#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GAD2	2572	broad.mit.edu	37	10	26518595	26518595	+	Silent	SNP	C	C	T	rs149136572	byFrequency	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr10:26518595C>T	ENST00000376261.3	+	7	1232	c.729C>T	c.(727-729)ggC>ggT	p.G243G	GAD2_ENST00000259271.3_Silent_p.G243G	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	243					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.G243G(3)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CTTTAGGTGGCGCCATATCTA	0.443													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		21933	0.0		0.0	False		,,,				2504	0.0				p.G243G												.	.	3	Substitution - coding silent(3)	large_intestine(2)|lung(1)	c.C729T	10						.	C	,	2,4404	4.2+/-10.8	0,2,2201	197.0	161.0	173.0		729,729	-0.5	1.0	10	dbSNP_134	173	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GAD2	NM_000818.2,NM_001134366.1	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	243/586,243/586	26518595	2,13004	2203	4300	6503	26558601	SO:0001819	synonymous_variant	2572	exon7			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.729C>T	10.37:g.26518595C>T			26558601	NM_001134366	Q9UD87	Silent	SNP	ENST00000376261.3	37	CCDS7149.1																																																																																				0.443	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
KIF5B	3799	broad.mit.edu	37	10	32344784	32344784	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr10:32344784C>T	ENST00000302418.4	-	1	575	c.118G>A	c.(118-120)Gtg>Atg	p.V40M	Y_RNA_ENST00000383933.1_RNA	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	40	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.V40M(1)	KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				ACCGCGATCACGACCGTGTCT	0.587			T	"""RET, ALK"""	NSCLC																																p.V40M			Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G118A	10						.						68.0	54.0	58.0					10																	32344784		2203	4300	6503	32384790	SO:0001583	missense	3799	exon1			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.118G>A	10.37:g.32344784C>T	ENSP00000307078:p.Val40Met		32384790	NM_004521	A0AVB2|Q5VZ85	Missense_Mutation	SNP	ENST00000302418.4	37	CCDS7171.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659187	0.47467	.	.	ENSG00000170759	ENST00000302418	T	0.74315	-0.83	5.25	-1.67	0.08238	Kinesin, motor domain (4);	0.301676	0.36002	N	0.002841	T	0.68155	0.2970	L	0.37466	1.105	0.23210	N	0.998112	P	0.46020	0.871	P	0.51701	0.677	T	0.63497	-0.6624	10	0.39692	T	0.17	.	8.9751	0.35930	0.0:0.5792:0.1393:0.2815	.	40	P33176	KINH_HUMAN	M	40	ENSP00000307078:V40M	ENSP00000307078:V40M	V	-	1	0	KIF5B	32384790	0.003000	0.15002	0.491000	0.27477	0.986000	0.74619	0.003000	0.13083	-0.602000	0.05775	-0.345000	0.07892	GTG		0.587	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521	
CCKBR	887	broad.mit.edu	37	11	6291928	6291928	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:6291928G>A	ENST00000334619.2	+	4	899	c.706G>A	c.(706-708)Gtg>Atg	p.V236M	CCKBR_ENST00000532715.1_Missense_Mutation_p.V152M|CCKBR_ENST00000525462.1_Missense_Mutation_p.V236M	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	236					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)	p.V236M(3)		NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	GGTTATGGCCGTGGCCTACGG	0.567																																					p.V236M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G706A	11						.						192.0	135.0	154.0					11																	6291928		2201	4296	6497	6248504	SO:0001583	missense	887	exon4			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.706G>A	11.37:g.6291928G>A	ENSP00000335544:p.Val236Met		6248504	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513324	0.64522	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.41758	0.99;0.99;0.99	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.247555	0.41294	D	0.000901	T	0.67646	0.2915	M	0.83384	2.64	0.45962	D	0.998785	D;D;D	0.89917	1.0;0.987;0.989	D;P;P	0.79108	0.992;0.742;0.832	T	0.64334	-0.6432	10	0.27785	T	0.31	.	18.5901	0.91208	0.0:0.0:1.0:0.0	.	236;170;236	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	M	236;152;236	ENSP00000335544:V236M;ENSP00000432079:V152M;ENSP00000435534:V236M	ENSP00000335544:V236M	V	+	1	0	CCKBR	6248504	0.999000	0.42202	0.956000	0.39512	0.995000	0.86356	3.206000	0.51098	2.735000	0.93741	0.655000	0.94253	GTG		0.567	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
PTPN5	84867	broad.mit.edu	37	11	18762240	18762240	+	Silent	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:18762240G>A	ENST00000358540.2	-	8	1255	c.825C>T	c.(823-825)cgC>cgT	p.R275R	PTPN5_ENST00000396167.2_Silent_p.R243R|PTPN5_ENST00000396171.4_Silent_p.R275R|PTPN5_ENST00000396168.1_Silent_p.R251R|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000477854.1_Silent_p.R79R|PTPN5_ENST00000396170.1_Silent_p.R243R|PTPN5_ENST00000496201.2_5'Flank	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	275					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)	p.R275R(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GCAGGTACTCGCGGGCGGACT	0.602																																					p.R275R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C825T	11						.						61.0	59.0	60.0					11																	18762240		2199	4293	6492	18718816	SO:0001819	synonymous_variant	84867	exon8			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.825C>T	11.37:g.18762240G>A			18718816	NM_032781	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Silent	SNP	ENST00000358540.2	37	CCDS7845.1																																																																																				0.602	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970	
FBXO3	26273	broad.mit.edu	37	11	33777486	33777486	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:33777486C>T	ENST00000265651.3	-	5	527	c.509G>A	c.(508-510)cGt>cAt	p.R170H	FBXO3_ENST00000534136.1_Missense_Mutation_p.R170H|FBXO3_ENST00000526785.1_Missense_Mutation_p.R57H|FBXO3_ENST00000448981.2_Missense_Mutation_p.R170H|FBXO3_ENST00000531080.1_5'Flank|FBXO3_ENST00000532057.1_5'Flank|FBXO3_ENST00000533103.1_5'Flank|FBXO3_ENST00000530401.1_Missense_Mutation_p.R165H	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	170					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)	p.R170H(1)		NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		ATCTTCAGAACGATAGTGATT	0.448																																					p.R170H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G509A	11						.						78.0	71.0	73.0					11																	33777486		2202	4298	6500	33734062	SO:0001583	missense	26273	exon5			AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.509G>A	11.37:g.33777486C>T	ENSP00000265651:p.Arg170His		33734062	NM_033406	B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	ENST00000265651.3	37	CCDS7887.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.197355|5.197355	0.94960|0.94960	.|.	.|.	ENSG00000110429|ENSG00000110429	ENST00000526785;ENST00000265651;ENST00000530401;ENST00000534136;ENST00000448981|ENST00000321458	T;T;T;T;T|.	0.45668|.	0.89;0.89;0.89;0.89;0.89|.	5.63|5.63	5.63|5.63	0.86233|0.86233	Cell wall assembly/cell proliferation coordinating protein, KNR4-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75347|0.75347	0.3837|0.3837	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;0.999|.	D;D;P|.	0.65010|.	0.909;0.931;0.869|.	T|T	0.75233|0.75233	-0.3390|-0.3390	10|6	0.62326|0.54805	D|T	0.03|0.06	-16.5187|-16.5187	19.6756|19.6756	0.95930|0.95930	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	165;170;170|.	Q9UK99-3;Q9UK99-2;Q9UK99|.	.;.;FBX3_HUMAN|.	H|I	57;170;165;170;170|168	ENSP00000435680:R57H;ENSP00000265651:R170H;ENSP00000433781:R165H;ENSP00000431745:R170H;ENSP00000408836:R170H|.	ENSP00000265651:R170H|ENSP00000315066:V168I	R|V	-|-	2|1	0|0	FBXO3|FBXO3	33734062|33734062	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.442000|7.442000	0.80503|0.80503	2.655000|2.655000	0.90218|0.90218	0.555000|0.555000	0.69702|0.69702	CGT|GTT		0.448	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388665.1	NM_012175	
OR8I2	120586	broad.mit.edu	37	11	55861577	55861577	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:55861577C>A	ENST00000302124.2	+	1	825	c.794C>A	c.(793-795)tCa>tAa	p.S265*		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S265*(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					GATAACACATCATCGCTGACC	0.468																																					p.S265X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C794A	11						.						114.0	110.0	111.0					11																	55861577		2201	4296	6497	55618153	SO:0001587	stop_gained	120586	exon1			AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.794C>A	11.37:g.55861577C>A	ENSP00000303864:p.Ser265*		55618153	NM_001003750	B2RNN4|Q6IFC0|Q96RC5	Nonsense_Mutation	SNP	ENST00000302124.2	37	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	C	7.657	0.684072	0.14907	.	.	ENSG00000172154	ENST00000302124	.	.	.	4.33	-1.63	0.08345	.	0.749703	0.10943	U	0.616993	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-5.3404	4.4477	0.11606	0.265:0.4808:0.0:0.2543	.	.	.	.	X	265	.	ENSP00000303864:S265X	S	+	2	0	OR8I2	55618153	0.000000	0.05858	0.140000	0.22221	0.255000	0.26057	-3.092000	0.00608	0.041000	0.15688	0.440000	0.28878	TCA		0.468	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
TNKS1BP1	85456	broad.mit.edu	37	11	57069686	57069686	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:57069686G>A	ENST00000532437.1	-	7	5007	c.4696C>T	c.(4696-4698)Ctc>Ttc	p.L1566F	TNKS1BP1_ENST00000358252.3_Missense_Mutation_p.L1566F			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1566	Acidic.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.L1566F(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GCACTGTCGAGGATCTCGGTG	0.657																																					p.L1566F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4696T	11						.						38.0	35.0	36.0					11																	57069686		2201	4296	6497	56826262	SO:0001583	missense	85456	exon8			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.4696C>T	11.37:g.57069686G>A	ENSP00000437271:p.Leu1566Phe		56826262	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Missense_Mutation	SNP	ENST00000532437.1	37	CCDS7951.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294034	0.81025	.	.	ENSG00000149115	ENST00000358252;ENST00000532437	T;T	0.56444	0.46;0.46	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000004	T	0.69043	0.3067	L	0.60455	1.87	0.50467	D	0.999877	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.998	T	0.71151	-0.4676	10	0.62326	D	0.03	-15.3738	15.6156	0.76764	0.0:0.0:1.0:0.0	.	1566;148	Q9C0C2;Q86TK2	TB182_HUMAN;.	F	1566	ENSP00000350990:L1566F;ENSP00000437271:L1566F	ENSP00000350990:L1566F	L	-	1	0	TNKS1BP1	56826262	1.000000	0.71417	0.979000	0.43373	0.899000	0.52679	5.831000	0.69330	2.422000	0.82143	0.561000	0.74099	CTC		0.657	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
CCDC87	55231	broad.mit.edu	37	11	66359383	66359383	+	Silent	SNP	C	C	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:66359383C>A	ENST00000333861.3	-	1	1171	c.1104G>T	c.(1102-1104)ggG>ggT	p.G368G	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	368					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)			p.G368G(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGTAGCGAGTCCCCTCCAACT	0.582																																					p.G368G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1104T	11						.						50.0	54.0	53.0					11																	66359383		2200	4294	6494	66115959	SO:0001819	synonymous_variant	55231	exon1			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1104G>T	11.37:g.66359383C>A			66115959	NM_018219	Q8NE76	Silent	SNP	ENST00000333861.3	37	CCDS8145.1																																																																																				0.582	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219	
USP2	9099	broad.mit.edu	37	11	119230287	119230288	+	Missense_Mutation	DNP	GT	GT	TG			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	GT	GT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr11:119230287_119230288GT>TG	ENST00000260187.2	-	4	1202_1203	c.908_909AC>CA	c.(907-909)gAC>gCA	p.D303A	USP2_ENST00000525735.1_Missense_Mutation_p.D94A|USP2_ENST00000455332.2_Missense_Mutation_p.D60A	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	303	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.D303>?(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		CGTGGTGCAGGTCCCGCATGTA	0.589																																					.												.	.	1	Complex(1)	large_intestine(1)	c.281_282CA	11						.																																			118735498	SO:0001583	missense	9099	exon3			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.908_909delinsTG	11.37:g.119230287_119230288delinsTG	ENSP00000260187:p.Asp303Ala		118735497	NM_171997	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	DNP	ENST00000260187.2	37	CCDS8422.1																																																																																				0.589	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
KMT2D	8085	broad.mit.edu	37	12	49431873	49431874	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr12:49431873_49431874insC	ENST00000301067.7	-	34	9264_9265	c.9265_9266insG	c.(9265-9267)gtgfs	p.V3089fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3089					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V2819fs*9(1)|p.V3089fs*9(1)									TCCTGGCTCCACCCCCCGCAGC	0.624																																					p.V3089fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.9266_9267insG	12						.																																			47718141	SO:0001589	frameshift_variant	8085	exon34			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9266dupG	12.37:g.49431879_49431879dupC	ENSP00000301067:p.Val3089fs		47718140	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																				0.624	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CDKN1B	1027	broad.mit.edu	37	12	12870995	12870995	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr12:12870995C>G	ENST00000228872.4	+	1	938	c.222C>G	c.(220-222)taC>taG	p.Y74*	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Nonsense_Mutation_p.Y74*	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	74					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.Y74*(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		AGGGCAAGTACGAGTGGCAAG	0.592																																					p.Y74X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C222G	12						.						77.0	88.0	84.0					12																	12870995		2203	4300	6503	12762262	SO:0001587	stop_gained	1027	exon1			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.222C>G	12.37:g.12870995C>G	ENSP00000228872:p.Tyr74*		12762262	NM_004064	Q16307|Q5U0H2|Q9BUS6	Nonsense_Mutation	SNP	ENST00000228872.4	37	CCDS8653.1	.	.	.	.	.	.	.	.	.	.	C	43	10.345728	0.99388	.	.	ENSG00000111276	ENST00000228872;ENST00000535674;ENST00000396340	.	.	.	5.4	2.14	0.27477	.	0.153716	0.44688	D	0.000431	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.0847	11.6909	0.51514	0.0:0.7682:0.0:0.2318	.	.	.	.	X	74;23;74	.	ENSP00000228872:Y74X	Y	+	3	2	CDKN1B	12762262	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	2.682000	0.46934	0.666000	0.31087	-0.145000	0.13849	TAC		0.592	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064	
KRAS	3845	broad.mit.edu	37	12	25398255	25398255	+	Missense_Mutation	SNP	G	G	T	rs121913236		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr12:25398255G>T	ENST00000256078.4	-	2	127	c.64C>A	c.(64-66)Cag>Aag	p.Q22K	KRAS_ENST00000311936.3_Missense_Mutation_p.Q22K|KRAS_ENST00000556131.1_Missense_Mutation_p.Q22K|KRAS_ENST00000557334.1_Missense_Mutation_p.Q22K	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	22			Q -> E (in CFC2; exhibits an increase in intrinsic and guanine nucleotide exchange factor catalyzed nucleotide exchange in combination with an impaired GTPase- activating protein-stimulated GTP hydrolysis but functional in interaction with effectors). {ECO:0000269|PubMed:17056636}.|Q -> R (in NS3; impairs GTPase-activating protein stimulated GTP hydrolysis with unaffected intrinsic functions and a virtually functional effector interaction).		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q22K(8)|p.Q22*(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TGAATTAGCTGTATCGTCAAG	0.363		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.Q22K	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,head_neck,Substitution - coding silent,+2 	.	9	Substitution - Missense(8)|Substitution - Nonsense(1)	large_intestine(7)|haematopoietic_and_lymphoid_tissue(1)|small_intestine(1)	c.C64A	12	GRCh37	CM070964	KRAS	M	rs121913236	.						88.0	76.0	80.0					12																	25398255		2203	4300	6503	25289522	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.64C>A	12.37:g.25398255G>T	ENSP00000256078:p.Gln22Lys		25289522	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113031	0.94339	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.79749	-1.3;-0.43;-0.43;-0.43	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90013	0.6882	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.976	D	0.90739	0.4648	10	0.87932	D	0	.	18.3719	0.90409	0.0:0.0:1.0:0.0	.	22;22	P01116-2;P01116	.;RASK_HUMAN	K	22	ENSP00000308495:Q22K;ENSP00000452512:Q22K;ENSP00000256078:Q22K;ENSP00000451856:Q22K	ENSP00000256078:Q22K	Q	-	1	0	KRAS	25289522	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.770000	0.98971	2.668000	0.90789	0.563000	0.77884	CAG		0.363	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
OR6C3	254786	broad.mit.edu	37	12	55725989	55725989	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr12:55725989A>G	ENST00000379667.1	+	1	505	c.505A>G	c.(505-507)Aac>Gac	p.N169D		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	169					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N169D(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						CTGTGCTTCCAACGTCATTGA	0.438																																					p.N169D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A505G	12						.						282.0	253.0	263.0					12																	55725989		2203	4300	6503	54012256	SO:0001583	missense	254786	exon1			AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.505A>G	12.37:g.55725989A>G	ENSP00000368989:p.Asn169Asp		54012256	NM_054104		Missense_Mutation	SNP	ENST00000379667.1	37	CCDS31819.1	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808696	0.31961	.	.	ENSG00000205329	ENST00000379667	T	0.00241	8.46	5.28	2.93	0.34026	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000050	T	0.00328	0.0010	M	0.83312	2.635	0.09310	N	1	P	0.49559	0.925	P	0.51516	0.672	T	0.39800	-0.9596	10	0.72032	D	0.01	.	5.0071	0.14293	0.5875:0.2496:0.1629:0.0	.	169	Q9NZP0	OR6C3_HUMAN	D	169	ENSP00000368989:N169D	ENSP00000368989:N169D	N	+	1	0	OR6C3	54012256	0.016000	0.18221	0.379000	0.26080	0.204000	0.24138	2.746000	0.47467	0.549000	0.28973	-0.250000	0.11733	AAC		0.438	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406309.1		
TMCC3	57458	broad.mit.edu	37	12	94975538	94975538	+	Silent	SNP	G	G	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr12:94975538G>T	ENST00000261226.4	-	2	986	c.855C>A	c.(853-855)ggC>ggA	p.G285G	TMCC3_ENST00000551457.1_Silent_p.G254G	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	285						integral component of membrane (GO:0016021)		p.G285G(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						CGGCGAGCTTGCCCTGGCTGT	0.567																																					p.G285G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C855A	12						.						96.0	94.0	94.0					12																	94975538		2203	4300	6503	93499669	SO:0001819	synonymous_variant	57458	exon2			AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.855C>A	12.37:g.94975538G>T			93499669	NM_020698	Q8IWB2	Silent	SNP	ENST00000261226.4	37	CCDS31877.1																																																																																				0.567	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
HECTD4	283450	broad.mit.edu	37	12	112638547	112638547	+	Missense_Mutation	SNP	C	C	T	rs535700898		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr12:112638547C>T	ENST00000430131.2	-	54	8341	c.7196G>A	c.(7195-7197)cGa>cAa	p.R2399Q	HECTD4_ENST00000550722.1_Missense_Mutation_p.R2675Q|HECTD4_ENST00000377560.5_Missense_Mutation_p.R2649Q			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2399					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R2399Q(1)|p.R2649Q(1)									ATACCAGTATCGCACCAGCAC	0.478																																					p.R2649Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7946A	12						.						134.0	132.0	133.0					12																	112638547		2067	4222	6289	111122930	SO:0001583	missense	283450	exon54			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.7196G>A	12.37:g.112638547C>T	ENSP00000404379:p.Arg2399Gln		111122930	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	37	6.323721	0.97476	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000548896	T;T;T	0.53423	0.62;0.63;0.62	5.86	5.86	0.93980	.	.	.	.	.	T	0.58004	0.2092	L	0.27053	0.805	0.53005	D	0.999966	D	0.64830	0.994	D	0.64042	0.921	T	0.59495	-0.7444	9	0.87932	D	0	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	2399	Q9Y4D8	K0614_HUMAN	Q	2649;2399;2675;30	ENSP00000366783:R2649Q;ENSP00000404379:R2399Q;ENSP00000449784:R2675Q	ENSP00000366783:R2649Q	R	-	2	0	C12orf51	111122930	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	7.226000	0.78060	2.937000	0.99478	0.650000	0.86243	CGA		0.478	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
TGM1	7051	broad.mit.edu	37	14	24724250	24724250	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr14:24724250T>C	ENST00000206765.6	-	12	1978	c.1855A>G	c.(1855-1857)Act>Gct	p.T619A	TGM1_ENST00000544573.1_Missense_Mutation_p.T177A	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	619					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.T619A(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GTATAGAAAGTGACTGAGAGG	0.562																																					p.T619A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1855G	14						.						70.0	62.0	65.0					14																	24724250		2203	4300	6503	23794090	SO:0001583	missense	7051	exon12			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1855A>G	14.37:g.24724250T>C	ENSP00000206765:p.Thr619Ala		23794090	NM_000359	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	T	19.31	3.803364	0.70682	.	.	ENSG00000092295	ENST00000206765;ENST00000544573	T;T	0.68331	-0.32;-0.32	5.28	5.28	0.74379	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.044531	0.85682	D	0.000000	T	0.72431	0.3459	L	0.61218	1.895	0.37978	D	0.933514	P	0.48162	0.906	P	0.52343	0.696	T	0.74087	-0.3778	10	0.30854	T	0.27	-31.0938	14.3153	0.66446	0.0:0.0:0.0:1.0	.	619	P22735	TGM1_HUMAN	A	619;177	ENSP00000206765:T619A;ENSP00000439446:T177A	ENSP00000206765:T619A	T	-	1	0	TGM1	23794090	1.000000	0.71417	0.987000	0.45799	0.989000	0.77384	4.259000	0.58828	2.209000	0.71365	0.533000	0.62120	ACT		0.562	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
AHNAK2	113146	broad.mit.edu	37	14	105412698	105412699	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	GG	GG					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr14:105412698_105412699GG>AT	ENST00000333244.5	-	7	9208_9209	c.9089_9090CC>AT	c.(9088-9090)cCC>cAT	p.P3030H	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3030						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P3030>?(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCAGAGGGGGGCTCAATGCT	0.639																																					.												.	.	1	Complex(1)	large_intestine(1)	c.9089_9090AT	14						.																																			104483744	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9089_9090delinsAT	14.37:g.105412698_105412699delinsAT	ENSP00000353114:p.Pro3030His		104483743	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	DNP	ENST00000333244.5	37	CCDS45177.1																																																																																				0.639	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NPAP1	23742	broad.mit.edu	37	15	24921752	24921752	+	Silent	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr15:24921752C>T	ENST00000329468.2	+	1	1212	c.738C>T	c.(736-738)gcC>gcT	p.A246A		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	246					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.A246A(1)									ACAGCCAGGCCGGATGTGCCC	0.622																																					p.A246A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C738T	15						.						32.0	35.0	34.0					15																	24921752		2203	4299	6502	22472845	SO:0001819	synonymous_variant	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.738C>T	15.37:g.24921752C>T			22472845	NM_018958		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																				0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
TMOD3	29766	broad.mit.edu	37	15	52161473	52161473	+	Silent	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr15:52161473G>A	ENST00000308580.7	+	3	467	c.186G>A	c.(184-186)ggG>ggA	p.G62G	TMOD3_ENST00000544199.1_Silent_p.G62G	NM_014547.4	NP_055362.1	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	62						striated muscle thin filament (GO:0005865)	tropomyosin binding (GO:0005523)	p.G62G(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|stomach(1)	14				all cancers(107;0.00194)		CCACCACAGGGCCATTTGATA	0.453																																					p.G62G	Colon(122;1837 2251 18387 22826)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G186A	15						.						93.0	92.0	92.0					15																	52161473		2195	4293	6488	49948765	SO:0001819	synonymous_variant	29766	exon3			AF177171	CCDS10145.1	15q21.1-q21.2	2008-05-14			ENSG00000138594	ENSG00000138594			11873	protein-coding gene	gene with protein product		605112				10662549	Standard	NM_014547		Approved	UTMOD	uc002abn.3	Q9NYL9	OTTHUMG00000131803	ENST00000308580.7:c.186G>A	15.37:g.52161473G>A			49948765	NM_014547	B2R6G7|Q9NT43|Q9NZR0	Silent	SNP	ENST00000308580.7	37	CCDS10145.1																																																																																				0.453	TMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254740.3		
PRM2	5620	broad.mit.edu	37	16	11370148	11370148	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr16:11370148C>T	ENST00000241808.4	-	1	189	c.80G>A	c.(79-81)gGa>gAa	p.G27E	PRM2_ENST00000435245.2_Missense_Mutation_p.G27E|PRM3_ENST00000327157.2_5'Flank|SNORA48_ENST00000390926.1_RNA|RMI2_ENST00000572173.1_Intron	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2	27					cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G27E(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						GCCGTGGTGTCCTTGCTCTTG	0.617																																					p.G27E												.	.	2	Substitution - Missense(1)|Whole gene deletion(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G80A	16						.						83.0	90.0	88.0					16																	11370148		2180	4280	6460	11277649	SO:0001583	missense	5620	exon1				CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317	ENST00000241808.4:c.80G>A	16.37:g.11370148C>T	ENSP00000241808:p.Gly27Glu		11277649	NM_002762	Q6ZMM0	Missense_Mutation	SNP	ENST00000241808.4	37	CCDS42118.1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609466	0.46527	.	.	ENSG00000122304	ENST00000241808;ENST00000435245	.	.	.	3.13	-3.01	0.05463	.	0.515171	0.14626	N	0.308099	T	0.25382	0.0617	L	0.27053	0.805	0.09310	N	1	B;B	0.20887	0.049;0.008	B;B	0.17433	0.018;0.006	T	0.16778	-1.0391	9	0.87932	D	0	.	8.2431	0.31671	0.0:0.2168:0.0:0.7832	.	27;27	Q6ZMM0;P04554	.;PRM2_HUMAN	E	27	.	ENSP00000241808:G27E	G	-	2	0	PRM2	11277649	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.775000	0.04679	-0.603000	0.05767	0.491000	0.48974	GGA		0.617	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417808.1		
CHD9	80205	broad.mit.edu	37	16	53272320	53272320	+	Missense_Mutation	SNP	A	A	G	rs370605180		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr16:53272320A>G	ENST00000398510.3	+	11	2786	c.2699A>G	c.(2698-2700)tAt>tGt	p.Y900C	CHD9_ENST00000566029.1_Missense_Mutation_p.Y900C|CHD9_ENST00000564845.1_Missense_Mutation_p.Y900C|CHD9_ENST00000447540.1_Missense_Mutation_p.Y900C			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	900	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Y900C(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ACATTCCTCTATGAAATCCTT	0.363																																					p.Y900C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2699G	16						.	A	CYS/TYR	0,3660		0,0,1830	121.0	113.0	115.0		2699	3.9	1.0	16		115	1,8173		0,1,4086	no	missense	CHD9	NM_025134.4	194	0,1,5916	GG,GA,AA		0.0122,0.0,0.0085	possibly-damaging	900/2882	53272320	1,11833	1830	4087	5917	51829821	SO:0001583	missense	80205	exon12			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.2699A>G	16.37:g.53272320A>G	ENSP00000381522:p.Tyr900Cys		51829821	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	A	15.97	2.988518	0.53934	0.0	1.22E-4	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.93488	-3.23;-3.23	5.02	3.9	0.45041	DEAD-like helicase (2);SNF2-related (1);	0.251083	0.28203	N	0.016209	D	0.92116	0.7501	L	0.28504	0.86	0.34407	D	0.695933	P;D;P;P	0.56287	0.491;0.975;0.512;0.456	P;P;B;B	0.61328	0.586;0.887;0.432;0.306	D	0.91857	0.5496	10	0.39692	T	0.17	-1.6142	7.6522	0.28354	0.7151:0.1456:0.0:0.1393	.	426;900;900;900	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	C	900;900;426	ENSP00000396345:Y900C;ENSP00000381522:Y900C	ENSP00000219084:Y426C	Y	+	2	0	CHD9	51829821	0.997000	0.39634	0.998000	0.56505	0.959000	0.62525	3.396000	0.52565	0.729000	0.32403	0.377000	0.23210	TAT		0.363	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CLEC18C	283971	broad.mit.edu	37	16	70219844	70219844	+	Missense_Mutation	SNP	G	G	A	rs560740555	byFrequency	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr16:70219844G>A	ENST00000569347.2	+	11	1522	c.1268G>A	c.(1267-1269)cGc>cAc	p.R423H	CLEC18C_ENST00000541793.2_Missense_Mutation_p.R423H|CLEC18C_ENST00000536907.2_Missense_Mutation_p.R432H|CLEC18C_ENST00000314151.8_Missense_Mutation_p.R423H	NM_173619.2	NP_775890.2	Q8NCF0	CL18C_HUMAN	C-type lectin domain family 18, member C	423	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.R423H(2)		endometrium(3)|large_intestine(6)|lung(1)	10						AACAACCAGCGCTGCAAAACC	0.587													g|||	2	0.000399361	0.0	0.0	5008	,	,		17169	0.0		0.002	False		,,,				2504	0.0				p.R423H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1268A	16						.						94.0	132.0	119.0					16																	70219844		2076	4297	6373	68777345	SO:0001583	missense	283971	exon11			AL833339	CCDS32473.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157335		"""C-type lectin domain containing"""	28538	protein-coding gene	gene with protein product						12477932	Standard	XM_005255906		Approved	MGC34761		Q8NCF0		ENST00000569347.2:c.1268G>A	16.37:g.70219844G>A	ENSP00000455920:p.Arg423His		68777345	NM_173619	Q8IUW8	Missense_Mutation	SNP	ENST00000569347.2	37	CCDS32473.1	.	.	.	.	.	.	.	.	.	.	g	20.3	3.962318	0.74016	.	.	ENSG00000157335	ENST00000541793;ENST00000314151;ENST00000536907	T;T;T	0.55052	0.54;0.54;0.54	4.34	4.34	0.51931	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.069626	0.64402	D	0.000019	T	0.55000	0.1893	L	0.33339	1.005	0.48341	D	0.999634	D;D	0.61697	0.98;0.99	P;P	0.56823	0.807;0.707	T	0.57625	-0.7779	10	0.54805	T	0.06	.	12.7412	0.57253	0.0:0.0:1.0:0.0	.	423;432	Q8NCF0;F8W692	CL18C_HUMAN;.	H	423;423;432	ENSP00000444875:R423H;ENSP00000326538:R423H;ENSP00000444726:R432H	ENSP00000326538:R423H	R	+	2	0	CLEC18C	68777345	1.000000	0.71417	0.990000	0.47175	0.958000	0.62258	3.543000	0.53633	2.132000	0.65825	0.450000	0.29827	CGC		0.587	CLEC18C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434588.2	NM_173619	
SOX9	6662	broad.mit.edu	37	17	70119807	70119808	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr17:70119807_70119808insC	ENST00000245479.2	+	3	1181_1182	c.809_810insC	c.(808-813)ttccgcfs	p.R271fs		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	271					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R271fs*25(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CCTATCGACTTCCGCGACGTGG	0.649																																					p.F270fs	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.809_810insC	17						.																																			67631403	SO:0001589	frameshift_variant	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.811dupC	17.37:g.70119809_70119809dupC	ENSP00000245479:p.Arg271fs		67631402	NM_000346	Q53Y80	Frame_Shift_Ins	INS	ENST00000245479.2	37	CCDS11689.1																																																																																				0.649	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
FZD2	2535	broad.mit.edu	37	17	42636400	42636400	+	Silent	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr17:42636400C>T	ENST00000315323.3	+	1	1476	c.1344C>T	c.(1342-1344)gaC>gaT	p.D448D		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	448					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.D448D(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGAAGCACGACGGCACCAAGA	0.607																																					p.D448D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1344T	17						.						107.0	92.0	97.0					17																	42636400		2203	4300	6503	39991926	SO:0001819	synonymous_variant	2535	exon1			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1344C>T	17.37:g.42636400C>T			39991926	NM_001466	Q0VG82	Silent	SNP	ENST00000315323.3	37	CCDS11484.1																																																																																				0.607	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457806.1	NM_001466	
NGFR	4804	broad.mit.edu	37	17	47587820	47587820	+	Silent	SNP	G	G	A	rs377669981		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr17:47587820G>A	ENST00000172229.3	+	4	740	c.615G>A	c.(613-615)tcG>tcA	p.S205S	NGFR_ENST00000504201.1_Silent_p.S111S|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	205	Ser/Thr-rich.		S -> L (in dbSNP:rs2072446).		apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.S205S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					CAGAGGGCTCGGACAGCACAG	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18535	0.0		0.0	False		,,,				2504	0.0				p.S205S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G615A	17						.	G		1,4405	2.1+/-5.4	0,1,2202	78.0	78.0	78.0		615	-9.3	0.0	17		78	0,8600		0,0,4300	no	coding-synonymous	NGFR	NM_002507.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		205/428	47587820	1,13005	2203	4300	6503	44942819	SO:0001819	synonymous_variant	4804	exon4			M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.615G>A	17.37:g.47587820G>A			44942819	NM_002507	B2R961|B4E096	Silent	SNP	ENST00000172229.3	37	CCDS11549.1																																																																																				0.617	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
EFNB3	1949	broad.mit.edu	37	17	7611424	7611424	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr17:7611424C>T	ENST00000226091.2	+	2	668	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C		NM_001406.3	NP_001397.1	Q15768	EFNB3_HUMAN	ephrin-B3	91	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				adult walking behavior (GO:0007628)|axon choice point recognition (GO:0016198)|axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)	p.R91C(1)		large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	8		all_cancers(10;1.14e-06)|Prostate(122;0.081)				TCAGGGCCGGCGCTGTGAGGC	0.602																																					p.R91C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C271T	17						.						62.0	68.0	66.0					17																	7611424		2203	4300	6503	7552149	SO:0001583	missense	1949	exon2			U57001	CCDS11120.1	17p13.1	2011-03-09			ENSG00000108947	ENSG00000108947		"""Ephrins"""	3228	protein-coding gene	gene with protein product		602297		EPLG8		9126477	Standard	NM_001406		Approved	LERK-8	uc002gis.3	Q15768	OTTHUMG00000108161	ENST00000226091.2:c.271C>T	17.37:g.7611424C>T	ENSP00000226091:p.Arg91Cys		7552149	NM_001406	B2RBW2|D3DTQ6|O00680|Q8TBH7|Q92875	Missense_Mutation	SNP	ENST00000226091.2	37	CCDS11120.1	.	.	.	.	.	.	.	.	.	.	c	12.58	1.981039	0.34942	.	.	ENSG00000108947	ENST00000226091	D	0.93488	-3.23	4.98	4.98	0.66077	Cupredoxin (2);	0.067130	0.56097	D	0.000025	D	0.94463	0.8218	L	0.43152	1.355	0.46823	D	0.99921	D	0.89917	1.0	D	0.73708	0.981	D	0.94239	0.7483	10	0.62326	D	0.03	0.4507	12.2855	0.54789	0.1698:0.8302:0.0:0.0	.	91	Q15768	EFNB3_HUMAN	C	91	ENSP00000226091:R91C	ENSP00000226091:R91C	R	+	1	0	EFNB3	7552149	0.986000	0.35501	1.000000	0.80357	0.087000	0.18053	0.509000	0.22707	2.576000	0.86940	0.574000	0.79327	CGC		0.602	EFNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226965.1	NM_001406	
SOX9	6662	broad.mit.edu	37	17	70120103	70120103	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr17:70120103C>T	ENST00000245479.2	+	3	1477	c.1105C>T	c.(1105-1107)Cag>Tag	p.Q369*		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	369	Gln/Pro-rich.				astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q369*(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			gcccccacagcagccggcggc	0.771																																					p.Q369X	Pancreas(42;83 1041 2320 35205 39456)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1105T	17						.						8.0	11.0	10.0					17																	70120103		2143	4198	6341	67631698	SO:0001587	stop_gained	6662	exon3			S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1105C>T	17.37:g.70120103C>T	ENSP00000245479:p.Gln369*		67631698	NM_000346	Q53Y80	Nonsense_Mutation	SNP	ENST00000245479.2	37	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	C	37	6.225287	0.97390	.	.	ENSG00000125398	ENST00000245479	.	.	.	3.84	2.83	0.33086	.	1.206400	0.06266	U	0.694773	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	10.8696	0.46875	0.0:0.8066:0.1934:0.0	.	.	.	.	X	369	.	ENSP00000245479:Q369X	Q	+	1	0	SOX9	67631698	0.013000	0.17824	0.197000	0.23402	0.224000	0.24922	0.000000	0.12993	0.558000	0.29135	0.462000	0.41574	CAG		0.771	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
SLC14A1	6563	broad.mit.edu	37	18	43316498	43316498	+	Missense_Mutation	SNP	C	C	T	rs367901541		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr18:43316498C>T	ENST00000321925.4	+	6	780	c.548C>T	c.(547-549)gCg>gTg	p.A183V	RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000402943.2_Missense_Mutation_p.A78V|SLC14A1_ENST00000591541.1_5'Flank|SLC14A1_ENST00000535474.1_Missense_Mutation_p.A51V|SLC14A1_ENST00000436407.3_Missense_Mutation_p.A239V|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000415427.3_Missense_Mutation_p.A239V|SLC14A1_ENST00000586142.1_Missense_Mutation_p.A183V|SLC14A1_ENST00000591943.1_Intron|SLC14A1_ENST00000589700.1_Missense_Mutation_p.A183V|SLC14A1_ENST00000502059.2_Missense_Mutation_p.A75V	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	183					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)	p.A183V(2)|p.A239V(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						TTCAACATGGCGTTGTCAATG	0.443																																					p.A183V												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.C548T	18						.	C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	167.0	147.0	154.0		716,548,716,548	4.7	0.9	18		154	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SLC14A1	NM_001128588.3,NM_001146036.2,NM_001146037.1,NM_015865.6	64,64,64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign	239/446,183/390,239/446,183/390	43316498	1,13005	2203	4300	6503	41570496	SO:0001583	missense	6563	exon6			BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.548C>T	18.37:g.43316498C>T	ENSP00000318546:p.Ala183Val		41570496	NM_015865	A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Missense_Mutation	SNP	ENST00000321925.4	37	CCDS11925.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.482152	0.44147	0.0	1.16E-4	ENSG00000141469	ENST00000321925;ENST00000415427;ENST00000502059;ENST00000402943;ENST00000535474;ENST00000436407	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	5.51	4.65	0.58169	.	0.306075	0.32624	N	0.005848	T	0.39809	0.1092	M	0.66297	2.02	0.80722	D	1	B;B;P	0.46277	0.333;0.133;0.875	B;B;B	0.41332	0.061;0.03;0.354	T	0.36407	-0.9749	10	0.08381	T	0.77	-3.2679	14.4418	0.67323	0.0:0.9294:0.0:0.0706	.	239;75;183	Q13336-2;B3KXJ3;Q13336	.;.;UT1_HUMAN	V	183;239;75;78;51;239	ENSP00000318546:A183V;ENSP00000412309:A239V;ENSP00000442180:A75V;ENSP00000385320:A78V;ENSP00000441998:A51V;ENSP00000390637:A239V	ENSP00000318546:A183V	A	+	2	0	SLC14A1	41570496	0.999000	0.42202	0.869000	0.34112	0.894000	0.52154	3.996000	0.57009	1.344000	0.45657	0.650000	0.86243	GCG		0.443	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865	
DSEL	92126	broad.mit.edu	37	18	65181497	65181497	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr18:65181497A>C	ENST00000310045.7	-	2	1852	c.379T>G	c.(379-381)Tgg>Ggg	p.W127G	RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	117					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.W127G(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				ATTTCATTCCACTTGGCAGCA	0.398																																					p.W127G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T379G	18						.						114.0	101.0	106.0					18																	65181497		2203	4300	6503	63332477	SO:0001583	missense	92126	exon2			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.379T>G	18.37:g.65181497A>C	ENSP00000310565:p.Trp127Gly		63332477	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386726	0.82902	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.23552	1.9	4.79	4.79	0.61399	.	0.000000	0.85682	U	0.000000	T	0.50922	0.1644	M	0.75777	2.31	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.56312	-0.8000	10	0.72032	D	0.01	-6.2316	14.6496	0.68786	1.0:0.0:0.0:0.0	.	117	Q8IZU8	DSEL_HUMAN	G	127;117	ENSP00000310565:W127G	ENSP00000310565:W127G	W	-	1	0	DSEL	63332477	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.057000	0.93889	1.937000	0.56155	0.459000	0.35465	TGG		0.398	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
CYP2A13	1553	broad.mit.edu	37	19	41597792	41597792	+	Silent	SNP	C	C	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr19:41597792C>G	ENST00000330436.3	+	5	810	c.810C>G	c.(808-810)tcC>tcG	p.S270S		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	270					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.S270S(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	TCATCGACTCCTTTCTCATCC	0.592																																					p.S270S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C810G	19						.						139.0	108.0	119.0					19																	41597792		2203	4300	6503	46289632	SO:0001819	synonymous_variant	1553	exon5			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.810C>G	19.37:g.41597792C>G			46289632	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	ENST00000330436.3	37	CCDS12571.1																																																																																				0.592	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
PAFAH1B3	5050	broad.mit.edu	37	19	42801507	42801507	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr19:42801507G>A	ENST00000262890.3	-	5	680	c.419C>T	c.(418-420)cCg>cTg	p.P140L	PAFAH1B3_ENST00000538771.1_Missense_Mutation_p.P140L	NM_002573.3	NP_002564.1	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)	140					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)	p.P140L(1)		breast(1)|large_intestine(2)|ovary(1)	4		Prostate(69;0.0704)				TTGGCCTCGCGGAAGCAGGCC	0.582																																					p.P140L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C419T	19						.						61.0	57.0	58.0					19																	42801507		2203	4300	6503	47493347	SO:0001583	missense	5050	exon5			D63391	CCDS12602.1	19q13.1	2011-10-24	2010-02-10			ENSG00000079462			8576	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 1 subunit"""	603074	"""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit (29kD)"", ""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa)"""			7669037	Standard	NM_002573		Approved		uc010xwj.1	Q15102		ENST00000262890.3:c.419C>T	19.37:g.42801507G>A	ENSP00000262890:p.Pro140Leu		47493347	NM_002573	Q53X88	Missense_Mutation	SNP	ENST00000262890.3	37	CCDS12602.1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.862764	0.71949	.	.	ENSG00000079462	ENST00000538771;ENST00000262890	T;T	0.56103	0.48;0.48	5.93	5.93	0.95920	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.054076	0.85682	N	0.000000	T	0.81602	0.4857	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86347	0.1708	10	0.87932	D	0	-14.1733	17.8376	0.88704	0.0:0.0:1.0:0.0	.	140	Q15102	PA1B3_HUMAN	L	140	ENSP00000444935:P140L;ENSP00000262890:P140L	ENSP00000262890:P140L	P	-	2	0	PAFAH1B3	47493347	1.000000	0.71417	0.981000	0.43875	0.112000	0.19704	9.460000	0.97641	2.815000	0.96918	0.561000	0.74099	CCG		0.582	PAFAH1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463726.1	NM_002573	
PLEKHA4	57664	broad.mit.edu	37	19	49348687	49348687	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr19:49348687C>G	ENST00000263265.6	-	16	2238	c.1683G>C	c.(1681-1683)agG>agC	p.R561S	PLEKHA4_ENST00000355496.5_Missense_Mutation_p.R536S	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	561						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)	p.R561S(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CCCGGGAGACCCTCGGAGACC	0.577																																					p.R561S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1683C	19						.						87.0	92.0	90.0					19																	49348687		2203	4300	6503	54040499	SO:0001583	missense	57664	exon16			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1683G>C	19.37:g.49348687C>G	ENSP00000263265:p.Arg561Ser		54040499	NM_020904	Q8N4M8|Q8N658	Missense_Mutation	SNP	ENST00000263265.6	37	CCDS12737.1	.	.	.	.	.	.	.	.	.	.	c	11.73	1.724428	0.30593	.	.	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.25250	1.81;1.81	4.97	1.33	0.21861	.	0.889799	0.09388	N	0.808988	T	0.14787	0.0357	L	0.27053	0.805	0.09310	N	1	B;B	0.34290	0.447;0.003	B;B	0.33690	0.168;0.002	T	0.26189	-1.0110	10	0.22109	T	0.4	.	4.1996	0.10460	0.1811:0.6256:0.0:0.1933	.	536;561	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	S	561;536	ENSP00000263265:R561S;ENSP00000347683:R536S	ENSP00000263265:R561S	R	-	3	2	PLEKHA4	54040499	0.000000	0.05858	0.073000	0.20177	0.653000	0.38743	-0.433000	0.06948	0.746000	0.32786	0.544000	0.68410	AGG		0.577	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466216.1		
ZNF561	93134	broad.mit.edu	37	19	9724724	9724724	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr19:9724724C>A	ENST00000302851.3	-	5	660	c.297G>T	c.(295-297)aaG>aaT	p.K99N	ZNF561_ENST00000326044.5_Intron|ZNF561_ENST00000424629.1_Missense_Mutation_p.K30N|ZNF561_ENST00000495503.1_5'UTR|ZNF561_ENST00000354661.4_Intron	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561	99	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K30N(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						ATATTTGATTCTTCAAAAAAC	0.333																																					p.K99N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G297T	19						.						129.0	128.0	128.0					19																	9724724		2203	4300	6503	9585724	SO:0001583	missense	93134	exon5			AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.297G>T	19.37:g.9724724C>A	ENSP00000303915:p.Lys99Asn		9585724	NM_152289	B4E2Q8|Q6PJS0	Missense_Mutation	SNP	ENST00000302851.3	37	CCDS12216.2	.	.	.	.	.	.	.	.	.	.	C	6.619	0.482654	0.12581	.	.	ENSG00000171469	ENST00000424629;ENST00000302851;ENST00000444611	T;T;T	0.08720	3.06;3.16;3.77	1.69	-0.679	0.11350	Krueppel-associated box (2);	.	.	.	.	T	0.09642	0.0237	N	0.16708	0.43	0.09310	N	1	D	0.57899	0.981	D	0.67231	0.95	T	0.32534	-0.9903	9	0.21540	T	0.41	.	4.0789	0.09917	0.0:0.5732:0.0:0.4268	.	99	Q8N587	ZN561_HUMAN	N	30;99;105	ENSP00000393074:K30N;ENSP00000303915:K99N;ENSP00000392013:K105N	ENSP00000303915:K99N	K	-	3	2	ZNF561	9585724	0.000000	0.05858	0.000000	0.03702	0.235000	0.25334	-1.186000	0.03070	-0.107000	0.12088	0.313000	0.20887	AAG		0.333	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347272.2	NM_152289	
CACNG6	59285	broad.mit.edu	37	19	54515329	54515329	+	Silent	SNP	C	C	T	rs199614002		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr19:54515329C>T	ENST00000252729.2	+	4	1259	c.669C>T	c.(667-669)tgC>tgT	p.C223C	CACNG6_ENST00000352529.1_Silent_p.C152C|CACNG6_ENST00000346968.2_Silent_p.C177C	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	223					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.C223C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CCCTGGGCTGCGGCGTGGGGG	0.706																																					p.C177C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C531T	19						.						23.0	28.0	26.0					19																	54515329		2195	4278	6473	59207141	SO:0001819	synonymous_variant	59285	exon3			AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.669C>T	19.37:g.54515329C>T			59207141	NM_145815		Silent	SNP	ENST00000252729.2	37	CCDS12870.1																																																																																				0.706	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139359.1		
ZNF593	51042	broad.mit.edu	37	1	26497149	26497149	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:26497149G>A	ENST00000374266.5	+	3	460	c.347G>A	c.(346-348)cGg>cAg	p.R116Q	RP11-96L14.7_ENST00000433939.1_RNA|RP11-96L14.7_ENST00000444682.1_RNA|ZNF593_ENST00000270812.5_Silent_p.A147A|RP11-96L14.7_ENST00000407889.2_RNA|RP11-96L14.7_ENST00000448923.1_RNA|RP11-96L14.7_ENST00000414762.1_RNA	NM_015871.4	NP_056955.2	O00488	ZN593_HUMAN	zinc finger protein 593	116					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)	p.R116Q(1)		large_intestine(4)|prostate(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCCCAGGCGGCTGGCAGTG	0.597																																					p.R116Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G347A	1						.						76.0	79.0	78.0					1																	26497149		2203	4300	6503	26369736	SO:0001583	missense	51042	exon3			D45213	CCDS275.2	1p35.3	2012-10-05			ENSG00000142684	ENSG00000142684			30943	protein-coding gene	gene with protein product						9115366	Standard	NM_015871		Approved	ZT86	uc001bll.4	O00488	OTTHUMG00000007538	ENST00000374266.5:c.347G>A	1.37:g.26497149G>A	ENSP00000363384:p.Arg116Gln		26369736	NM_015871	B2R4S0|Q5T2H7	Missense_Mutation	SNP	ENST00000374266.5	37	CCDS275.2	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862309	0.32884	.	.	ENSG00000142684	ENST00000374266	T	0.43688	0.94	5.27	3.27	0.37495	.	0.447922	0.24447	N	0.038441	T	0.28067	0.0692	L	0.38175	1.15	0.47819	D	0.999522	B	0.25105	0.118	B	0.20577	0.03	T	0.10222	-1.0639	10	0.39692	T	0.17	-16.4282	5.4111	0.16349	0.1121:0.0:0.5407:0.3472	.	116	O00488	ZN593_HUMAN	Q	116	ENSP00000363384:R116Q	ENSP00000363384:R116Q	R	+	2	0	ZNF593	26369736	0.231000	0.23751	0.760000	0.31359	0.036000	0.12997	1.871000	0.39539	1.354000	0.45846	-0.169000	0.13324	CGG		0.597	ZNF593-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019842.2	NM_015871	
ARID1A	8289	broad.mit.edu	37	1	27105553	27105553	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:27105553C>T	ENST00000324856.7	+	20	5535	c.5164C>T	c.(5164-5166)Cga>Tga	p.R1722*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.R1505*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.R1339*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.R50*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1722					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R1722*(5)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATATTTCCGACGATGCCTGAT	0.443			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R1722X			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	5	Substitution - Nonsense(5)	large_intestine(2)|ovary(1)|stomach(1)|endometrium(1)	c.C5164T	1						.						181.0	199.0	193.0					1																	27105553		2203	4300	6503	26978140	SO:0001587	stop_gained	8289	exon20			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5164C>T	1.37:g.27105553C>T	ENSP00000320485:p.Arg1722*		26978140	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.312365|9.312365	0.99133|0.99133	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|.	.|.	.|.	4.71|4.71	2.75|2.75	0.32379|0.32379	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.68421	.|0.2999	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.66614	.|-0.5879	.|4	0.02654|.	T|.	1|.	-5.1918|-5.1918	13.8273|13.8273	0.63359|0.63359	0.2773:0.7227:0.0:0.0|0.2773:0.7227:0.0:0.0	.|.	.|.	.|.	.|.	X|M	1722;1505;1339;50|618	.|.	ENSP00000320485:R1722X|.	R|T	+|+	1|2	2|0	ARID1A|ARID1A	26978140|26978140	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.362000|4.362000	0.59467|0.59467	0.659000|0.659000	0.30945|0.30945	0.591000|0.591000	0.81541|0.81541	CGA|ACG		0.443	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CSMD2	114784	broad.mit.edu	37	1	33999486	33999486	+	Missense_Mutation	SNP	G	G	A	rs143597727		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:33999486G>A	ENST00000373381.4	-	63	10077	c.9901C>T	c.(9901-9903)Cgt>Tgt	p.R3301C		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R3157C(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTTTGACAACGGAAGAGGACT	0.562																																					p.R3157C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C9469T	1						.	G	CYS/ARG	0,4406		0,0,2203	137.0	116.0	123.0		9469	4.4	1.0	1	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	missense	CSMD2	NM_052896.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	3157/3488	33999486	1,13005	2203	4300	6503	33772073	SO:0001583	missense	114784	exon62			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9901C>T	1.37:g.33999486G>A	ENSP00000362479:p.Arg3301Cys		33772073	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	19.65	3.866564	0.72065	0.0	1.16E-4	ENSG00000121904	ENST00000373381	T	0.65916	-0.18	5.33	4.36	0.52297	Complement control module (2);Sushi/SCR/CCP (3);	0.324034	0.31010	N	0.008421	T	0.76905	0.4053	M	0.83012	2.62	0.80722	D	1	D;D	0.76494	0.994;0.999	P;D	0.67900	0.846;0.954	T	0.77419	-0.2595	10	0.42905	T	0.14	.	11.072	0.48008	0.0:0.0:0.664:0.336	.	3157;3301	Q7Z408;E7EUA6	CSMD2_HUMAN;.	C	3301	ENSP00000362479:R3301C	ENSP00000241312:R3157C	R	-	1	0	CSMD2	33772073	1.000000	0.71417	0.995000	0.50966	0.600000	0.36913	6.781000	0.75068	2.505000	0.84491	0.591000	0.81541	CGT		0.562	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
KDM4A	9682	broad.mit.edu	37	1	44125982	44125982	+	Missense_Mutation	SNP	C	C	T	rs200705318		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:44125982C>T	ENST00000372396.3	+	4	462	c.328C>T	c.(328-330)Cgc>Tgc	p.R110C	KDM4A_ENST00000463151.1_3'UTR	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	110					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R110C(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						CTGTACCCCACGCTATAGTGA	0.378																																					p.R110C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C328T	1						.						86.0	85.0	85.0					1																	44125982		2203	4300	6503	43898569	SO:0001583	missense	9682	exon4			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.328C>T	1.37:g.44125982C>T	ENSP00000361473:p.Arg110Cys		43898569	NM_014663	Q5VVB1	Missense_Mutation	SNP	ENST00000372396.3	37	CCDS491.1	.	.	.	.	.	.	.	.	.	.	C	32	5.168471	0.94768	.	.	ENSG00000066135	ENST00000372396	T	0.50277	0.75	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.73892	0.3645	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.70716	0.792;0.97	T	0.75932	-0.3143	10	0.72032	D	0.01	-15.0475	20.5827	0.99408	0.0:1.0:0.0:0.0	.	110;110	B4DT38;O75164	.;KDM4A_HUMAN	C	110	ENSP00000361473:R110C	ENSP00000361473:R110C	R	+	1	0	KDM4A	43898569	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.423000	0.66458	2.941000	0.99782	0.655000	0.94253	CGC		0.378	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
NSUN4	387338	broad.mit.edu	37	1	46810514	46810514	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:46810514G>C	ENST00000474844.1	+	2	785	c.135G>C	c.(133-135)ttG>ttC	p.L45F	NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_5'UTR|NSUN4_ENST00000536062.1_5'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	45					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)	p.L45F(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					GACTGGCTTTGCAGAATTTTG	0.483																																					p.L45F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G135C	1						.						161.0	160.0	160.0					1																	46810514		2203	4300	6503	46583101	SO:0001583	missense	387338	exon2			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.135G>C	1.37:g.46810514G>C	ENSP00000419740:p.Leu45Phe		46583101	NM_199044	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Missense_Mutation	SNP	ENST00000474844.1	37	CCDS534.1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750224	0.69533	.	.	ENSG00000117481	ENST00000474844	T	0.26067	1.76	5.45	1.18	0.20946	.	0.000000	0.64402	D	0.000001	T	0.47192	0.1432	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.43097	-0.9412	10	0.49607	T	0.09	-8.2124	6.9949	0.24777	0.2168:0.1247:0.6585:0.0	.	45	Q96CB9	NSUN4_HUMAN	F	45	ENSP00000419740:L45F	ENSP00000419740:L45F	L	+	3	2	NSUN4	46583101	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.748000	0.47483	0.680000	0.31366	0.563000	0.77884	TTG		0.483	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044	
PRKAA2	5563	broad.mit.edu	37	1	57161768	57161768	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:57161768G>A	ENST00000371244.4	+	6	790	c.724G>A	c.(724-726)Gcc>Acc	p.A242T		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	242	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.A242T(1)		breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	TCGTTCTGTCGCCACTCTCCT	0.418																																					p.A242T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G724A	1						.						233.0	232.0	233.0					1																	57161768		2203	4300	6503	56934356	SO:0001583	missense	5563	exon6			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.724G>A	1.37:g.57161768G>A	ENSP00000360290:p.Ala242Thr		56934356	NM_006252	Q9H1E8|Q9UD43	Missense_Mutation	SNP	ENST00000371244.4	37	CCDS605.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676777	0.67928	.	.	ENSG00000162409	ENST00000371244	T	0.65549	-0.16	5.98	5.98	0.97165	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	N	0.20483	0.58	0.80722	D	1	B	0.28400	0.21	B	0.30316	0.114	T	0.42649	-0.9439	10	0.27082	T	0.32	-13.7548	20.4434	0.99119	0.0:0.0:1.0:0.0	.	242	P54646	AAPK2_HUMAN	T	242	ENSP00000360290:A242T	ENSP00000360290:A242T	A	+	1	0	PRKAA2	56934356	0.998000	0.40836	0.987000	0.45799	0.938000	0.57974	3.912000	0.56386	2.838000	0.97847	0.655000	0.94253	GCC		0.418	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022753.2	NM_006252	
DPYD	1806	broad.mit.edu	37	1	98039426	98039426	+	Missense_Mutation	SNP	C	C	T	rs199646142		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:98039426C>T	ENST00000370192.3	-	11	1329	c.1229G>A	c.(1228-1230)cGg>cAg	p.R410Q		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	410					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.R410Q(2)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TTGCTCTGTCCGAACAAACTG	0.433																																					p.R410Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G1229A	1						.	C	GLN/ARG	0,4406		0,0,2203	201.0	169.0	180.0		1229	5.8	1.0	1		180	2,8598	2.2+/-6.3	0,2,4298	yes	missense	DPYD	NM_000110.3	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	410/1026	98039426	2,13004	2203	4300	6503	97812014	SO:0001583	missense	1806	exon11			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1229G>A	1.37:g.98039426C>T	ENSP00000359211:p.Arg410Gln		97812014	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	33	5.233382	0.95207	0.0	2.33E-4	ENSG00000188641	ENST00000370192	D	0.94897	-3.55	5.81	5.81	0.92471	.	0.059399	0.64402	D	0.000001	D	0.95472	0.8529	M	0.81682	2.555	0.80722	D	1	D	0.71674	0.998	P	0.51742	0.678	D	0.95065	0.8199	10	0.52906	T	0.07	-12.6181	17.8525	0.88751	0.0:1.0:0.0:0.0	.	410	Q12882	DPYD_HUMAN	Q	410	ENSP00000359211:R410Q	ENSP00000359211:R410Q	R	-	2	0	DPYD	97812014	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.432000	0.80349	2.737000	0.93849	0.650000	0.86243	CGG		0.433	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
RYR2	6262	broad.mit.edu	37	1	237774225	237774225	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr1:237774225G>T	ENST00000366574.2	+	36	5164	c.4847G>T	c.(4846-4848)gGc>gTc	p.G1616V	RYR2_ENST00000542537.1_Missense_Mutation_p.G1600V|RYR2_ENST00000360064.6_Missense_Mutation_p.G1614V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1616	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.G1614V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAACGCCAAGGCTGGTTGGTG	0.527																																					p.G1616V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4847T	1						.						73.0	73.0	73.0					1																	237774225		2002	4174	6176	235840848	SO:0001583	missense	6262	exon36			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4847G>T	1.37:g.237774225G>T	ENSP00000355533:p.Gly1616Val		235840848	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747140	0.89663	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98567	-5.0;-4.98;-4.99	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000019	D	0.99032	0.9669	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	D	0.99712	1.1007	10	0.87932	D	0	.	18.7848	0.91949	0.0:0.0:1.0:0.0	.	1616	Q92736	RYR2_HUMAN	V	1616;1614;1600	ENSP00000355533:G1616V;ENSP00000353174:G1614V;ENSP00000443798:G1600V	ENSP00000353174:G1614V	G	+	2	0	RYR2	235840848	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.595000	0.98260	2.658000	0.90341	0.655000	0.94253	GGC		0.527	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CSTF1	1477	broad.mit.edu	37	20	54970683	54970683	+	Silent	SNP	C	C	T	rs112830633	byFrequency	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr20:54970683C>T	ENST00000217109.4	+	2	427	c.75C>T	c.(73-75)gaC>gaT	p.D25D	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	25	Hydrophobic.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.D25D(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			TGCTATATGACGGCTACATCA	0.502													C|||	12	0.00239617	0.0083	0.0014	5008	,	,		19914	0.0		0.0	False		,,,				2504	0.0				p.D25D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C75T	20						.	C	,,	14,4392	21.2+/-45.6	0,14,2189	109.0	87.0	94.0		75,75,75	-10.0	0.1	20	dbSNP_132	94	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CSTF1	NM_001033521.1,NM_001033522.1,NM_001324.2	,,	0,14,6489	TT,TC,CC		0.0,0.3177,0.1076	,,	25/432,25/432,25/432	54970683	14,12992	2203	4300	6503	54404090	SO:0001819	synonymous_variant	1477	exon2				CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.75C>T	20.37:g.54970683C>T			54404090	NM_001033521	Q5QPD8	De_novo_Start_OutOfFrame	SNP	ENST00000217109.4	37	CCDS13452.1																																																																																				0.502	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079794.2	NM_001033521	
TIAM1	7074	broad.mit.edu	37	21	32525074	32525074	+	Silent	SNP	G	G	A	rs151124534		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr21:32525074G>A	ENST00000286827.3	-	20	3717	c.3246C>T	c.(3244-3246)gaC>gaT	p.D1082D	TIAM1_ENST00000541036.1_Silent_p.D1022D	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1082	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D1082D(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CAAAAAGCACGTCAAGCTAGA	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		19631	0.0		0.0	False		,,,				2504	0.001				p.D1082D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3246T	21						.	G		0,4406		0,0,2203	51.0	52.0	52.0		3246	-1.0	1.0	21	dbSNP_134	52	2,8598	3.0+/-9.4	0,2,4298	no	coding-synonymous	TIAM1	NM_003253.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		1082/1592	32525074	2,13004	2203	4300	6503	31446945	SO:0001819	synonymous_variant	7074	exon20				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3246C>T	21.37:g.32525074G>A			31446945	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																				0.323	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
HLCS	3141	broad.mit.edu	37	21	38309487	38309487	+	Silent	SNP	A	A	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr21:38309487A>G	ENST00000399120.1	-	5	1488	c.258T>C	c.(256-258)gcT>gcC	p.A86A	HLCS_ENST00000336648.4_Silent_p.A86A	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	86					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)	p.A86A(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CACTGTCCCCAGCAGGCTCAC	0.557																																					p.A86A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T258C	21						.						80.0	71.0	74.0					21																	38309487		2203	4300	6503	37231357	SO:0001819	synonymous_variant	3141	exon5				CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.258T>C	21.37:g.38309487A>G			37231357	NM_000411	B2RAH1|D3DSG6|Q99451	Silent	SNP	ENST00000399120.1	37	CCDS13647.1																																																																																				0.557	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
PI4KA	5297	broad.mit.edu	37	22	21115649	21115649	+	Missense_Mutation	SNP	G	G	A	rs202070171		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr22:21115649G>A	ENST00000572273.1	-	23	2790	c.2560C>T	c.(2560-2562)Cgc>Tgc	p.R854C	PI4KA_ENST00000255882.6_Missense_Mutation_p.R912C|PI4KA_ENST00000466162.1_5'UTR			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	854					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.R854C(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			ACCTGGAAGCGATCAGGATCT	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		20116	0.001		0.0	False		,,,				2504	0.0				p.R854C	GBM(136;1332 1831 3115 23601 50806)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2560T	22						.						102.0	92.0	95.0					22																	21115649		2203	4300	6503	19445649	SO:0001583	missense	5297	exon23			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.2560C>T	22.37:g.21115649G>A	ENSP00000458238:p.Arg854Cys		19445649	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.63	3.664681	0.67700	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	L	0.36672	1.1	0.80722	D	1	B	0.30824	0.296	B	0.20767	0.031	T	0.48281	-0.9049	9	0.48119	T	0.1	-25.0446	19.1301	0.93402	0.0:0.0:1.0:0.0	.	854	P42356	PI4KA_HUMAN	C	854	.	ENSP00000255882:R854C	R	-	1	0	PI4KA	19445649	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.593000	0.61034	2.767000	0.95098	0.655000	0.94253	CGC		0.378	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
MYO18B	84700	broad.mit.edu	37	22	26343729	26343729	+	Missense_Mutation	SNP	C	C	T	rs368617132		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr22:26343729C>T	ENST00000407587.2	+	36	5855	c.5686C>T	c.(5686-5688)Cgc>Tgc	p.R1896C	MYO18B_ENST00000335473.7_Missense_Mutation_p.R1895C|MYO18B_ENST00000536101.1_Missense_Mutation_p.R1895C			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1895	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.R1896C(1)		NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CCTCCTGAAGCGCATCGATGA	0.557																																					p.R1895C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5683T	22						.	C	CYS/ARG	1,4211		0,1,2105	67.0	69.0	69.0		5683	5.1	1.0	22		69	0,8466		0,0,4233	no	missense	MYO18B	NM_032608.5	180	0,1,6338	TT,TC,CC		0.0,0.0237,0.0079	probably-damaging	1895/2568	26343729	1,12677	2106	4233	6339	24673729	SO:0001583	missense	84700	exon36			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5686C>T	22.37:g.26343729C>T	ENSP00000386096:p.Arg1896Cys		24673729	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	17.87	3.494010	0.64186	2.37E-4	0.0	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.88354	-2.34;-2.34;-2.37	5.06	5.06	0.68205	.	0.151245	0.42172	D	0.000759	D	0.93061	0.7791	M	0.76328	2.33	0.48975	D	0.999736	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;P;D;D	0.65874	0.917;0.87;0.917;0.939	D	0.93566	0.6899	10	0.87932	D	0	.	12.1623	0.54110	0.1711:0.8289:0.0:0.0	.	1408;1895;1896;1895	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	C	1895;1895;1896	ENSP00000441229:R1895C;ENSP00000334563:R1895C;ENSP00000386096:R1896C	ENSP00000334563:R1895C	R	+	1	0	MYO18B	24673729	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	2.123000	0.41996	2.360000	0.80028	0.655000	0.94253	CGC		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
RNF215	200312	broad.mit.edu	37	22	30776099	30776099	+	Silent	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr22:30776099C>T	ENST00000382363.3	-	7	1034	c.960G>A	c.(958-960)ccG>ccA	p.P320P	RP1-130H16.16_ENST00000332468.4_RNA	NM_001017981.1	NP_001017981.1	Q9Y6U7	RN215_HUMAN	ring finger protein 215	320						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.P320P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)	6						TCTCAGCACCCGGATCTGGGA	0.642																																					p.P320P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G960A	22						.						64.0	73.0	70.0					22																	30776099		2203	4300	6503	29106099	SO:0001819	synonymous_variant	200312	exon7				CCDS33633.1	22q12.2	2013-01-09			ENSG00000099999	ENSG00000099999		"""RING-type (C3HC4) zinc fingers"""	33434	protein-coding gene	gene with protein product							Standard	NM_001017981		Approved		uc003ahp.3	Q9Y6U7	OTTHUMG00000151016	ENST00000382363.3:c.960G>A	22.37:g.30776099C>T			29106099	NM_001017981	A6NEL1	Silent	SNP	ENST00000382363.3	37	CCDS33633.1	.	.	.	.	.	.	.	.	.	.	C	0.074	-1.195768	0.01594	.	.	ENSG00000099999	ENST00000215798	.	.	.	3.71	-7.42	0.01388	.	.	.	.	.	T	0.52322	0.1727	.	.	.	0.42395	D	0.992543	.	.	.	.	.	.	T	0.58607	-0.7607	4	.	.	.	-23.0055	11.1364	0.48377	0.1549:0.5944:0.2507:0.0	.	.	.	.	R	258	.	.	G	-	1	0	RNF215	29106099	0.000000	0.05858	0.005000	0.12908	0.008000	0.06430	-4.557000	0.00216	-2.128000	0.00818	-0.397000	0.06425	GGG		0.642	RNF215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320960.1	NM_001017981	
L3MBTL2	83746	broad.mit.edu	37	22	41625556	41625556	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr22:41625556C>T	ENST00000216237.5	+	16	2059	c.1901C>T	c.(1900-1902)cCg>cTg	p.P634L	CHADL_ENST00000216241.9_3'UTR	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	634					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.P634L(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AAAAGAATCCCGCCCACTAAG	0.542																																					p.P634L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1901T	22						.						46.0	48.0	48.0					22																	41625556		2203	4300	6503	39955502	SO:0001583	missense	83746	exon16			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1901C>T	22.37:g.41625556C>T	ENSP00000216237:p.Pro634Leu		39955502	NM_031488	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817607	0.32145	.	.	ENSG00000100395	ENST00000216237	T	0.16897	2.31	4.41	2.33	0.28932	.	0.249318	0.34178	N	0.004200	T	0.07728	0.0194	N	0.24115	0.695	0.24165	N	0.995645	P	0.39782	0.688	B	0.27715	0.082	T	0.26950	-1.0088	10	0.48119	T	0.1	.	5.9839	0.19423	0.0:0.6807:0.0:0.3193	.	634	Q969R5	LMBL2_HUMAN	L	634	ENSP00000216237:P634L	ENSP00000216237:P634L	P	+	2	0	L3MBTL2	39955502	0.319000	0.24607	0.375000	0.26029	0.830000	0.47004	1.855000	0.39378	0.798000	0.33994	0.650000	0.86243	CCG		0.542	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
PXDN	7837	broad.mit.edu	37	2	1667459	1667459	+	Silent	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:1667459G>A	ENST00000252804.4	-	12	1535	c.1485C>T	c.(1483-1485)caC>caT	p.H495H	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	495	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.H495H(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGCCCTGGTCGTGGAGGGCAA	0.622																																					p.H495H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1485T	2						.						82.0	90.0	88.0					2																	1667459		2051	4171	6222	1646466	SO:0001819	synonymous_variant	7837	exon12			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1485C>T	2.37:g.1667459G>A			1646466	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	2.695	-0.272295	0.05716	.	.	ENSG00000130508	ENST00000433670	.	.	.	5.79	-10.5	0.00291	.	.	.	.	.	T	0.72053	0.3413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79296	-0.1862	4	.	.	.	-37.822	22.7105	0.99975	0.8558:0.0:0.1442:0.0	.	.	.	.	M	491	.	.	T	-	2	0	PXDN	1646466	0.489000	0.26004	0.089000	0.20774	0.333000	0.28666	-0.105000	0.10907	-2.393000	0.00584	-1.202000	0.01658	ACG		0.622	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
BUB1	699	broad.mit.edu	37	2	111431795	111431795	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:111431795T>C	ENST00000302759.6	-	3	211	c.93A>G	c.(91-93)atA>atG	p.I31M	BUB1_ENST00000409311.1_Missense_Mutation_p.I31M|BUB1_ENST00000535254.1_Missense_Mutation_p.I11M	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	31	BUB1 N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00822}.|Necessary for kinetochore localization.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I31M(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		CTACCCACTGTATGTATCTAG	0.299																																					p.I31M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A93G	2						.						63.0	66.0	65.0					2																	111431795		2201	4300	6501	111148266	SO:0001583	missense	699	exon3			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.93A>G	2.37:g.111431795T>C	ENSP00000302530:p.Ile31Met		111148266	NM_004336	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	37	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.387893	0.25031	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432;ENST00000447014;ENST00000420328;ENST00000436916	T;T;T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53;-0.53;-0.53	5.43	-3.12	0.05282	Mad3/BUB1 homology region 1 (3);	0.470132	0.24323	N	0.039529	T	0.57888	0.2084	L	0.51422	1.61	0.25072	N	0.990982	B;B;B	0.15930	0.002;0.015;0.009	B;B;B	0.25759	0.008;0.04;0.063	T	0.50039	-0.8874	10	0.45353	T	0.12	-0.7592	7.1156	0.25414	0.1167:0.332:0.0:0.5513	.	11;31;31	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	M	11;31;31;31;22;22;22	ENSP00000441013:I11M;ENSP00000386701:I31M;ENSP00000302530:I31M;ENSP00000402883:I22M;ENSP00000409713:I22M;ENSP00000392219:I22M	ENSP00000302530:I31M	I	-	3	3	BUB1	111148266	0.001000	0.12720	0.362000	0.25862	0.930000	0.56654	-1.248000	0.02890	-0.509000	0.06532	-0.375000	0.07067	ATA		0.299	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331925.1	NM_004336	
TTN	7273	broad.mit.edu	37	2	179559340	179559340	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:179559340A>T	ENST00000591111.1	-	115	30685	c.30461T>A	c.(30460-30462)gTt>gAt	p.V10154D	TTN_ENST00000589042.1_Missense_Mutation_p.V10471D|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V9227D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V9227D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTCAATAACTTCTTCCTG	0.303																																					p.V9227D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T27680A	2						.						27.0	25.0	26.0					2																	179559340		1788	4038	5826	179267585	SO:0001583	missense	7273	exon114			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30461T>A	2.37:g.179559340A>T	ENSP00000465570:p.Val10154Asp		179267585	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	16.57	3.158892	0.57368	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T	0.71817	-0.6	6.07	4.93	0.64822	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.59418	0.2192	N	0.08118	0	0.80722	D	1	B;P	0.45212	0.145;0.853	B;P	0.49999	0.063;0.628	T	0.65274	-0.6208	9	0.87932	D	0	.	9.7816	0.40651	0.9218:0.0:0.0782:0.0	.	10154;10154	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	D	9227;349	ENSP00000343764:V9227D	ENSP00000343764:V9227D	V	-	2	0	TTN	179267585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.290000	0.51755	1.128000	0.42052	0.533000	0.62120	GTT		0.303	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SESTD1	91404	broad.mit.edu	37	2	179982297	179982297	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:179982297T>G	ENST00000428443.3	-	14	1802	c.1486A>C	c.(1486-1488)Atg>Ctg	p.M496L		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	496							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.M496L(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			AACTGCACCATCTGAAGCATC	0.338																																					p.M496L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1486C	2						.						190.0	163.0	173.0					2																	179982297		2203	4300	6503	179690542	SO:0001583	missense	91404	exon14			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.1486A>C	2.37:g.179982297T>G	ENSP00000415332:p.Met496Leu		179690542	NM_178123	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	ENST00000428443.3	37	CCDS33338.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447503	0.43429	.	.	ENSG00000187231	ENST00000428443	T	0.31769	1.48	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.19366	0.0465	N	0.14661	0.345	0.58432	D	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.07385	-1.0775	9	.	.	.	-21.3053	15.2453	0.73502	0.0:0.0:0.0:1.0	.	496	Q86VW0	SESD1_HUMAN	L	496	ENSP00000415332:M496L	.	M	-	1	0	SESTD1	179690542	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.345000	0.79337	2.080000	0.62538	0.477000	0.44152	ATG		0.338	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335916.2	NM_178123	
RSAD2	91543	broad.mit.edu	37	2	7030441	7030441	+	Silent	SNP	T	T	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:7030441T>C	ENST00000382040.3	+	4	1009	c.873T>C	c.(871-873)ccT>ccC	p.P291P	RSAD2_ENST00000541728.1_Silent_p.P184P	NM_080657.4	NP_542388.2			radical S-adenosyl methionine domain containing 2									p.P291P(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)	20	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		GCTTGGTGCCTGAATCTAACC	0.413																																					p.P291P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T873C	2						.						91.0	88.0	89.0					2																	7030441		2203	4300	6503	6947892	SO:0001819	synonymous_variant	91543	exon4			AF442151	CCDS1656.1	2p25.2	2008-02-05			ENSG00000134321	ENSG00000134321			30908	protein-coding gene	gene with protein product		607810				11752458	Standard	NM_080657		Approved	cig5, viperin, vig1	uc002qyp.1	Q8WXG1	OTTHUMG00000090352	ENST00000382040.3:c.873T>C	2.37:g.7030441T>C			6947892	NM_080657		Silent	SNP	ENST00000382040.3	37	CCDS1656.1																																																																																				0.413	RSAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206724.2	NM_080657	
BRE	9577	broad.mit.edu	37	2	28248112	28248112	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:28248112C>T	ENST00000342045.2	+	6	461	c.320C>T	c.(319-321)cCt>cTt	p.P107L	BRE_ENST00000344773.2_Missense_Mutation_p.P107L|BRE_ENST00000379632.2_Missense_Mutation_p.P107L|BRE_ENST00000379624.1_Missense_Mutation_p.P107L|BRE_ENST00000603461.1_3'UTR|BRE_ENST00000361704.2_Missense_Mutation_p.P107L	NM_199194.2	NP_954664.1			brain and reproductive organ-expressed (TNFRSF1A modulator)									p.P107L(2)		NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					TCCTGGAATCCTTCAAATCCT	0.408																																					p.P107L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C320T	2						.						103.0	114.0	111.0					2																	28248112		2202	4300	6502	28101616	SO:0001583	missense	9577	exon6			AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000342045.2:c.320C>T	2.37:g.28248112C>T	ENSP00000339371:p.Pro107Leu		28101616	NM_199193		Missense_Mutation	SNP	ENST00000342045.2	37	CCDS1763.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520412	0.64747	.	.	ENSG00000158019	ENST00000436924;ENST00000344773;ENST00000379624;ENST00000342045;ENST00000379632;ENST00000361704;ENST00000379629;ENST00000379623	.	.	.	5.7	5.7	0.88788	.	0.053968	0.85682	D	0.000000	T	0.56093	0.1962	L	0.41824	1.3	0.80722	D	1	P;B;P;B	0.47910	0.902;0.224;0.557;0.187	B;B;B;B	0.44133	0.442;0.096;0.125;0.058	T	0.55774	-0.8088	9	0.42905	T	0.14	-15.9175	19.8379	0.96666	0.0:1.0:0.0:0.0	.	107;107;107;107	Q9NXR7-1;Q9NXR7;Q9NXR7-4;Q9NXR7-3	.;BRE_HUMAN;.;.	L	107;107;107;107;107;107;107;9	.	ENSP00000339371:P107L	P	+	2	0	BRE	28101616	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.085000	0.76875	2.694000	0.91930	0.555000	0.69702	CCT		0.408	BRE-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215114.1		
NRXN1	9378	broad.mit.edu	37	2	50699461	50699461	+	Silent	SNP	G	G	A	rs563089155		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:50699461G>A	ENST00000406316.2	-	16	4695	c.3219C>T	c.(3217-3219)aaC>aaT	p.N1073N	NRXN1_ENST00000406859.3_Silent_p.N1073N|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000404971.1_Silent_p.N1113N|NRXN1_ENST00000405472.3_Silent_p.N1065N|NRXN1_ENST00000401669.2_Silent_p.N1073N|NRXN1_ENST00000401710.1_Silent_p.N82N|NRXN1_ENST00000402717.3_Silent_p.N1065N	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1073	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.N1073N(1)|p.N1114N(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CGATCTGTCCGTTGCAGAAAA	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		16575	0.001		0.0	False		,,,				2504	0.0				p.N1113N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3339T	2						.						83.0	78.0	79.0					2																	50699461		1864	4114	5978	50552965	SO:0001819	synonymous_variant	9378	exon17			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3219C>T	2.37:g.50699461G>A			50552965	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1																																																																																				0.433	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
GPR75	10936	broad.mit.edu	37	2	54080575	54080575	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:54080575T>G	ENST00000394705.2	-	2	1589	c.1319A>C	c.(1318-1320)aAa>aCa	p.K440T	ASB3_ENST00000498475.2_Intron|ASB3_ENST00000406625.2_Intron|GPR75-ASB3_ENST00000352846.3_Intron	NM_006794.3	NP_006785.1	O95800	GPR75_HUMAN	G protein-coupled receptor 75	440					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of neuron death (GO:1901214)	integral component of plasma membrane (GO:0005887)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)	p.K440T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTCCACAAATTTCTTCTGTGG	0.473																																					p.K440T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1319C	2						.						118.0	114.0	115.0					2																	54080575		2203	4300	6503	53934079	SO:0001583	missense	10936	exon2			AF101472	CCDS1849.1	2p16	2012-08-21			ENSG00000119737	ENSG00000119737		"""GPCR / Class A : Orphans"""	4526	protein-coding gene	gene with protein product		606704				10381362	Standard	NM_006794		Approved	WI-31133	uc002rxo.3	O95800	OTTHUMG00000129280	ENST00000394705.2:c.1319A>C	2.37:g.54080575T>G	ENSP00000378195:p.Lys440Thr		53934079	NM_006794	B2RC02|Q6NWR2	Missense_Mutation	SNP	ENST00000394705.2	37	CCDS1849.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.602255	0.46423	.	.	ENSG00000119737	ENST00000394705	T	0.27720	1.65	4.99	4.99	0.66335	.	0.049284	0.85682	D	0.000000	T	0.47838	0.1467	.	.	.	0.53688	D	0.999979	D	0.63880	0.993	P	0.56343	0.796	T	0.48969	-0.8987	9	0.52906	T	0.07	-9.698	15.1378	0.72583	0.0:0.0:0.0:1.0	.	440	O95800	GPR75_HUMAN	T	440	ENSP00000378195:K440T	ENSP00000378195:K440T	K	-	2	0	GPR75	53934079	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.840000	0.48215	2.224000	0.72417	0.459000	0.35465	AAA		0.473	GPR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251403.2		
TTN	7273	broad.mit.edu	37	2	179399547	179399548	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:179399547_179399548delCT	ENST00000591111.1	-	308	97095_97096	c.96871_96872delAG	c.(96871-96873)agtfs	p.S32291fs	TTN_ENST00000589042.1_Frame_Shift_Del_p.S33932fs|TTN_ENST00000342992.6_Frame_Shift_Del_p.S31364fs|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN_ENST00000342175.6_Frame_Shift_Del_p.S25059fs|TTN_ENST00000460472.2_Frame_Shift_Del_p.S24867fs|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000359218.5_Frame_Shift_Del_p.S24992fs|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32291	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.H24993fs*1(1)|p.H31363fs*1(1)|p.H25060fs*1(1)|p.H24868fs*1(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATATTATGACTGTGTAAAAAC	0.351																																					p.24866_24867del												.	.	4	Deletion - Frameshift(4)	large_intestine(4)	c.74598_74599del	2						.																																			179107794	SO:0001589	frameshift_variant	7273	exon186			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96871_96872delAG	2.37:g.179399547_179399548delCT	ENSP00000465570:p.Ser32291fs		179107793	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37																																																																																					0.351	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SLC4A3	6508	broad.mit.edu	37	2	220502425	220502425	+	Silent	SNP	G	G	A	rs61753431	byFrequency	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr2:220502425G>A	ENST00000358055.3	+	17	3170	c.2658G>A	c.(2656-2658)ccG>ccA	p.P886P	SLC4A3_ENST00000373760.2_Silent_p.P886P|SLC4A3_ENST00000273063.6_Silent_p.P913P|SLC4A3_ENST00000317151.3_Silent_p.P886P|SLC4A3_ENST00000373762.3_Silent_p.P913P			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	886	Membrane (anion exchange).			SPR -> GPE (in Ref. 2; AAB05850). {ECO:0000305}.	bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)	p.P913P(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCCCAGCCCGAGGAACCAGC	0.647													G|||	21	0.00419329	0.0151	0.0014	5008	,	,		18214	0.0		0.0	False		,,,				2504	0.0				p.P886P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2658A	2						.	G	,	65,4341	60.5+/-97.4	0,65,2138	65.0	52.0	57.0		2658,2739	-9.1	0.0	2	dbSNP_129	57	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SLC4A3	NM_005070.3,NM_201574.2	,	0,65,6438	AA,AG,GG		0.0,1.4753,0.4998	,	886/1233,913/1260	220502425	65,12941	2203	4300	6503	220210669	SO:0001819	synonymous_variant	6508	exon17				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2658G>A	2.37:g.220502425G>A			220210669	NM_005070	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	37	CCDS2445.1																																																																																				0.647	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
PLCXD2	257068	broad.mit.edu	37	3	111564679	111564679	+	3'UTR	SNP	T	T	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr3:111564679T>A	ENST00000477665.1	+	0	1287				PHLDB2_ENST00000393923.3_5'UTR|PLCXD2_ENST00000393934.3_Missense_Mutation_p.I293N	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2						lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.I293N(1)		endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						CTGGCACTGATCCCAGTTTAT	0.458																																					p.I293N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T878A	3						.						185.0	168.0	174.0					3																	111564679		2203	4300	6503	113047369	SO:0001624	3_prime_UTR_variant	257068	exon4			AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.*45T>A	3.37:g.111564679T>A			113047369	NM_153268	Q96N12	Missense_Mutation	SNP	ENST00000477665.1	37	CCDS54619.1	.	.	.	.	.	.	.	.	.	.	T	4.359	0.066179	0.08388	.	.	ENSG00000240891	ENST00000393934	.	.	.	4.25	-0.815	0.10843	.	.	.	.	.	T	0.30916	0.0780	.	.	.	0.09310	N	1	B	0.21753	0.06	B	0.24006	0.05	T	0.33954	-0.9848	7	0.87932	D	0	.	7.334	0.26599	0.0:0.4427:0.0:0.5573	.	293	Q0VAA5-2	.	N	293	.	ENSP00000377511:I293N	I	+	2	0	PLCXD2	113047369	0.000000	0.05858	0.004000	0.12327	0.032000	0.12392	-0.247000	0.08866	-0.120000	0.11809	0.459000	0.35465	ATC		0.458	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
SEMA5B	54437	broad.mit.edu	37	3	122631753	122631753	+	Missense_Mutation	SNP	C	C	T	rs78490011	byFrequency	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr3:122631753C>T	ENST00000357599.3	-	18	3048	c.2662G>A	c.(2662-2664)Ggg>Agg	p.G888R	SEMA5B_ENST00000195173.4_Missense_Mutation_p.G887R|SEMA5B_ENST00000451055.2_Missense_Mutation_p.G942R	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	888	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G888R(1)|p.G942R(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GGCAGGCCCCCGTTGCGGGGC	0.692																																					p.G888R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2662A	3						.						39.0	49.0	46.0					3																	122631753		2199	4300	6499	124114443	SO:0001583	missense	54437	exon18			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2662G>A	3.37:g.122631753C>T	ENSP00000350215:p.Gly888Arg		124114443	NM_001031702	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.126145	0.77549	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	5.2	5.2	0.72013	.	0.167915	0.52532	D	0.000079	D	0.83741	0.5320	M	0.93016	3.37	0.29631	N	0.845472	D;D	0.76494	0.998;0.999	D;D	0.70935	0.918;0.971	T	0.82623	-0.0366	10	0.72032	D	0.01	.	17.9141	0.88943	0.0:1.0:0.0:0.0	.	830;888	D3YTI7;Q9P283	.;SEM5B_HUMAN	R	888;887;830;942;888	ENSP00000350215:G888R;ENSP00000195173:G887R;ENSP00000389588:G942R;ENSP00000377208:G888R	ENSP00000195173:G887R	G	-	1	0	SEMA5B	124114443	0.318000	0.24598	0.997000	0.53966	0.996000	0.88848	2.374000	0.44274	2.722000	0.93159	0.655000	0.94253	GGG		0.692	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
OR5K2	402135	broad.mit.edu	37	3	98216888	98216888	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr3:98216888C>T	ENST00000427338.1	+	1	441	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	CLDND1_ENST00000502288.1_3'UTR	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R122C(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GGCCTATGACCGCTATGTGGC	0.478																																					p.R122C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C364T	3						.						108.0	109.0	109.0					3																	98216888		2203	4300	6503	99699578	SO:0001583	missense	402135	exon1			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.364C>T	3.37:g.98216888C>T	ENSP00000393889:p.Arg122Cys		99699578	NM_001004737	B2RN70|Q6IF47	Missense_Mutation	SNP	ENST00000427338.1	37	CCDS33804.1	.	.	.	.	.	.	.	.	.	.	C	9.026	0.986140	0.18889	.	.	ENSG00000231861	ENST00000427338	T	0.77358	-1.09	2.65	1.76	0.24704	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43747	D	0.000530	T	0.74230	0.3689	M	0.87381	2.88	0.80722	D	1	P	0.35684	0.515	B	0.27715	0.082	T	0.74176	-0.3750	10	0.72032	D	0.01	-11.3127	7.6658	0.28430	0.0:0.8636:0.0:0.1364	.	122	Q8NHB8	OR5K2_HUMAN	C	122	ENSP00000393889:R122C	ENSP00000393889:R122C	R	+	1	0	OR5K2	99699578	0.367000	0.25023	0.995000	0.50966	0.650000	0.38633	0.689000	0.25437	0.677000	0.31305	0.298000	0.19748	CGC		0.478	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359020.2		
VEPH1	79674	broad.mit.edu	37	3	157082169	157082169	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr3:157082169G>T	ENST00000362010.2	-	8	1567	c.1260C>A	c.(1258-1260)agC>agA	p.S420R	RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.S420R|VEPH1_ENST00000392833.2_Missense_Mutation_p.S420R|VEPH1_ENST00000543418.1_Missense_Mutation_p.S420R	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	420						plasma membrane (GO:0005886)		p.S420R(1)		autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CAGGGGTATTGCTCCCTGCAT	0.358																																					p.S420R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1260A	3						.						143.0	138.0	139.0					3																	157082169		2203	4300	6503	158564863	SO:0001583	missense	79674	exon8			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.1260C>A	3.37:g.157082169G>T	ENSP00000354919:p.Ser420Arg		158564863	NM_001167911	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	G	1.812	-0.474314	0.04414	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.08458	3.09;3.09;3.09;3.09	5.71	4.84	0.62591	.	0.763942	0.13061	N	0.416890	T	0.08133	0.0203	N	0.24115	0.695	0.58432	D	0.999996	B;B	0.20459	0.045;0.026	B;B	0.23275	0.045;0.021	T	0.26087	-1.0113	10	0.36615	T	0.2	-17.4684	14.6753	0.68975	0.0695:0.0:0.9305:0.0	.	420;420	Q14D04-2;Q14D04	.;MELT_HUMAN	R	420	ENSP00000376578:S420R;ENSP00000354919:S420R;ENSP00000446258:S420R;ENSP00000376577:S420R	ENSP00000354919:S420R	S	-	3	2	VEPH1	158564863	0.051000	0.20477	0.003000	0.11579	0.017000	0.09413	2.069000	0.41481	1.420000	0.47138	0.650000	0.86243	AGC		0.358	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621	
ENPEP	2028	broad.mit.edu	37	4	111412299	111412299	+	Silent	SNP	A	A	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr4:111412299A>G	ENST00000265162.5	+	3	1239	c.897A>G	c.(895-897)agA>agG	p.R299R		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	299					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R299R(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CTGTAAAGAGAATATCAAATA	0.343																																					p.R299R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A897G	4						.						79.0	82.0	81.0					4																	111412299		2203	4300	6503	111631748	SO:0001819	synonymous_variant	2028	exon3			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.897A>G	4.37:g.111412299A>G			111631748	NM_001977	Q504U2	Silent	SNP	ENST00000265162.5	37	CCDS3691.1																																																																																				0.343	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
ANK2	287	broad.mit.edu	37	4	114262919	114262919	+	Silent	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr4:114262919C>T	ENST00000357077.4	+	33	4022	c.3969C>T	c.(3967-3969)tgC>tgT	p.C1323C	ANK2_ENST00000394537.3_Silent_p.C1323C|ANK2_ENST00000509550.1_Silent_p.C499C|ANK2_ENST00000506722.1_Silent_p.C1314C|ANK2_ENST00000510275.2_5'Flank|ANK2_ENST00000504887.1_3'UTR|ANK2_ENST00000264366.6_Silent_p.C1290C	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1323	UPA domain.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.C1323C(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AAATTATCTGCGTACCTTATA	0.378																																					p.C1323C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3969T	4						.						143.0	146.0	145.0					4																	114262919		2203	4300	6503	114482368	SO:0001819	synonymous_variant	287	exon33			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3969C>T	4.37:g.114262919C>T			114482368	NM_020977	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	9.925	1.213296	0.22289	.	.	ENSG00000145362	ENST00000514960;ENST00000504415	.	.	.	5.68	0.668	0.17912	.	.	.	.	.	T	0.55784	0.1942	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47923	-0.9079	4	.	.	.	.	9.095	0.36634	0.0:0.2871:0.0:0.7129	.	.	.	.	C	336;18	.	.	R	+	1	0	ANK2	114482368	0.991000	0.36638	0.998000	0.56505	0.985000	0.73830	0.224000	0.17738	0.109000	0.17891	-0.469000	0.05056	CGT		0.378	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
HTT	3064	broad.mit.edu	37	4	3231640	3231640	+	Silent	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr4:3231640C>T	ENST00000355072.5	+	60	8281	c.8136C>T	c.(8134-8136)acC>acT	p.T2712T	HTT_ENST00000513806.1_3'UTR	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2712					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)	p.T2712T(1)		breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACTTGTTCACCGAGCGCAACC	0.547																																					p.T2712T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C8136T	4						.						106.0	112.0	110.0					4																	3231640		2170	4282	6452	3201438	SO:0001819	synonymous_variant	3064	exon60			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8136C>T	4.37:g.3231640C>T			3201438	NM_002111	Q9UQB7	Silent	SNP	ENST00000355072.5	37	CCDS43206.1																																																																																				0.547	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
JADE1	79960	broad.mit.edu	37	4	129792844	129792844	+	Silent	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr4:129792844G>A	ENST00000226319.6	+	11	2236	c.1956G>A	c.(1954-1956)gtG>gtA	p.V652V	PHF17_ENST00000452328.2_Silent_p.V640V|PHF17_ENST00000512960.1_Silent_p.V652V	NM_199320.2	NP_955352.1												p.V652V(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ATGGTGTGGTGATGCCAGACC	0.428																																					p.V652V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1956A	4						.						78.0	78.0	78.0					4																	129792844		2203	4300	6503	130012294	SO:0001819	synonymous_variant	79960	exon11																														ENST00000226319.6:c.1956G>A	4.37:g.129792844G>A			130012294	NM_199320		Silent	SNP	ENST00000226319.6	37	CCDS34062.1																																																																																				0.428	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
LRRTM2	26045	broad.mit.edu	37	5	138209261	138209261	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:138209261T>A	ENST00000274711.6	-	2	1367	c.989A>T	c.(988-990)cAa>cTa	p.Q330L	CTNNA1_ENST00000520400.1_Intron|LRRTM2_ENST00000518785.1_3'UTR|CTNNA1_ENST00000518825.1_Intron|LRRTM2_ENST00000521094.2_Intron|CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000540387.1_5'Flank|LRRTM2_ENST00000523537.1_5'Flank|CTNNA1_ENST00000302763.7_Intron	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	330	LRRCT.				long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.Q330L(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CCACCGACCTTGGAAACTGCC	0.532																																					p.Q330L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A989T	5						.						91.0	91.0	91.0					5																	138209261		2017	4174	6191	138237160	SO:0001583	missense	26045	exon2			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.989A>T	5.37:g.138209261T>A	ENSP00000274711:p.Gln330Leu		138237160	NM_015564	A0AVL3|A8K4U9|B7ZLN8|Q7L770	Missense_Mutation	SNP	ENST00000274711.6	37	CCDS47272.1	.	.	.	.	.	.	.	.	.	.	T	10.82	1.458590	0.26248	.	.	ENSG00000146006	ENST00000274711	T	0.45668	0.89	5.3	5.3	0.74995	.	0.135329	0.49916	D	0.000135	T	0.34658	0.0905	L	0.44542	1.39	0.38661	D	0.952073	B;B	0.23735	0.003;0.09	B;B	0.19148	0.005;0.024	T	0.28808	-1.0032	10	0.52906	T	0.07	.	10.5452	0.45056	0.0:0.0769:0.0:0.9231	.	196;330	B7Z4G4;O43300	.;LRRT2_HUMAN	L	330	ENSP00000274711:Q330L	ENSP00000274711:Q330L	Q	-	2	0	LRRTM2	138237160	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.402000	0.52608	2.227000	0.72691	0.528000	0.53228	CAA		0.532	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374043.2		
PCDHA6	56142	broad.mit.edu	37	5	140209559	140209559	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:140209559C>T	ENST00000529310.1	+	1	1997	c.1883C>T	c.(1882-1884)aCg>aTg	p.T628M	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	628	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T628M(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTGTACACGGGCGAGATC	0.667																																					p.T628M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1883T	5						.						71.0	78.0	75.0					5																	140209559		2203	4300	6503	140189743	SO:0001583	missense	56142	exon1			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1883C>T	5.37:g.140209559C>T	ENSP00000433378:p.Thr628Met		140189743	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.706462	0.30232	.	.	ENSG00000081842	ENST00000529310	T	0.58060	0.36	3.98	3.11	0.35812	Cadherin (4);Cadherin-like (1);	0.000000	0.37715	U	0.001966	T	0.74801	0.3764	H	0.97564	4.03	0.80722	D	1	D;D	0.76494	0.999;0.997	P;P	0.62491	0.903;0.871	T	0.74708	-0.3574	10	0.72032	D	0.01	.	3.3184	0.07041	0.1467:0.5329:0.2199:0.1005	.	628;628	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	M	628	ENSP00000433378:T628M	ENSP00000433378:T628M	T	+	2	0	PCDHA6	140189743	0.636000	0.27207	0.999000	0.59377	0.142000	0.21351	1.214000	0.32419	1.024000	0.39682	0.306000	0.20318	ACG		0.667	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHB3	56132	broad.mit.edu	37	5	140482106	140482106	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:140482106C>T	ENST00000231130.2	+	1	1873	c.1873C>T	c.(1873-1875)Cgc>Tgc	p.R625C	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	625	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R625C(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCGAAGTGCGCACCGCCAG	0.706																																					p.R625C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1873T	5						.						31.0	33.0	32.0					5																	140482106		2153	4172	6325	140462290	SO:0001583	missense	56132	exon1			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1873C>T	5.37:g.140482106C>T	ENSP00000231130:p.Arg625Cys		140462290	NM_018937	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001096	0.54254	.	.	ENSG00000113205	ENST00000231130	T	0.52754	0.65	4.38	4.38	0.52667	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.79015	0.4375	H	0.98295	4.195	0.45995	D	0.9988	D	0.89917	1.0	D	0.87578	0.998	D	0.85404	0.1133	9	0.72032	D	0.01	.	11.1869	0.48662	0.3161:0.6839:0.0:0.0	.	625	Q9Y5E6	PCDB3_HUMAN	C	625	ENSP00000231130:R625C	ENSP00000231130:R625C	R	+	1	0	PCDHB3	140462290	0.973000	0.33851	1.000000	0.80357	0.992000	0.81027	0.709000	0.25734	2.143000	0.66587	0.556000	0.70494	CGC		0.706	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB12	56124	broad.mit.edu	37	5	140588873	140588873	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:140588873G>A	ENST00000239450.2	+	1	583	c.394G>A	c.(394-396)Gtc>Atc	p.V132I	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	132	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V132I(1)		NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCACTCTCCCGTCTTCTTGGA	0.408																																					p.V132I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G394A	5						.						101.0	110.0	107.0					5																	140588873		2202	4299	6501	140569057	SO:0001583	missense	56124	exon1			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.394G>A	5.37:g.140588873G>A	ENSP00000239450:p.Val132Ile		140569057	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	37	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	G	2.721	-0.266481	0.05754	.	.	ENSG00000120328	ENST00000239450	T	0.21734	1.99	4.25	-0.996	0.10218	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.15565	0.0375	L	0.39633	1.23	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.22661	-1.0210	9	0.37606	T	0.19	.	8.035	0.30486	0.3308:0.1041:0.565:0.0	.	132	Q9Y5F1	PCDBC_HUMAN	I	132	ENSP00000239450:V132I	ENSP00000239450:V132I	V	+	1	0	PCDHB12	140569057	0.000000	0.05858	0.000000	0.03702	0.459000	0.32528	-4.600000	0.00210	-0.900000	0.03896	-1.134000	0.01955	GTC		0.408	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
RANBP3L	202151	broad.mit.edu	37	5	36269540	36269540	+	Missense_Mutation	SNP	G	G	A	rs146572714		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:36269540G>A	ENST00000296604.3	-	4	705	c.220C>T	c.(220-222)Cgg>Tgg	p.R74W	RANBP3L_ENST00000502994.1_Missense_Mutation_p.R74W|RANBP3L_ENST00000515759.1_Missense_Mutation_p.R74W	NM_145000.3	NP_659437.3	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like	74					intracellular transport (GO:0046907)			p.R74W(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	16	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			GATGAAGACCGTACACGCTTT	0.358																																					p.R74W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C220T	5						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	107.0	104.0	105.0		220,220	1.1	0.8	5	dbSNP_134	105	2,8596	2.2+/-6.3	0,2,4297	no	missense,missense	RANBP3L	NM_001161429.1,NM_145000.3	101,101	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	74/491,74/466	36269540	2,13002	2203	4299	6502	36305297	SO:0001583	missense	202151	exon4			BC047660	CCDS3918.1, CCDS54843.1	5p13.2	2008-02-05			ENSG00000164188	ENSG00000164188			26353	protein-coding gene	gene with protein product						12477932	Standard	NM_145000		Approved	FLJ25422	uc011cow.2	Q86VV4	OTTHUMG00000131110	ENST00000296604.3:c.220C>T	5.37:g.36269540G>A	ENSP00000296604:p.Arg74Trp		36305297	NM_145000	B7Z866|E9PGP9|Q96LK2	Missense_Mutation	SNP	ENST00000296604.3	37	CCDS3918.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.202313	0.58234	0.0	2.33E-4	ENSG00000164188	ENST00000296604;ENST00000502994;ENST00000515759;ENST00000505865	T;T;T;T	0.73469	-0.69;0.08;-0.68;-0.75	4.66	1.13	0.20643	.	0.196194	0.34777	N	0.003696	D	0.82664	0.5086	M	0.75615	2.305	0.24072	N	0.995979	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.967	T	0.73509	-0.3960	10	0.87932	D	0	-1.3722	10.3751	0.44077	0.0:0.0:0.3576:0.6423	.	74;74	E9PGP9;Q86VV4	.;RNB3L_HUMAN	W	74	ENSP00000296604:R74W;ENSP00000421853:R74W;ENSP00000421149:R74W;ENSP00000427147:R74W	ENSP00000296604:R74W	R	-	1	2	RANBP3L	36305297	0.076000	0.21285	0.760000	0.31359	0.960000	0.62799	0.664000	0.25068	0.463000	0.27118	0.561000	0.74099	CGG		0.358	RANBP3L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253773.2	NM_145000	
C5orf42	65250	broad.mit.edu	37	5	37167162	37167162	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:37167162C>A	ENST00000508244.1	-	34	7480	c.7387G>T	c.(7387-7389)Gac>Tac	p.D2463Y	C5orf42_ENST00000425232.2_Missense_Mutation_p.D2463Y|C5orf42_ENST00000274258.7_Missense_Mutation_p.D1343Y			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2463						integral component of membrane (GO:0016021)		p.D2463Y(1)|p.D1343Y(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TTTTTACTGTCCTTTCCTTGT	0.323																																					p.D2463Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7387T	5						.						177.0	165.0	169.0					5																	37167162		2203	4300	6503	37202919	SO:0001583	missense	65250	exon35				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.7387G>T	5.37:g.37167162C>A	ENSP00000421690:p.Asp2463Tyr		37202919	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069812	0.55539	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.27402	1.69;1.69;1.67;1.67	5.41	4.49	0.54785	.	0.883173	0.09576	N	0.783546	T	0.39436	0.1078	L	0.40543	1.245	0.29048	N	0.884689	D;D	0.65815	0.986;0.995	P;P	0.59288	0.855;0.834	T	0.27706	-1.0066	10	0.66056	D	0.02	.	5.2622	0.15580	0.0:0.6329:0.0:0.3671	.	2463;1343	E9PH94;Q9H799	.;CE042_HUMAN	Y	2463;2463;1343;1511;1343	ENSP00000421690:D2463Y;ENSP00000389014:D2463Y;ENSP00000274258:D1343Y;ENSP00000424223:D1511Y	ENSP00000274258:D1343Y	D	-	1	0	C5orf42	37202919	0.628000	0.27138	0.929000	0.37066	0.960000	0.62799	1.037000	0.30241	1.139000	0.42245	0.591000	0.81541	GAC		0.323	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
PIK3R1	5295	broad.mit.edu	37	5	67590446	67590446	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:67590446G>A	ENST00000521381.1	+	12	2124	c.1508G>A	c.(1507-1509)cGg>cAg	p.R503Q	PIK3R1_ENST00000274335.5_Missense_Mutation_p.R503Q|PIK3R1_ENST00000523872.1_Missense_Mutation_p.R140Q|PIK3R1_ENST00000320694.8_Missense_Mutation_p.R203Q|PIK3R1_ENST00000336483.5_Missense_Mutation_p.R233Q|PIK3R1_ENST00000521657.1_Missense_Mutation_p.R503Q|PIK3R1_ENST00000396611.1_Missense_Mutation_p.R503Q	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	503					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.R503Q(2)|p.R203L(1)|p.0?(1)|p.?(1)|p.R503L(1)|p.R233Q(1)|p.R233L(1)|p.R203Q(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	ACCCAAGAGCGGTACAGCAAA	0.343			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.R503Q			Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	.	9	Substitution - Missense(7)|Whole gene deletion(1)|Unknown(1)	urinary_tract(3)|endometrium(3)|large_intestine(2)|lung(1)	c.G1508A	5						.						72.0	73.0	73.0					5																	67590446		2203	4300	6503	67626202	SO:0001583	missense	5295	exon11			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1508G>A	5.37:g.67590446G>A	ENSP00000428056:p.Arg503Gln		67626202	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	ENST00000521381.1	37	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870119	0.72065	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000336483;ENST00000519025;ENST00000523872	T;T;T;T;T;T;T;D	0.81908	-0.43;-0.43;-0.32;-0.43;-1.45;-1.45;0.36;-1.55	5.18	5.18	0.71444	.	0.054607	0.64402	D	0.000001	T	0.75280	0.3828	L	0.60455	1.87	0.80722	D	1	B;B;B;P	0.35807	0.017;0.061;0.006;0.522	B;B;B;B	0.19391	0.003;0.01;0.006;0.025	T	0.73145	-0.4075	10	0.27082	T	0.32	-16.1879	12.5699	0.56331	0.0758:0.0:0.9242:0.0	.	173;233;203;503	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	Q	503;503;503;503;203;233;176;140	ENSP00000428056:R503Q;ENSP00000429277:R503Q;ENSP00000379855:R503Q;ENSP00000274335:R503Q;ENSP00000323512:R203Q;ENSP00000338554:R233Q;ENSP00000429156:R176Q;ENSP00000430098:R140Q	ENSP00000274335:R503Q	R	+	2	0	PIK3R1	67626202	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.591000	0.74090	2.861000	0.98227	0.650000	0.86243	CGG		0.343	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
APC	324	broad.mit.edu	37	5	112175424	112175424	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:112175424delA	ENST00000457016.1	+	16	4513	c.4133delA	c.(4132-4134)cagfs	p.Q1378fs	APC_ENST00000257430.4_Frame_Shift_Del_p.Q1378fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.Q1378fs			P25054	APC_HUMAN	adenomatous polyposis coli	1378	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1378fs*7(2)|p.Y1376fs*41(1)|p.?(1)|p.Q1378fs*5(1)|p.K1192fs*3(1)|p.Y1376fs*5(1)|p.Y1376fs*1(1)|p.Q1378fs*37(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CACTATGTTCAGGAGACCCCA	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1360fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,+1 	.	9	Deletion - Frameshift(7)|Unknown(1)|Complex - frameshift(1)	large_intestine(7)|soft_tissue(1)|skin(1)	c.4079delA	5						.						92.0	88.0	89.0					5																	112175424		2202	4300	6502	112203323	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4133delA	5.37:g.112175424delA	ENSP00000413133:p.Gln1378fs		112203323	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.468	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
LMAN2	10960	broad.mit.edu	37	5	176765564	176765564	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr5:176765564C>T	ENST00000303127.7	-	3	562	c.358G>A	c.(358-360)Gtc>Atc	p.V120I	LMAN2_ENST00000506310.1_5'UTR|LMAN2_ENST00000515209.1_Missense_Mutation_p.V120I|RN7SL562P_ENST00000582768.1_RNA	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	120	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)	p.V120I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGCCGTGGACTTTGAAGTGG	0.617																																					p.V120I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G358A	5						.						283.0	228.0	247.0					5																	176765564		2203	4300	6503	176698170	SO:0001583	missense	10960	exon3			U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.358G>A	5.37:g.176765564C>T	ENSP00000303366:p.Val120Ile		176698170	NM_006816	Q53HH1	Missense_Mutation	SNP	ENST00000303127.7	37	CCDS4417.1	.	.	.	.	.	.	.	.	.	.	C	6.429	0.447326	0.12223	.	.	ENSG00000169223	ENST00000303127;ENST00000539488;ENST00000515209;ENST00000514458;ENST00000502560;ENST00000513877	T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21	5.03	3.26	0.37387	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.239990	0.42821	N	0.000649	T	0.33498	0.0865	N	0.03084	-0.415	0.50313	D	0.999867	B;B	0.02656	0.0;0.0	B;B	0.12837	0.005;0.008	T	0.27020	-1.0086	10	0.02654	T	1	-32.5341	6.3583	0.21414	0.0:0.6058:0.0:0.3942	.	120;120	Q12907;D6RBV2	LMAN2_HUMAN;.	I	120;49;120;120;120;49	ENSP00000303366:V120I;ENSP00000423998:V120I;ENSP00000424132:V120I;ENSP00000425229:V120I;ENSP00000427377:V49I	ENSP00000303366:V120I	V	-	1	0	LMAN2	176698170	1.000000	0.71417	0.997000	0.53966	0.873000	0.50193	1.851000	0.39338	0.835000	0.34877	0.591000	0.81541	GTC		0.617	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253434.1	NM_006816	
GRM1	2911	broad.mit.edu	37	6	146720759	146720759	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:146720759G>A	ENST00000282753.1	+	7	2819	c.2584G>A	c.(2584-2586)Gat>Aat	p.D862N	GRM1_ENST00000361719.2_Missense_Mutation_p.D862N|GRM1_ENST00000492807.2_Missense_Mutation_p.D862N|GRM1_ENST00000392299.2_Missense_Mutation_p.D862N|GRM1_ENST00000507907.1_Missense_Mutation_p.D862N|GRM1_ENST00000355289.4_Missense_Mutation_p.D862N			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	862					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.D862N(1)		NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GCATGTTGGCGATGGCAAGCT	0.517																																					p.D862N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2584A	6						.						50.0	42.0	45.0					6																	146720759		2203	4299	6502	146762452	SO:0001583	missense	2911	exon8			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2584G>A	6.37:g.146720759G>A	ENSP00000282753:p.Asp862Asn		146762452	NM_001114329	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822644	0.90873	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.88431	-2.38;-2.33;-2.33;-2.38;-2.32;-2.33	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.94265	0.8158	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	0.961;1.0;0.961	B;D;B	0.77557	0.436;0.99;0.436	D	0.93572	0.6905	10	0.52906	T	0.07	.	19.7753	0.96389	0.0:0.0:1.0:0.0	.	862;862;862	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	N	862	ENSP00000354896:D862N;ENSP00000376119:D862N;ENSP00000424095:D862N;ENSP00000282753:D862N;ENSP00000347437:D862N;ENSP00000425599:D862N	ENSP00000282753:D862N	D	+	1	0	GRM1	146762452	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.686000	0.91538	0.585000	0.79938	GAT		0.517	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
SYNE1	23345	broad.mit.edu	37	6	152831401	152831401	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:152831401G>A	ENST00000367255.5	-	8	1109	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W	SYNE1_ENST00000423061.1_Missense_Mutation_p.R177W|SYNE1_ENST00000265368.4_Missense_Mutation_p.R170W|SYNE1_ENST00000341594.5_Missense_Mutation_p.R170W|SYNE1_ENST00000466159.2_Missense_Mutation_p.R170W|SYNE1_ENST00000448038.1_Missense_Mutation_p.R177W|SYNE1_ENST00000367248.3_Missense_Mutation_p.R177W|SYNE1_ENST00000367253.4_Missense_Mutation_p.R170W|SYNE1_ENST00000413186.2_Missense_Mutation_p.R170W	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	170	Actin-binding.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R170W(7)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCACCTTCCGTTTACTTGGT	0.483										HNSCC(10;0.0054)																											p.R177W												.	.	7	Substitution - Missense(7)	large_intestine(4)|prostate(3)	c.C529T	6						.						195.0	175.0	182.0					6																	152831401		2203	4300	6503	152873094	SO:0001583	missense	23345	exon8			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.508C>T	6.37:g.152831401G>A	ENSP00000356224:p.Arg170Trp		152873094	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271820	0.59649	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.92348	0.32;0.31;0.22;0.31;0.47;-2.46;-2.58;-2.59;-2.83;-3.02	5.66	1.3	0.21679	Calponin homology domain (1);	0.118151	0.37219	N	0.002183	D	0.94889	0.8348	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.998;0.999;1.0	D	0.95353	0.8448	10	0.72032	D	0.01	.	14.8467	0.70264	0.0:0.0:0.52:0.4799	.	170;170;170;170;177	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	W	170;177;170;177;170;170;177;170;170;170	ENSP00000356224:R170W;ENSP00000396024:R177W;ENSP00000265368:R170W;ENSP00000390975:R177W;ENSP00000341887:R170W;ENSP00000356222:R170W;ENSP00000356217:R177W;ENSP00000414510:R170W;ENSP00000446021:R170W;ENSP00000441264:R170W	ENSP00000265368:R170W	R	-	1	2	SYNE1	152873094	0.978000	0.34361	0.672000	0.29872	0.750000	0.42670	1.413000	0.34725	0.686000	0.31488	-0.202000	0.12741	CGG		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SCGN	10590	broad.mit.edu	37	6	25701470	25701470	+	Silent	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:25701470C>T	ENST00000377961.2	+	11	906	c.738C>T	c.(736-738)cgC>cgT	p.R246R	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	246	EF-hand 6. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.R246R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						ATAAGTTCCGCGAGATTCTCC	0.498																																					p.R246R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C738T	6						.						118.0	100.0	106.0					6																	25701470		2203	4300	6503	25809449	SO:0001819	synonymous_variant	10590	exon11			BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.738C>T	6.37:g.25701470C>T			25809449	NM_006998	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Silent	SNP	ENST00000377961.2	37	CCDS4561.1																																																																																				0.498	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1		
ANKS1A	23294	broad.mit.edu	37	6	35048877	35048878	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	GC	GC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:35048877_35048878GC>CT	ENST00000360359.3	+	17	2789_2790	c.2651_2652GC>CT	c.(2650-2652)cGC>cCT	p.R884P	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	884					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.R884>?(1)|p.R210>?(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GGCAGGAGGCGCCATGACAGTC	0.634																																					.												.	.	2	Complex(2)	large_intestine(2)	c.2651_2652CT	6						.																																			35156856	SO:0001583	missense	23294	exon17			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	Exception_encountered	6.37:g.35048877_35048878delinsCT	ENSP00000353518:p.Arg884Pro		35156855	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	DNP	ENST00000360359.3	37	CCDS4798.1																																																																																				0.634	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
BRPF3	27154	broad.mit.edu	37	6	36168861	36168861	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:36168861G>T	ENST00000357641.6	+	2	1015	c.762G>T	c.(760-762)tgG>tgT	p.W254C	BRPF3_ENST00000443324.2_Missense_Mutation_p.W254C|BRPF3_ENST00000534694.1_Missense_Mutation_p.W254C|BRPF3_ENST00000543502.1_Missense_Mutation_p.W254C|BRPF3_ENST00000339717.7_Missense_Mutation_p.W254C|BRPF3_ENST00000534400.1_Missense_Mutation_p.W254C	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	254					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)	p.W254C(1)		breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						AGGGCCAGTGGCTATGCCGCT	0.552																																					p.W254C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G762T	6						.						87.0	78.0	81.0					6																	36168861		2203	4300	6503	36276839	SO:0001583	missense	27154	exon2			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.762G>T	6.37:g.36168861G>T	ENSP00000350267:p.Trp254Cys		36276839	NM_015695	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	ENST00000357641.6	37	CCDS34437.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.818557	0.71028	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400	D;D;D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39;-3.39;-3.39	5.79	5.79	0.91817	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.98585	0.9527	H	0.99464	4.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.99568	1.0970	10	0.87932	D	0	.	20.0368	0.97565	0.0:0.0:1.0:0.0	.	254;254;254	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	C	254	ENSP00000350267:W254C;ENSP00000345419:W254C;ENSP00000434501:W254C;ENSP00000445352:W254C;ENSP00000387368:W254C;ENSP00000436504:W254C	ENSP00000345419:W254C	W	+	3	0	BRPF3	36276839	1.000000	0.71417	0.971000	0.41717	0.987000	0.75469	9.414000	0.97362	2.735000	0.93741	0.563000	0.77884	TGG		0.552	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040335.3	NM_015695	
PEX6	5190	broad.mit.edu	37	6	42933493	42933493	+	Silent	SNP	A	A	G			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:42933493A>G	ENST00000304611.8	-	13	2466	c.2397T>C	c.(2395-2397)atT>atC	p.I799I	PEX6_ENST00000244546.4_Missense_Mutation_p.L717S	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	799					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.I799I(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			CAAAGAAGATAATGCATGGAG	0.567																																					p.I799I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2397C	6						.						108.0	120.0	116.0					6																	42933493		2203	4300	6503	43041471	SO:0001819	synonymous_variant	5190	exon13			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2397T>C	6.37:g.42933493A>G			43041471	NM_000287	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.597925	0.28445	.	.	ENSG00000124587	ENST00000244546	D	0.95788	-3.81	5.86	-4.42	0.03579	.	.	.	.	.	D	0.90590	0.7050	.	.	.	0.22982	N	0.998473	.	.	.	.	.	.	D	0.87842	0.2652	6	0.87932	D	0	-8.186	9.786	0.40677	0.3778:0.0:0.5236:0.0986	.	.	.	.	S	717	ENSP00000244546:L717S	ENSP00000244546:L717S	L	-	2	0	PEX6	43041471	0.963000	0.33076	0.774000	0.31636	0.997000	0.91878	0.167000	0.16602	-0.678000	0.05224	0.460000	0.39030	TTA		0.567	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
FILIP1	27145	broad.mit.edu	37	6	76023702	76023702	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:76023702G>A	ENST00000237172.7	-	5	2176	c.1846C>T	c.(1846-1848)Cga>Tga	p.R616*	FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Nonsense_Mutation_p.R517*|FILIP1_ENST00000393004.2_Nonsense_Mutation_p.R616*	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	616								p.R616*(1)		breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GACCCTTTTCGTGACCTTCCT	0.398																																					p.R616X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1846T	6						.						264.0	273.0	270.0					6																	76023702		2203	4300	6503	76080422	SO:0001587	stop_gained	27145	exon5			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1846C>T	6.37:g.76023702G>A	ENSP00000237172:p.Arg616*		76080422	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Nonsense_Mutation	SNP	ENST00000237172.7	37	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	G	37	6.036074	0.97221	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	.	.	.	6.11	4.29	0.51040	.	0.249082	0.40064	N	0.001184	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-5.9393	8.1643	0.31217	0.076:0.0:0.4741:0.4499	.	.	.	.	X	616;616;517	.	ENSP00000237172:R616X	R	-	1	2	FILIP1	76080422	0.025000	0.19082	0.647000	0.29507	0.410000	0.31052	1.616000	0.36933	0.861000	0.35504	0.655000	0.94253	CGA		0.398	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
THBS2	7058	broad.mit.edu	37	6	169622458	169622458	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr6:169622458C>T	ENST00000366787.3	-	20	3356	c.3107G>A	c.(3106-3108)cGc>cAc	p.R1036H	XXyac-YX65C7_A.2_ENST00000444188.1_RNA|THBS2_ENST00000488355.1_5'UTR	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	1036	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R1036H(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CACATAGAAGCGGCTGCTTGA	0.577																																					p.R1036H	Esophageal Squamous(91;219 1934 18562 44706)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3107A	6						.						69.0	61.0	64.0					6																	169622458		2203	4300	6503	169364383	SO:0001583	missense	7058	exon20				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3107G>A	6.37:g.169622458C>T	ENSP00000355751:p.Arg1036His		169364383	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652566	0.47362	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	D	0.95447	-3.71	4.32	3.43	0.39272	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.41294	U	0.000901	D	0.87038	0.6078	L	0.38175	1.15	0.44316	D	0.997197	P	0.47962	0.903	B	0.36186	0.219	D	0.86173	0.1601	10	0.54805	T	0.06	-40.6879	13.2774	0.60194	0.1598:0.8402:0.0:0.0	.	1036	P35442	TSP2_HUMAN	H	1036;294	ENSP00000355751:R1036H	ENSP00000355751:R1036H	R	-	2	0	THBS2	169364383	1.000000	0.71417	0.997000	0.53966	0.609000	0.37215	7.276000	0.78559	0.758000	0.33059	0.297000	0.19635	CGC		0.577	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
ST7	7982	broad.mit.edu	37	7	116810941	116810941	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr7:116810941G>A	ENST00000393446.2	+	9	1223	c.920G>A	c.(919-921)aGt>aAt	p.S307N	ST7_ENST00000393449.1_Missense_Mutation_p.S330N|ST7_ENST00000432298.1_Missense_Mutation_p.S284N|ST7_ENST00000393451.3_Missense_Mutation_p.S307N|ST7_ENST00000393447.4_Missense_Mutation_p.S287N|ST7_ENST00000393443.1_Missense_Mutation_p.S257N|ST7_ENST00000393444.3_Missense_Mutation_p.S264N|ST7_ENST00000323984.3_Missense_Mutation_p.S330N|ST7_ENST00000487459.1_3'UTR|ST7_ENST00000422922.1_Missense_Mutation_p.S261N|ST7_ENST00000265437.5_Missense_Mutation_p.S330N			Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.S330N(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CCCCTTCTGAGTATGTTCAAT	0.333																																					p.S307N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920A	7						.						98.0	97.0	97.0					7																	116810941		2203	4300	6503	116598177	SO:0001583	missense	7982	exon9			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000393446.2:c.920G>A	7.37:g.116810941G>A	ENSP00000377092:p.Ser307Asn		116598177	NM_018412	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000393446.2	37		.	.	.	.	.	.	.	.	.	.	G	12.02	1.811220	0.32053	.	.	ENSG00000004866	ENST00000393446;ENST00000265437;ENST00000393451;ENST00000323984;ENST00000393449;ENST00000446490;ENST00000432298;ENST00000422922;ENST00000393443;ENST00000393447;ENST00000393444;ENST00000490039	T;T;T;T;T;T;T;T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04;2.04	5.28	5.28	0.74379	Tetratricopeptide-like helical (1);	0.079027	0.85682	D	0.000000	T	0.30355	0.0762	N	0.25890	0.77	0.80722	D	1	D;B;B;B;B;B;B;B	0.64830	0.994;0.018;0.022;0.033;0.018;0.022;0.0;0.008	D;B;B;B;B;B;B;B	0.72338	0.977;0.042;0.018;0.036;0.031;0.068;0.002;0.029	T	0.01393	-1.1366	10	0.02654	T	1	-10.935	19.2638	0.93979	0.0:0.0:1.0:0.0	.	278;287;307;307;257;284;307;330	C9JU30;B7Z4L1;B7Z573;Q9NRC1-7;Q9NRC1-6;B7Z4U3;Q9NRC1-2;Q9NRC1	.;.;.;.;.;.;.;ST7_HUMAN	N	307;330;307;330;330;307;284;261;257;287;264;278	ENSP00000377092:S307N;ENSP00000265437:S330N;ENSP00000377097:S307N;ENSP00000325673:S330N;ENSP00000377095:S330N;ENSP00000402934:S307N;ENSP00000411118:S284N;ENSP00000414031:S261N;ENSP00000377089:S257N;ENSP00000377093:S287N;ENSP00000377090:S264N;ENSP00000419516:S278N	ENSP00000265437:S330N	S	+	2	0	ST7	116598177	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.420000	0.97426	2.629000	0.89072	0.557000	0.71058	AGT		0.333	ST7-013	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000319687.1	NM_021908	
MIOS	54468	broad.mit.edu	37	7	7613282	7613282	+	Silent	SNP	G	G	A			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr7:7613282G>A	ENST00000340080.4	+	4	1597	c.1176G>A	c.(1174-1176)acG>acA	p.T392T	MIOS_ENST00000405785.1_Silent_p.T392T	NM_019005.3	NP_061878.3	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog (Drosophila)	392						lysosomal membrane (GO:0005765)		p.T392T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ATATAGCAACGAAGATGCGTC	0.408																																					p.T392T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1176A	7						.						82.0	78.0	79.0					7																	7613282		1848	4095	5943	7579807	SO:0001819	synonymous_variant	54468	exon4				CCDS43554.1	7p21.3	2011-09-12			ENSG00000164654	ENSG00000164654			21905	protein-coding gene	gene with protein product	"""WD repeat-containing protein mio"""	615359				14973288	Standard	NM_019005		Approved	FLJ20323	uc003srf.3	Q9NXC5	OTTHUMG00000152440	ENST00000340080.4:c.1176G>A	7.37:g.7613282G>A			7579807	NM_019005	B2RTV6|O75216|Q7L551|Q9H092	Silent	SNP	ENST00000340080.4	37	CCDS43554.1																																																																																				0.408	MIOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326218.1	NM_019005	
DNAJC2	27000	broad.mit.edu	37	7	102982334	102982335	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	TC	TC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr7:102982334_102982335delTC	ENST00000379263.3	-	2	381_382	c.131_132delGA	c.(130-132)agafs	p.R44fs	DNAJC2_ENST00000249270.7_Frame_Shift_Del_p.R44fs|DNAJC2_ENST00000412522.1_Frame_Shift_Del_p.R44fs	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	44					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)	p.R44fs*12(2)		endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						CAGAAGCATTTCTGTTTCTCCT	0.416																																					p.44_44del												.	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.131_132del	7						.																																			102769571	SO:0001589	frameshift_variant	27000	exon2			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.131_132delGA	7.37:g.102982334_102982335delTC	ENSP00000368565:p.Arg44fs		102769570	NM_001129887	A4VCI0|Q9BVX1	Frame_Shift_Del	DEL	ENST00000379263.3	37	CCDS43628.1																																																																																				0.416	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
NCAPG2	54892	broad.mit.edu	37	7	158482625	158482625	+	Silent	SNP	A	A	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr7:158482625A>T	ENST00000409423.1	-	7	730	c.558T>A	c.(556-558)ctT>ctA	p.L186L	NCAPG2_ENST00000409339.3_Silent_p.L186L|NCAPG2_ENST00000449727.2_Silent_p.L186L|NCAPG2_ENST00000275830.10_5'Flank|NCAPG2_ENST00000356309.3_Silent_p.L186L	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	186					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.L186L(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		GGATACGCCAAAGCCGACATA	0.303																																					p.L186L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T558A	7						.						47.0	43.0	44.0					7																	158482625		1832	4087	5919	158175386	SO:0001819	synonymous_variant	54892	exon6			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.558T>A	7.37:g.158482625A>T			158175386	NM_017760	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	De_novo_Start_OutOfFrame	SNP	ENST00000409423.1	37	CCDS43686.1																																																																																				0.303	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760	
PTDSS1	9791	broad.mit.edu	37	8	97311947	97311947	+	Missense_Mutation	SNP	A	A	G	rs375073869		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr8:97311947A>G	ENST00000517309.1	+	6	952	c.626A>G	c.(625-627)aAt>aGt	p.N209S	PTDSS1_ENST00000522072.1_Missense_Mutation_p.N6S|PTDSS1_ENST00000455950.2_Missense_Mutation_p.N63S|PTDSS1_ENST00000518776.1_3'UTR	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	209					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)	p.N209S(1)		endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CTCCTCCCCAATTTTGCCGAG	0.468																																					p.N209S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A626G	8						.	A	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	216.0	195.0	202.0		626	5.6	1.0	8		202	0,8600		0,0,4300	no	missense	PTDSS1	NM_014754.1	46	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	209/474	97311947	1,13005	2203	4300	6503	97381123	SO:0001583	missense	9791	exon6			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.626A>G	8.37:g.97311947A>G	ENSP00000430548:p.Asn209Ser		97381123	NM_014754	E5RFC5|Q9BUQ5	Missense_Mutation	SNP	ENST00000517309.1	37	CCDS6271.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.865371	0.91511	2.27E-4	0.0	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.62105	0.05;0.24;0.17	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.83945	0.5364	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88169	0.2863	10	0.87932	D	0	-23.8644	14.4249	0.67207	1.0:0.0:0.0:0.0	.	209	P48651	PTSS1_HUMAN	S	209;63;6	ENSP00000430548:N209S;ENSP00000401248:N63S;ENSP00000430928:N6S	ENSP00000401248:N63S	N	+	2	0	PTDSS1	97381123	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	9.339000	0.96797	2.141000	0.66446	0.528000	0.53228	AAT		0.468	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379743.2		
PAPPA	5069	broad.mit.edu	37	9	118949480	118949480	+	Missense_Mutation	SNP	G	G	A	rs146292613	byFrequency	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr9:118949480G>A	ENST00000328252.3	+	2	832	c.463G>A	c.(463-465)Gtg>Atg	p.V155M	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	155					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V155M(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						AGGATGGGTCGTGGGCATTCA	0.483													G|||	19	0.00379393	0.0	0.0274	5008	,	,		18541	0.0		0.0	False		,,,				2504	0.0				p.V155M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463A	9						.	G	MET/VAL	4,4402	8.1+/-20.4	0,4,2199	80.0	79.0	79.0		463	3.0	1.0	9	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PAPPA	NM_002581.3	21	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	benign	155/1628	118949480	5,13001	2203	4300	6503	117989301	SO:0001583	missense	5069	exon2				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.463G>A	9.37:g.118949480G>A	ENSP00000330658:p.Val155Met		117989301	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	10	0.004578754578754579	0	0.0	10	0.027624309392265192	0	0.0	0	0.0	G	12.36	1.915184	0.33815	9.08E-4	1.16E-4	ENSG00000182752	ENST00000328252	T	0.74421	-0.84	6.07	3.05	0.35203	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.314452	0.34411	N	0.003994	T	0.35770	0.0943	L	0.34521	1.04	0.80722	D	1	B	0.20887	0.049	B	0.19391	0.025	T	0.47971	-0.9075	10	0.48119	T	0.1	-7.4136	7.1652	0.25687	0.169:0.2885:0.5424:0.0	.	155	Q13219	PAPP1_HUMAN	M	155	ENSP00000330658:V155M	ENSP00000330658:V155M	V	+	1	0	PAPPA	117989301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.372000	0.44257	0.858000	0.35431	0.655000	0.94253	GTG		0.483	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PAPPA	5069	broad.mit.edu	37	9	118950322	118950322	+	Silent	SNP	C	C	T	rs371022168		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr9:118950322C>T	ENST00000328252.3	+	2	1674	c.1305C>T	c.(1303-1305)caC>caT	p.H435H	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	435	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H435H(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGACGGGCCACGACGGCGGGG	0.602																																					p.H435H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1305T	9						.	C		0,4406		0,0,2203	64.0	51.0	55.0		1305	-5.5	0.3	9		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PAPPA	NM_002581.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		435/1628	118950322	1,13005	2203	4300	6503	117990143	SO:0001819	synonymous_variant	5069	exon2				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1305C>T	9.37:g.118950322C>T			117990143	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	ENST00000328252.3	37	CCDS6813.1																																																																																				0.602	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
CTSV	1515	broad.mit.edu	37	9	99799857	99799857	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr9:99799857A>C	ENST00000259470.5	-	3	416	c.167T>G	c.(166-168)aTg>aGg	p.M56R	CTSV_ENST00000538255.1_Missense_Mutation_p.M56R|CTSV_ENST00000479932.1_5'UTR	NM_001333.3	NP_001324.2	O60911	CATL2_HUMAN	cathepsin V	56					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic cell death (GO:0048102)|catagen (GO:0042637)|cellular response to starvation (GO:0009267)|decidualization (GO:0046697)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|multicellular organismal aging (GO:0010259)|negative regulation of keratinocyte proliferation (GO:0010839)|nerve development (GO:0021675)|protein autoprocessing (GO:0016540)|regulation of actin cytoskeleton reorganization (GO:2000249)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to gonadotropin (GO:0034698)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	aminopeptidase activity (GO:0004177)|cysteine-type carboxypeptidase activity (GO:0016807)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|peptide binding (GO:0042277)	p.M56R(1)									AATCATTTTCATATTCTTTTC	0.438																																					p.M56R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T167G	9						.						257.0	228.0	238.0					9																	99799857		2203	4300	6503	98839678	SO:0001583	missense	1515	exon3			Y14734	CCDS6723.1	9q22.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000136943	ENSG00000136943		"""Cathepsins"""	2538	protein-coding gene	gene with protein product		603308	"""cathepsin L2"""	CTSL2		9563472, 10029531	Standard	NM_001201575		Approved	CTSU	uc004awt.3	O60911	OTTHUMG00000020314	ENST00000259470.5:c.167T>G	9.37:g.99799857A>C	ENSP00000259470:p.Met56Arg		98839678	NM_001333	O60233|Q2TB86|Q5T1U0	Missense_Mutation	SNP	ENST00000259470.5	37	CCDS6723.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.641257	0.29157	.	.	ENSG00000136943	ENST00000259470;ENST00000538255	D;D	0.85773	-2.03;-2.03	3.81	2.62	0.31277	Proteinase inhibitor I29, cathepsin propeptide (2);	0.242826	0.42548	D	0.000695	T	0.75925	0.3916	L	0.37561	1.115	0.45477	D	0.998445	B;B	0.18741	0.03;0.016	B;B	0.26094	0.044;0.066	T	0.65038	-0.6265	9	.	.	.	.	7.9995	0.30288	0.8175:0.0:0.0:0.1825	.	56;56	B2R717;O60911	.;CATL2_HUMAN	R	56	ENSP00000259470:M56R;ENSP00000445052:M56R	.	M	-	2	0	CTSL2	98839678	1.000000	0.71417	0.975000	0.42487	0.996000	0.88848	6.711000	0.74675	0.793000	0.33875	0.459000	0.35465	ATG		0.438	CTSV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053301.2	NM_001333	
CACNA1B	774	broad.mit.edu	37	9	141010123	141010123	+	Silent	SNP	C	C	T	rs201682730		TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chr9:141010123C>T	ENST00000371372.1	+	42	5914	c.5769C>T	c.(5767-5769)ggC>ggT	p.G1923G	CACNA1B_ENST00000371357.1_Silent_p.G1922G|CACNA1B_ENST00000371355.4_Silent_p.G1924G|CACNA1B_ENST00000277549.5_Silent_p.G1117G|CACNA1B_ENST00000371363.1_Silent_p.G1921G|CACNA1B_ENST00000277551.2_Silent_p.G1923G	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1923					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.G1923G(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCAGCAATGGCGGGGCCATGT	0.587																																					p.G1923G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5769T	9						.						58.0	60.0	60.0					9																	141010123		1969	4151	6120	140129944	SO:0001819	synonymous_variant	774	exon41			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5769C>T	9.37:g.141010123C>T			140129944	NM_000718	B1AQK5	Silent	SNP	ENST00000371372.1	37	CCDS59522.1																																																																																				0.587	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
NXF5	55998	broad.mit.edu	37	X	101096737	101096737	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chrX:101096737C>T	ENST00000361708.2	-	5	508	c.149G>A	c.(148-150)cGa>cAa	p.R50Q	NXF5_ENST00000473265.2_Missense_Mutation_p.R50Q|NXF5_ENST00000537026.1_Missense_Mutation_p.R50Q			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	50	RRM.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R50Q(2)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TGCCCGATTTCGGATGTAGTG	0.507																																					p.R50Q												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G149A	X						.						163.0	135.0	145.0					X																	101096737		2203	4300	6503	100983393	SO:0001583	missense	55998	exon5			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.149G>A	X.37:g.101096737C>T	ENSP00000355286:p.Arg50Gln		100983393	NM_032946	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	ENST00000361708.2	37		.	.	.	.	.	.	.	.	.	.	.	8.283	0.816095	0.16607	.	.	ENSG00000126952	ENST00000537026;ENST00000473265;ENST00000361708	T;T;T	0.45276	0.9;0.9;0.9	2.18	-0.423	0.12325	.	0.805437	0.11286	U	0.579766	T	0.24624	0.0597	N	0.22421	0.69	0.09310	N	1	B	0.15719	0.014	B	0.17722	0.019	T	0.19614	-1.0300	10	0.45353	T	0.12	.	4.2641	0.10754	0.0:0.3854:0.0:0.6146	.	50	A2RRM0	.	Q	50	ENSP00000442401:R50Q;ENSP00000426978:R50Q;ENSP00000355286:R50Q	ENSP00000263032:R50Q	R	-	2	0	NXF5	100983393	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.078000	0.11375	-0.130000	0.11599	-0.731000	0.03576	CGA		0.507	NXF5-201	KNOWN	basic	protein_coding	protein_coding			
RPS4X	6191	broad.mit.edu	37	X	71493153	71493153	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chrX:71493153C>T	ENST00000316084.6	-	6	723	c.619G>A	c.(619-621)Gtg>Atg	p.V207M	RPS4X_ENST00000486733.1_5'UTR	NM_001007.4	NP_000998.1	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked	207					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.V207M(1)		NS(1)|large_intestine(1)	2	Renal(35;0.156)					ACGTGAACCACGTCAAAAGAT	0.468																																					p.V207M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G619A	X						.						62.0	49.0	53.0					X																	71493153		2203	4300	6503	71409878	SO:0001583	missense	6191	exon6				CCDS14418.1	Xq13.1	2011-04-05			ENSG00000198034	ENSG00000198034		"""S ribosomal proteins"""	10424	protein-coding gene	gene with protein product	"""40S ribosomal protein S4, X isoform"", ""ribosomal protein S4X isoform"", ""single-copy abundant mRNA"", ""cell cycle gene 2"""	312760				1795030, 8139551	Standard	NM_001007		Approved	DXS306, CCG2, SCAR, SCR10, FLJ40595, RPS4, S4	uc004ear.3	P62701	OTTHUMG00000021813	ENST00000316084.6:c.619G>A	X.37:g.71493153C>T	ENSP00000362744:p.Val207Met		71409878	NM_001007	P12631|P12750|P27576|P55831|Q14727|Q6IPY4	Missense_Mutation	SNP	ENST00000316084.6	37	CCDS14418.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.573230	0.45902	.	.	ENSG00000198034	ENST00000316084	T	0.27720	1.65	4.52	4.52	0.55395	KOW (1);	0.000000	0.64402	D	0.000003	T	0.20292	0.0488	N	0.12637	0.245	0.80722	D	1	B	0.26483	0.15	B	0.29785	0.107	T	0.07693	-1.0759	10	0.41790	T	0.15	.	14.0455	0.64702	0.0:1.0:0.0:0.0	.	207	P62701	RS4X_HUMAN	M	207	ENSP00000362744:V207M	ENSP00000362744:V207M	V	-	1	0	RPS4X	71409878	1.000000	0.71417	0.996000	0.52242	0.930000	0.56654	7.642000	0.83385	1.975000	0.57531	0.600000	0.82982	GTG		0.468	RPS4X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057188.1	NM_001007	
ARHGAP36	158763	broad.mit.edu	37	X	130220336	130220336	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AG-A025-01A-01W-A00E-09	TCGA-AG-A025-10A-01W-A00E-09	g.chrX:130220336C>T	ENST00000276211.5	+	10	1660	c.1315C>T	c.(1315-1317)Cgc>Tgc	p.R439C	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R427C|ARHGAP36_ENST00000370921.1_Missense_Mutation_p.R303C	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	439					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R439C(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GGTTGCTAAGCGCGTGTGGAA	0.453																																					p.R439C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1315T	X						.						100.0	91.0	94.0					X																	130220336		2203	4300	6503	130048017	SO:0001583	missense	158763	exon10				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1315C>T	X.37:g.130220336C>T	ENSP00000276211:p.Arg439Cys		130048017	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662549	0.29515	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.10860	2.83;2.83;2.84;2.86	4.69	2.74	0.32292	.	0.000000	0.45126	D	0.000397	T	0.12433	0.0302	N	0.08118	0	0.43430	D	0.995599	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.977;0.977;0.948	T	0.15150	-1.0447	10	0.51188	T	0.08	.	8.361	0.32359	0.4276:0.5724:0.0:0.0	.	408;427;439	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	C	439;427;408;303	ENSP00000276211:R439C;ENSP00000359960:R427C;ENSP00000408515:R408C;ENSP00000359959:R303C	ENSP00000276211:R439C	R	+	1	0	ARHGAP36	130048017	0.993000	0.37304	0.999000	0.59377	0.117000	0.20001	0.628000	0.24522	1.059000	0.40554	0.600000	0.82982	CGC		0.453	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
