#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OGDHL	55753	hgsc.bcm.edu	37	10	50946053	50946053	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr10:50946053G>A	ENST00000374103.4	-	19	2542	c.2457C>T	c.(2455-2457)tcC>tcT	p.S819S	OGDHL_ENST00000490844.1_5'UTR|OGDHL_ENST00000419399.1_Silent_p.S762S|OGDHL_ENST00000432695.1_Silent_p.S610S	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	819					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.S819S(1)		central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						TGGCCGGTGTGGAGCAGTTGA	0.632																																					p.S762S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2286T	10						.						251.0	232.0	238.0					10																	50946053		2203	4300	6503	50616059	SO:0001819	synonymous_variant	55753	exon18			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2457C>T	10.37:g.50946053G>A			50616059	NM_001143996	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Silent	SNP	ENST00000374103.4	37	CCDS7234.1																																																																																				0.632	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
HELLS	3070	hgsc.bcm.edu	37	10	96353345	96353345	+	Silent	SNP	T	T	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr10:96353345T>C	ENST00000348459.5	+	18	2166	c.2061T>C	c.(2059-2061)gaT>gaC	p.D687D	HELLS_ENST00000371332.4_Silent_p.D733D|HELLS_ENST00000394036.1_3'UTR|HELLS_ENST00000394045.1_Silent_p.D589D|RP11-119K6.6_ENST00000432120.1_RNA|HELLS_ENST00000239026.6_3'UTR	NM_018063.3	NP_060533.2			helicase, lymphoid-specific									p.D687D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		CTGCAGCAGATACAGTTATCA	0.363																																					p.D687D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2061C	10						.						121.0	113.0	116.0					10																	96353345		2203	4300	6503	96343335	SO:0001819	synonymous_variant	3070	exon18			AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.2061T>C	10.37:g.96353345T>C			96343335	NM_018063		Silent	SNP	ENST00000348459.5	37	CCDS7434.1																																																																																				0.363	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
GBF1	8729	hgsc.bcm.edu	37	10	104121552	104121552	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr10:104121552G>A	ENST00000369983.3	+	14	1826	c.1566G>A	c.(1564-1566)ctG>ctA	p.L522L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	522					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.L522L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		AGATGGCACTGGAGGCCATTG	0.468																																					p.L523L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1569A	10						.						139.0	122.0	128.0					10																	104121552		2203	4300	6503	104111542	SO:0001819	synonymous_variant	8729	exon14			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.1566G>A	10.37:g.104121552G>A			104111542	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Silent	SNP	ENST00000369983.3	37	CCDS7533.1																																																																																				0.468	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
PRDM11	56981	hgsc.bcm.edu	37	11	45245965	45245965	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr11:45245965G>A	ENST00000530656.1	+	7	1042	c.1042G>A	c.(1042-1044)Gaa>Aaa	p.E348K	CTD-2560E9.3_ENST00000527450.1_RNA|PRDM11_ENST00000263765.4_Missense_Mutation_p.E348K|PRDM11_ENST00000424263.2_Missense_Mutation_p.E314K|PRDM11_ENST00000528980.1_Intron			Q9NQV5	PRD11_HUMAN	PR domain containing 11	348							methyltransferase activity (GO:0008168)	p.E348K(1)		endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GGCCTCACTGGAATCTGCGAA	0.517																																					p.E348K	NSCLC(118;1511 1736 6472 36603 43224)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1042A	11						.						136.0	140.0	139.0					11																	45245965		2203	4299	6502	45202541	SO:0001583	missense	56981	exon8			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.1042G>A	11.37:g.45245965G>A	ENSP00000435976:p.Glu348Lys		45202541	NM_020229	Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	37		.	.	.	.	.	.	.	.	.	.	G	24.7	4.560611	0.86335	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000424263	T;T;T	0.50277	0.75;0.75;0.75	5.41	5.41	0.78517	.	0.000000	0.56097	D	0.000027	T	0.59998	0.2235	L	0.29908	0.895	0.47476	D	0.999436	D	0.71674	0.998	D	0.80764	0.994	T	0.63625	-0.6595	10	0.87932	D	0	-25.2056	19.2758	0.94031	0.0:0.0:1.0:0.0	.	348	Q9NQV5	PRD11_HUMAN	K	348;348;314	ENSP00000263765:E348K;ENSP00000435976:E348K;ENSP00000394314:E314K	ENSP00000263765:E348K	E	+	1	0	PRDM11	45202541	1.000000	0.71417	0.972000	0.41901	0.690000	0.40134	8.599000	0.90856	2.569000	0.86673	0.558000	0.71614	GAA		0.517	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229	
BCL9L	283149	hgsc.bcm.edu	37	11	118772693	118772693	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr11:118772693G>A	ENST00000334801.3	-	6	2723	c.1759C>T	c.(1759-1761)Caa>Taa	p.Q587*	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	587					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)	p.Q587*(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		ATGGGATCTTGAACATCCATG	0.642																																					p.Q587X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1759T	11						.						36.0	37.0	37.0					11																	118772693		2200	4295	6495	118277903	SO:0001587	stop_gained	283149	exon6			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.1759C>T	11.37:g.118772693G>A	ENSP00000335320:p.Gln587*		118277903	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Nonsense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	G	46	12.284320	0.99653	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000392849;ENST00000431085	.	.	.	4.73	4.73	0.59995	.	0.000000	0.41712	D	0.000823	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7137	17.4781	0.87666	0.0:0.0:1.0:0.0	.	.	.	.	X	587;550;587;587	.	ENSP00000335320:Q587X	Q	-	1	0	BCL9L	118277903	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	2.858000	0.48356	2.465000	0.83290	0.313000	0.20887	CAA		0.642	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
KRAS	3845	hgsc.bcm.edu	37	12	25398281	25398281	+	Missense_Mutation	SNP	C	C	T	rs112445441		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr12:25398281C>T	ENST00000256078.4	-	2	101	c.38G>A	c.(37-39)gGc>gAc	p.G13D	KRAS_ENST00000557334.1_Missense_Mutation_p.G13D|KRAS_ENST00000556131.1_Missense_Mutation_p.G13D|KRAS_ENST00000311936.3_Missense_Mutation_p.G13D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	13			G -> D (in a breast carcinoma cell line and GASC; somatic mutation). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:3627975}.|G -> R (in pylocytic astrocytoma; somatic mutation; increase activation of the Ras pathway). {ECO:0000269|PubMed:16247081}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G13D(3223)|p.G13V(33)|p.G13A(28)|p.G13E(3)|p.G13I(1)|p.G13N(1)|p.G13_V14>DI(1)|p.G13R(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGCCTACGCCACCAGCTCC	0.338	G13D(DLD1_LARGE_INTESTINE)|G13D(DV90_LUNG)|G13D(HCT116_LARGE_INTESTINE)|G13D(HCT15_LARGE_INTESTINE)|G13D(LOVO_LARGE_INTESTINE)|G13D(MDAMB231_BREAST)|G13D(NCIH647_LUNG)|G13D(NCIH747_LARGE_INTESTINE)|G13D(NOMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G13D(T84_LARGE_INTESTINE)|G13D(TOLEDO_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G13D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,lung,NS,Substitution - Missense,-1 	.	3291	Substitution - Missense(3290)|Complex - compound substitution(1)	large_intestine(2808)|haematopoietic_and_lymphoid_tissue(94)|lung(92)|endometrium(54)|soft_tissue(38)|ovary(38)|stomach(32)|pancreas(30)|thyroid(27)|biliary_tract(21)|prostate(20)|breast(10)|cervix(4)|gastrointestinal_tract_(site_indeterminate)(3)|upper_aerodigestive_tract(3)|urinary_tract(3)|liver(3)|salivary_gland(3)|small_intestine(3)|oesophagus(2)|skin(1)|genital_tract(1)|bone(1)	c.G38A	12						.						88.0	78.0	82.0					12																	25398281		2203	4300	6503	25289548	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.38G>A	12.37:g.25398281C>T	ENSP00000256078:p.Gly13Asp		25289548	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867862	0.91587	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	D;T;T;T	0.82803	-1.65;-0.7;-0.7;-0.7	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.93062	3.375	0.80722	D	1	B;P	0.43314	0.215;0.803	B;P	0.46172	0.175;0.506	D	0.92106	0.5692	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	13;13	P01116-2;P01116	.;RASK_HUMAN	D	13	ENSP00000308495:G13D;ENSP00000452512:G13D;ENSP00000256078:G13D;ENSP00000451856:G13D	ENSP00000256078:G13D	G	-	2	0	KRAS	25289548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGC		0.338	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TPH2	121278	hgsc.bcm.edu	37	12	72425471	72425471	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr12:72425471T>C	ENST00000333850.3	+	11	1610	c.1469T>C	c.(1468-1470)aTt>aCt	p.I490T		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	490					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.I490T(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	TATCTGGGGATTTGATGCCTG	0.423																																					p.I490T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1469C	12						.						147.0	147.0	147.0					12																	72425471		2203	4299	6502	70711738	SO:0001583	missense	121278	exon11			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1469T>C	12.37:g.72425471T>C	ENSP00000329093:p.Ile490Thr		70711738	NM_173353	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	37	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	T	17.33	3.361693	0.61403	.	.	ENSG00000139287	ENST00000333850	D	0.99557	-6.16	5.86	5.86	0.93980	.	0.055324	0.64402	D	0.000001	D	0.98002	0.9342	N	0.14661	0.345	0.58432	D	0.999999	P	0.45594	0.862	B	0.41917	0.37	D	0.99862	1.1084	10	0.87932	D	0	.	16.2526	0.82494	0.0:0.0:0.0:1.0	.	490	Q8IWU9	TPH2_HUMAN	T	490	ENSP00000329093:I490T	ENSP00000329093:I490T	I	+	2	0	TPH2	70711738	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	8.040000	0.89188	2.241000	0.73720	0.482000	0.46254	ATT		0.423	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
ANO4	121601	hgsc.bcm.edu	37	12	101430924	101430924	+	Missense_Mutation	SNP	A	A	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr12:101430924A>C	ENST00000392977.3	+	10	1103	c.893A>C	c.(892-894)cAt>cCt	p.H298P	RP11-350G24.1_ENST00000549036.1_RNA|ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.H263P			Q32M45	ANO4_HUMAN	anoctamin 4	298					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.H263P(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TTTCCCCTGCATGAGGTATTG	0.353										HNSCC(74;0.22)																											p.H263P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A788C	12						.						360.0	311.0	328.0					12																	101430924		2203	4300	6503	99955055	SO:0001583	missense	121601	exon9			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.893A>C	12.37:g.101430924A>C	ENSP00000376703:p.His298Pro		99955055	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	A	23.9	4.473143	0.84640	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.73363	-0.74;-0.74	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89729	0.6799	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.92335	0.5877	10	0.87932	D	0	.	16.1172	0.81314	1.0:0.0:0.0:0.0	.	298;263	Q32M45;Q32M45-2	ANO4_HUMAN;.	P	263;298	ENSP00000376705:H263P;ENSP00000376703:H298P	ENSP00000376703:H298P	H	+	2	0	ANO4	99955055	1.000000	0.71417	0.981000	0.43875	0.973000	0.67179	8.894000	0.92506	2.266000	0.75297	0.533000	0.62120	CAT		0.353	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
P2RX7	5027	hgsc.bcm.edu	37	12	121603968	121603968	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr12:121603968A>G	ENST00000546057.1	+	7	865	c.722A>G	c.(721-723)aAt>aGt	p.N241S	P2RX7_ENST00000535250.1_Missense_Mutation_p.N151S|P2RX7_ENST00000541446.1_5'UTR|P2RX7_ENST00000328963.5_Missense_Mutation_p.N71S|P2RX7_ENST00000377162.2_Intron|P2RX7_ENST00000443520.3_3'UTR	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	241					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)	p.N241S(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACAGGCGATAATTTTTCAGAT	0.493																																					p.N241S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A722G	12						.						254.0	256.0	255.0					12																	121603968		2203	4300	6503	120088351	SO:0001583	missense	5027	exon7			Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.722A>G	12.37:g.121603968A>G	ENSP00000442349:p.Asn241Ser		120088351	NM_002562	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	ENST00000546057.1	37	CCDS9213.1	.	.	.	.	.	.	.	.	.	.	A	13.50	2.254522	0.39896	.	.	ENSG00000089041	ENST00000546057;ENST00000328963;ENST00000535250	T;T;T	0.04234	3.67;3.67;3.67	5.38	2.92	0.33932	.	0.665278	0.14804	N	0.297471	T	0.06234	0.0161	L	0.57536	1.79	0.41357	D	0.987409	B;B;B	0.22909	0.037;0.077;0.01	B;B;B	0.23716	0.017;0.048;0.04	T	0.20405	-1.0276	10	0.33940	T	0.23	.	6.8597	0.24060	0.7675:0.1512:0.0813:0.0	.	71;151;241	F8W951;F5H7E8;Q99572	.;.;P2RX7_HUMAN	S	241;71;151	ENSP00000442349:N241S;ENSP00000330696:N71S;ENSP00000442572:N151S	ENSP00000330696:N71S	N	+	2	0	P2RX7	120088351	0.072000	0.21174	0.693000	0.30195	0.990000	0.78478	1.869000	0.39519	0.306000	0.22856	0.460000	0.39030	AAT		0.493	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402532.1	NM_002562	
SGCG	6445	hgsc.bcm.edu	37	13	23869602	23869602	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr13:23869602G>T	ENST00000218867.3	+	6	678	c.554G>T	c.(553-555)aGa>aTa	p.R185I	SGCG_ENST00000545013.1_Missense_Mutation_p.R185I|SGCG_ENST00000537476.1_Missense_Mutation_p.R185I	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	185					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.R185I(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		CCCCTTGTCAGAGCCGACCCG	0.413																																					p.R185I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G554T	13						.						144.0	146.0	146.0					13																	23869602		2203	4300	6503	22767602	SO:0001583	missense	6445	exon6			U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.554G>T	13.37:g.23869602G>T	ENSP00000218867:p.Arg185Ile		22767602	NM_000231	Q32M32|Q5T9J6	Missense_Mutation	SNP	ENST00000218867.3	37	CCDS9299.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.295704	0.23564	.	.	ENSG00000102683	ENST00000218867;ENST00000537476;ENST00000545013	D;D;D	0.95137	-3.62;-3.62;-3.62	4.6	-1.05	0.10036	.	0.321642	0.37483	N	0.002076	D	0.92420	0.7594	M	0.86502	2.82	0.52501	D	0.999956	P	0.34562	0.457	B	0.33799	0.17	D	0.84963	0.0878	10	0.72032	D	0.01	-15.8157	4.6131	0.12413	0.302:0.2919:0.4061:0.0	.	185	Q13326	SGCG_HUMAN	I	185	ENSP00000218867:R185I;ENSP00000444100:R185I;ENSP00000442232:R185I	ENSP00000218867:R185I	R	+	2	0	SGCG	22767602	0.933000	0.31639	0.045000	0.18777	0.346000	0.29079	0.184000	0.16939	-0.549000	0.06191	-0.310000	0.09108	AGA		0.413	SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044151.1	NM_000231	
UBR1	197131	hgsc.bcm.edu	37	15	43307955	43307955	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr15:43307955G>C	ENST00000290650.4	-	29	3218	c.3140C>G	c.(3139-3141)aCt>aGt	p.T1047S	UBR1_ENST00000568782.1_5'UTR|UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1047					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T1047S(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GAGTTTATGAGTTTCAATGAA	0.373																																					p.T1047S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3140G	15						.						192.0	182.0	186.0					15																	43307955		2203	4299	6502	41095247	SO:0001583	missense	197131	exon29				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3140C>G	15.37:g.43307955G>C	ENSP00000290650:p.Thr1047Ser		41095247	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226781	0.58668	.	.	ENSG00000159459	ENST00000290650	T	0.39787	1.06	5.65	5.65	0.86999	.	0.106370	0.64402	D	0.000003	T	0.26557	0.0649	N	0.17474	0.49	0.80722	D	1	B;B	0.34200	0.02;0.441	B;B	0.24848	0.019;0.056	T	0.08269	-1.0730	10	0.11182	T	0.66	-11.2637	19.9142	0.97043	0.0:0.0:1.0:0.0	.	1047;1047	B4DYL2;Q8IWV7	.;UBR1_HUMAN	S	1047	ENSP00000290650:T1047S	ENSP00000290650:T1047S	T	-	2	0	UBR1	41095247	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.263000	0.95617	2.941000	0.99782	0.655000	0.94253	ACT		0.373	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
SKOR1	390598	hgsc.bcm.edu	37	15	68122580	68122580	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr15:68122580A>T	ENST00000380035.2	+	4	2517	c.2459A>T	c.(2458-2460)aAa>aTa	p.K820I	RP11-34F13.3_ENST00000558889.1_RNA|SKOR1_ENST00000554054.1_Missense_Mutation_p.K792I|SKOR1_ENST00000389002.1_Missense_Mutation_p.K776I|SKOR1_ENST00000341418.5_Missense_Mutation_p.K723I|SKOR1_ENST00000554240.1_Missense_Mutation_p.K781I			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	820					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)	p.K776I(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						GAAACGAGGAAATCCTATCCA	0.522																																					p.K776I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2327T	15						.						89.0	78.0	82.0					15																	68122580		2200	4298	6498	65909634	SO:0001583	missense	390598	exon5				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.2459A>T	15.37:g.68122580A>T	ENSP00000369374:p.Lys820Ile		65909634	NM_001031807	A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	ENST00000380035.2	37		.	.	.	.	.	.	.	.	.	.	A	23.9	4.473075	0.84640	.	.	ENSG00000188779	ENST00000341418;ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7	5.79	4.66	0.58398	.	0.131887	0.50627	D	0.000107	T	0.52885	0.1762	L	0.32530	0.975	0.39226	D	0.963584	D	0.63880	0.993	P	0.61940	0.896	T	0.57353	-0.7826	10	0.66056	D	0.02	-16.7565	10.7214	0.46042	0.9248:0.0:0.0752:0.0	.	776	P84550-3	.	I	723;781;792;820;776	ENSP00000343200:K723I;ENSP00000451193:K781I;ENSP00000452361:K792I;ENSP00000369374:K820I;ENSP00000373654:K776I	ENSP00000343200:K723I	K	+	2	0	SKOR1	65909634	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.591000	0.61019	1.020000	0.39573	0.533000	0.62120	AAA		0.522	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000410832.1	NM_001031807	
CDH8	1006	hgsc.bcm.edu	37	16	61854885	61854885	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr16:61854885A>T	ENST00000577390.1	-	6	1922	c.968T>A	c.(967-969)cTt>cAt	p.L323H	CDH8_ENST00000584337.1_Missense_Mutation_p.L323H|CDH8_ENST00000299345.6_Missense_Mutation_p.L323H|CDH8_ENST00000577730.1_Missense_Mutation_p.L323H	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	323	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.L323H(1)|p.L323P(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GATTTCAAAAAGTGCTGTTCC	0.403																																					p.L323H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T968A	16						.						172.0	138.0	149.0					16																	61854885		2203	4300	6503	60412386	SO:0001583	missense	1006	exon6			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.968T>A	16.37:g.61854885A>T	ENSP00000462701:p.Leu323His		60412386	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003550	0.74932	.	.	ENSG00000150394	ENST00000299345	T	0.03745	3.82	6.16	6.16	0.99307	Cadherin (4);Cadherin-like (1);	0.181883	0.49305	D	0.000155	T	0.09905	0.0243	L	0.33093	0.98	0.37111	D	0.90036	P;B	0.48764	0.915;0.006	P;B	0.60789	0.879;0.017	T	0.45963	-0.9225	10	0.23891	T	0.37	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	139;323	Q3LID3;P55286	.;CADH8_HUMAN	H	323	ENSP00000299345:L323H	ENSP00000299345:L323H	L	-	2	0	CDH8	60412386	0.696000	0.27757	0.998000	0.56505	0.980000	0.70556	5.886000	0.69743	2.367000	0.80283	0.528000	0.53228	CTT		0.403	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
SF3B3	23450	hgsc.bcm.edu	37	16	70599160	70599160	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr16:70599160G>A	ENST00000302516.5	+	19	2867	c.2656G>A	c.(2656-2658)Gag>Aag	p.E886K		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	886					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)	p.E886K(1)		breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				GGAACAGAATGAGGCAGCTTT	0.527																																					p.E886K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2656A	16						.						79.0	78.0	78.0					16																	70599160		2198	4300	6498	69156661	SO:0001583	missense	23450	exon19			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.2656G>A	16.37:g.70599160G>A	ENSP00000305790:p.Glu886Lys		69156661	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	37	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	G	36	5.955745	0.97145	.	.	ENSG00000189091	ENST00000302516	T	0.61859	0.07	5.96	5.96	0.96718	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81597	0.4856	M	0.90082	3.085	0.80722	D	1	D	0.63880	0.993	D	0.68765	0.96	D	0.84104	0.0397	10	0.87932	D	0	.	20.422	0.99049	0.0:0.0:1.0:0.0	.	886	Q15393	SF3B3_HUMAN	K	886	ENSP00000305790:E886K	ENSP00000305790:E886K	E	+	1	0	SF3B3	69156661	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.789000	0.99068	2.832000	0.97577	0.655000	0.94253	GAG		0.527	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
TP53	7157	hgsc.bcm.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R213X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,+1 	.	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	c.C637T	17	GRCh37	CM951226	TP53	M		.						132.0	118.0	123.0					17																	7578212		2203	4300	6503	7518937	SO:0001587	stop_gained	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*		7518937	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRT20	54474	hgsc.bcm.edu	37	17	39038874	39038874	+	Silent	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr17:39038874A>G	ENST00000167588.3	-	2	464	c.423T>C	c.(421-423)tgT>tgC	p.C141C		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	141	Coil 1B.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)	p.C141C(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				TTTGCAGGACACACCGAGCAT	0.318																																					p.C141C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T423C	17						.						128.0	118.0	122.0					17																	39038874		2203	4300	6503	36292400	SO:0001819	synonymous_variant	54474	exon2			BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.423T>C	17.37:g.39038874A>G			36292400	NM_019010	B2R6W7	Silent	SNP	ENST00000167588.3	37	CCDS11379.1																																																																																				0.318	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257202.2		
DNMT1	1786	hgsc.bcm.edu	37	19	10291152	10291152	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:10291152G>C	ENST00000340748.4	-	4	554	c.319C>G	c.(319-321)Cta>Gta	p.L107V	DNMT1_ENST00000540357.1_Missense_Mutation_p.L107V|DNMT1_ENST00000359526.4_Missense_Mutation_p.L107V			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	107	Interaction with DMAP1.|Interaction with DNMT3A.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L107V(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CCGTTTTCTAGACGTCCATTC	0.517																																					p.L107V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319G	19						.						129.0	125.0	126.0					19																	10291152		2203	4300	6503	10152152	SO:0001583	missense	1786	exon4			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.319C>G	19.37:g.10291152G>C	ENSP00000345739:p.Leu107Val		10152152	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	g	11.78	1.740070	0.30865	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748	T;T;T	0.29142	1.9;1.58;1.58	5.65	3.35	0.38373	.	1.024130	0.07797	N	0.955835	T	0.19366	0.0465	N	0.19112	0.55	0.09310	N	1	P;P;P	0.40794	0.729;0.729;0.61	B;B;B	0.39027	0.288;0.288;0.15	T	0.11397	-1.0589	10	0.33940	T	0.23	.	4.8236	0.13405	0.1721:0.4721:0.3558:0.0	.	107;107;107	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	V	107	ENSP00000352516:L107V;ENSP00000440457:L107V;ENSP00000345739:L107V	ENSP00000345739:L107V	L	-	1	2	DNMT1	10152152	0.146000	0.22672	0.111000	0.21465	0.990000	0.78478	0.908000	0.28545	1.371000	0.46172	0.650000	0.86243	CTA		0.517	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
CALR	811	hgsc.bcm.edu	37	19	13051137	13051137	+	Silent	SNP	G	G	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:13051137G>C	ENST00000316448.5	+	5	646	c.573G>C	c.(571-573)gtG>gtC	p.V191V		NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	191	4 X approximate repeats.|N-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.V191V(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	ACAGCCAGGTGGAGTCCGGCT	0.507																																					p.V191V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G573C	19						.						99.0	106.0	104.0					19																	13051137		2203	4300	6503	12912137	SO:0001819	synonymous_variant	811	exon5			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.573G>C	19.37:g.13051137G>C			12912137	NM_004343	Q6IAT4|Q9UDG2	Silent	SNP	ENST00000316448.5	37	CCDS12288.1																																																																																				0.507	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
SIN3B	23309	hgsc.bcm.edu	37	19	16962243	16962243	+	Silent	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:16962243C>T	ENST00000248054.5	+	6	768	c.747C>T	c.(745-747)tgC>tgT	p.C249C	SIN3B_ENST00000596802.1_Silent_p.C249C|SIN3B_ENST00000379803.1_Silent_p.C249C					SIN3 transcription regulator family member B									p.C249C(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACGGGCCGTGCGAGATGCACA	0.647																																					p.C249C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C747T	19						.						81.0	80.0	81.0					19																	16962243		2203	4300	6503	16823243	SO:0001819	synonymous_variant	23309	exon6			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.747C>T	19.37:g.16962243C>T			16823243	NM_015260		Silent	SNP	ENST00000248054.5	37																																																																																					0.647	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
ZNF569	148266	hgsc.bcm.edu	37	19	37904605	37904605	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:37904605C>A	ENST00000316950.6	-	6	1512	c.955G>T	c.(955-957)Gtt>Ttt	p.V319F	ZNF569_ENST00000392149.2_Missense_Mutation_p.V319F|ZNF569_ENST00000392150.2_Missense_Mutation_p.V160F	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V319F(1)		breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCAGTATGAACTTTCTGATGT	0.388																																					p.V319F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G955T	19						.						132.0	131.0	131.0					19																	37904605		2203	4300	6503	42596445	SO:0001583	missense	148266	exon6			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.955G>T	19.37:g.37904605C>A	ENSP00000325018:p.Val319Phe		42596445	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	37	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.789238	0.49997	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.09911	2.93;2.93	3.97	0.537	0.17144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34223	N	0.004145	T	0.20700	0.0498	M	0.69463	2.115	0.30014	N	0.81494	B;D	0.67145	0.44;0.996	B;D	0.79108	0.255;0.992	T	0.13602	-1.0503	10	0.87932	D	0	.	0.5092	0.00592	0.1849:0.3455:0.1803:0.2893	.	160;319	Q17RR6;Q5MCW4	.;ZN569_HUMAN	F	319;160	ENSP00000325018:V319F;ENSP00000375993:V160F	ENSP00000325018:V319F	V	-	1	0	ZNF569	42596445	0.000000	0.05858	1.000000	0.80357	0.999000	0.98932	-0.475000	0.06599	0.412000	0.25729	0.655000	0.94253	GTT		0.388	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52004667	52004667	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:52004667G>T	ENST00000291707.3	-	1	376	c.321C>A	c.(319-321)agC>agA	p.S107R	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	107	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.S107R(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGTCTCTGATGCTCAGGGTAC	0.493																																					p.S107R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C321A	19						.						167.0	149.0	155.0					19																	52004667		2203	4300	6503	56696479	SO:0001583	missense	89858	exon1			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.321C>A	19.37:g.52004667G>T	ENSP00000291707:p.Ser107Arg		56696479	NM_053003	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	12.08	1.830289	0.32329	.	.	ENSG00000254521	ENST00000291707	T	0.64618	-0.11	2.42	1.3	0.21679	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59528	0.2200	M	0.64676	1.99	0.22541	N	0.999003	D	0.71674	0.998	P	0.46885	0.53	T	0.50866	-0.8777	9	0.51188	T	0.08	.	6.6415	0.22911	0.0:0.3009:0.6991:0.0	.	107	Q96PQ1	SIG12_HUMAN	R	107	ENSP00000291707:S107R	ENSP00000291707:S107R	S	-	3	2	SIGLEC12	56696479	0.305000	0.24481	0.349000	0.25694	0.135000	0.20990	0.149000	0.16243	0.194000	0.20326	0.395000	0.25975	AGC		0.493	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
ZNF160	90338	hgsc.bcm.edu	37	19	53571637	53571637	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:53571637C>G	ENST00000429604.1	-	7	2565	c.2150G>C	c.(2149-2151)cGt>cCt	p.R717P	ZNF160_ENST00000601421.1_Missense_Mutation_p.R681P|ZNF160_ENST00000418871.1_Missense_Mutation_p.R717P|ZNF160_ENST00000599056.1_Missense_Mutation_p.R717P	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	717					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R717P(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TAGGCTTGAACGAACACTGAA	0.443																																					p.R717P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2150C	19						.						161.0	142.0	148.0					19																	53571637		2203	4300	6503	58263449	SO:0001583	missense	90338	exon7			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.2150G>C	19.37:g.53571637C>G	ENSP00000406201:p.Arg717Pro		58263449	NM_198893	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	ENST00000429604.1	37	CCDS12859.1	.	.	.	.	.	.	.	.	.	.	C	4.492	0.091275	0.08632	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07688	3.17;3.17	2.21	-4.43	0.03568	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02807	0.0084	N	0.10645	0.015	0.09310	N	1	P	0.52061	0.95	B	0.40134	0.32	T	0.24657	-1.0154	9	0.39692	T	0.17	.	0.8491	0.01168	0.3943:0.2656:0.1307:0.2093	.	717	Q9HCG1	ZN160_HUMAN	P	717	ENSP00000406201:R717P;ENSP00000409597:R717P	ENSP00000409597:R717P	R	-	2	0	ZNF160	58263449	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.989000	0.00319	-1.232000	0.02554	-0.314000	0.08810	CGT		0.443	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463994.2	NM_033288	
NLRP4	147945	hgsc.bcm.edu	37	19	56370508	56370508	+	Silent	SNP	C	C	T	rs201393247		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr19:56370508C>T	ENST00000301295.6	+	3	2171	c.1749C>T	c.(1747-1749)aaC>aaT	p.N583N	NLRP4_ENST00000587891.1_Silent_p.N508N|NLRP4_ENST00000346986.5_Silent_p.N583N	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	583					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.N583N(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTATTGACAACGTGGACTTGG	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		20296	0.001		0.0	False		,,,				2504	0.0				p.N583N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1749T	19						.	C		0,4406		0,0,2203	82.0	75.0	77.0		1749	-6.9	0.0	19		77	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	NLRP4	NM_134444.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		583/995	56370508	2,13004	2203	4300	6503	61062320	SO:0001819	synonymous_variant	147945	exon3			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1749C>T	19.37:g.56370508C>T			61062320	NM_134444	Q86W87|Q96AY6	Silent	SNP	ENST00000301295.6	37	CCDS12936.1																																																																																				0.418	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
GPR89A	653519	hgsc.bcm.edu	37	1	145765381	145765381	+	Silent	SNP	T	T	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:145765381T>C	ENST00000313835.9	-	13	1292	c.1149A>G	c.(1147-1149)ttA>ttG	p.L383L	GPR89A_ENST00000454423.3_Silent_p.L263L|GPR89A_ENST00000462900.2_Silent_p.L358L|GPR89A_ENST00000534502.1_Silent_p.L358L			B7ZAQ6	GPHRA_HUMAN	G protein-coupled receptor 89A	383					intracellular pH reduction (GO:0051452)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|regulation of anion transport (GO:0044070)|signal transduction (GO:0007165)	Golgi cisterna membrane (GO:0032580)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)|voltage-gated anion channel activity (GO:0008308)	p.L383L(1)		breast(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			TTATCTGTGCTAATAGCAGGA	0.323																																					p.L358L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1074G	1						.						213.0	233.0	226.0					1																	145765381		2203	4300	6503	144476738	SO:0001819	synonymous_variant	653519	exon14			AB097024	CCDS72857.1, CCDS72858.1	1q21.1	2008-12-17	2007-06-06	2007-06-06	ENSG00000117262	ENSG00000117262			31984	protein-coding gene	gene with protein product		612821					Standard	NM_001097612		Approved	UNQ192	uc001eot.2	B7ZAQ6	OTTHUMG00000013738	ENST00000313835.9:c.1149A>G	1.37:g.145765381T>C			144476738	NM_001097613	A6NN37|B2RUV3|B3KMN3|B4DLT3|B4DXE7|Q53FQ9|Q5T2V8|Q5T5P5|Q659E2|Q6NVY5|Q9P0S4|Q9Y302	Silent	SNP	ENST00000313835.9	37	CCDS41377.1																																																																																				0.323	GPR89A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038507.2	NM_001097612	
PAX7	5081	hgsc.bcm.edu	37	1	19018317	19018317	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:19018317G>A	ENST00000375375.3	+	5	1254	c.656G>A	c.(655-657)cGc>cAc	p.R219H	PAX7_ENST00000400661.3_Missense_Mutation_p.R217H|PAX7_ENST00000420770.2_Missense_Mutation_p.R219H	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	219					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R219H(1)	PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		AAGCAGCGACGCAGTCGGACC	0.637			T	FOXO1A	alveolar rhabdomyosarcoma																																p.R217H			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G650A	1						.						40.0	33.0	35.0					1																	19018317		2202	4300	6502	18890904	SO:0001583	missense	5081	exon5			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.656G>A	1.37:g.19018317G>A	ENSP00000364524:p.Arg219His		18890904	NM_013945	E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	ENST00000375375.3	37	CCDS186.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091474	0.76756	.	.	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.96885	-4.16;-4.16;-4.16	4.98	4.98	0.66077	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98896	0.9626	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	P;D;D	0.77004	0.824;0.927;0.989	D	0.99552	1.0966	10	0.87932	D	0	.	16.8192	0.85741	0.0:0.0:1.0:0.0	.	219;217;219	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	H	219;219;217	ENSP00000364524:R219H;ENSP00000403389:R219H;ENSP00000383502:R217H	ENSP00000364524:R219H	R	+	2	0	PAX7	18890904	1.000000	0.71417	0.960000	0.40013	0.195000	0.23768	9.823000	0.99369	2.313000	0.78055	0.655000	0.94253	CGC		0.637	PAX7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006928.1	NM_002584	
PLA2G5	5322	hgsc.bcm.edu	37	1	20416369	20416369	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:20416369G>A	ENST00000375108.3	+	4	541	c.273G>A	c.(271-273)gcG>gcA	p.A91A	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	91					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)	p.A91A(1)		NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		ACAGATTCGCGTGGGGCGTGG	0.587																																					p.A91A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G273A	1						.						100.0	82.0	88.0					1																	20416369		2203	4300	6503	20288956	SO:0001819	synonymous_variant	5322	exon4			U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.273G>A	1.37:g.20416369G>A			20288956	NM_000929	Q8N435	Silent	SNP	ENST00000375108.3	37	CCDS202.1																																																																																				0.587	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007668.1	NM_000929	
SLC9C2	284525	hgsc.bcm.edu	37	1	173506165	173506165	+	Missense_Mutation	SNP	T	T	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:173506165T>G	ENST00000367714.3	-	14	1993	c.1571A>C	c.(1570-1572)aAa>aCa	p.K524T	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Missense_Mutation_p.K422T	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	524					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.K524T(1)									GTTACGCTGTTTTTCAAAGCT	0.333																																					p.K524T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1571C	1						.						115.0	118.0	117.0					1																	173506165		2203	4300	6503	171772788	SO:0001583	missense	284525	exon14			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1571A>C	1.37:g.173506165T>G	ENSP00000356687:p.Lys524Thr		171772788	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527872	0.44969	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.24908	1.83;1.83	5.52	4.33	0.51752	.	0.000000	0.64402	D	0.000008	T	0.12603	0.0306	L	0.60455	1.87	0.23309	N	0.997932	P	0.42409	0.779	B	0.39840	0.311	T	0.04870	-1.0921	10	0.38643	T	0.18	-32.4035	10.0974	0.42484	0.0:0.0:0.1804:0.8196	.	524	Q5TAH2	S9A11_HUMAN	T	524;422	ENSP00000356687:K524T;ENSP00000445437:K422T	ENSP00000356687:K524T	K	-	2	0	SLC9A11	171772788	0.999000	0.42202	1.000000	0.80357	0.846000	0.48090	2.372000	0.44257	2.094000	0.63399	0.416000	0.27883	AAA		0.333	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
PIK3R3	8503	hgsc.bcm.edu	37	1	46511590	46511590	+	Splice_Site	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:46511590A>G	ENST00000262741.5	-	9	1876	c.1187T>C	c.(1186-1188)gTg>gCg	p.V396A	PIK3R3_ENST00000340332.6_Splice_Site_p.V301A|PIK3R3_ENST00000488808.1_5'UTR|PIK3R3_ENST00000420542.1_Splice_Site_p.V396A|PIK3R3_ENST00000540385.1_Splice_Site_p.V442A|PIK3R3_ENST00000354242.4_Splice_Site_p.V337A|PIK3R3_ENST00000423209.1_Splice_Site_p.V337A|PIK3R3_ENST00000372006.1_Splice_Site_p.V396A|RP4-533D7.4_ENST00000450004.1_RNA	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	396	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)	p.V396A(1)		endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	GAAGACTTACACCACAGAGCA	0.363																																					p.V396A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1187C	1						.						164.0	151.0	155.0					1																	46511590		2203	4300	6503	46284177	SO:0001630	splice_region_variant	8503	exon9			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.1187+1T>C	1.37:g.46511590A>G			46284177	NM_003629	B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Missense_Mutation	SNP	ENST00000262741.5	37	CCDS529.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.901574	0.92035	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000340332;ENST00000540385;ENST00000423209	D;D;D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5	6.08	6.08	0.98989	SH2 motif (5);	0.054304	0.64402	D	0.000001	D	0.93268	0.7855	M	0.62209	1.925	0.80722	D	1	P;P;P;D	0.56521	0.756;0.84;0.745;0.976	P;P;P;D	0.71870	0.503;0.666;0.65;0.975	D	0.92685	0.6161	9	.	.	.	-8.1552	16.6438	0.85155	1.0:0.0:0.0:0.0	.	442;429;337;396	F6TDL0;Q7Z3W2;Q92569-2;Q92569	.;.;.;P55G_HUMAN	A	396;396;396;337;301;442;337	ENSP00000361075:V396A;ENSP00000262741:V396A;ENSP00000412546:V396A;ENSP00000346188:V337A;ENSP00000342484:V301A;ENSP00000439913:V442A;ENSP00000391431:V337A	.	V	-	2	0	PIK3R3	46284177	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.339000	0.96797	2.333000	0.79357	0.533000	0.62120	GTG		0.363	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022171.1	NM_003629	Missense_Mutation
PLPPR4	9890	hgsc.bcm.edu	37	1	99771528	99771528	+	Silent	SNP	G	G	A	rs202142961		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:99771528G>A	ENST00000370185.3	+	7	1751	c.1254G>A	c.(1252-1254)ccG>ccA	p.P418P	LPPR4_ENST00000370184.1_Silent_p.P260P|LPPR4_ENST00000457765.1_Silent_p.P360P	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		418					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)	p.P418P(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		ATACCTTGCCGCGAGCCAATA	0.498																																					p.P418P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	c.G1254A	1						.						54.0	56.0	55.0					1																	99771528		2203	4300	6503	99544116	SO:0001819	synonymous_variant	9890	exon7																														ENST00000370185.3:c.1254G>A	1.37:g.99771528G>A			99544116	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	ENST00000370185.3	37	CCDS757.1																																																																																				0.498	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
SLC26A9	115019	hgsc.bcm.edu	37	1	205896666	205896666	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr1:205896666G>A	ENST00000367135.3	-	10	1282	c.1169C>T	c.(1168-1170)gCg>gTg	p.A390V	SLC26A9_ENST00000367134.2_Missense_Mutation_p.A390V|SLC26A9_ENST00000340781.4_Missense_Mutation_p.A390V	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	390					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)	p.A390V(1)		NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GACAGAAAGCGCACAGCAAAT	0.527																																					p.A390V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1169T	1						.						74.0	76.0	75.0					1																	205896666		2203	4300	6503	204163289	SO:0001583	missense	115019	exon10			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1169C>T	1.37:g.205896666G>A	ENSP00000356103:p.Ala390Val		204163289	NM_134325	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	37	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	G	33	5.279698	0.95489	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.93366	-3.21;-3.21;-3.21	5.09	5.09	0.68999	Sulphate transporter (1);	0.000000	0.85682	D	0.000000	D	0.95484	0.8533	M	0.84511	2.7	0.58432	D	0.999995	D;D	0.69078	0.992;0.997	P;P	0.49922	0.488;0.626	D	0.96247	0.9180	10	0.87932	D	0	.	18.4557	0.90720	0.0:0.0:1.0:0.0	.	390;390	Q7LBE3;B1AVM8	S26A9_HUMAN;.	V	390	ENSP00000341682:A390V;ENSP00000356103:A390V;ENSP00000356102:A390V	ENSP00000341682:A390V	A	-	2	0	SLC26A9	204163289	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.414000	0.97362	2.525000	0.85131	0.655000	0.94253	GCG		0.527	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
DIDO1	11083	hgsc.bcm.edu	37	20	61542512	61542512	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr20:61542512G>A	ENST00000266070.4	-	3	778	c.453C>T	c.(451-453)acC>acT	p.T151T	DIDO1_ENST00000266071.5_Silent_p.T151T|DIDO1_ENST00000395335.2_Silent_p.T151T|DIDO1_ENST00000370371.4_Silent_p.T151T|DIDO1_ENST00000370366.1_Silent_p.T151T|DIDO1_ENST00000354665.4_Silent_p.T151T|DIDO1_ENST00000395343.1_Silent_p.T151T|DIDO1_ENST00000395340.1_Silent_p.T151T|DIDO1_ENST00000370368.1_Silent_p.T151T	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	151					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T151T(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CACTATCGGAGGTGTCATCGT	0.572																																					p.T151T	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C453T	20						.						95.0	71.0	79.0					20																	61542512		2203	4300	6503	61012957	SO:0001819	synonymous_variant	11083	exon3			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.453C>T	20.37:g.61542512G>A			61012957	NM_022105	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1																																																																																				0.572	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
ATP6V1E2	90423	hgsc.bcm.edu	37	2	46739441	46739441	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr2:46739441C>T	ENST00000306448.4	-	2	1523	c.410G>A	c.(409-411)cGg>cAg	p.R137Q	ATP6V1E2_ENST00000522587.1_Missense_Mutation_p.R137Q	NM_080653.3	NP_542384.1	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2	137					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.R137Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			GTCTTGTGGCCGGCAGCGTAC	0.542																																					p.R137Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G410A	2						.						93.0	91.0	92.0					2																	46739441		2203	4300	6503	46592945	SO:0001583	missense	90423	exon2			BC008981	CCDS1826.1	2p21	2011-02-10	2006-01-13	2002-06-21	ENSG00000250565	ENSG00000250565		"""ATPases / V-type"""	18125	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD-like 2"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 2"""	ATP6EL2, ATP6V1EL2		12036578	Standard	NM_080653		Approved	MGC9341, VMA4, ATP6E1	uc002ruy.3	Q96A05	OTTHUMG00000128819	ENST00000306448.4:c.410G>A	2.37:g.46739441C>T	ENSP00000304891:p.Arg137Gln		46592945	NM_080653		Missense_Mutation	SNP	ENST00000306448.4	37	CCDS1826.1	.	.	.	.	.	.	.	.	.	.	C	32	5.183964	0.94885	.	.	ENSG00000250565	ENST00000306448;ENST00000522587	.	.	.	4.37	4.37	0.52481	.	0.048550	0.64402	D	0.000001	T	0.79673	0.4486	M	0.88775	2.98	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	T	0.83156	-0.0101	9	0.87932	D	0	-22.3678	12.7449	0.57276	0.0:1.0:0.0:0.0	.	137	Q96A05	VATE2_HUMAN	Q	137	.	ENSP00000304891:R137Q	R	-	2	0	ATP6V1E2	46592945	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	5.022000	0.64078	2.713000	0.92767	0.655000	0.94253	CGG		0.542	ATP6V1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250753.1	NM_080653	
SLC9C1	285335	hgsc.bcm.edu	37	3	111950220	111950220	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:111950220C>G	ENST00000305815.5	-	13	1812	c.1560G>C	c.(1558-1560)ttG>ttC	p.L520F	SLC9C1_ENST00000487372.1_Missense_Mutation_p.L472F	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	520					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.L520F(1)									TTTGTGCTGACAAGAGACGCC	0.358																																					p.L520F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1560C	3						.						148.0	142.0	144.0					3																	111950220		2203	4300	6503	113432910	SO:0001583	missense	285335	exon13			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1560G>C	3.37:g.111950220C>G	ENSP00000306627:p.Leu520Phe		113432910	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	C	11.57	1.678413	0.29783	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;D	0.81579	-1.48;-1.51	5.44	0.279	0.15677	.	0.321128	0.21091	N	0.080309	T	0.77994	0.4214	L	0.32530	0.975	0.09310	N	0.999997	D;D	0.63880	0.991;0.993	D;P	0.69654	0.965;0.855	T	0.65590	-0.6131	10	0.62326	D	0.03	-6.3067	1.6981	0.02866	0.1461:0.4578:0.1424:0.2536	.	472;520	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	F	520;472	ENSP00000306627:L520F;ENSP00000420688:L472F	ENSP00000306627:L520F	L	-	3	2	SLC9A10	113432910	0.016000	0.18221	0.065000	0.19835	0.520000	0.34377	-1.058000	0.03482	0.044000	0.15775	-0.351000	0.07748	TTG		0.358	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
SLC7A14	57709	hgsc.bcm.edu	37	3	170198432	170198432	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:170198432G>A	ENST00000231706.5	-	7	1954	c.1639C>T	c.(1639-1641)Cgg>Tgg	p.R547W	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	547					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)	p.R547W(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			AGGCCCAGCCGGATTCTCATG	0.507																																					p.R547W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1639T	3						.						97.0	96.0	96.0					3																	170198432		2203	4300	6503	171681126	SO:0001583	missense	57709	exon7			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1639C>T	3.37:g.170198432G>A	ENSP00000231706:p.Arg547Trp		171681126	NM_020949	B3KV33|Q9HCF9	Missense_Mutation	SNP	ENST00000231706.5	37	CCDS33892.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.105603	0.56291	.	.	ENSG00000013293	ENST00000231706	D	0.88509	-2.39	5.51	5.51	0.81932	.	0.363497	0.31859	N	0.006950	D	0.87501	0.6193	L	0.56769	1.78	0.58432	D	0.999995	P	0.51537	0.946	B	0.40565	0.333	D	0.87203	0.2242	10	0.36615	T	0.2	.	19.3998	0.94623	0.0:0.0:1.0:0.0	.	547	Q8TBB6	S7A14_HUMAN	W	547	ENSP00000231706:R547W	ENSP00000231706:R547W	R	-	1	2	SLC7A14	171681126	1.000000	0.71417	0.999000	0.59377	0.556000	0.35491	6.400000	0.73252	2.579000	0.87056	0.591000	0.81541	CGG		0.507	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
MYRIP	25924	hgsc.bcm.edu	37	3	40275432	40275432	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:40275432C>T	ENST00000302541.6	+	12	2330	c.1988C>T	c.(1987-1989)tCt>tTt	p.S663F	MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000444716.1_Missense_Mutation_p.S663F|MYRIP_ENST00000396217.3_Missense_Mutation_p.S574F|MYRIP_ENST00000425621.1_Intron|MYRIP_ENST00000539167.1_Missense_Mutation_p.S476F	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	663	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)	p.S663F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		ATAGCAGGATCTACAGGGCCC	0.512																																					p.S663F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1988T	3						.						80.0	76.0	78.0					3																	40275432		2203	4300	6503	40250436	SO:0001583	missense	25924	exon12			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.1988C>T	3.37:g.40275432C>T	ENSP00000301972:p.Ser663Phe		40250436	NM_015460	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	37	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	C	17.52	3.410877	0.62399	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000396217;ENST00000539167	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.79	4.92	0.64577	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.063145	0.64402	D	0.000004	T	0.52008	0.1708	L	0.58101	1.795	0.36284	D	0.855967	D;D	0.60160	0.983;0.987	P;D	0.63703	0.899;0.917	T	0.60510	-0.7249	9	.	.	.	.	12.6195	0.56595	0.0:0.9203:0.0:0.0797	.	574;663	Q32M42;Q8NFW9	.;MYRIP_HUMAN	F	663;663;574;476	ENSP00000398665:S663F;ENSP00000301972:S663F;ENSP00000379519:S574F;ENSP00000438297:S476F	.	S	+	2	0	MYRIP	40250436	1.000000	0.71417	0.683000	0.30040	0.917000	0.54804	6.710000	0.74670	1.458000	0.47871	-0.136000	0.14681	TCT		0.512	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
CYP8B1	1582	hgsc.bcm.edu	37	3	42916263	42916263	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:42916263C>T	ENST00000316161.4	-	1	1370	c.1046G>A	c.(1045-1047)cGg>cAg	p.R349Q	KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Missense_Mutation_p.R349Q|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	349					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)	p.R349Q(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		AGCCCTCAGCCGCAGCGTCTC	0.587																																					p.R349Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1046A	3						.						51.0	49.0	50.0					3																	42916263		2203	4300	6503	42891267	SO:0001583	missense	1582	exon1			AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.1046G>A	3.37:g.42916263C>T	ENSP00000318867:p.Arg349Gln		42891267	NM_004391	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	37	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604933	0.66445	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	D;D	0.97480	-4.4;-4.4	5.27	5.27	0.74061	.	0.078391	0.51477	D	0.000099	D	0.98918	0.9633	H	0.94503	3.545	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99675	1.0997	10	0.87932	D	0	-20.635	17.6592	0.88187	0.0:1.0:0.0:0.0	.	349;349	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	Q	349	ENSP00000404499:R349Q;ENSP00000318867:R349Q	ENSP00000318867:R349Q	R	-	2	0	CYP8B1	42891267	0.949000	0.32298	0.296000	0.24974	0.015000	0.08874	7.724000	0.84798	2.456000	0.83038	0.561000	0.74099	CGG		0.587	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391	
TGM4	7047	hgsc.bcm.edu	37	3	44943361	44943361	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:44943361G>A	ENST00000296125.4	+	8	977	c.909G>A	c.(907-909)acG>acA	p.T303T	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	303					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.T303T(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GGAACCTCACGGTGGACACCT	0.542																																					p.T303T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G909A	3						.						127.0	117.0	121.0					3																	44943361		2203	4300	6503	44918365	SO:0001819	synonymous_variant	7047	exon8			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.909G>A	3.37:g.44943361G>A			44918365	NM_003241	Q16707|Q96QN4	Silent	SNP	ENST00000296125.4	37	CCDS2723.1																																																																																				0.542	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
COL7A1	1294	hgsc.bcm.edu	37	3	48608296	48608296	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:48608296G>A	ENST00000328333.8	-	94	7377	c.7270C>T	c.(7270-7272)Cgg>Tgg	p.R2424W	COL7A1_ENST00000454817.1_Missense_Mutation_p.R2392W	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2424	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R2424W(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCCCTCACCCGCTCTCCACTA	0.667																																					p.R2424W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7270T	3						.						34.0	29.0	31.0					3																	48608296		2202	4300	6502	48583300	SO:0001583	missense	1294	exon94			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7270C>T	3.37:g.48608296G>A	ENSP00000332371:p.Arg2424Trp		48583300	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014011	0.19277	.	.	ENSG00000114270	ENST00000328333;ENST00000454817;ENST00000422991	D;D;D	0.96334	-3.98;-3.98;-3.98	5.24	3.36	0.38483	.	0.000000	0.41396	D	0.000897	D	0.97791	0.9275	M	0.83483	2.645	0.44834	D	0.997842	D	0.89917	1.0	D	0.76071	0.987	D	0.98036	1.0379	10	0.66056	D	0.02	.	12.5534	0.56240	0.0:0.0:0.5423:0.4577	.	2424	Q02388	CO7A1_HUMAN	W	2424;2392;89	ENSP00000332371:R2424W;ENSP00000412569:R2392W;ENSP00000391608:R89W	ENSP00000332371:R2424W	R	-	1	2	COL7A1	48583300	0.980000	0.34600	1.000000	0.80357	0.284000	0.27059	0.318000	0.19504	1.174000	0.42811	0.655000	0.94253	CGG		0.667	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
NLGN1	22871	hgsc.bcm.edu	37	3	173999082	173999082	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr3:173999082A>T	ENST00000457714.1	+	7	2890	c.2461A>T	c.(2461-2463)Acc>Tcc	p.T821S	NLGN1_ENST00000545397.1_Missense_Mutation_p.T821S|NLGN1_ENST00000361589.4_Missense_Mutation_p.T821S|NLGN1_ENST00000401917.3_Missense_Mutation_p.T861S	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	838					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.T821S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACATTCAACAACCAGGGTATA	0.418																																					p.T821S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2461T	3						.						45.0	44.0	44.0					3																	173999082		2203	4300	6503	175481776	SO:0001583	missense	22871	exon7			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.2461A>T	3.37:g.173999082A>T	ENSP00000392500:p.Thr821Ser		175481776	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813831	0.50527	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.73363	-0.69;-0.69;-0.69;-0.74	5.6	4.37	0.52481	.	0.166402	0.52532	D	0.000075	D	0.82733	0.5101	M	0.62723	1.935	0.53688	D	0.999972	D	0.56035	0.974	D	0.67725	0.953	D	0.84690	0.0722	10	0.87932	D	0	.	13.2655	0.60131	0.8686:0.1314:0.0:0.0	.	821	Q8N2Q7-2	.	S	821;821;821;861	ENSP00000392500:T821S;ENSP00000354541:T821S;ENSP00000441108:T821S;ENSP00000385750:T861S	ENSP00000354541:T821S	T	+	1	0	NLGN1	175481776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.262000	0.72514	2.254000	0.74563	0.482000	0.46254	ACC		0.418	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
PDLIM5	10611	hgsc.bcm.edu	37	4	95506883	95506883	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr4:95506883A>G	ENST00000317968.4	+	6	1014	c.878A>G	c.(877-879)gAa>gGa	p.E293G	PDLIM5_ENST00000538141.1_Missense_Mutation_p.E170G|PDLIM5_ENST00000514743.1_Missense_Mutation_p.E190G|PDLIM5_ENST00000437932.1_Missense_Mutation_p.E184G|PDLIM5_ENST00000318007.5_Missense_Mutation_p.E170G|PDLIM5_ENST00000542407.1_Missense_Mutation_p.E171G|PDLIM5_ENST00000380180.3_Missense_Mutation_p.E190G|PDLIM5_ENST00000450793.1_Missense_Mutation_p.E190G|PDLIM5_ENST00000380176.3_3'UTR|PDLIM5_ENST00000508216.1_Missense_Mutation_p.E190G	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	293					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)	p.E293G(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		ACTGGGACTGAACATTGTAAG	0.458																																					p.E184G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A551G	4						.						84.0	74.0	77.0					4																	95506883		2203	4300	6503	95725906	SO:0001583	missense	10611	exon6			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.878A>G	4.37:g.95506883A>G	ENSP00000321746:p.Glu293Gly		95725906	NM_001011513	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	ENST00000317968.4	37	CCDS3641.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.4|28.4	4.917481|4.917481	0.92249|0.92249	.|.	.|.	ENSG00000163110|ENSG00000163110	ENST00000437932;ENST00000380180;ENST00000318007;ENST00000450793;ENST00000538141;ENST00000317968;ENST00000503974;ENST00000542407;ENST00000508216;ENST00000514743|ENST00000513341	T;T;T;T;T;T;T;T;T;T|.	0.69685|.	-0.07;0.95;0.86;1.0;0.55;0.1;-0.07;-0.42;0.95;-0.3|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	0.050975|.	0.85682|.	D|.	0.000000|.	T|T	0.72779|0.72779	0.3503|0.3503	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	D;D;P;D;P;D|.	0.89917|.	0.994;0.999;0.773;0.995;0.932;1.0|.	D;D;B;D;P;D|.	0.80764|.	0.968;0.922;0.437;0.948;0.638;0.994|.	T|T	0.72717|0.72717	-0.4209|-0.4209	10|5	0.62326|.	D|.	0.03|.	.|.	15.5463|15.5463	0.76104|0.76104	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	190;190;293;184;190;170|.	E9PBF5;D6RB78;Q96HC4;Q96HC4-4;Q96HC4-2;Q96HC4-3|.	.;.;PDLI5_HUMAN;.;.;.|.	G|D	184;190;170;190;170;293;190;171;190;190|152	ENSP00000398469:E184G;ENSP00000369527:E190G;ENSP00000322021:E170G;ENSP00000401579:E190G;ENSP00000439795:E170G;ENSP00000321746:E293G;ENSP00000424297:E190G;ENSP00000442187:E171G;ENSP00000426804:E190G;ENSP00000424360:E190G|.	ENSP00000321746:E293G|.	E|N	+|+	2|1	0|0	PDLIM5|PDLIM5	95725906|95725906	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.995000|0.995000	0.86356|0.86356	8.905000|8.905000	0.92613|0.92613	2.120000|2.120000	0.65058|0.65058	0.528000|0.528000	0.53228|0.53228	GAA|AAC		0.458	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		
PSD2	84249	hgsc.bcm.edu	37	5	139192982	139192982	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr5:139192982C>T	ENST00000274710.3	+	3	665	c.460C>T	c.(460-462)Cag>Tag	p.Q154*		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	154					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.Q154*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGGGCACCCAGTACAGCAG	0.637																																					p.Q154X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C460T	5						.						42.0	46.0	45.0					5																	139192982		2203	4300	6503	139173166	SO:0001587	stop_gained	84249	exon3			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.460C>T	5.37:g.139192982C>T	ENSP00000274710:p.Gln154*		139173166	NM_032289	D3DQD3|Q8N3J8	Nonsense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	C	37	6.509314	0.97624	.	.	ENSG00000146005	ENST00000274710	.	.	.	4.52	3.36	0.38483	.	0.249733	0.34088	N	0.004274	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	3.6945	0.08358	0.0:0.6882:0.0:0.3118	.	.	.	.	X	154	.	ENSP00000274710:Q154X	Q	+	1	0	PSD2	139173166	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.255000	0.65462	2.214000	0.71695	0.462000	0.41574	CAG		0.637	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
GZMK	3003	hgsc.bcm.edu	37	5	54329599	54329599	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr5:54329599T>A	ENST00000231009.2	+	5	710	c.640T>A	c.(640-642)Tca>Aca	p.S214T	CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	214	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.S214T(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CCAGGGTGACTCAGGGGGCCC	0.458																																					p.S214T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T640A	5						.						72.0	68.0	70.0					5																	54329599		2203	4300	6503	54365356	SO:0001583	missense	3003	exon5			BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.640T>A	5.37:g.54329599T>A	ENSP00000231009:p.Ser214Thr		54365356	NM_002104	B2R563	Missense_Mutation	SNP	ENST00000231009.2	37	CCDS3964.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.144348	0.77888	.	.	ENSG00000113088	ENST00000231009	D	0.96491	-4.03	5.28	4.08	0.47627	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.64402	D	0.000001	D	0.98137	0.9385	M	0.91920	3.255	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.98066	1.0396	10	0.87932	D	0	.	9.4908	0.38958	0.1582:0.0:0.0:0.8418	.	214	P49863	GRAK_HUMAN	T	214	ENSP00000231009:S214T	ENSP00000231009:S214T	S	+	1	0	GZMK	54365356	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	4.088000	0.57678	0.963000	0.38082	0.533000	0.62120	TCA		0.458	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1	NM_002104	
FBXO38	81545	hgsc.bcm.edu	37	5	147820739	147820739	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr5:147820739G>A	ENST00000340253.5	+	21	3495	c.3327G>A	c.(3325-3327)agG>agA	p.R1109R	FBXO38_ENST00000513826.1_Silent_p.R864R|FBXO38_ENST00000296701.6_Silent_p.R864R|FBXO38_ENST00000394370.3_Silent_p.R1034R			Q6PIJ6	FBX38_HUMAN	F-box protein 38	1109					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R1109R(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGGCTGAGGTCATTACGAG	0.438																																					p.R1109R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3327A	5						.						240.0	198.0	212.0					5																	147820739		2203	4300	6503	147800932	SO:0001819	synonymous_variant	81545	exon21			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.3327G>A	5.37:g.147820739G>A			147800932	NM_205836	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Silent	SNP	ENST00000340253.5	37																																																																																					0.438	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
DCDC2	51473	hgsc.bcm.edu	37	6	24278380	24278380	+	Silent	SNP	G	G	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr6:24278380G>A	ENST00000378454.3	-	7	1120	c.819C>T	c.(817-819)ccC>ccT	p.P273P		NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	273					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)			p.P273P(2)		breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TCCTCTTCAGGGGCTGAGGAG	0.358																																					p.P273P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.C819T	6						.						136.0	127.0	130.0					6																	24278380		2203	4300	6503	24386359	SO:0001819	synonymous_variant	51473	exon8			AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.819C>T	6.37:g.24278380G>A			24386359	NM_001195610	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Silent	SNP	ENST00000378454.3	37	CCDS4550.1																																																																																				0.358	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356	
PEX3	8504	hgsc.bcm.edu	37	6	143792159	143792159	+	Silent	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr6:143792159C>T	ENST00000367591.4	+	5	456	c.393C>T	c.(391-393)gtC>gtT	p.V131V		NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	131	Interaction with PEX19.				peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)	p.V131V(1)		endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		TTTTGCGGGTCCAGTTAAACA	0.368																																					p.V131V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C393T	6						.						145.0	138.0	140.0					6																	143792159		2203	4300	6503	143833852	SO:0001819	synonymous_variant	8504	exon5			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.393C>T	6.37:g.143792159C>T			143833852	NM_003630	Q6FGP5	Silent	SNP	ENST00000367591.4	37	CCDS5199.1																																																																																				0.368	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1		
IFRD1	3475	hgsc.bcm.edu	37	7	112112275	112112275	+	Splice_Site	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr7:112112275A>G	ENST00000403825.3	+	10	1304	c.1043A>G	c.(1042-1044)gAa>gGa	p.E348G	IFRD1_ENST00000535603.1_Splice_Site_p.E298G|IFRD1_ENST00000005558.4_Splice_Site_p.E348G	NM_001550.3	NP_001541.2	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	348					adult somatic muscle development (GO:0007527)|multicellular organismal development (GO:0007275)|myoblast fate determination (GO:0007518)	nucleus (GO:0005634)		p.E348G(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|urinary_tract(1)	15						ATTGGTTAGGAACGGGATTTT	0.373																																					p.E348G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1043G	7						.						113.0	113.0	113.0					7																	112112275		2203	4300	6503	111899511	SO:0001630	splice_region_variant	3475	exon10			Y10313	CCDS34736.1, CCDS56504.1	7q31.1	2005-10-17			ENSG00000006652	ENSG00000006652			5456	protein-coding gene	gene with protein product		603502				9722946	Standard	NM_001550		Approved	PC4, TIS7	uc003vgh.3	O00458	OTTHUMG00000155124	ENST00000403825.3:c.1042-1A>G	7.37:g.112112275A>G			111899511	NM_001550	B7Z5G1|O75234|Q5U013|Q9BVE4	Missense_Mutation	SNP	ENST00000403825.3	37	CCDS34736.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.197436	0.58126	.	.	ENSG00000006652	ENST00000005558;ENST00000403825;ENST00000536259;ENST00000535603;ENST00000421296;ENST00000462155	T;T;T	0.49432	0.78;0.78;0.8	5.93	5.93	0.95920	.	0.097095	0.64402	D	0.000001	T	0.37237	0.0996	L	0.35487	1.065	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.003	T	0.21759	-1.0236	10	0.11485	T	0.65	-18.5924	16.3789	0.83431	1.0:0.0:0.0:0.0	.	348;348	A4D0U1;O00458	.;IFRD1_HUMAN	G	348;348;83;298;83;11	ENSP00000005558:E348G;ENSP00000384477:E348G;ENSP00000439188:E298G	ENSP00000005558:E348G	E	+	2	0	IFRD1	111899511	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.981000	0.93465	2.267000	0.75376	0.533000	0.62120	GAA		0.373	IFRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338700.1	NM_001550	Missense_Mutation
PPP1R3A	5506	hgsc.bcm.edu	37	7	113522320	113522320	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr7:113522320T>C	ENST00000284601.3	-	2	906	c.838A>G	c.(838-840)Aca>Gca	p.T280A		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	280					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)		p.T280A(1)		NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATATTACCTGTATTCTTTGGA	0.254																																					p.T280A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A838G	7						.						40.0	41.0	40.0					7																	113522320		2188	4277	6465	113309556	SO:0001583	missense	5506	exon2			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.838A>G	7.37:g.113522320T>C	ENSP00000284601:p.Thr280Ala		113309556	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	T	9.368	1.069695	0.20147	.	.	ENSG00000154415	ENST00000284601	T	0.16743	2.32	5.92	2.16	0.27623	.	0.613719	0.17499	N	0.172069	T	0.10252	0.0251	L	0.36672	1.1	0.22240	N	0.999269	B	0.06786	0.001	B	0.08055	0.003	T	0.29212	-1.0019	10	0.25106	T	0.35	.	1.8772	0.03220	0.1605:0.146:0.1145:0.5789	.	280	Q16821	PPR3A_HUMAN	A	280	ENSP00000284601:T280A	ENSP00000284601:T280A	T	-	1	0	PPP1R3A	113309556	0.870000	0.30015	0.446000	0.26920	0.510000	0.34073	0.864000	0.27926	0.447000	0.26695	0.459000	0.35465	ACA		0.254	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
FAM71F1	84691	hgsc.bcm.edu	37	7	128359089	128359089	+	Silent	SNP	G	G	A	rs144120466		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr7:128359089G>A	ENST00000315184.5	+	3	692	c.639G>A	c.(637-639)acG>acA	p.T213T	FAM71F1_ENST00000469348.1_3'UTR|FAM71F1_ENST00000485070.1_Silent_p.T114T	NM_001282788.1|NM_032599.2	NP_001269717.1|NP_115988.1	Q96KD3	F71F1_HUMAN	family with sequence similarity 71, member F1	213								p.T213T(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18						TTCTTGTCACGCACTGCCTGG	0.532																																					p.T213T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G639A	7						.	G		0,4406		0,0,2203	123.0	112.0	115.0		639	1.0	1.0	7	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FAM71F1	NM_032599.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		213/345	128359089	1,13005	2203	4300	6503	128146325	SO:0001819	synonymous_variant	84691	exon3			AF367470	CCDS5804.1, CCDS64763.1	7q32.1	2007-11-20	2007-11-20	2007-11-20	ENSG00000135248	ENSG00000135248			30704	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member A"""	FAM137A		12477932	Standard	XM_005250645		Approved	NYD-SP18	uc003vno.1	Q96KD3	OTTHUMG00000158276	ENST00000315184.5:c.639G>A	7.37:g.128359089G>A			128146325	NM_032599	Q8IY75|Q8NA48	Silent	SNP	ENST00000315184.5	37	CCDS5804.1																																																																																				0.532	FAM71F1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350544.2	NM_032599	
TRIM73	375593	hgsc.bcm.edu	37	7	75033015	75033015	+	Nonsense_Mutation	SNP	C	C	T	rs199982097		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr7:75033015C>T	ENST00000437796.1	+	2	506	c.487C>T	c.(487-489)Cga>Tga	p.R163*	TRIM73_ENST00000450434.1_Nonsense_Mutation_p.R32*|TRIM73_ENST00000447409.2_Nonsense_Mutation_p.R163*|TRIM73_ENST00000323819.3_Nonsense_Mutation_p.R163*|TRIM73_ENST00000430211.1_Nonsense_Mutation_p.R163*			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	163						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R163*(2)		endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						AAACCGGACCCGAATCGTCGT	0.562																																					p.R163X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C487T	7						.																																			74870951	SO:0001587	stop_gained	375593	exon3			AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.487C>T	7.37:g.75033015C>T	ENSP00000417040:p.Arg163*		74870951	NM_198924	Q8N0S3	Nonsense_Mutation	SNP	ENST00000437796.1	37	CCDS34665.1	111	0.050824175824175824	65	0.13211382113821138	17	0.04696132596685083	1	0.0017482517482517483	28	0.036939313984168866	C	24.4	4.523034	0.85600	.	.	ENSG00000178809	ENST00000450434;ENST00000323819;ENST00000430211;ENST00000447409;ENST00000437796	.	.	.	2.64	2.64	0.31445	.	0.000000	0.56097	D	0.000029	.	.	.	.	.	.	0.09310	P	0.9999999999999825	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	12.8686	0.57953	0.0:1.0:0.0:0.0	.	.	.	.	X	32;163;163;163;163	.	ENSP00000318615:R163X	R	+	1	2	TRIM73	74870951	1.000000	0.71417	0.993000	0.49108	0.679000	0.39708	2.995000	0.49441	1.793000	0.52555	0.400000	0.26472	CGA		0.562	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342950.1		
NYAP1	222950	hgsc.bcm.edu	37	7	100085867	100085867	+	Missense_Mutation	SNP	T	T	C	rs202132246		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr7:100085867T>C	ENST00000300179.2	+	4	682	c.523T>C	c.(523-525)Tcc>Ccc	p.S175P	NYAP1_ENST00000423930.1_Missense_Mutation_p.S175P|NYAP1_ENST00000454988.1_Missense_Mutation_p.S118P	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	175	Involved in CYFIP1- and NCKAP1-binding. {ECO:0000250}.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.S175P(1)									GCTCTCTGTCTCCTTCGATGA	0.652																																					p.S175P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T523C	7						.						84.0	93.0	90.0					7																	100085867		2203	4300	6503	99923803	SO:0001583	missense	222950	exon4			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.523T>C	7.37:g.100085867T>C	ENSP00000300179:p.Ser175Pro		99923803	NM_173564	Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	ENST00000300179.2	37	CCDS5696.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635852	0.67130	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.67171	-0.25;-0.25;-0.25	5.32	5.32	0.75619	.	0.000000	0.50627	D	0.000111	T	0.79240	0.4412	M	0.67700	2.07	0.48040	D	0.999579	D	0.89917	1.0	D	0.85130	0.997	T	0.79848	-0.1630	10	0.48119	T	0.1	-23.7526	13.2221	0.59894	0.0:0.0:0.0:1.0	.	175	Q6ZVC0	CG051_HUMAN	P	175;175;118	ENSP00000300179:S175P;ENSP00000411861:S175P;ENSP00000394424:S118P	ENSP00000300179:S175P	S	+	1	0	C7orf51	99923803	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.187000	0.58344	2.013000	0.59113	0.334000	0.21626	TCC		0.652	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
NOM1	64434	hgsc.bcm.edu	37	7	156754863	156754863	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr7:156754863A>G	ENST00000275820.3	+	5	1666	c.1651A>G	c.(1651-1653)Acg>Gcg	p.T551A		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	551	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T551A(1)		endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		TATGCTAGAGACGATGTTGGC	0.448																																					p.T551A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1651G	7						.						197.0	204.0	201.0					7																	156754863		2203	4300	6503	156447624	SO:0001583	missense	64434	exon5			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.1651A>G	7.37:g.156754863A>G	ENSP00000275820:p.Thr551Ala		156447624	NM_138400	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125668	0.77436	.	.	ENSG00000146909	ENST00000275820	T	0.23552	1.9	4.52	4.52	0.55395	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	U	0.000000	T	0.50463	0.1617	M	0.85299	2.745	0.58432	D	0.999999	P	0.46621	0.881	P	0.59288	0.855	T	0.53830	-0.8383	10	0.38643	T	0.18	-25.9397	13.8879	0.63719	1.0:0.0:0.0:0.0	.	551	Q5C9Z4	NOM1_HUMAN	A	551	ENSP00000275820:T551A	ENSP00000275820:T551A	T	+	1	0	NOM1	156447624	1.000000	0.71417	0.957000	0.39632	0.986000	0.74619	8.561000	0.90715	1.676000	0.50930	0.444000	0.29173	ACG		0.448	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
TRPA1	8989	hgsc.bcm.edu	37	8	72969251	72969251	+	Splice_Site	SNP	A	A	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr8:72969251A>C	ENST00000262209.4	-	10	1302	c.1095T>G	c.(1093-1095)ggT>ggG	p.G365G		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	365					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.G365G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CTACTTGGGCACCTAAAAAAA	0.274																																					p.G365G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1095G	8						.						25.0	24.0	24.0					8																	72969251		2200	4295	6495	73131805	SO:0001630	splice_region_variant	8989	exon10			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1094-1T>G	8.37:g.72969251A>C			73131805	NM_007332	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1																																																																																				0.274	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	Silent
MMP16	4325	hgsc.bcm.edu	37	8	89179995	89179995	+	Silent	SNP	T	T	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr8:89179995T>C	ENST00000286614.6	-	4	893	c.612A>G	c.(610-612)ggA>ggG	p.G204G	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	204					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G204G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GTGCCAAAAATCCTCCCTCTC	0.443																																					p.G204G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A612G	8						.						98.0	85.0	89.0					8																	89179995		2203	4300	6503	89249111	SO:0001819	synonymous_variant	4325	exon4			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.612A>G	8.37:g.89179995T>C			89249111	NM_005941	B2RAN7|Q14824|Q52H48	Silent	SNP	ENST00000286614.6	37	CCDS6246.1																																																																																				0.443	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
ENPP2	5168	hgsc.bcm.edu	37	8	120581486	120581486	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr8:120581486A>G	ENST00000075322.6	-	21	2100	c.2042T>C	c.(2041-2043)cTc>cCc	p.L681P	ENPP2_ENST00000259486.6_Missense_Mutation_p.L733P|ENPP2_ENST00000522826.1_Missense_Mutation_p.L706P|ENPP2_ENST00000427067.2_Missense_Mutation_p.L702P|ENPP2_ENST00000522167.1_Missense_Mutation_p.L316P	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	681					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.L733P(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AGGAGGAAAGAGGAATCCGTA	0.443																																					p.L706P	Melanoma(20;305 879 2501 4818 31020)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2117C	8						.						170.0	162.0	165.0					8																	120581486		2203	4300	6503	120650667	SO:0001583	missense	5168	exon22			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.2042T>C	8.37:g.120581486A>G	ENSP00000075322:p.Leu681Pro		120650667	NM_001130863	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093265	0.76756	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45	5.37	5.37	0.77165	DNA/RNA non-specific endonuclease (2);Extracellular Endonuclease, subunit A (2);	0.000000	0.85682	D	0.000000	D	0.90762	0.7100	M	0.87827	2.91	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.92444	0.5964	10	0.87932	D	0	.	15.386	0.74703	1.0:0.0:0.0:0.0	.	219;706;681;733;316	B4DJD3;E9PHP7;Q13822;Q13822-2;E5RIA2	.;.;ENPP2_HUMAN;.;.	P	733;702;316;706;681	ENSP00000259486:L733P;ENSP00000403315:L702P;ENSP00000429476:L316P;ENSP00000428291:L706P;ENSP00000075322:L681P	ENSP00000075322:L681P	L	-	2	0	ENPP2	120650667	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.524000	0.90579	2.038000	0.60285	0.533000	0.62120	CTC		0.443	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
TAF1L	138474	hgsc.bcm.edu	37	9	32630351	32630351	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr9:32630351C>A	ENST00000242310.4	-	1	5316	c.5227G>T	c.(5227-5229)Gat>Tat	p.D1743Y		NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1743					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.D1743Y(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCTGCAAGATCACCATCTCCC	0.488																																					p.D1743Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5227T	9						.						242.0	219.0	227.0					9																	32630351		2203	4300	6503	32620351	SO:0001583	missense	138474	exon1			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.5227G>T	9.37:g.32630351C>A	ENSP00000418379:p.Asp1743Tyr		32620351	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	37	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964477	0.53507	.	.	ENSG00000122728	ENST00000242310	T	0.11495	2.77	1.16	1.16	0.20824	.	0.092799	0.64402	D	0.000001	T	0.19765	0.0475	L	0.56769	1.78	0.46564	D	0.999109	D	0.71674	0.998	P	0.59288	0.855	T	0.01039	-1.1472	10	0.62326	D	0.03	.	8.1579	0.31180	0.0:1.0:0.0:0.0	.	1743	Q8IZX4	TAF1L_HUMAN	Y	1743	ENSP00000418379:D1743Y	ENSP00000418379:D1743Y	D	-	1	0	TAF1L	32620351	1.000000	0.71417	0.876000	0.34364	0.344000	0.29017	3.306000	0.51881	0.507000	0.28148	0.195000	0.17529	GAT		0.488	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
ASTN2	23245	hgsc.bcm.edu	37	9	119382680	119382680	+	Missense_Mutation	SNP	T	T	C	rs370185624		TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chr9:119382680T>C	ENST00000313400.4	-	18	3215	c.3115A>G	c.(3115-3117)Aaa>Gaa	p.K1039E	ASTN2_ENST00000361477.3_Missense_Mutation_p.K91E|ASTN2_ENST00000373996.3_Missense_Mutation_p.K1035E|ASTN2_ENST00000288520.5_Missense_Mutation_p.K140E|ASTN2_ENST00000341734.4_Missense_Mutation_p.K91E|ASTN2_ENST00000358637.4_Missense_Mutation_p.K91E|ASTN2_ENST00000361209.2_Missense_Mutation_p.K988E			O75129	ASTN2_HUMAN	astrotactin 2	1039					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)		p.K988E(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACATCCCCTTTCCCTGAGCAC	0.527																																					p.K140E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A418G	9						.	T	GLU/LYS,GLU/LYS,GLU/LYS,GLU/LYS,GLU/LYS,GLU/LYS	1,4405	2.1+/-5.4	0,1,2202	188.0	169.0	175.0		271,271,2962,418,271,271	6.1	1.0	9		175	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense	ASTN2	NM_001184734.1,NM_001184735.1,NM_014010.4,NM_198186.3,NM_198187.3,NM_198188.2	56,56,56,56,56,56	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	91/376,91/195,988/1289,140/441,91/403,91/396	119382680	1,13005	2203	4300	6503	118422501	SO:0001583	missense	23245	exon3			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.3115A>G	9.37:g.119382680T>C	ENSP00000314038:p.Lys1039Glu		118422501	NM_198186	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	T	18.08	3.544356	0.65198	2.27E-4	0.0	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000288520;ENST00000341734;ENST00000373986;ENST00000361209;ENST00000361477;ENST00000358637	T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	6.08	6.08	0.98989	.	0.099528	0.64402	D	0.000002	T	0.30854	0.0778	L	0.38838	1.175	0.51012	D	0.9999	B;P;P;B;P;B;P;P	0.43094	0.373;0.728;0.734;0.372;0.799;0.216;0.525;0.728	B;B;B;B;B;B;B;B	0.38378	0.081;0.199;0.187;0.114;0.255;0.19;0.115;0.272	T	0.03576	-1.1023	9	.	.	.	-14.9714	16.6438	0.85155	0.0:0.0:0.0:1.0	.	91;91;762;988;1039;1035;91;140	B7ZKP4;B7ZKP5;A2A2T8;O75129-2;O75129;O75129-3;O75129-6;O75129-4	.;.;.;.;ASTN2_HUMAN;.;.;.	E	1039;1035;140;91;762;988;91;91	ENSP00000314038:K1039E;ENSP00000363108:K1035E;ENSP00000288520:K140E;ENSP00000339925:K91E;ENSP00000363098:K762E;ENSP00000354504:K988E;ENSP00000355116:K91E;ENSP00000351460:K91E	.	K	-	1	0	ASTN2	118422501	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	7.665000	0.83852	2.333000	0.79357	0.533000	0.62120	AAA		0.527	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
WNK3	65267	hgsc.bcm.edu	37	X	54224990	54224991	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:54224990_54224991insT	ENST00000375159.2	-	23	5168_5169	c.5169_5170insA	c.(5167-5172)tcactcfs	p.L1724fs	WNK3_ENST00000375169.3_Frame_Shift_Ins_p.L1667fs|WNK3_ENST00000354646.2_Frame_Shift_Ins_p.L1724fs			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1724					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L1724fs*20(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						AATGAAGGGAGTGAGAGTCCTT	0.49																																					p.L1667fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.4999_5000insA	X						.																																			54241716	SO:0001589	frameshift_variant	65267	exon23			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.5170dupA	X.37:g.54224991_54224991dupT	ENSP00000364301:p.Leu1724fs		54241715	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Frame_Shift_Ins	INS	ENST00000375159.2	37	CCDS14357.1																																																																																				0.490	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
TENM1	10178	hgsc.bcm.edu	37	X	123695614	123695614	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:123695614C>A	ENST00000371130.3	-	14	2404	c.2341G>T	c.(2341-2343)Ggt>Tgt	p.G781C	TENM1_ENST00000422452.2_Missense_Mutation_p.G781C	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	781	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.G783C(1)									CAGTGCCAACCATTTTGATCC	0.488																																					p.G781C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2341T	X						.						199.0	154.0	169.0					X																	123695614		2203	4300	6503	123523295	SO:0001583	missense	10178	exon14			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2341G>T	X.37:g.123695614C>A	ENSP00000360171:p.Gly781Cys		123523295	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671819	0.88348	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.14640	2.49;2.49	5.39	5.39	0.77823	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.96	T	0.41910	-0.9482	10	0.72032	D	0.01	.	18.4118	0.90554	0.0:1.0:0.0:0.0	.	780;781;781	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	C	781	ENSP00000360171:G781C;ENSP00000403954:G781C	ENSP00000360171:G781C	G	-	1	0	ODZ1	123523295	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	2.376000	0.81061	0.594000	0.82650	GGT		0.488	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
CNKSR2	22866	hgsc.bcm.edu	37	X	21534689	21534689	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:21534689C>G	ENST00000379510.3	+	9	933	c.897C>G	c.(895-897)agC>agG	p.S299R	CNKSR2_ENST00000543067.1_Intron|CNKSR2_ENST00000279451.4_Missense_Mutation_p.S299R|CNKSR2_ENST00000425654.2_Missense_Mutation_p.S299R	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	299					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.S299R(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						GACCTCAGAGCATGCTTACCT	0.438																																					p.S299R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C897G	X						.						112.0	97.0	102.0					X																	21534689		2203	4300	6503	21444610	SO:0001583	missense	22866	exon9			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.897C>G	X.37:g.21534689C>G	ENSP00000368824:p.Ser299Arg		21444610	NM_001168647	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752354	0.69533	.	.	ENSG00000149970	ENST00000425654;ENST00000279451;ENST00000379510	T;T;T	0.38722	1.12;1.12;1.12	5.25	5.25	0.73442	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.56688	0.2002	M	0.62723	1.935	0.80722	D	1	D;P	0.62365	0.991;0.93	P;P	0.56612	0.802;0.67	T	0.54846	-0.8232	10	0.33940	T	0.23	-22.4144	17.8997	0.88900	0.0:1.0:0.0:0.0	.	299;299	B7ZLJ1;Q8WXI2	.;CNKR2_HUMAN	R	299	ENSP00000397906:S299R;ENSP00000279451:S299R;ENSP00000368824:S299R	ENSP00000279451:S299R	S	+	3	2	CNKSR2	21444610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.754000	0.68743	2.160000	0.67779	0.594000	0.82650	AGC		0.438	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
RBM10	8241	hgsc.bcm.edu	37	X	47044541	47044541	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:47044541C>T	ENST00000377604.3	+	18	2780	c.2038C>T	c.(2038-2040)Cga>Tga	p.R680*	RBM10_ENST00000345781.6_Nonsense_Mutation_p.R603*|RBM10_ENST00000329236.7_Nonsense_Mutation_p.R602*	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	680					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.R680*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CAGCTCCCTGCGAGATGACGA	0.567																																					p.R680X	Melanoma(171;120 2705 19495 39241)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2038T	X						.						53.0	48.0	50.0					X																	47044541		2203	4300	6503	46929485	SO:0001587	stop_gained	8241	exon18			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.2038C>T	X.37:g.47044541C>T	ENSP00000366829:p.Arg680*		46929485	NM_005676	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Nonsense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	C	40	8.407096	0.98799	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	.	.	.	5.72	2.84	0.33178	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6775	12.4108	0.55466	0.4736:0.5264:0.0:0.0	.	.	.	.	X	680;602;603	.	ENSP00000328848:R602X	R	+	1	2	RBM10	46929485	0.448000	0.25681	0.805000	0.32314	0.921000	0.55340	0.184000	0.16939	0.205000	0.20568	0.594000	0.82650	CGA		0.567	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
RBM3	5935	hgsc.bcm.edu	37	X	48434980	48434980	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:48434980A>T	ENST00000376759.3	+	5	464	c.401A>T	c.(400-402)gAc>gTc	p.D134V	RBM3_ENST00000354480.2_Missense_Mutation_p.T107S|RBM3_ENST00000430348.2_Missense_Mutation_p.T107S|RBM3_ENST00000376755.1_Missense_Mutation_p.D134V|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000466764.1_3'UTR	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	134	Gly-rich.				positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)	p.T107S(1)|p.D134V(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						CGTTCCAGAGACTATAATGGC	0.512																																					p.D134V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A401T	X						.						69.0	64.0	66.0					X																	48434980		2195	4277	6472	48319924	SO:0001583	missense	5935	exon5			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.401A>T	X.37:g.48434980A>T	ENSP00000365950:p.Asp134Val		48319924	NM_006743		Missense_Mutation	SNP	ENST00000376759.3	37	CCDS14301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.44|16.44	3.125220|3.125220	0.56721|0.56721	.|.	.|.	ENSG00000102317|ENSG00000102317	ENST00000376759;ENST00000376755|ENST00000430348;ENST00000354480	T;T|.	0.19532|.	2.14;2.14|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.267553|.	0.29775|.	U|.	0.011224|.	T|T	0.40171|0.40171	0.1106|0.1106	L|L	0.36672|0.36672	1.1|1.1	0.20074|0.20074	N|N	0.999932|0.999932	D|.	0.59357|.	0.985|.	B|.	0.42422|.	0.387|.	T|T	0.28650|0.28650	-1.0037|-1.0037	9|5	.|.	.|.	.|.	-6.744|-6.744	12.1034|12.1034	0.53798|0.53798	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	134|.	P98179|.	RBM3_HUMAN|.	V|S	134|107	ENSP00000365950:D134V;ENSP00000365946:D134V|.	.|.	D|T	+|+	2|1	0|0	RBM3|RBM3	48319924|48319924	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	6.434000|6.434000	0.73408|0.73408	1.831000|1.831000	0.53308|0.53308	0.486000|0.486000	0.48141|0.48141	GAC|ACT		0.512	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	
HUWE1	10075	hgsc.bcm.edu	37	X	53642763	53642763	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:53642763T>A	ENST00000342160.3	-	21	2448	c.1991A>T	c.(1990-1992)gAt>gTt	p.D664V	HUWE1_ENST00000218328.8_Missense_Mutation_p.D664V|HUWE1_ENST00000262854.6_Missense_Mutation_p.D664V			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	664					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)	p.D664V(1)		NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CATGAGCTCATCGACAGCACT	0.448																																					p.D664V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1991T	X						.						194.0	137.0	156.0					X																	53642763		2203	4300	6503	53659488	SO:0001583	missense	10075	exon22			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.1991A>T	X.37:g.53642763T>A	ENSP00000340648:p.Asp664Val		53659488	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.734909	0.89482	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.63913	-0.07;-0.07;-0.07	5.75	5.75	0.90469	E3 ubiquitin ligase, domain of unknown function DUF913 (1);Armadillo-type fold (1);	0.061437	0.64402	D	0.000008	T	0.80226	0.4584	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.83400	0.0022	10	0.87932	D	0	.	13.9463	0.64086	0.0:0.0:0.0:1.0	.	664	Q7Z6Z7	HUWE1_HUMAN	V	664	ENSP00000340648:D664V;ENSP00000262854:D664V;ENSP00000218328:D664V	ENSP00000218328:D664V	D	-	2	0	HUWE1	53659488	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.628000	0.83189	1.939000	0.56221	0.441000	0.28932	GAT		0.448	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
CYLC1	1538	hgsc.bcm.edu	37	X	83128982	83128982	+	Silent	SNP	A	A	G			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:83128982A>G	ENST00000329312.4	+	4	1303	c.1266A>G	c.(1264-1266)gaA>gaG	p.E422E		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	422					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.E421E(3)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AGAAAGATGAAAAAAAGGATA	0.338																																					p.E422E												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.A1266G	X						.						20.0	16.0	17.0					X																	83128982		2186	4262	6448	83015638	SO:0001819	synonymous_variant	1538	exon4			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1266A>G	X.37:g.83128982A>G			83015638	NM_021118	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																				0.338	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
SMARCA1	6594	hgsc.bcm.edu	37	X	128633741	128633741	+	Missense_Mutation	SNP	A	A	C			TCGA-AF-2689-01A-01W-0831-10	TCGA-AF-2689-10A-01W-0831-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			SOLID	8d3fb086-a5f4-4044-95bf-23595663672e	05c78132-6673-4e34-a7cb-d90f30cf1de2	g.chrX:128633741A>C	ENST00000371122.4	-	10	1374	c.1245T>G	c.(1243-1245)atT>atG	p.I415M	SMARCA1_ENST00000371123.1_Missense_Mutation_p.I415M|SMARCA1_ENST00000371121.3_Missense_Mutation_p.I415M	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	415					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.I415M(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						GCCCCAAGTAAATCTTTATTT	0.308																																					p.I415M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1245G	X						.						112.0	116.0	115.0					X																	128633741		2203	4297	6500	128461422	SO:0001583	missense	6594	exon10			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.1245T>G	X.37:g.128633741A>C	ENSP00000360163:p.Ile415Met		128461422	NM_003069	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	37	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.077238	0.55753	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.28	5.28	0.74379	SNF2-related (1);	0.081974	0.47093	D	0.000245	T	0.79112	0.4391	L	0.56769	1.78	0.44508	D	0.997451	P;P;P;P	0.44429	0.835;0.835;0.802;0.74	P;P;P;P	0.49477	0.612;0.612;0.477;0.457	T	0.80386	-0.1404	10	0.62326	D	0.03	-6.5305	9.6497	0.39890	0.8424:0.0:0.0:0.1576	.	394;415;415;415	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	M	415;415;415;394	ENSP00000360162:I415M;ENSP00000360164:I415M;ENSP00000360163:I415M;ENSP00000404275:I394M	ENSP00000360162:I415M	I	-	3	3	SMARCA1	128461422	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.324000	0.43831	1.738000	0.51689	0.417000	0.27973	ATT		0.308	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
