.0	77.0	80.0		1188	-7.1	0.6	6	dbSNP_134	80	0,8600		0,0,4300	no	coding-synonymous	CPNE5	NM_020939.1		0,24,6479	AA,AG,GG		0.0,0.5447,0.1845		396/594	36714185	24,12982	2203	4300	6503	36822163	SO:0001819	synonymous_variant	57699	exon16			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1188C>T	6.37:g.36714185G>A			36822163	NM_020939	Q7Z6C8	Silent	SNP	ENST00000244751.2	37	CCDS4825.1																																																																																				0.632	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
KIF6	221458	broad.mit.edu	37	6	39328285	39328285	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:39328285G>A	ENST00000287152.7	-	18	2062	c.1968C>T	c.(1966-1968)cgC>cgT	p.R656R	KIF6_ENST00000541946.1_Silent_p.R107R|KIF6_ENST00000373215.3_Silent_p.R639R|KIF6_ENST00000229913.5_Silent_p.R107R|KIF6_ENST00000394362.1_Silent_p.R107R|KIF6_ENST00000538893.1_Silent_p.R600R|KIF6_ENST00000373216.3_Silent_p.R656R|KIF6_ENST00000373213.4_Silent_p.R495R	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	656					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R656R(2)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GGGCTTTCAGGCGAGTGAACA	0.527																																					p.R656R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1968T	6						.						96.0	85.0	88.0					6																	39328285		2203	4300	6503	39436263	SO:0001819	synonymous_variant	221458	exon18			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1968C>T	6.37:g.39328285G>A			39436263	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Silent	SNP	ENST00000287152.7	37	CCDS4844.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308339	0.23821	.	.	ENSG00000164627	ENST00000458470	.	.	.	4.47	2.63	0.31362	.	.	.	.	.	T	0.47135	0.1429	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43972	-0.9358	4	.	.	.	.	10.617	0.45456	0.1707:0.0:0.8293:0.0	.	.	.	.	V	548	.	.	A	-	2	0	KIF6	39436263	1.000000	0.71417	0.826000	0.32828	0.983000	0.72400	2.512000	0.45485	1.014000	0.39417	0.462000	0.41574	GCC		0.527	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	
SLC22A7	10864	broad.mit.edu	37	6	43271893	43271893	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:43271893C>T	ENST00000372585.5	+	10	1598	c.1503C>T	c.(1501-1503)atC>atT	p.I501I	SLC22A7_ENST00000372589.3_Silent_p.I499I|SLC22A7_ENST00000372574.3_Silent_p.I499I|ZNF318_ENST00000607252.1_5'Flank	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	501					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)	p.I501I(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	ATGGGGGGATCGCCCTGCTGG	0.652																																					p.I499I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1497T	6						.						62.0	71.0	68.0					6																	43271893		2203	4299	6502	43379871	SO:0001819	synonymous_variant	10864	exon9			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1503C>T	6.37:g.43271893C>T			43379871	NM_006672	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Silent	SNP	ENST00000372585.5	37	CCDS4893.2																																																																																				0.652	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		
HMGCLL1	54511	broad.mit.edu	37	6	55443836	55443836	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:55443836G>A	ENST00000398661.2	-	1	149	c.18C>T	c.(16-18)tcC>tcT	p.S6S	HMGCLL1_ENST00000370850.2_Silent_p.S6S|HMGCLL1_ENST00000274901.4_Silent_p.S6S|HMGCLL1_ENST00000508459.1_Silent_p.S6S|HMGCLL1_ENST00000358072.5_Silent_p.S6S|HMGCLL1_ENST00000308161.4_Silent_p.S6S|HMGCLL1_ENST00000428842.1_Silent_p.S6S	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	6					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)	p.S6S(2)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			GCTTCACCGCGGATGGCACAT	0.687																																					p.S6S	Ovarian(35;840 893 7837 15538 42887)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C18T	6						.						21.0	23.0	23.0					6																	55443836		1993	4146	6139	55551795	SO:0001819	synonymous_variant	54511	exon1			AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.18C>T	6.37:g.55443836G>A			55551795	NM_019036	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Silent	SNP	ENST00000398661.2	37	CCDS43475.1																																																																																				0.687	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383	
KCNQ5	56479	broad.mit.edu	37	6	73787159	73787159	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:73787159G>A	ENST00000370398.1	+	4	840	c.731G>A	c.(730-732)cGc>cAc	p.R244H	KCNQ5_ENST00000342056.2_Missense_Mutation_p.R244H|KCNQ5_ENST00000403813.2_Missense_Mutation_p.R244H|KCNQ5_ENST00000414165.2_Missense_Mutation_p.R244H|KCNQ5_ENST00000355194.4_Missense_Mutation_p.R244H|KCNQ5_ENST00000355635.3_Missense_Mutation_p.R244H|KCNQ5_ENST00000402622.2_Missense_Mutation_p.R244H|KCNQ5_ENST00000370392.1_Missense_Mutation_p.R244H	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	244			R -> C (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.R244H(2)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CGCATGGTGCGCATGGACCGA	0.438																																					p.R244H	GBM(142;1375 1859 14391 23261 44706)											KCNQ5,large_intestine,colon,Substitution - Missense,+1 	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G731A	6						.						80.0	77.0	78.0					6																	73787159		2203	4300	6503	73843880	SO:0001583	missense	56479	exon4			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.731G>A	6.37:g.73787159G>A	ENSP00000359425:p.Arg244His		73843880	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844706	0.91197	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94;-4.94;-4.94;-4.94;-4.94	5.84	5.84	0.93424	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98346	0.9451	L	0.48174	1.505	0.80722	D	1	D;D;D;D;D;D	0.89917	0.985;1.0;0.995;0.989;1.0;1.0	P;D;D;P;D;D	0.87578	0.766;0.998;0.919;0.887;0.958;0.99	D	0.98098	1.0413	10	0.40728	T	0.16	.	20.1438	0.98071	0.0:0.0:1.0:0.0	.	244;244;244;244;244;244	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	H	244	ENSP00000345055:R244H;ENSP00000347326:R244H;ENSP00000359425:R244H;ENSP00000359419:R244H;ENSP00000385501:R244H;ENSP00000347853:R244H;ENSP00000384453:R244H;ENSP00000409861:R244H	ENSP00000345055:R244H	R	+	2	0	KCNQ5	73843880	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.768000	0.95171	0.650000	0.86243	CGC		0.438	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
DDX43	55510	broad.mit.edu	37	6	74123769	74123769	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:74123769G>T	ENST00000370336.4	+	13	1731	c.1573G>T	c.(1573-1575)Gat>Tat	p.D525Y	MB21D1_ENST00000370318.1_Intron	NM_018665.2	NP_061135.2	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	525	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.D525Y(1)		NS(1)|breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						AGAACAGAGAGATCGGGAGAA	0.363																																					p.D525Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1573T	6						.						60.0	59.0	60.0					6																	74123769		2203	4300	6503	74180490	SO:0001583	missense	55510	exon13				CCDS4977.1	6q13	2014-01-21			ENSG00000080007	ENSG00000080007		"""DEAD-boxes"""	18677	protein-coding gene	gene with protein product	"""cancer/testis antigen 13"""	606286				10919659	Standard	NM_018665		Approved	HAGE, DKFZp434H2114, CT13	uc003pgw.3	Q9NXZ2	OTTHUMG00000015033	ENST00000370336.4:c.1573G>T	6.37:g.74123769G>T	ENSP00000359361:p.Asp525Tyr		74180490	NM_018665	B4E0C8|Q6NXR1	Missense_Mutation	SNP	ENST00000370336.4	37	CCDS4977.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675384	0.47781	.	.	ENSG00000080007	ENST00000370336	T	0.76186	-1.0	4.6	4.6	0.57074	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81678	0.4873	L	0.60845	1.875	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83659	0.0160	10	0.87932	D	0	-20.4045	17.532	0.87817	0.0:0.0:1.0:0.0	.	525	Q9NXZ2	DDX43_HUMAN	Y	525	ENSP00000359361:D525Y	ENSP00000359361:D525Y	D	+	1	0	DDX43	74180490	1.000000	0.71417	0.358000	0.25811	0.027000	0.11550	6.978000	0.76147	2.523000	0.85059	0.655000	0.94253	GAT		0.363	DDX43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041219.3	NM_018665	
COL12A1	1303	broad.mit.edu	37	6	75912479	75912479	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:75912479G>A	ENST00000322507.8	-	2	339	c.30C>T	c.(28-30)gcC>gcT	p.A10A	COL12A1_ENST00000345356.6_Silent_p.A10A|COL12A1_ENST00000416123.2_Silent_p.A10A|COL12A1_ENST00000483888.2_Silent_p.A10A	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	10					cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.A10A(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGCCCAGGGCGGCAAGCGCTG	0.567																																					p.A10A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C30T	6						.						39.0	40.0	40.0					6																	75912479		1815	3885	5700	75969199	SO:0001819	synonymous_variant	1303	exon2			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.30C>T	6.37:g.75912479G>A			75969199	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1																																																																																				0.567	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
TTK	7272	broad.mit.edu	37	6	80724229	80724229	+	Missense_Mutation	SNP	G	G	T	rs200901836		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:80724229G>T	ENST00000369798.2	+	10	1145	c.1034G>T	c.(1033-1035)aGt>aTt	p.S345I	TTK_ENST00000515751.1_3'UTR|TTK_ENST00000230510.3_Missense_Mutation_p.S345I|TTK_ENST00000509894.1_Missense_Mutation_p.S345I	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	345					chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.S329I(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		GATGAAAAGAGTTCTGAACTT	0.308																																					p.S345I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1034T	6						.						78.0	85.0	82.0					6																	80724229		2203	4295	6498	80780948	SO:0001583	missense	7272	exon10				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.1034G>T	6.37:g.80724229G>T	ENSP00000358813:p.Ser345Ile		80780948	NM_001166691	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	ENST00000369798.2	37	CCDS4993.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439843	0.43326	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.70164	-0.46;-0.46;-0.45	5.29	3.5	0.40072	.	0.128026	0.64402	D	0.000001	T	0.49440	0.1557	M	0.66939	2.045	0.39613	D	0.969902	P;P	0.35033	0.481;0.481	B;B	0.36922	0.236;0.213	T	0.55296	-0.8163	10	0.72032	D	0.01	.	8.0829	0.30754	0.187:0.0:0.813:0.0	.	345;345	P33981;A8K8U5	TTK_HUMAN;.	I	345	ENSP00000422936:S345I;ENSP00000230510:S345I;ENSP00000358813:S345I	ENSP00000230510:S345I	S	+	2	0	TTK	80780948	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.526000	0.45607	0.720000	0.32209	0.585000	0.79938	AGT		0.308	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041316.2		
FHL5	9457	broad.mit.edu	37	6	97058624	97058624	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:97058624A>T	ENST00000326771.2	+	6	1061	c.681A>T	c.(679-681)aaA>aaT	p.K227N	FHL5_ENST00000541107.1_Missense_Mutation_p.K227N	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	227	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.K227N(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		CCTGTTCCAAACCCATTAGTG	0.383																																					p.K227N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A681T	6						.						147.0	142.0	144.0					6																	97058624		2203	4300	6503	97165345	SO:0001583	missense	9457	exon5			AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.681A>T	6.37:g.97058624A>T	ENSP00000326022:p.Lys227Asn		97165345	NM_001170807	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	ENST00000326771.2	37	CCDS5035.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.989922	0.35131	.	.	ENSG00000112214	ENST00000541107;ENST00000326771	D;D	0.88975	-2.45;-2.45	5.98	2.07	0.26955	Zinc finger, LIM-type (5);	0.000000	0.48286	D	0.000188	T	0.78272	0.4257	M	0.71036	2.16	0.51012	D	0.999905	B	0.20368	0.044	B	0.27608	0.081	T	0.70425	-0.4875	10	0.14252	T	0.57	.	10.4658	0.44607	0.604:0.0:0.396:0.0	.	227	Q5TD97	FHL5_HUMAN	N	227	ENSP00000442357:K227N;ENSP00000326022:K227N	ENSP00000326022:K227N	K	+	3	2	FHL5	97165345	0.098000	0.21812	0.999000	0.59377	0.752000	0.42762	-0.376000	0.07465	0.455000	0.26910	0.528000	0.53228	AAA		0.383	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
AGPAT4	56895	broad.mit.edu	37	6	161574408	161574408	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr6:161574408C>T	ENST00000320285.4	-	5	846	c.634G>A	c.(634-636)Gcc>Acc	p.A212T	AGPAT4_ENST00000457520.2_Intron|AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000366911.5_3'UTR	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	212					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)	p.A212T(2)		endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		ACGGTGATGGCGAAGCCCTTG	0.622											OREG0017775	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A212T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G634A	6						.						94.0	69.0	77.0					6																	161574408		2203	4300	6503	161494398	SO:0001583	missense	56895	exon5			AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.634G>A	6.37:g.161574408C>T	ENSP00000314036:p.Ala212Thr	1817	161494398	NM_020133	B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	37	CCDS5280.1	.	.	.	.	.	.	.	.	.	.	C	5.808	0.333347	0.11013	.	.	ENSG00000026652	ENST00000320285	D	0.93426	-3.22	4.82	3.96	0.45880	Phospholipid/glycerol acyltransferase (2);	0.316586	0.34676	N	0.003763	T	0.65144	0.2663	N	0.01219	-0.95	0.80722	D	1	P	0.51653	0.947	B	0.42030	0.373	T	0.78677	-0.2111	10	0.02654	T	1	-15.6488	13.2004	0.59765	0.0:0.923:0.0:0.077	.	212	Q9NRZ5	PLCD_HUMAN	T	212	ENSP00000314036:A212T	ENSP00000314036:A212T	A	-	1	0	AGPAT4	161494398	0.999000	0.42202	0.338000	0.25549	0.901000	0.52897	3.935000	0.56560	1.273000	0.44346	0.555000	0.69702	GCC		0.622	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133	
ZNF277	11179	broad.mit.edu	37	7	111982761	111982761	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr7:111982761A>G	ENST00000361822.3	+	12	1459	c.1330A>G	c.(1330-1332)Att>Gtt	p.I444V	AC004112.4_ENST00000431064.1_RNA|AC004112.4_ENST00000411413.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	444					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.I444V(1)		breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						ACAAAGCAGTATTTTGAACCA	0.353																																					p.I444V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1330G	7						.						68.0	65.0	66.0					7																	111982761		2203	4300	6503	111769997	SO:0001583	missense	11179	exon12			AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.1330A>G	7.37:g.111982761A>G	ENSP00000354501:p.Ile444Val		111769997	NM_021994	Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	ENST00000361822.3	37	CCDS5755.2	.	.	.	.	.	.	.	.	.	.	A	3.942	-0.014063	0.07681	.	.	ENSG00000198839	ENST00000361822;ENST00000421864	T	0.25912	1.77	6.06	-0.0844	0.13690	.	0.392379	0.28694	N	0.014442	T	0.07728	0.0194	N	0.02247	-0.625	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42068	-0.9473	10	0.02654	T	1	-8.0492	11.5111	0.50494	0.4427:0.0:0.5573:0.0	.	444	Q9NRM2	ZN277_HUMAN	V	444;112	ENSP00000354501:I444V	ENSP00000354501:I444V	I	+	1	0	ZNF277	111769997	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	0.715000	0.25822	0.183000	0.20059	0.533000	0.62120	ATT		0.353	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316843.2	NM_021994	
FOXK1	221937	broad.mit.edu	37	7	4796634	4796634	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr7:4796634C>T	ENST00000328914.4	+	5	1060	c.1060C>T	c.(1060-1062)Cgg>Tgg	p.R354W	FOXK1_ENST00000446823.1_Missense_Mutation_p.R191W	NM_001037165.1	NP_001032242.1			forkhead box K1									p.R354W(2)|p.R332W(2)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GAATTCTATCCGGCACAACCT	0.522																																					p.R354W												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C1060T	7						.						78.0	79.0	78.0					7																	4796634		2203	4300	6503	4763160	SO:0001583	missense	221937	exon5			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1060C>T	7.37:g.4796634C>T	ENSP00000328720:p.Arg354Trp		4763160	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191421	0.78902	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.98135	-4.74;-4.74	5.8	5.8	0.92144	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.059857	0.64402	D	0.000003	D	0.99378	0.9781	H	0.98996	4.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98393	1.0564	10	0.87932	D	0	.	19.0512	0.93046	0.0:1.0:0.0:0.0	.	354;191	P85037;P85037-2	FOXK1_HUMAN;.	W	191;118;354;237	ENSP00000394442:R191W;ENSP00000328720:R354W	ENSP00000328720:R354W	R	+	1	2	FOXK1	4763160	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	3.933000	0.56545	2.735000	0.93741	0.655000	0.94253	CGG		0.522	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
PTPRZ1	5803	broad.mit.edu	37	7	121699922	121699922	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr7:121699922C>T	ENST00000393386.2	+	29	7198	c.6787C>T	c.(6787-6789)Cca>Tca	p.P2263S	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.P1396S	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2263	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.P2263S(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TCTGATGAGGCCAGGAGTCTT	0.413																																					p.P2263S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6787T	7						.						113.0	102.0	106.0					7																	121699922		2203	4300	6503	121487158	SO:0001583	missense	5803	exon29			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6787C>T	7.37:g.121699922C>T	ENSP00000377047:p.Pro2263Ser		121487158	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	C	32	5.176597	0.94846	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.13420	2.59;2.59	6.07	6.07	0.98685	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000001	T	0.41396	0.1157	M	0.72479	2.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.998	T	0.06881	-1.0802	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1402;1396;2263	P23471-2;C9JFM0;P23471	.;.;PTPRZ_HUMAN	S	2263;1396	ENSP00000377047:P2263S;ENSP00000410000:P1396S	ENSP00000377047:P2263S	P	+	1	0	PTPRZ1	121487158	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	CCA		0.413	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
RGS22	26166	broad.mit.edu	37	8	101075803	101075803	+	Missense_Mutation	SNP	G	G	A	rs370599090		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:101075803G>A	ENST00000360863.6	-	8	1387	c.1193C>T	c.(1192-1194)gCg>gTg	p.A398V	RGS22_ENST00000523287.1_Missense_Mutation_p.A217V|RGS22_ENST00000523437.1_Missense_Mutation_p.A386V	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	398					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.A398V(1)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACACCAGTCCGCCCTGCTCTC	0.368																																					p.A398V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1193T	8						.	G	VAL/ALA	0,3772		0,0,1886	145.0	133.0	137.0		1193	4.8	0.9	8		137	1,8209		0,1,4104	no	missense	RGS22	NM_015668.3	64	0,1,5990	AA,AG,GG		0.0122,0.0,0.0083	probably-damaging	398/1265	101075803	1,11981	1886	4105	5991	101144979	SO:0001583	missense	26166	exon8			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1193C>T	8.37:g.101075803G>A	ENSP00000354109:p.Ala398Val		101144979	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065152	0.36470	0.0	1.22E-4	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.63096	-0.02;-0.02;-0.02	5.68	4.79	0.61399	Regulator of G protein signalling superfamily (1);	0.270973	0.30667	N	0.009127	T	0.74696	0.3750	M	0.66939	2.045	0.30693	N	0.751126	D;D;D	0.76494	0.997;0.997;0.999	P;P;P	0.59825	0.734;0.734;0.864	T	0.77422	-0.2594	10	0.54805	T	0.06	.	16.8092	0.85715	0.0:0.1289:0.8711:0.0	.	386;398;217	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	V	398;386;217;386	ENSP00000354109:A398V;ENSP00000429382:A217V;ENSP00000428212:A386V	ENSP00000354109:A398V	A	-	2	0	RGS22	101144979	1.000000	0.71417	0.903000	0.35520	0.009000	0.06853	4.255000	0.58804	1.496000	0.48567	0.650000	0.86243	GCG		0.368	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
SCARA5	286133	broad.mit.edu	37	8	27824005	27824005	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:27824005G>T	ENST00000354914.3	-	3	652	c.167C>A	c.(166-168)tCg>tAg	p.S56*	SCARA5_ENST00000518030.1_Intron|SCARA5_ENST00000301906.4_Intron|SCARA5_ENST00000524352.1_Nonsense_Mutation_p.S56*|SCARA5_ENST00000380385.2_Nonsense_Mutation_p.S56*	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	56					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.S56*(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		CTTCAGGGCCGACAGGGACCC	0.527																																					p.S56X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C167A	8						.						97.0	103.0	101.0					8																	27824005		2203	4300	6503	27879924	SO:0001587	stop_gained	286133	exon3			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.167C>A	8.37:g.27824005G>T	ENSP00000346990:p.Ser56*		27879924	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Nonsense_Mutation	SNP	ENST00000354914.3	37	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	G	42	9.285645	0.99125	.	.	ENSG00000168079	ENST00000354914;ENST00000380385;ENST00000524352	.	.	.	5.93	5.93	0.95920	.	0.269718	0.30584	N	0.009305	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8364	0.78801	0.0:0.0:1.0:0.0	.	.	.	.	X	56	.	ENSP00000346990:S56X	S	-	2	0	SCARA5	27879924	1.000000	0.71417	0.987000	0.45799	0.873000	0.50193	5.403000	0.66338	2.814000	0.96858	0.563000	0.77884	TCG		0.527	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
NUGGC	389643	broad.mit.edu	37	8	27922074	27922074	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:27922074C>T	ENST00000413272.2	-	7	1028	c.886G>A	c.(886-888)Gac>Aac	p.D296N	NUGGC_ENST00000341513.6_Missense_Mutation_p.D296N	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	296					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.D296N(1)									CTGTTGAAGTCGCCTGTGCCT	0.507																																					p.D296N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G886A	8						.						76.0	79.0	78.0					8																	27922074		2060	4187	6247	27977993	SO:0001583	missense	389643	exon7			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.886G>A	8.37:g.27922074C>T	ENSP00000408697:p.Asp296Asn		27977993	NM_001010906	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	37	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999497	0.93227	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	D;D	0.96856	-4.15;-4.15	6.08	6.08	0.98989	Dynamin, GTPase domain (1);	0.000000	0.64402	D	0.000002	D	0.98210	0.9408	M	0.85630	2.765	0.40611	D	0.981678	D	0.89917	1.0	D	0.97110	1.0	D	0.99187	1.0869	10	0.87932	D	0	-25.5178	16.1754	0.81847	0.0:1.0:0.0:0.0	.	296	Q68CJ6	SLIP_HUMAN	N	296	ENSP00000408697:D296N;ENSP00000345031:D296N	ENSP00000345031:D296N	D	-	1	0	C8orf80	27977993	0.996000	0.38824	0.974000	0.42286	0.998000	0.95712	4.482000	0.60257	2.895000	0.99335	0.650000	0.86243	GAC		0.507	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
NRG1	3084	broad.mit.edu	37	8	32505455	32505456	+	Intron	DEL	AG	AG	-	rs371797228	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	AG	AG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:32505455_32505456delAG	ENST00000405005.3	+	5	502				NRG1_ENST00000338921.4_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000520502.2_Frame_Shift_Del_p.E74fs|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000523079.1_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000287842.3_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.K75fs*30(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCCTCAACTCAGAGAAAATCTG	0.574																																					p.73_74del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.219_220del	8						.																																			32624998	SO:0001627	intron_variant	3084	exon1			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.502+31052AG>-	8.37:g.32505457_32505458delAG			32624997	NM_013959	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Frame_Shift_Del	DEL	ENST00000405005.3	37	CCDS6085.1																																																																																				0.574	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
PXDNL	137902	broad.mit.edu	37	8	52287284	52287284	+	Missense_Mutation	SNP	C	C	T	rs371171299		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:52287284C>T	ENST00000356297.4	-	18	3665	c.3565G>A	c.(3565-3567)Ggc>Agc	p.G1189S	PXDNL_ENST00000543296.1_Missense_Mutation_p.G1189S	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1189					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.G388S(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CCTGGAGAGCCGTACAACCTG	0.473																																					p.G1189S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3565A	8						.	C	SER/GLY	1,4059		0,1,2029	57.0	57.0	57.0		3565	-6.1	0.0	8		57	0,8392		0,0,4196	no	missense	PXDNL	NM_144651.4	56	0,1,6225	TT,TC,CC		0.0,0.0246,0.0080	probably-damaging	1189/1464	52287284	1,12451	2030	4196	6226	52449837	SO:0001583	missense	137902	exon18				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3565G>A	8.37:g.52287284C>T	ENSP00000348645:p.Gly1189Ser		52449837	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179707	0.57800	2.46E-4	0.0	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.76186	-1.0;-1.0	4.46	-6.1	0.02138	.	1.052750	0.07566	N	0.917801	T	0.73877	0.3643	M	0.67700	2.07	0.09310	N	1	D	0.59357	0.985	P	0.54499	0.754	T	0.67581	-0.5634	10	0.62326	D	0.03	.	2.8393	0.05524	0.1125:0.3251:0.1107:0.4516	.	1189	A1KZ92	PXDNL_HUMAN	S	1189	ENSP00000348645:G1189S;ENSP00000444865:G1189S	ENSP00000348645:G1189S	G	-	1	0	PXDNL	52449837	0.063000	0.20901	0.000000	0.03702	0.000000	0.00434	0.818000	0.27295	-2.171000	0.00775	-1.740000	0.00687	GGC		0.473	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
KCNB2	9312	broad.mit.edu	37	8	73480197	73480197	+	Silent	SNP	G	G	C			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:73480197G>C	ENST00000523207.1	+	2	816	c.228G>C	c.(226-228)gtG>gtC	p.V76V		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	76					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.V76V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TCCTGGAAGTGTGCGACGACT	0.532																																					p.V76V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G228C	8						.						83.0	81.0	81.0					8																	73480197		2203	4300	6503	73642751	SO:0001819	synonymous_variant	9312	exon2			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.228G>C	8.37:g.73480197G>C			73642751	NM_004770	Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	CCDS6209.1																																																																																				0.532	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
GDF6	392255	broad.mit.edu	37	8	97156898	97156898	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:97156898C>T	ENST00000287020.5	-	2	1360	c.1261G>A	c.(1261-1263)Gtg>Atg	p.V421M		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	421					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)		p.V421M(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					TTGGTGGGCACGCAGCAGCTG	0.607																																					p.V421M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1261A	8						.						72.0	76.0	75.0					8																	97156898		2203	4300	6503	97226074	SO:0001583	missense	392255	exon2				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1261G>A	8.37:g.97156898C>T	ENSP00000287020:p.Val421Met		97226074	NM_001001557	Q6PI58	Missense_Mutation	SNP	ENST00000287020.5	37	CCDS34926.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.4|24.4	4.528248|4.528248	0.85706|0.85706	.|.	.|.	ENSG00000156466|ENSG00000156466	ENST00000435084|ENST00000287020	.|D	.|0.90261	.|-2.64	4.95|4.95	4.95|4.95	0.65309|0.65309	.|Transforming growth factor-beta, C-terminal (3);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.96818|0.96818	0.8961|0.8961	H|H	0.95780|0.95780	3.72|3.72	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	D|D	0.97907|0.97907	1.0306|1.0306	6|10	0.87932|0.87932	D|D	0|0	.|.	17.1426|17.1426	0.86758|0.86758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|421	.|Q6KF10	.|GDF6_HUMAN	H|M	337|421	.|ENSP00000287020:V421M	ENSP00000412749:R337H|ENSP00000287020:V421M	R|V	-|-	2|1	0|0	GDF6|GDF6	97226074|97226074	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.604000|7.604000	0.82830|0.82830	2.567000|2.567000	0.86603|0.86603	0.650000|0.650000	0.86243|0.86243	CGT|GTG		0.607	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379862.2	NM_001001557	
ZHX2	22882	broad.mit.edu	37	8	123964739	123964739	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr8:123964739G>A	ENST00000314393.4	+	3	1824	c.989G>A	c.(988-990)cGg>cAg	p.R330Q		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	330	Required for homodimerization.|Required for interaction with NFYA.|Required for nuclear localization.|Required for repressor activity.				mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.R330Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GAGGAGGCCCGGAAGAAGATG	0.602																																					p.R330Q	Esophageal Squamous(94;1056 1388 11767 13799 49639)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G989A	8						.						96.0	82.0	87.0					8																	123964739		2203	4300	6503	124033920	SO:0001583	missense	22882	exon3			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.989G>A	8.37:g.123964739G>A	ENSP00000314709:p.Arg330Gln		124033920	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956298	0.92726	.	.	ENSG00000178764	ENST00000314393	T	0.64991	-0.13	5.84	5.84	0.93424	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.82245	0.4995	M	0.82323	2.585	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.83693	0.0178	10	0.87932	D	0	-23.7383	20.1363	0.98032	0.0:0.0:1.0:0.0	.	330	Q9Y6X8	ZHX2_HUMAN	Q	330	ENSP00000314709:R330Q	ENSP00000314709:R330Q	R	+	2	0	ZHX2	124033920	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.476000	0.97823	2.774000	0.95407	0.484000	0.47621	CGG		0.602	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
ASTN2	23245	broad.mit.edu	37	9	119976958	119976958	+	Missense_Mutation	SNP	G	G	A	rs138260564		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:119976958G>A	ENST00000313400.4	-	3	794	c.694C>T	c.(694-696)Cgt>Tgt	p.R232C	ASTN2_ENST00000361209.2_Missense_Mutation_p.R232C|ASTN2_ENST00000361477.3_De_novo_Start_OutOfFrame|ASTN2_ENST00000373996.3_Missense_Mutation_p.R232C			O75129	ASTN2_HUMAN	astrotactin 2	232					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.R232C(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TTCTGCCAACGTCGCTGGGCG	0.632																																					p.R232C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C694T	9						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	48.0	46.0	46.0		694	5.5	1.0	9	dbSNP_134	46	0,8600		0,0,4300	no	missense	ASTN2	NM_014010.4	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	232/1289	119976958	1,13005	2203	4300	6503	119016779	SO:0001583	missense	23245	exon3			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.694C>T	9.37:g.119976958G>A	ENSP00000314038:p.Arg232Cys		119016779	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	G	19.63	3.863558	0.71949	2.27E-4	0.0	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.15139	2.53;2.53;2.45	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000001	T	0.29850	0.0746	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.993;0.993	T	0.02966	-1.1088	9	.	.	.	-21.1878	19.0397	0.92993	0.0:0.0:1.0:0.0	.	232;232;232	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	C	232	ENSP00000314038:R232C;ENSP00000363108:R232C;ENSP00000354504:R232C	.	R	-	1	0	ASTN2	119016779	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.757000	0.98924	2.599000	0.87857	0.655000	0.94253	CGT		0.632	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
ODF2	4957	broad.mit.edu	37	9	131262485	131262485	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:131262485C>A	ENST00000434106.3	+	21	2804	c.2441C>A	c.(2440-2442)tCc>tAc	p.S814Y	ODF2_ENST00000351030.3_Missense_Mutation_p.S809Y|ODF2_ENST00000372807.5_Missense_Mutation_p.S809Y|ODF2_ENST00000444119.2_Missense_Mutation_p.S790Y|ODF2_ENST00000604420.1_Missense_Mutation_p.S814Y|ODF2_ENST00000393527.3_Missense_Mutation_p.S790Y	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	814					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)	p.S790Y(1)		autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GGTCCCTATTCCACCTTCCTG	0.572																																					p.S878Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2633A	9						.						252.0	203.0	219.0					9																	131262485		2203	4300	6503	130302306	SO:0001583	missense	4957	exon21			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.2441C>A	9.37:g.131262485C>A	ENSP00000403453:p.Ser814Tyr		130302306	NM_153435	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	C	8.967	0.971891	0.18736	.	.	ENSG00000136811	ENST00000351030;ENST00000372796;ENST00000303890	T;T;T	0.25085	1.83;1.82;1.82	5.5	2.33	0.28932	.	0.484833	0.18083	N	0.152232	T	0.18467	0.0443	N	0.08118	0	0.09310	N	1	B;B;B;B	0.31351	0.086;0.25;0.32;0.073	B;B;B;B	0.38056	0.086;0.115;0.264;0.06	T	0.32079	-0.9920	10	0.72032	D	0.01	-1.467	16.076	0.80969	0.0:0.5051:0.4948:0.0	.	809;159;814;790	Q5BJF6-4;Q6PJQ8;Q5BJF6;Q5BJF6-3	.;.;ODFP2_HUMAN;.	Y	809;814;790	ENSP00000342581:S809Y;ENSP00000361882:S814Y;ENSP00000307781:S790Y	ENSP00000307781:S790Y	S	+	2	0	ODF2	130302306	0.001000	0.12720	0.207000	0.23584	0.191000	0.23601	0.348000	0.20031	0.610000	0.30035	0.561000	0.74099	TCC		0.572	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
VLDLR	7436	broad.mit.edu	37	9	2651465	2651465	+	Nonsense_Mutation	SNP	G	G	T	rs143836414		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:2651465G>T	ENST00000382100.3	+	16	2658	c.2302G>T	c.(2302-2304)Gaa>Taa	p.E768*	VLDLR_ENST00000382099.2_Intron	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	768	Clustered O-linked oligosaccharides.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.E768*(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		GAACACAACAGAAATTTCAGC	0.408																																					p.E768X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2302T	9						.						90.0	82.0	85.0					9																	2651465		2203	4300	6503	2641465	SO:0001587	stop_gained	7436	exon16				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.2302G>T	9.37:g.2651465G>T	ENSP00000371532:p.Glu768*		2641465	NM_003383	B2RMZ7|D3DRH6|Q5VVF6	Nonsense_Mutation	SNP	ENST00000382100.3	37	CCDS6446.1	.	.	.	.	.	.	.	.	.	.	G	41	9.147817	0.99080	.	.	ENSG00000147852	ENST00000382100;ENST00000382092	.	.	.	5.26	2.25	0.28309	.	0.426300	0.19874	N	0.104121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	7.423	0.27083	0.1533:0.137:0.7097:0.0	.	.	.	.	X	768;647	.	ENSP00000371524:E647X	E	+	1	0	VLDLR	2641465	1.000000	0.71417	0.977000	0.42913	0.998000	0.95712	2.436000	0.44819	0.710000	0.31997	0.591000	0.81541	GAA		0.408	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383	
ERMP1	79956	broad.mit.edu	37	9	5797837	5797837	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:5797837T>G	ENST00000339450.5	-	13	2455	c.2366A>C	c.(2365-2367)aAa>aCa	p.K789T	ERMP1_ENST00000381506.3_3'UTR|ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000543230.1_Missense_Mutation_p.K367T	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	789						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)	p.K789T(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		AAAAGTCAATTTTATAGAATC	0.363																																					p.K789T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2366C	9						.						111.0	125.0	120.0					9																	5797837		2203	4300	6503	5787837	SO:0001583	missense	79956	exon13			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.2366A>C	9.37:g.5797837T>G	ENSP00000340427:p.Lys789Thr		5787837	NM_024896	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	.	.	.	.	.	.	.	.	.	.	T	11.25	1.583738	0.28268	.	.	ENSG00000099219	ENST00000339450;ENST00000543230	T	0.45668	0.89	5.77	3.48	0.39840	.	0.182174	0.64402	D	0.000018	T	0.23410	0.0566	L	0.29908	0.895	0.80722	D	1	P	0.40000	0.698	B	0.29353	0.101	T	0.04413	-1.0953	10	0.45353	T	0.12	-12.8392	7.0648	0.25145	0.0:0.3448:0.0:0.6552	.	789	Q7Z2K6	ERMP1_HUMAN	T	789;367	ENSP00000340427:K789T	ENSP00000340427:K789T	K	-	2	0	ERMP1	5787837	1.000000	0.71417	0.920000	0.36463	0.413000	0.31143	1.485000	0.35519	1.025000	0.39708	0.383000	0.25322	AAA		0.363	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
PSIP1	11168	broad.mit.edu	37	9	15469306	15469306	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:15469306C>T	ENST00000380733.4	-	12	1405	c.1062G>A	c.(1060-1062)agG>agA	p.R354R	PSIP1_ENST00000380738.4_Silent_p.R354R			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	354					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)	p.R354R(1)		breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CAGCATGTATCCTTTGAAGTC	0.279																																					p.R354R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1062A	9						.						56.0	60.0	59.0					9																	15469306		2199	4282	6481	15459306	SO:0001819	synonymous_variant	11168	exon12			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.1062G>A	9.37:g.15469306C>T			15459306	NM_001128217	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Silent	SNP	ENST00000380733.4	37	CCDS6479.1																																																																																				0.279	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055445.1	NM_033222	
SPATA31A3	727830	broad.mit.edu	37	9	40701736	40701736	+	Silent	SNP	C	C	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:40701736C>T	ENST00000356699.5	+	2	245	c.216C>T	c.(214-216)ccC>ccT	p.P72P	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	72					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P72P(2)									GGCGGAGGCCCAGAGGCAGGA	0.532																																					p.P72P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C216T	9						.						1.0	1.0	1.0					9																	40701736		291	740	1031	40691736	SO:0001819	synonymous_variant	727830	exon2					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.216C>T	9.37:g.40701736C>T			40691736	NM_001083124		Silent	SNP	ENST00000356699.5	37	CCDS47969.1																																																																																				0.532	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124	
USP20	10868	broad.mit.edu	37	9	132642547	132642547	+	Missense_Mutation	SNP	G	G	A	rs374645414		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chr9:132642547G>A	ENST00000315480.4	+	25	2898	c.2740G>A	c.(2740-2742)Gtg>Atg	p.V914M	USP20_ENST00000472108.1_3'UTR|USP20_ENST00000372429.3_Missense_Mutation_p.V914M|USP20_ENST00000358355.1_Missense_Mutation_p.V914M			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	914					endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.V914M(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GACGCGGGCCGTGTGATCTGC	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		14703	0.0		0.0	False		,,,				2504	0.001				p.V914M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2740A	9						.	G	MET/VAL,MET/VAL,MET/VAL	1,4197		0,1,2098	16.0	22.0	20.0		2740,2740,2740	-0.5	0.2	9		20	0,8424		0,0,4212	no	missense,missense,missense	USP20	NM_001008563.3,NM_001110303.2,NM_006676.6	21,21,21	0,1,6310	AA,AG,GG		0.0,0.0238,0.0079	benign,benign,benign	914/915,914/915,914/915	132642547	1,12621	2099	4212	6311	131682368	SO:0001583	missense	10868	exon25			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2740G>A	9.37:g.132642547G>A	ENSP00000313811:p.Val914Met		131682368	NM_001008563	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	G	9.391	1.075501	0.20227	2.38E-4	0.0	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.21031	2.03;2.03;2.03	5.01	-0.505	0.11993	.	0.706629	0.12690	N	0.447267	T	0.11410	0.0278	L	0.29908	0.895	0.22213	N	0.999284	B	0.32604	0.377	B	0.24269	0.052	T	0.16070	-1.0415	10	0.72032	D	0.01	.	4.4527	0.11628	0.0716:0.2454:0.4365:0.2464	.	914	Q9Y2K6	UBP20_HUMAN	M	914	ENSP00000361506:V914M;ENSP00000313811:V914M;ENSP00000351122:V914M	ENSP00000313811:V914M	V	+	1	0	USP20	131682368	0.570000	0.26651	0.160000	0.22671	0.001000	0.01503	0.913000	0.28611	-0.422000	0.07405	-0.253000	0.11424	GTG		0.637	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
PLXNB3	5365	broad.mit.edu	37	X	153030932	153030933	+	5'UTR	INS	-	-	C	rs5987152	byFrequency	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chrX:153030932_153030933insC	ENST00000361971.5	+	0	56_57				PLXNB3_ENST00000538966.1_5'UTR|PLXNB3_ENST00000538282.1_5'Flank|PLXNB3_ENST00000538543.1_5'UTR|U52111.14_ENST00000416854.1_RNA|U52111.14_ENST00000434284.1_RNA|PLXNB3_ENST00000538776.1_5'UTR	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3						axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TCAGGACAATGCCCCCCCGCAG	0.688																																					.												.	.	0			.	X						.																																			152684127	SO:0001623	5_prime_UTR_variant	5365	.			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.-58->C	X.37:g.153030939_153030939dupC			152684126	.	B7Z3E6|F5H773|Q9HDA4	De_novo_Start_OutOfFrame	INS	ENST00000361971.5	37	CCDS14729.1																																																																																				0.688	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
IL1RAPL2	26280	broad.mit.edu	37	X	104993063	104993063	+	Silent	SNP	A	A	C	rs372925400		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chrX:104993063A>C	ENST00000372582.1	+	9	1915	c.1159A>C	c.(1159-1161)Agg>Cgg	p.R387R	IL1RAPL2_ENST00000344799.4_Silent_p.R387R|IL1RAPL2_ENST00000485671.1_3'UTR	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	387					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R387R(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GCTCTTCTACAGGCAGCACTT	0.413																																					p.R387R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1159C	X						.	A		0,3835		0,0,1632,571	115.0	92.0	100.0		1159	-2.9	0.9	X		100	1,6727		0,1,2427,1872	no	coding-synonymous	IL1RAPL2	NM_017416.1		0,1,4059,2443	CC,CA,AA,A		0.0149,0.0,0.0095		387/687	104993063	1,10562	2203	4300	6503	104879719	SO:0001819	synonymous_variant	26280	exon9			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1159A>C	X.37:g.104993063A>C			104879719	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	CCDS14517.1																																																																																				0.413	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
NLGN4X	57502	broad.mit.edu	37	X	5821678	5821678	+	Silent	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chrX:5821678G>A	ENST00000381095.3	-	5	1668	c.1041C>T	c.(1039-1041)gaC>gaT	p.D347D	NLGN4X_ENST00000381092.1_Silent_p.D347D|NLGN4X_ENST00000538097.1_Silent_p.D347D|NLGN4X_ENST00000381093.2_Silent_p.D367D|NLGN4X_ENST00000275857.6_Silent_p.D347D	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	347					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.D347D(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CTGGGATGACGTCGCCGTCGA	0.587																																					p.D347D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1041T	X						.						133.0	92.0	106.0					X																	5821678		2203	4300	6503	5831678	SO:0001819	synonymous_variant	57502	exon5			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1041C>T	X.37:g.5821678G>A			5831678	NM_020742	Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	CCDS14126.1																																																																																				0.587	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
DACH2	117154	broad.mit.edu	37	X	85769338	85769338	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chrX:85769338G>A	ENST00000373125.4	+	3	584	c.584G>A	c.(583-585)cGc>cAc	p.R195H	DACH2_ENST00000510272.1_5'UTR|DACH2_ENST00000508860.1_Missense_Mutation_p.R28H|DACH2_ENST00000373131.1_Missense_Mutation_p.R182H	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	195					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R182H(2)|p.R195H(2)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GAAAATGCCCGCCTTCTGACC	0.468																																					p.R195H												.	.	4	Substitution - Missense(4)	large_intestine(2)|endometrium(2)	c.G584A	X						.						54.0	46.0	49.0					X																	85769338		2203	4300	6503	85655994	SO:0001583	missense	117154	exon3			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.584G>A	X.37:g.85769338G>A	ENSP00000362217:p.Arg195His		85655994	NM_053281	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	G	5.896	0.349361	0.11182	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000400297	D;D	0.83163	-1.69;-1.68	4.88	4.01	0.46588	.	0.170292	0.41194	D	0.000921	T	0.65165	0.2665	N	0.20766	0.605	0.80722	D	1	P;B;P	0.45902	0.868;0.181;0.735	B;B;B	0.34452	0.09;0.183;0.109	T	0.62053	-0.6935	10	0.12430	T	0.62	.	12.126	0.53917	0.0857:0.0:0.9143:0.0	.	61;182;195	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	H	195;182;195;28;28	ENSP00000362223:R182H;ENSP00000362217:R195H	ENSP00000345134:R195H	R	+	2	0	DACH2	85655994	0.999000	0.42202	0.992000	0.48379	0.987000	0.75469	2.924000	0.48876	0.834000	0.34852	0.506000	0.49869	CGC		0.468	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
PCDH11X	27328	broad.mit.edu	37	X	91137944	91137944	+	Intron	SNP	G	G	T			TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chrX:91137944G>T	ENST00000373094.1	+	2	3878				PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000395337.2_Missense_Mutation_p.E1024D|PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000406881.1_Intron	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked						homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E1024D(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TCTGCAGTGAGATATAACTTT	0.318																																					p.E1024D	NSCLC(38;925 1092 2571 38200 45895)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3072T	X						.						144.0	129.0	134.0					X																	91137944		2203	4299	6502	91024600	SO:0001627	intron_variant	27328	exon6			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+3672G>T	X.37:g.91137944G>T			91024600	NM_032967	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852726	0.32699	.	.	ENSG00000102290	ENST00000395337	T	0.52295	0.67	3.42	2.55	0.30701	.	.	.	.	.	T	0.25568	0.0622	.	.	.	0.80722	D	1	P	0.42871	0.792	B	0.43301	0.415	T	0.29579	-1.0007	8	0.02654	T	1	.	5.498	0.16813	0.1558:0.0:0.8442:0.0	.	1024	Q9BZA7-2	.	D	1024	ENSP00000378746:E1024D	ENSP00000378746:E1024D	E	+	3	2	PCDH11X	91024600	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	1.090000	0.30902	0.807000	0.34208	0.523000	0.50628	GAG		0.318	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
MAGEC2	51438	broad.mit.edu	37	X	141291474	141291474	+	Silent	SNP	C	C	T	rs528011223		TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-3883-01A-02W-0899-10	TCGA-AG-3883-10A-01W-0901-10	g.chrX:141291474C>T	ENST00000247452.3	-	3	647	c.300G>A	c.(298-300)ctG>ctA	p.L100L		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	100	Ser-rich.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.L100L(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					AGCAGGAGCTCAgaggactct	0.572										HNSCC(46;0.14)																											p.L100L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G300A	X						.						72.0	67.0	69.0					X																	141291474		2203	4300	6503	141119140	SO:0001819	synonymous_variant	51438	exon3			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.300G>A	X.37:g.141291474C>T			141119140	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Silent	SNP	ENST00000247452.3	37	CCDS14678.1																																																																																				0.572	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
