#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SLC1A7	6512	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	53580475	53580475	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr1:53580475C>T	ENST00000371494.4	-	3	513	c.386G>A	c.(385-387)gGg>gAg	p.G129E	RP11-334A14.8_ENST00000439621.1_RNA|SLC1A7_ENST00000371491.4_Missense_Mutation_p.G129E	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	129					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		GATGGGCTTCCCACTCTGCTC	0.622																																					p.G129E	NSCLC(128;80 1811 21245 38490 51715)												.	.			0			c.G386A												133.0	107.0	116.0					1																	53580475		2203	4300	6503	SO:0001583	missense	6512	exon3			GGCTTCCCACTCT	U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.386G>A	1.37:g.53580475C>T	ENSP00000360549:p.Gly129Glu		89	0	0		140	0.06	8	NM_006671	2	0.00	0	Q5VVZ0|Q969Z8|Q9BW45	Missense_Mutation	SNP	ENST00000371494.4	37	CCDS574.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.083034	0.55861	.	.	ENSG00000162383	ENST00000371494;ENST00000371491	T;T	0.57273	0.41;0.41	5.69	4.78	0.61160	.	0.264242	0.43747	D	0.000530	T	0.38214	0.1032	N	0.13235	0.315	0.53005	D	0.99996	B;B	0.18968	0.032;0.003	B;B	0.28139	0.086;0.01	T	0.14615	-1.0466	10	0.23891	T	0.37	-24.1877	14.723	0.69323	0.0:0.9306:0.0:0.0694	.	129;129	Q9BW45;O00341	.;EAA5_HUMAN	E	129	ENSP00000360549:G129E;ENSP00000360546:G129E	ENSP00000360546:G129E	G	-	2	0	SLC1A7	53353063	0.998000	0.40836	0.916000	0.36221	0.964000	0.63967	4.665000	0.61547	1.429000	0.47314	0.655000	0.94253	GGG			0.622	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000024746.1		NM_006671	
NBPF10	100132406	broad.mit.edu	37	1	145293269	145293269	+	Splice_Site	SNP	G	G	A	rs61350760		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr1:145293269G>A	ENST00000468030.1	+	5	1125		c.e5+1		NBPF10_ENST00000369338.1_Splice_Site|NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_5'Flank																							TTTCACAACAGTAAGTTAAGA	0.423																																					.													.	NBPF10	221		0			.																																									SO:0001630	splice_region_variant	100132406	.			ACAACAGTAAGTT																												ENST00000468030.1:c.714+1G>A	1.37:g.145293269G>A			26	0	0		39	0.21	8	.	0		0		Splice_Site	SNP	ENST00000468030.1	37																																																																																						0.423	RP11-458D21.5-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding		OTTHUMT00000038553.9			Intron
PRELP	5549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	203453089	203453089	+	Silent	SNP	C	C	T	rs370979066		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr1:203453089C>T	ENST00000343110.2	+	2	904	c.777C>T	c.(775-777)aaC>aaT	p.N259N		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	259					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.N259N(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			CCATCCCTAACGGATACTTCA	0.507																																					p.N259N													PRELP,caecum,carcinoma,0,1	PRELP	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C777T							C	,	2,4404	4.2+/-10.8	0,2,2201	121.0	122.0	122.0		777,777	-9.5	0.0	1		122	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PRELP	NM_002725.3,NM_201348.1	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	259/383,259/383	203453089	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	5549	exon2			CCCTAACGGATAC	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.777C>T	1.37:g.203453089C>T			129	0	0		207	0.13	26	NM_201348	29	0.03	1	Q6FG38	Silent	SNP	ENST00000343110.2	37	CCDS1438.1																																																																																					0.507	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087474.1		NM_002725	
ADARB2	105	mdanderson.org	37	10	1245984	1245984	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr10:1245984C>G	ENST00000381312.1	-	8	2111	c.1786G>C	c.(1786-1788)Gca>Cca	p.A596P	ADARB2_ENST00000381310.3_Missense_Mutation_p.A105P|ADARB2_ENST00000381305.1_5'UTR	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	596	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		ATGACGCGTGCGAGGTGGCCC	0.697																																					p.A596P													.	.			0			c.G1786C												40.0	36.0	37.0					10																	1245984		2196	4295	6491	SO:0001583	missense	105	exon8			CGCGTGCGAGGTG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1786G>C	10.37:g.1245984C>G	ENSP00000370713:p.Ala596Pro		24	0	0		27	0.11	3	NM_018702	0		0	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	37	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957205	0.53293	.	.	ENSG00000185736	ENST00000381312;ENST00000381310	D;D	0.93906	-3.31;-3.31	5.77	0.503	0.16940	Adenosine deaminase/editase (3);	0.329390	0.32314	N	0.006273	D	0.92260	0.7545	L	0.29908	0.895	0.80722	D	1	B;D	0.56521	0.041;0.976	B;P	0.57324	0.048;0.818	D	0.89903	0.4046	10	0.46703	T	0.11	-24.6355	15.32	0.74115	0.4558:0.5442:0.0:0.0	.	596;105	Q9NS39;Q5VW42	RED2_HUMAN;.	P	596;105	ENSP00000370713:A596P;ENSP00000370711:A105P	ENSP00000370711:A105P	A	-	1	0	ADARB2	1235984	0.774000	0.28592	0.787000	0.31911	0.528000	0.34623	1.450000	0.35134	-0.153000	0.11137	-0.274000	0.10170	GCA			0.697	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046426.1		NM_018702	
TAF3	83860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	8006560	8006560	+	Nonsense_Mutation	SNP	C	C	T	rs568125079		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr10:8006560C>T	ENST00000344293.5	+	3	1293	c.1087C>T	c.(1087-1089)Cag>Tag	p.Q363*		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	363					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						AAAACAAATACAGACACCCCC	0.463																																					p.Q363X													.	.			0			c.C1087T												51.0	48.0	49.0					10																	8006560		1873	4115	5988	SO:0001587	stop_gained	83860	exon3			CAAATACAGACAC	AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1087C>T	10.37:g.8006560C>T	ENSP00000340271:p.Gln363*		90	0	0		109	0.14	15	NM_031923	12	0.17	2	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Nonsense_Mutation	SNP	ENST00000344293.5	37	CCDS41487.1	.	.	.	.	.	.	.	.	.	.	C	16.20	3.054852	0.55325	.	.	ENSG00000165632	ENST00000344293	.	.	.	5.4	5.4	0.78164	.	0.202723	0.34156	N	0.004205	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-13.6143	19.1676	0.93563	0.0:1.0:0.0:0.0	.	.	.	.	X	363	.	ENSP00000340271:Q363X	Q	+	1	0	TAF3	8046566	0.204000	0.23447	0.020000	0.16555	0.005000	0.04900	5.359000	0.66074	2.546000	0.85860	0.650000	0.86243	CAG			0.463	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046725.1		NM_031923	
LRRTM3	347731	broad.mit.edu;mdanderson.org	37	10	68687000	68687000	+	Missense_Mutation	SNP	G	G	A	rs143239282		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr10:68687000G>A	ENST00000361320.4	+	2	904	c.326G>A	c.(325-327)cGc>cAc	p.R109H	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	109					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						AATGGAATACGCAGACTCAAA	0.368																																					p.R109H													.	LRRTM3	241		0			c.G326A							G	,,HIS/ARG	0,4406		0,0,2203	98.0	102.0	101.0		,,326	5.4	1.0	10	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense	CTNNA3,LRRTM3	NM_001127384.1,NM_013266.2,NM_178011.3	,,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,probably-damaging	,,109/582	68687000	1,13005	2203	4300	6503	SO:0001583	missense	347731	exon2			GAATACGCAGACT	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.326G>A	10.37:g.68687000G>A	ENSP00000355187:p.Arg109His		39	0	0		52	0.08	4	NM_178011	0		0	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494906	0.64186	0.0	1.16E-4	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.59638	0.25	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000004	T	0.61060	0.2317	N	0.11000	0.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68243	-0.5460	10	0.54805	T	0.06	.	18.0114	0.89225	0.0:0.0:1.0:0.0	.	109;109	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	H	109	ENSP00000355187:R109H	ENSP00000355187:R109H	R	+	2	0	LRRTM3	68357006	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.543000	0.85770	0.655000	0.94253	CGC			0.368	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048277.2		NM_178011	
IRF7	3665	mdanderson.org	37	11	615253	615253	+	Silent	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr11:615253G>T	ENST00000397574.2	-	3	396	c.27C>A	c.(25-27)gcC>gcA	p.A9A	IRF7_ENST00000397562.3_5'UTR|IRF7_ENST00000397570.1_Silent_p.A9A|IRF7_ENST00000330243.5_Silent_p.A22A|IRF7_ENST00000348655.6_Silent_p.A9A|IRF7_ENST00000397566.1_Silent_p.A22A|IRF7_ENST00000525445.1_5'UTR	NM_001572.3	NP_001563.2	Q92985	IRF7_HUMAN	interferon regulatory factor 7	9					cellular response to DNA damage stimulus (GO:0006974)|cytokine-mediated signaling pathway (GO:0019221)|establishment of viral latency (GO:0019043)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-alpha production (GO:0032607)|interferon-beta production (GO:0032608)|interferon-gamma-mediated signaling pathway (GO:0060333)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of adaptive immune response (GO:0002819)|regulation of immune response (GO:0050776)|regulation of monocyte differentiation (GO:0045655)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|regulation of MyD88-independent toll-like receptor signaling pathway (GO:0034127)|regulation of type I interferon production (GO:0032479)|response to virus (GO:0009615)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCACGCGTGGGGCTGCCCTGC	0.701																																					p.A22A													.	.			0			c.C66A												6.0	7.0	7.0					11																	615253		2123	4182	6305	SO:0001819	synonymous_variant	3665	exon1			GCGTGGGGCTGCC	U53830	CCDS7703.1, CCDS7704.1, CCDS7705.1	11p15.5	2005-10-10			ENSG00000185507	ENSG00000185507			6122	protein-coding gene	gene with protein product		605047					Standard	XM_005252906		Approved		uc001lqh.3	Q92985	OTTHUMG00000132019	ENST00000397574.2:c.27C>A	11.37:g.615253G>T			23	0	0		19	0.11	2	NM_004031	125	0.00	0	B9EGL3|O00331|O00332|O00333|O75924|Q9UE79	Silent	SNP	ENST00000397574.2	37	CCDS7703.1																																																																																					0.701	IRF7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255026.1		NM_001572	
Unknown	0	bcgsc.ca	37	11	18931986	18931986	+	IGR	SNP	T	T	C			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr11:18931986T>C								AC103974.1 (105953 upstream) : MRGPRX1 (23373 downstream)																							CCTCACTGCCTGAATCTGCTT	0.537																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ACTGCCTGAATCT																													11.37:g.18931986T>C			38	0	0		37	0.11	4	.	0		0		RNA	SNP		37																																																																																					0	0.537										
CCDC87	55231	mdanderson.org	37	11	66360040	66360040	+	Silent	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr11:66360040G>T	ENST00000333861.3	-	1	514	c.447C>A	c.(445-447)gcC>gcA	p.A149A	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	149					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGGTGAGGGTGGCTGATTCAG	0.632																																					p.A149A													.	.			0			c.C447A												50.0	50.0	50.0					11																	66360040		2200	4295	6495	SO:0001819	synonymous_variant	55231	exon1			GAGGGTGGCTGAT	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.447C>A	11.37:g.66360040G>T			46	0	0		41	0.07	3	NM_018219	1	0.00	0	Q8NE76	Silent	SNP	ENST00000333861.3	37	CCDS8145.1																																																																																					0.632	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393825.1		NM_018219	
LRP5	4041	mdanderson.org	37	11	68216521	68216521	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr11:68216521T>C	ENST00000294304.7	+	23	4937	c.4831T>C	c.(4831-4833)Tgc>Cgc	p.C1611R	LRP5_ENST00000529481.1_3'UTR	NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1611					adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCGTCCCCCTGCACGGACTC	0.562																																					p.C1611R													.	.			0			c.T4831C												32.0	36.0	34.0					11																	68216521		2200	4293	6493	SO:0001583	missense	4041	exon23			TCCCCCTGCACGG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4831T>C	11.37:g.68216521T>C	ENSP00000294304:p.Cys1611Arg		27	0	0		22	0.14	3	NM_002335	63	0.00	0	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.521898	0.44866	.	.	ENSG00000162337	ENST00000294304	D	0.93426	-3.22	4.53	4.53	0.55603	.	0.000000	0.50627	U	0.000102	D	0.95245	0.8458	L	0.57536	1.79	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.66497	0.944;0.944	D	0.95710	0.8757	10	0.87932	D	0	.	14.0922	0.64998	0.0:0.0:0.0:1.0	.	1611;1611	Q9UES7;O75197	.;LRP5_HUMAN	R	1611	ENSP00000294304:C1611R	ENSP00000294304:C1611R	C	+	1	0	LRP5	67973097	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	7.395000	0.79876	1.919000	0.55581	0.454000	0.30748	TGC			0.562	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395088.1		NM_002335	
STT3A	3703	mdanderson.org	37	11	125482643	125482643	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr11:125482643G>T	ENST00000529196.1	+	13	1571		c.e13+1		STT3A_ENST00000392708.4_Splice_Site|STT3A_ENST00000531491.1_Splice_Site			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)						cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TAAGAATGAAGTGAGAAGCAA	0.473																																					.													.	.			0			c.1365+1G>T												91.0	83.0	86.0					11																	125482643		2201	4299	6500	SO:0001630	splice_region_variant	3703	exon12			AATGAAGTGAGAA	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.1365+1G>T	11.37:g.125482643G>T			39	0.0256410256	1		43	0.07	3	NM_152713	9	0.00	0	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Splice_Site	SNP	ENST00000529196.1	37	CCDS8458.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733278	0.89482	.	.	ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491;ENST00000526726	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8291	0.96628	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STT3A	124987853	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.661000	0.98601	2.780000	0.95670	0.655000	0.94253	.			0.473	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000386691.1		NM_152713	Intron
WBP11	51729	broad.mit.edu	37	12	14947586	14947586	+	Silent	SNP	A	A	G			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr12:14947586A>G	ENST00000261167.2	-	7	839	c.606T>C	c.(604-606)ccT>ccC	p.P202P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	202	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GACCAGGGGGAGGGCCAGGAG	0.512																																					p.P202P													WBP11,right_lower_lobe,carcinoma,0,2	WBP11	66	2	0			c.T606C												100.0	107.0	105.0					12																	14947586		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon7			AGGGGGAGGGCCA	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.606T>C	12.37:g.14947586A>G			149	0.0201342282	3		419	0.02	8	NM_016312	460	0.01	3	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																					0.512	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
DDX11	1663	ucsc.edu	37	12	31254052	31254052	+	Missense_Mutation	SNP	G	G	C	rs201027785	byFrequency	TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr12:31254052G>C	ENST00000407793.2	+	20	2291	c.2040G>C	c.(2038-2040)gaG>gaC	p.E680D	DDX11_ENST00000350437.4_Missense_Mutation_p.E680D|DDX11_ENST00000542838.1_Missense_Mutation_p.E680D|DDX11_ENST00000228264.6_Missense_Mutation_p.E654D|DDX11_ENST00000545668.1_Missense_Mutation_p.E680D|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	680					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AGAAAAGAGAGCTGCCTCAGA	0.612										Multiple Myeloma(12;0.14)			G|||	11	0.00219649	0.0015	0.0101	5008	,	,		17144	0.0		0.001	False		,,,				2504	0.001				p.E680D													.	DDX11	188		0			c.G2040C												56.0	62.0	60.0					12																	31254052		2203	4300	6503	SO:0001583	missense	1663	exon20			AAGAGAGCTGCCT	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.2040G>C	12.37:g.31254052G>C	ENSP00000384703:p.Glu680Asp		109	0	0		171	0.01	2	NM_030653	209	0.12	26	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	149	0.06822344322344322	30	0.06097560975609756	20	0.055248618784530384	39	0.06818181818181818	60	0.079155672823219	G	3.714	-0.058844	0.07317	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.78003	-0.56;-0.55;-0.56;-0.55;-1.14	3.75	0.575	0.17374	.	0.161338	0.53938	D	0.000051	T	0.05044	0.0135	.	.	.	0.80722	D	1	B;B;B;B	0.15141	0.012;0.006;0.002;0.012	B;B;B;B	0.13407	0.009;0.003;0.004;0.009	T	0.02437	-1.1159	9	0.13470	T	0.59	.	2.3945	0.04386	0.112:0.3585:0.3457:0.1839	.	654;680;680;680	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	D	680;680;405;654;680;680	ENSP00000443426:E680D;ENSP00000384703:E680D;ENSP00000228264:E654D;ENSP00000440402:E680D;ENSP00000309965:E680D	ENSP00000228264:E654D	E	+	3	2	DDX11	31145319	0.402000	0.25311	0.969000	0.41365	0.258000	0.26162	0.027000	0.13621	0.748000	0.32831	0.597000	0.82753	GAG			0.612	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399728.1	rescued with RNA-seq	NM_030653	
KMT2D	8085	mdanderson.org	37	12	49427679	49427679	+	Silent	SNP	C	C	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr12:49427679C>T	ENST00000301067.7	-	39	10808	c.10809G>A	c.(10807-10809)caG>caA	p.Q3603Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3603	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3603Q(1)|p.Q3333Q(1)									gctgctgctgctgttgttgct	0.582																																					p.Q3603Q													MLL2_ENST00000301067,NS,carcinoma,0,2	MLL2_ENST00000301067	0	2	2	Substitution - coding silent(2)	endometrium(2)	c.G10809A												10.0	10.0	10.0					12																	49427679		2174	4260	6434	SO:0001819	synonymous_variant	8085	exon39			CTGCTGCTGTTGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10809G>A	12.37:g.49427679C>T			27	0	0		52	0.08	4	NM_003482	22	0.00	0	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																					0.582	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390183.2			
ITGA5	3678	broad.mit.edu	37	12	54791248	54791248	+	Silent	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr12:54791248G>T	ENST00000293379.4	-	29	3228	c.2967C>A	c.(2965-2967)acC>acA	p.T989T	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	989					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						CTTCTGCCTTGGTCCATTGCA	0.522																																					p.T989T													.	ITGA5	99		0			c.C2967A												177.0	127.0	144.0					12																	54791248		2203	4300	6503	SO:0001819	synonymous_variant	3678	exon29			TGCCTTGGTCCAT		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2967C>A	12.37:g.54791248G>T			56	0.0178571429	1		125	0.03	4	NM_002205	203	0.00	0	Q96HA5	Silent	SNP	ENST00000293379.4	37	CCDS8880.1	.	.	.	.	.	.	.	.	.	.	G	1.052	-0.675688	0.03378	.	.	ENSG00000161638	ENST00000547197	.	.	.	5.44	1.58	0.23477	.	.	.	.	.	T	0.43100	0.1232	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21245	-1.0251	4	.	.	.	.	1.9905	0.03445	0.1519:0.1351:0.4344:0.2786	.	.	.	.	Q	59	.	.	P	-	2	0	ITGA5	53077515	0.999000	0.42202	0.991000	0.47740	0.107000	0.19398	0.366000	0.20365	0.103000	0.17682	-0.816000	0.03127	CCA			0.522	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406174.1			
RFC3	5983	broad.mit.edu	37	13	34398073	34398073	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr13:34398073T>A	ENST00000380071.3	+	3	375	c.245T>A	c.(244-246)aTt>aAt	p.I82N	RFC3_ENST00000434425.1_Missense_Mutation_p.I82N	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	82					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		AAAAAAAAAATTGAAATTAGC	0.284																																					p.I82N													.	RFC3	40		0			c.T245A												28.0	31.0	30.0					13																	34398073		2196	4285	6481	SO:0001583	missense	5983	exon3			AAAAAATTGAAAT		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.245T>A	13.37:g.34398073T>A	ENSP00000369411:p.Ile82Asn		256	0.0078125	2		479	0.02	11	NM_002915	36	0.00	0	C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	ENST00000380071.3	37	CCDS9352.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462673	0.84425	.	.	ENSG00000133119	ENST00000380071;ENST00000434425	T;T	0.42513	0.97;0.97	5.74	5.74	0.90152	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.046773	0.85682	D	0.000000	T	0.67268	0.2875	M	0.85197	2.74	0.80722	D	1	D;D;D	0.60160	0.987;0.977;0.977	P;D;D	0.65573	0.879;0.936;0.936	T	0.73388	-0.3998	10	0.87932	D	0	-24.8682	15.2146	0.73254	0.0:0.0:0.0:1.0	.	82;82;82	B4DKE6;C9JU95;P40938	.;.;RFC3_HUMAN	N	82	ENSP00000369411:I82N;ENSP00000401001:I82N	ENSP00000369411:I82N	I	+	2	0	RFC3	33296073	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.498000	0.81546	2.195000	0.70347	0.533000	0.62120	ATT			0.284	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044450.2		NM_002915	
PCCA	5095	mdanderson.org	37	13	100915059	100915059	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr13:100915059G>T	ENST00000376285.1	+	10	831	c.793G>T	c.(793-795)Gat>Tat	p.D265Y	PCCA_ENST00000376286.4_Missense_Mutation_p.D239Y|PCCA_ENST00000376279.3_Missense_Mutation_p.D265Y	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	265	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	AAAATTTATTGATAATCCTCG	0.294																																					p.D265Y													.	.			0			c.G793T												105.0	123.0	117.0					13																	100915059		2200	4299	6499	SO:0001583	missense	5095	exon10			TTTATTGATAATC	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.793G>T	13.37:g.100915059G>T	ENSP00000365462:p.Asp265Tyr		36	0	0		46	0.07	3	NM_001178004	10	0.00	0	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	G	19.43	3.827015	0.71143	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.98060	-4.69;-4.69;-4.69	5.23	4.39	0.52855	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.98441	0.9481	M	0.76938	2.355	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76071	0.98;0.978;0.987	D	0.99007	1.0813	10	0.66056	D	0.02	.	13.7094	0.62659	0.0748:0.0:0.9252:0.0	.	265;239;265	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	Y	239;265;265	ENSP00000365463:D239Y;ENSP00000365456:D265Y;ENSP00000365462:D265Y	ENSP00000365456:D265Y	D	+	1	0	PCCA	99713060	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	7.252000	0.78309	1.187000	0.43000	0.655000	0.94253	GAT			0.294	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045627.2			
RP11-146E13.4	0	broad.mit.edu	37	14	19857036	19857036	+	lincRNA	SNP	A	A	G	rs374719458		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr14:19857036A>G	ENST00000548109.1	+	0	72																											CTGGATAATAAAGTTCATCTC	0.373																																					.													.	.			0			.																																											0	.			ATAATAAAGTTCA																													14.37:g.19857036A>G			20	0	0		35	0.14	5	.	4	0.00	0		RNA	SNP	ENST00000548109.1	37																																																																																						0.373	RP11-146E13.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409408.1			
OR10G3	26533	mdanderson.org	37	14	22038818	22038818	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr14:22038818G>T	ENST00000303532.1	-	1	57	c.58C>A	c.(58-60)Cca>Aca	p.P20T		NM_001005465.1	NP_001005465.1	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G, member 3	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)	15	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		AGCCTGAGTGGATACGGAATT	0.413																																					p.P20T													.	.			0			c.C58A												75.0	74.0	74.0					14																	22038818		2203	4300	6503	SO:0001583	missense	26533	exon1			TGAGTGGATACGG		CCDS32046.1	14q11.2	2013-09-24			ENSG00000169208	ENSG00000169208		"""GPCR / Class A : Olfactory receptors"""	8171	protein-coding gene	gene with protein product						8188290	Standard	NM_001005465		Approved		uc010tmb.2	Q8NGC4	OTTHUMG00000168886	ENST00000303532.1:c.58C>A	14.37:g.22038818G>T	ENSP00000302437:p.Pro20Thr		27	0	0		20	0.10	2	NM_001005465	0		0	Q6IET7|Q96R77	Missense_Mutation	SNP	ENST00000303532.1	37	CCDS32046.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.949315	0.00475	.	.	ENSG00000169208	ENST00000303532	T	0.03982	3.74	4.33	4.33	0.51752	.	0.000000	0.46442	D	0.000289	T	0.02848	0.0085	N	0.04724	-0.175	0.33664	D	0.610017	B	0.10296	0.003	B	0.12156	0.007	T	0.33854	-0.9852	10	0.13853	T	0.58	-8.6793	14.6822	0.69026	0.0:0.0:1.0:0.0	.	20	Q8NGC4	O10G3_HUMAN	T	20	ENSP00000302437:P20T	ENSP00000302437:P20T	P	-	1	0	OR10G3	21108658	0.000000	0.05858	0.938000	0.37757	0.281000	0.26958	-0.014000	0.12656	2.120000	0.65058	0.585000	0.79938	CCA			0.413	OR10G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401521.1			
LOC101927079	101927079	broad.mit.edu	37	15	22332492	22332492	+	RNA	SNP	A	A	C	rs540968052		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr15:22332492A>C	ENST00000558896.1	+	0	299																											TATTTCTCTTATTACTATTTT	0.383																																					.													.	.			0			.																																											0	.			TCTCTTATTACTA																													15.37:g.22332492A>C			84	0	0		188	0.03	5	.	0		0		RNA	SNP	ENST00000558896.1	37																																																																																						0.383	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping		OTTHUMT00000417625.1			
RP11-1000B6.3	0	broad.mit.edu	37	15	32828941	32828973	+	lincRNA	DEL	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	-			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	GCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr15:32828941_32828973delGCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT	ENST00000564670.1	+	0	103				RP11-632K20.7_ENST00000561563.2_RNA																							TTGGGCTCCAGCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCTGCTGCGCGGT	0.73																																					.													.	.			0			.																																											0	.			GCTCCAGCCCCAG																													15.37:g.32828941_32828973delGCCCCAGCCGGGCCCCCTCGCGCCGCTGCGGCT			13	0	0		16	0.31	5	.	0		0		RNA	DEL	ENST00000564670.1	37																																																																																						0.730	RP11-1000B6.3-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000429854.1			
TYRO3	7301	hgsc.bcm.edu;bcgsc.ca	37	15	41865666	41865666	+	Splice_Site	SNP	G	G	T	rs77680822		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr15:41865666G>T	ENST00000263798.3	+	17	2369		c.e17+1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAGTGACGTGGTGAGCAGGGT	0.582																																					.													.	.			0			c.2145+1G>T												87.0	81.0	83.0					15																	41865666		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon17			GACGTGGTGAGCA	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2145+1G>T	15.37:g.41865666G>T			95	0	0		121	0.09	11	NM_006293	0		0	O14953|Q86VR3	Splice_Site	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475047	0.84640	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1858	0.93644	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39652958	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.869000	0.99810	2.531000	0.85337	0.655000	0.94253	.			0.582	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252693.2			Intron
TMEM62	80021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43470879	43470879	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr15:43470879G>A	ENST00000260403.2	+	12	1735	c.1456G>A	c.(1456-1458)Gtg>Atg	p.V486M	EPB42_ENST00000563128.1_5'Flank|TMEM62_ENST00000569369.1_3'UTR	NM_024956.3	NP_079232.3	Q0P6H9	TMM62_HUMAN	transmembrane protein 62	486						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		all_cancers(109;1.16e-10)|all_epithelial(112;2.01e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;4.23e-07)		CTACTATTCTGTGTTGTTGTT	0.313																																					p.V486M													.	.			0			c.G1456A												127.0	117.0	121.0					15																	43470879		2202	4298	6500	SO:0001583	missense	80021	exon12			TATTCTGTGTTGT	BC009981	CCDS32210.1	15q15.2	2014-09-11			ENSG00000137842	ENSG00000137842			26269	protein-coding gene	gene with protein product							Standard	NM_024956		Approved	FLJ23375	uc001zqr.3	Q0P6H9	OTTHUMG00000176485	ENST00000260403.2:c.1456G>A	15.37:g.43470879G>A	ENSP00000260403:p.Val486Met		75	0	0		142	0.11	16	NM_024956	9	0.00	0	Q6I9Y5|Q9H5J6	Missense_Mutation	SNP	ENST00000260403.2	37	CCDS32210.1	.	.	.	.	.	.	.	.	.	.	G	9.801	1.180521	0.21787	.	.	ENSG00000137842	ENST00000260403	.	.	.	5.65	-1.97	0.07503	.	0.382601	0.29861	N	0.011013	T	0.37732	0.1014	L	0.55481	1.735	0.35483	D	0.798345	B	0.31209	0.313	B	0.26614	0.071	T	0.12502	-1.0545	9	0.41790	T	0.15	-0.3901	5.8251	0.18548	0.4249:0.0:0.3797:0.1954	.	486	Q0P6H9	TMM62_HUMAN	M	486	.	ENSP00000260403:V486M	V	+	1	0	TMEM62	41258171	0.000000	0.05858	0.774000	0.31636	0.715000	0.41141	-0.542000	0.06091	-0.533000	0.06323	-0.768000	0.03414	GTG			0.313	TMEM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000432227.1		NM_024956	
MEF2A	4205	hgsc.bcm.edu	37	15	100211846	100211846	+	Missense_Mutation	SNP	G	G	A	rs75705863		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr15:100211846G>A	ENST00000354410.5	+	5	1009	c.380G>A	c.(379-381)cGg>cAg	p.R127Q	MEF2A_ENST00000557942.1_Intron|MEF2A_ENST00000453228.2_Intron|MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000557785.1_Intron|MEF2A_ENST00000449277.2_Intron|MEF2A_ENST00000338042.6_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	127					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			AATATGATGCGGAATCATAAA	0.353																																					p.R127Q													MEF2A_ENST00000354410,NS,carcinoma,+1,1	MEF2A_ENST00000354410	1	1	0			c.G380A												23.0	21.0	22.0					15																	100211846		1829	4075	5904	SO:0001583	missense	4205	exon5			TGATGCGGAATCA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.380G>A	15.37:g.100211846G>A	ENSP00000346389:p.Arg127Gln		23	0.0434782609	1		54	0.07	4	NM_005587	4	0.00	0	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210988	0.39102	.	.	ENSG00000068305	ENST00000354410	T	0.53640	0.61	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.388740	0.29028	N	0.013366	T	0.33731	0.0873	N	0.10916	0.065	0.80722	D	1	B;B	0.29301	0.241;0.203	B;B	0.37422	0.249;0.135	T	0.11916	-1.0568	10	0.05833	T	0.94	-16.9184	19.5673	0.95398	0.0:0.0:1.0:0.0	.	127;127	Q02078;Q02078-5	MEF2A_HUMAN;.	Q	127	ENSP00000346389:R127Q	ENSP00000346389:R127Q	R	+	2	0	MEF2A	98029369	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.420000	0.97426	2.706000	0.92434	0.462000	0.41574	CGG			0.353	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000415980.1			
WASH3P	374666	broad.mit.edu	37	15	102516512	102516512	+	RNA	SNP	G	G	A	rs374640037		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr15:102516512G>A	ENST00000557932.1	+	0	1460				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GACTTGGGCCGTTGCTCTGAC	0.627																																					.													.	WASH3P	56		0			.																																											0	.			TGGGCCGTTGCTC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516512G>A			127	0	0		132	0.04	5	.	127	0.52	66		RNA	SNP	ENST00000557932.1	37																																																																																						0.627	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000417608.1	rescued with RNA-seq	NM_199163	
C1QTNF8	390664	mdanderson.org	37	16	1143813	1143813	+	Silent	SNP	G	G	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr16:1143813G>A	ENST00000328449.5	-	4	720	c.447C>T	c.(445-447)ttC>ttT	p.F149F		NM_207419.3	NP_997302.2	P60827	C1QT8_HUMAN	C1q and tumor necrosis factor related protein 8	149	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				lung(2)|prostate(1)|skin(1)	4		Hepatocellular(780;0.00369)				CGGCCAGGTCGAAGGCGCCGT	0.672																																					p.F149F													.	.			0			c.C447T												32.0	36.0	34.0					16																	1143813		2194	4291	6485	SO:0001819	synonymous_variant	390664	exon4			CAGGTCGAAGGCG	AY358832	CCDS32358.1	16p13.3	2014-08-12			ENSG00000184471	ENSG00000184471			31374	protein-coding gene	gene with protein product		614147				12975309	Standard	NM_207419		Approved	UNQ5829, CTRP8	uc010uuw.1	P60827	OTTHUMG00000167756	ENST00000328449.5:c.447C>T	16.37:g.1143813G>A			33	0	0		16	0.13	2	NM_207419	0		0	B7U178	Silent	SNP	ENST00000328449.5	37	CCDS32358.1																																																																																					0.672	C1QTNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396120.1		XM_372606	
KIAA0430	9665	broad.mit.edu	37	16	15709776	15709776	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr16:15709776G>T	ENST00000396368.3	-	16	3370	c.3164C>A	c.(3163-3165)aCc>aAc	p.T1055N	KIAA0430_ENST00000548025.1_Missense_Mutation_p.T1052N|KIAA0430_ENST00000602337.1_Missense_Mutation_p.T1052N|KIAA0430_ENST00000344181.3_Missense_Mutation_p.T657N|KIAA0430_ENST00000551742.1_Missense_Mutation_p.T1055N|KIAA0430_ENST00000540441.2_Missense_Mutation_p.T890N	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1055	HTH OST-type 2. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGGAACACAGGTAATGAAGTG	0.448																																					p.T1055N													.	KIAA0430	154		0			c.C3164A												172.0	168.0	169.0					16																	15709776		1931	4146	6077	SO:0001583	missense	9665	exon16			ACACAGGTAATGA	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.3164C>A	16.37:g.15709776G>T	ENSP00000379654:p.Thr1055Asn		136	0	0		207	0.02	4	NM_014647	11	0.00	0	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	ENST00000396368.3	37	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548104	0.86022	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.65647	0.2711	L	0.51422	1.61	0.80722	D	1	P;D;D;P	0.57571	0.702;0.98;0.98;0.578	B;P;P;B	0.53689	0.398;0.732;0.732;0.224	T	0.68788	-0.5316	9	0.56958	D	0.05	.	18.2165	0.89887	0.0:0.0:1.0:0.0	.	1054;1052;1051;1054	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	N	1055;890;657;1052;1055;835	.	ENSP00000341939:T657N	T	-	2	0	KIAA0430	15617277	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.372000	0.79612	2.293000	0.77203	0.563000	0.77884	ACC			0.448	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252131.2		NM_014647	
ERI2	112479	broad.mit.edu	37	16	20809122	20809122	+	Missense_Mutation	SNP	G	G	T	rs76921366	byFrequency	TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr16:20809122G>T	ENST00000357967.4	-	9	2042	c.2000C>A	c.(1999-2001)aCa>aAa	p.T667K	ERI2_ENST00000563117.1_Missense_Mutation_p.T574K|ERI2_ENST00000389345.5_Missense_Mutation_p.T402K|ERI2_ENST00000564349.1_Missense_Mutation_p.T574K|ERI2_ENST00000300005.3_Intron|ERI2_ENST00000569729.1_3'UTR	NM_001142725.1	NP_001136197.1	A8K979	ERI2_HUMAN	ERI1 exoribonuclease family member 2	667							exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(2)	11						AATATGGCTTGTTTCTGGAGA	0.378																																					p.T667K													.	ERI2	50		0			c.C2000A												83.0	81.0	81.0					16																	20809122		692	1591	2283	SO:0001583	missense	112479	exon9			TGGCTTGTTTCTG	BC010503	CCDS10590.1, CCDS45436.1	16p12.3	2014-02-18	2009-10-07	2008-12-16	ENSG00000196678	ENSG00000196678		"""Enhanced RNAi three prime mRNA exonucleases"""	30541	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 2 (C.elegans)"", ""exoribonuclease 2"", ""zinc finger, GRF-type containing 5"""		"""exonuclease domain containing 1"""	EXOD1		10819331	Standard	NM_080663		Approved	KIAA1504, MGC16943, ZGRF5	uc010vbb.1	A8K979	OTTHUMG00000131557	ENST00000357967.4:c.2000C>A	16.37:g.20809122G>T	ENSP00000350651:p.Thr667Lys		83	0.0481927711	4		155	0.10	15	NM_001142725	14	0.14	2	Q6ZSJ2|Q96FR9|Q9P224|Q9Y6V3	Missense_Mutation	SNP	ENST00000357967.4	37	CCDS45436.1	.	.	.	.	.	.	.	.	.	.	G	3.249	-0.153752	0.06585	.	.	ENSG00000196678	ENST00000357967;ENST00000389345	T;T	0.19669	2.17;2.13	5.67	-1.93	0.07594	.	0.481969	0.20229	N	0.096535	T	0.12944	0.0314	L	0.35723	1.085	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.14227	-1.0480	10	0.52906	T	0.07	-1.442	5.4443	0.16527	0.2501:0.0:0.5369:0.213	.	667	A8K979	ERI2_HUMAN	K	667;402	ENSP00000350651:T667K;ENSP00000373996:T402K	ENSP00000350651:T667K	T	-	2	0	ERI2	20716623	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-0.187000	0.09656	-0.480000	0.06803	-0.813000	0.03139	ACA			0.378	ERI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_080663	
PKD1L2	114780	broad.mit.edu	37	16	81146189	81146190	+	RNA	INS	-	-	A	rs558484764|rs59722247|rs11642587|rs59462829	byFrequency	TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr16:81146189_81146190insA	ENST00000534142.1	-	0	1161				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						tgatgatgagggggaggaggag	0.495																																					.													.	PKD1L2	361		0			.																																											114780	.			GATGAGGGGGAGG	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81146189_81146190insA			4	0	0		6	0.33	2	.	0		0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	INS	ENST00000534142.1	37																																																																																						0.495	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene		OTTHUMT00000387969.1			
PKD1L2	114780	broad.mit.edu	37	16	81146190	81146191	+	RNA	INS	-	-	GA	rs558484764|rs11642587|rs117593850|rs59462829	byFrequency	TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr16:81146190_81146191insGA	ENST00000534142.1	-	0	1161				PKD1L2_ENST00000533478.1_RNA|PKD1L2_ENST00000525539.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						gatgatgagggggaggaggagg	0.49																																					.													.	PKD1L2	361		0			.																																											114780	.			ATGAGGGGGAGGA	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81146190_81146191insGA			4	0	0		6	0.33	2	.	0		0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	INS	ENST00000534142.1	37																																																																																						0.490	PKD1L2-009	PUTATIVE	basic|exp_conf	processed_transcript	polymorphic_pseudogene		OTTHUMT00000387969.1			
ALOX12B	242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7982769	7982769	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr17:7982769G>A	ENST00000319144.4	-	8	1276	c.1016C>T	c.(1015-1017)cCc>cTc	p.P339L	ALOX12B_ENST00000577351.1_5'Flank|AC129492.6_ENST00000399413.3_5'Flank	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	339	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CAGGCAGAGGGGGGCGCAGTG	0.672										Multiple Myeloma(8;0.094)																											p.P339L													.	.			0			c.C1016T												21.0	19.0	20.0					17																	7982769		2123	4154	6277	SO:0001583	missense	242	exon8			CAGAGGGGGGCGC	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1016C>T	17.37:g.7982769G>A	ENSP00000315167:p.Pro339Leu		201	0	0		197	0.17	34	NM_001139	0		0		Missense_Mutation	SNP	ENST00000319144.4	37	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	G	33	5.206096	0.95033	.	.	ENSG00000179477	ENST00000319144	D	0.91894	-2.93	4.69	4.69	0.59074	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.97068	0.9042	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98204	1.0469	10	0.87932	D	0	-26.6189	16.7891	0.85583	0.0:0.0:1.0:0.0	.	339	O75342	LX12B_HUMAN	L	339	ENSP00000315167:P339L	ENSP00000315167:P339L	P	-	2	0	ALOX12B	7923494	1.000000	0.71417	0.941000	0.38009	0.928000	0.56348	9.589000	0.98235	2.352000	0.79861	0.442000	0.29010	CCC			0.672	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226984.3			
PLD6	201164	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	17109307	17109307	+	Silent	SNP	C	C	A	rs551772087		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr17:17109307C>A	ENST00000321560.3	-	1	322	c.294G>T	c.(292-294)ctG>ctT	p.L98L	RP11-45M22.4_ENST00000427497.3_Intron	NM_178836.3	NP_849158.2	Q8N2A8	PLD6_HUMAN	phospholipase D family, member 6	98					DNA methylation involved in gamete generation (GO:0043046)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|meiotic nuclear division (GO:0007126)|mitochondrial fusion (GO:0008053)|P granule organization (GO:0030719)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|piRNA metabolic process (GO:0034587)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	cardiolipin hydrolase activity (GO:0035755)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)	2						AGAAGGCGAACAGGCAGAGAT	0.731													C|||	1	0.000199681	0.0008	0.0	5008	,	,		11874	0.0		0.0	False		,,,				2504	0.0				p.L98L													.	PLD6	9		0			c.G294T												5.0	5.0	5.0					17																	17109307		2100	4130	6230	SO:0001819	synonymous_variant	201164	exon1			GGCGAACAGGCAG	AK090899	CCDS11182.1	17p11.2	2008-08-14			ENSG00000179598	ENSG00000179598			30447	protein-coding gene	gene with protein product		614960				12477932	Standard	NM_178836		Approved		uc002gqz.3	Q8N2A8	OTTHUMG00000059278	ENST00000321560.3:c.294G>T	17.37:g.17109307C>A			48	0.0208333333	1		31	0.19	6	NM_178836	1	0.00	0	Q8N5Y1	Silent	SNP	ENST00000321560.3	37	CCDS11182.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.620225	0.28801	.	.	ENSG00000179598	ENST00000427497	.	.	.	4.26	-4.22	0.03800	.	.	.	.	.	T	0.66218	0.2767	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71371	-0.4613	5	0.87932	D	0	-7.0137	10.6344	0.45556	0.1528:0.4722:0.375:0.0	.	.	.	.	F	72	.	ENSP00000394249:V72F	V	-	1	0	PLD6	17050032	.	.	0.953000	0.39169	0.886000	0.51366	.	.	-0.426000	0.07360	0.449000	0.29647	GTT			0.731	PLD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131600.2		NM_178836	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346594	39346594	+	Silent	SNP	C	C	T	rs377187211|rs148036927		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr17:39346594C>T	ENST00000398470.1	+	1	456	c.456C>T	c.(454-456)acC>acT	p.T152T	KRTAP9-1_ENST00000377723.3_Intron|KRTAP9-1_ENST00000318329.5_Silent_p.T69T	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	152	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)		p.T152_C153>S(2)		breast(1)|lung(3)	4						GCCAGCCCACCTGCTGTGGGT	0.582																																					p.T152T													KRTAP9-1_ENST00000398470,colon,carcinoma,+2,2	KRTAP9-1_ENST00000398470	2	2	2	Complex - deletion inframe(2)	breast(2)	c.C456T																																									SO:0001819	synonymous_variant	728318	exon1			GCCCACCTGCTGT	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	ENST00000398470.1:c.456C>T	17.37:g.39346594C>T			51	0	0		80	0.05	4	NM_001190460	0		0		Silent	SNP	ENST00000398470.1	37	CCDS56029.1																																																																																					0.582	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257781.1			
FZR1	51343	broad.mit.edu	37	19	3531983	3531983	+	Missense_Mutation	SNP	A	A	C	rs200584048		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr19:3531983A>C	ENST00000395095.3	+	9	898	c.898A>C	c.(898-900)Acc>Ccc	p.T300P	FZR1_ENST00000313639.8_Missense_Mutation_p.T211P|FZR1_ENST00000441788.2_Missense_Mutation_p.T300P	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	300					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACATCCGCACCCCGCCACT	0.711																																					p.T300P													.	FZR1	42		0			c.A898C												8.0	10.0	9.0					19																	3531983		2136	4221	6357	SO:0001583	missense	51343	exon9			ATCCGCACCCCGC	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.898A>C	19.37:g.3531983A>C	ENSP00000378529:p.Thr300Pro		30	0.3	9		31	0.42	13	NM_001136198	74	0.16	12	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.537243	0.65085	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.59502	1.35;1.35;0.26	5.42	1.97	0.26223	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.250630	0.46758	D	0.000275	T	0.64360	0.2591	M	0.69248	2.105	0.51012	D	0.999904	B;P;P	0.47034	0.352;0.725;0.889	B;P;P	0.58013	0.163;0.533;0.831	T	0.61584	-0.7033	10	0.62326	D	0.03	-34.4525	5.2095	0.15308	0.6487:0.0:0.0798:0.2715	.	300;211;300	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	P	300;300;211	ENSP00000410369:T300P;ENSP00000378529:T300P;ENSP00000321800:T211P	ENSP00000321800:T211P	T	+	1	0	FZR1	3482983	0.703000	0.27826	0.927000	0.36925	0.829000	0.46940	1.802000	0.38853	0.304000	0.22809	0.459000	0.35465	ACC			0.711	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000452869.2		NM_016263	
HMG20B	10362	mdanderson.org	37	19	3573771	3573771	+	Silent	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr19:3573771G>T	ENST00000333651.6	+	3	195	c.120G>T	c.(118-120)gcG>gcT	p.A40A	MFSD12_ENST00000591878.1_5'UTR|HMG20B_ENST00000585741.1_3'UTR	NM_006339.2	NP_006330.2	Q9P0W2	HM20B_HUMAN	high mobility group 20B	40					blood coagulation (GO:0007596)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of protein sumoylation (GO:0033234)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCACGCGCGGGCGAGAAGG	0.741																																					p.A40A													.	.			0			c.G120T												11.0	17.0	15.0					19																	3573771		1927	4093	6020	SO:0001819	synonymous_variant	10362	exon3			ACGCGCGGGCGAG	BC003505	CCDS45919.1	19p13.3	2011-07-01	2011-04-05		ENSG00000064961	ENSG00000064961		"""High mobility group / Non-canonical"""	5002	protein-coding gene	gene with protein product	"""HMG box domain containing 2"""	605535	"""high-mobility group 20B"""			10773667	Standard	NM_006339		Approved	SOXL, HMGX2, BRAF35, SMARCE1r, BRAF25, HMGXB2	uc002lya.3	Q9P0W2	OTTHUMG00000150437	ENST00000333651.6:c.120G>T	19.37:g.3573771G>T			40	0	0		49	0.06	3	NM_006339	40	0.00	0	A6NMS5|D6W616|Q6IBP8|Q8NBD5|Q9HD21|Q9Y491|Q9Y4A2	Silent	SNP	ENST00000333651.6	37	CCDS45919.1																																																																																					0.741	HMG20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318088.1		NM_006339	
TIMM44	10469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7998431	7998431	+	Silent	SNP	G	G	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr19:7998431G>A	ENST00000270538.3	-	7	976	c.708C>T	c.(706-708)caC>caT	p.H236H	TIMM44_ENST00000598968.1_5'Flank	NM_006351.3	NP_006342.2	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44 homolog (yeast)	236					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			NS(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	17						TGGAGTCCTTGTGCAGCACGA	0.652																																					p.H236H													.	.			0			c.C708T												231.0	213.0	219.0					19																	7998431		2203	4300	6503	SO:0001819	synonymous_variant	10469	exon7			GTCCTTGTGCAGC	AF026030	CCDS12192.1	19p13.3-p13.2	2008-07-04				ENSG00000104980			17316	protein-coding gene	gene with protein product		605058				10848612, 10339406	Standard	NM_006351		Approved	TIM44	uc002miz.3	O43615		ENST00000270538.3:c.708C>T	19.37:g.7998431G>A			163	0	0		169	0.17	29	NM_006351	188	0.31	59	A8K0R9|D6W664|Q8N193	Silent	SNP	ENST00000270538.3	37	CCDS12192.1																																																																																					0.652	TIMM44-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461596.3			
RAD23A	5886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13058807	13058807	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr19:13058807T>A	ENST00000586534.1	+	2	279	c.218T>A	c.(217-219)gTc>gAc	p.V73D	RAD23A_ENST00000316856.3_Missense_Mutation_p.V73D|RAD23A_ENST00000588826.2_3'UTR|RAD23A_ENST00000592268.1_Missense_Mutation_p.V73D|RAD23A_ENST00000541222.1_5'UTR			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	73	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						AACTTTGTGGTCGTCATGGTG	0.572								Nucleotide excision repair (NER)																													p.V73D													RAD23A,NS,carcinoma,+1,1	RAD23A	1	1	0			c.T218A												158.0	145.0	149.0					19																	13058807		2203	4300	6503	SO:0001583	missense	5886	exon2			TTGTGGTCGTCAT		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.218T>A	19.37:g.13058807T>A	ENSP00000467024:p.Val73Asp		62	0	0		58	0.14	8	NM_005053	295	0.29	87	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	37	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084150	0.76642	.	.	ENSG00000179262	ENST00000316856	T	0.77489	-1.1	4.84	4.84	0.62591	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.64402	D	0.000001	D	0.89839	0.6831	M	0.91354	3.2	0.80722	D	1	D;D;D	0.89917	0.999;0.98;1.0	D;P;D	0.91635	0.999;0.885;0.999	D	0.91969	0.5585	10	0.87932	D	0	-42.1099	13.3979	0.60865	0.0:0.0:0.0:1.0	.	73;90;73	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	D	73	ENSP00000321365:V73D	ENSP00000321365:V73D	V	+	2	0	RAD23A	12919807	1.000000	0.71417	0.963000	0.40424	0.980000	0.70556	5.574000	0.67424	1.803000	0.52742	0.528000	0.53228	GTC			0.572	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000452752.1		NM_005053	
BRD4	23476	broad.mit.edu	37	19	15350233	15350233	+	Silent	SNP	C	C	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr19:15350233C>T	ENST00000263377.2	-	17	3767	c.3546G>A	c.(3544-3546)caG>caA	p.Q1182Q		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1182	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			TCTTCGGCTCCTGTTTCTGTT	0.632			T	C15orf55	lethal midline carcinoma of young people																																p.Q1182Q				Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172		0			c.G3546A												70.0	70.0	70.0					19																	15350233		2203	4300	6503	SO:0001819	synonymous_variant	23476	exon17			CGGCTCCTGTTTC	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3546G>A	19.37:g.15350233C>T			161	0	0		166	0.02	4	NM_058243	128	0.02	2	O60433|Q4G0X8|Q86YS8|Q96PD3	Silent	SNP	ENST00000263377.2	37	CCDS12328.1																																																																																					0.632	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000465800.3		NM_058243	
LYPD3	27076	mdanderson.org	37	19	43967282	43967282	+	Silent	SNP	C	C	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr19:43967282C>T	ENST00000244333.3	-	4	628	c.540G>A	c.(538-540)acG>acA	p.T180T		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	180	UPAR/Ly6 2.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				CCTCACCTGCCGTCAAGGTGA	0.637																																					p.T180T													.	.			0			c.G540A												86.0	79.0	81.0					19																	43967282		2203	4300	6503	SO:0001819	synonymous_variant	27076	exon4			ACCTGCCGTCAAG	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.540G>A	19.37:g.43967282C>T			53	0	0		37	0.08	3	NM_014400	6	0.00	0	Q9UJ74	Silent	SNP	ENST00000244333.3	37	CCDS12620.1																																																																																					0.637	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463177.1		NM_014400	
ANKRD20A8P	729171	broad.mit.edu	37	2	95518674	95518674	+	RNA	DEL	G	G	-	rs200580888		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr2:95518674delG	ENST00000432432.2	-	0	605					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		AAAAAAAAAAGAATAACCCTG	0.274																																					.													.	.			0			.																																											0	.			AAAAAAGAATAAC			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95518674delG			8	0	0		6	0.33	2	.	0		0	A6NC18	RNA	DEL	ENST00000432432.2	37																																																																																						0.274	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	pseudogene		OTTHUMT00000451404.1			
AVP	551	mdanderson.org	37	20	3063730	3063730	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr20:3063730G>A	ENST00000380293.3	-	2	264	c.215C>T	c.(214-216)gCg>gTg	p.A72V		NM_000490.4	NP_000481.2	P01185	NEU2_HUMAN	arginine vasopressin	72					cell-cell signaling (GO:0007267)|ERK1 and ERK2 cascade (GO:0070371)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|hyperosmotic salinity response (GO:0042538)|locomotory behavior (GO:0007626)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of female receptivity (GO:0007621)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of renal sodium excretion (GO:0035813)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to testosterone (GO:0033574)|signal transduction (GO:0007165)|social behavior (GO:0035176)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)|water transport (GO:0006833)	cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|neuropeptide hormone activity (GO:0005184)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|signal transducer activity (GO:0004871)|V1A vasopressin receptor binding (GO:0031894)			central_nervous_system(1)|prostate(1)|skin(1)	3				COAD - Colon adenocarcinoma(99;0.00643)		GCAGCGCAGCGCCTCAGCCGT	0.746																																					p.A72V													.	.			0			c.C215T												5.0	6.0	6.0					20																	3063730		2018	4019	6037	SO:0001583	missense	551	exon2			CGCAGCGCCTCAG	M25647	CCDS13045.1	20p13	2014-09-17	2008-07-31		ENSG00000101200	ENSG00000101200		"""Endogenous ligands"""	894	protein-coding gene	gene with protein product	"""antidiuretic hormone"", ""neurophysin II"", ""diabetes insipidus"", ""neurohypophyseal"", ""prepro-AVP-NP II"", ""prepro-arginine-vasopressin-neurophysin II"""	192340		ARVP		1840604	Standard	NM_000490		Approved	ADH	uc002whu.3	P01185	OTTHUMG00000031733	ENST00000380293.3:c.215C>T	20.37:g.3063730G>A	ENSP00000369647:p.Ala72Val		13	0	0		10	0.30	3	NM_000490	11	0.00	0	A0AV35|O14935	Missense_Mutation	SNP	ENST00000380293.3	37	CCDS13045.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397458	0.83120	.	.	ENSG00000101200	ENST00000380293	D	0.97888	-4.59	4.71	2.66	0.31614	.	0.276683	0.39341	N	0.001384	D	0.96605	0.8892	M	0.70595	2.14	0.32368	N	0.556215	D	0.55800	0.973	P	0.46659	0.523	D	0.96179	0.9129	10	0.72032	D	0.01	.	9.9266	0.41496	0.0774:0.1384:0.7842:0.0	.	72	P01185	NEU2_HUMAN	V	72	ENSP00000369647:A72V	ENSP00000369647:A72V	A	-	2	0	AVP	3011730	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	5.130000	0.64745	0.968000	0.38212	0.491000	0.48974	GCG			0.746	AVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077713.2		NM_000490	
RRBP1	6238	bcgsc.ca	37	20	17639834	17639834	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr20:17639834T>C	ENST00000377813.1	-	3	1622	c.1319A>G	c.(1318-1320)aAg>aGg	p.K440R	RRBP1_ENST00000377807.2_Intron|RRBP1_ENST00000246043.4_Missense_Mutation_p.K440R|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000360807.4_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	440	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CTCGGCCTTCTTGCCCTGGTT	0.642																																					.													.	RRBP1	157		0			.																																									SO:0001583	missense	6238	.			GCCTTCTTGCCCT	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.1319A>G	20.37:g.17639834T>C	ENSP00000367044:p.Lys440Arg		242	0.0165289256	4		257	0.07	17	.	837	0.07	59	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		.	.	.	.	.	.	.	.	.	.	T	10.88	1.476573	0.26511	.	.	ENSG00000125844	ENST00000377813;ENST00000246043	T;T	0.42513	0.97;0.97	4.66	2.37	0.29283	.	0.203139	0.24445	N	0.038471	T	0.44746	0.1308	.	.	.	0.50467	D	0.999879	.	.	.	.	.	.	T	0.21621	-1.0240	7	0.40728	T	0.16	-15.1084	8.065	0.30654	0.0:0.1767:0.0:0.8233	.	.	.	.	R	440	ENSP00000367044:K440R;ENSP00000246043:K440R	ENSP00000246043:K440R	K	-	2	0	RRBP1	17587834	0.000000	0.05858	0.018000	0.16275	0.000000	0.00434	-0.433000	0.06948	0.364000	0.24374	-1.243000	0.01532	AAG			0.642	RRBP1-002	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000078125.1		NM_001042576	
NINL	22981	mdanderson.org	37	20	25439019	25439019	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr20:25439019C>T	ENST00000278886.6	-	22	3916	c.3843G>A	c.(3841-3843)cgG>cgA	p.R1281R	NINL_ENST00000464285.1_5'UTR|NINL_ENST00000422516.1_Splice_Site_p.R932R	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1281					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CCCCACTTACCCGCTGTGCAT	0.647																																					p.R1281R													.	.			0			c.G3843A												76.0	66.0	69.0					20																	25439019		2203	4300	6503	SO:0001630	splice_region_variant	22981	exon22			ACTTACCCGCTGT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3843+1G>A	20.37:g.25439019C>T			36	0	0		20	0.15	3	NM_025176	39	0.00	0	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	ENST00000278886.6	37	CCDS33452.1																																																																																					0.647	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078445.3		NM_025176	Silent
FRG1B	284802	broad.mit.edu	37	20	29632635	29632635	+	Missense_Mutation	SNP	C	C	G	rs375238322		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr20:29632635C>G	ENST00000278882.3	+	8	830	c.450C>G	c.(448-450)gaC>gaG	p.D150E	FRG1B_ENST00000358464.4_Missense_Mutation_p.D150E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	150										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCTTCCAAGACCACAAACTTA	0.294																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	0	.			CCAAGACCACAAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.450C>G	20.37:g.29632635C>G	ENSP00000278882:p.Asp150Glu		352	0	0		650	0.01	7	.	104	0.10	10	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	14.68	2.606729	0.46527	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.44	-0.392	0.12442	.	0.054733	0.64402	U	0.000001	T	0.48995	0.1531	.	.	.	0.40619	D	0.981745	P	0.47302	0.893	P	0.49085	0.6	T	0.42682	-0.9437	8	0.46703	T	0.11	.	5.1111	0.14809	0.0:0.6492:0.0:0.3508	.	150	Q9BZ01	FRG1B_HUMAN	E	150	.	ENSP00000278882:D150E	D	+	3	2	FRG1B	28246296	1.000000	0.71417	0.994000	0.49952	0.944000	0.59088	0.699000	0.25586	-0.105000	0.12132	0.398000	0.26397	GAC			0.294	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2	rescued with RNA-seq	NR_003579	
BCAS1	8537	broad.mit.edu	37	20	52557949	52557950	+	IGR	INS	-	-	TT	rs72548465|rs201903487|rs141488543|rs2870294		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr20:52557949_52557950insTT	ENST00000395961.3	-	0	3303				AC005220.3_ENST00000450473.1_RNA	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			gtgtgtgtgtgtgtgtgtgcgc	0.5																																					.													.	.			0			.									194,519,1821		59,6,70,144,225,763						1.3	0.0		dbSNP_101	4	657,726,3403		150,19,338,195,317,1374	no	intergenic				209,25,408,339,542,2137	A1A1,A1A2,A1R,A2A2,A2R,RR		28.8968,28.1373,28.6339				851,1245,5224				SO:0001628	intergenic_variant	0	.			GTGTGTGTGTGTG	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772		20.37:g.52557949_52557950insTT			16	0	0		65	0.17	11	.	0		0	A0AVG5|Q68CZ3	RNA	INS	ENST00000395961.3	37	CCDS13444.1																																																																																					0.500	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079766.2		NM_003657	
C20orf195	79025	mdanderson.org	37	20	62187284	62187284	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr20:62187284C>A	ENST00000370098.3	+	2	360	c.268C>A	c.(268-270)Cag>Aag	p.Q90K	C20orf195_ENST00000370097.1_Missense_Mutation_p.Q90K	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	90						extracellular vesicular exosome (GO:0070062)				large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			CCTGGGCGACCAGAACCCGCT	0.627																																					p.Q90K													.	.			0			c.C268A												56.0	50.0	52.0					20																	62187284		2203	4300	6503	SO:0001583	missense	79025	exon2			GGCGACCAGAACC		CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.268C>A	20.37:g.62187284C>A	ENSP00000359116:p.Gln90Lys		16	0	0		21	0.14	3	NM_024059	5	0.00	0		Missense_Mutation	SNP	ENST00000370098.3	37	CCDS13526.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045080	0.75846	.	.	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.37	5.37	0.77165	.	0.000000	0.49305	D	0.000146	T	0.56587	0.1995	L	0.32530	0.975	0.33347	D	0.570618	D	0.54207	0.965	P	0.55615	0.78	T	0.68704	-0.5338	9	0.72032	D	0.01	-31.3003	14.6741	0.68967	0.0:0.8548:0.1452:0.0	.	90	Q9BVV2	CT195_HUMAN	K	90	.	ENSP00000359115:Q90K	Q	+	1	0	C20orf195	61657728	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.917000	0.48821	2.516000	0.84829	0.655000	0.94253	CAG			0.627	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080155.1		NM_024059	
BAGE2	85319	broad.mit.edu	37	21	11096512	11096516	+	RNA	DEL	GTTTT	GTTTT	-	rs139100150|rs150200394|rs573901432|rs150216981	byFrequency	TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	GTTTT	GTTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr21:11096512_11096516delGTTTT	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ccATTTTTAAgttttgttttgtttt	0.493																																					.													.	.			0			.																																											85319	.			TTTTAAGTTTTGT	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11096522_11096526delGTTTT			6	0	0		6	0.33	2	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.493	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
HIC2	23119	broad.mit.edu;mdanderson.org	37	22	21799538	21799538	+	Silent	SNP	C	C	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr22:21799538C>A	ENST00000443632.2	+	2	726	c.354C>A	c.(352-354)acC>acA	p.T118T	HIC2_ENST00000407598.2_Silent_p.T118T|HIC2_ENST00000407464.2_Silent_p.T118T			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	118					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				ACTTCAGCACCCTCCTCACTG	0.637																																					p.T118T	NSCLC(23;437 858 2282 27947 40366)												.	HIC2	42		0			c.C354A												49.0	51.0	51.0					22																	21799538		2203	4300	6503	SO:0001819	synonymous_variant	23119	exon3			CAGCACCCTCCTC	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.354C>A	22.37:g.21799538C>A			58	0	0		75	0.08	6	NM_015094	20	0.50	10	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Silent	SNP	ENST00000443632.2	37	CCDS13789.1																																																																																					0.637	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320061.2			
POM121L1P	25812	mdanderson.org	37	22	22979724	22979724	+	RNA	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr22:22979724G>T	ENST00000402027.1	-	0	1934					NR_024591.1		Q3SYA9	P12L1_HUMAN	POM121 transmembrane nucleoporin-like 1, pseudogene																		CCGTGTCCTGGCAGCATTTGG	0.453																																					.													.	.			0			.																																											25812	.			GTCCTGGCAGCAT			22q11.22	2013-10-11	2012-03-13	2009-01-15	ENSG00000183169	ENSG00000183169			16439	pseudogene	pseudogene	"""POM121-like 2"""		"""POM121 membrane glycoprotein-like 1 (rat)"", ""POM121 membrane glycoprotein-like 1, pseudogene"""	POM121L1		9074928	Standard	NR_024591		Approved		uc011ait.1	Q3SYA9	OTTHUMG00000151169		22.37:g.22979724G>T			21	0	0		40	0.08	3	.	0		0		RNA	SNP	ENST00000402027.1	37																																																																																						0.453	POM121L1P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene		OTTHUMT00000468457.1		NR_024591	
POM121L9P	29774	broad.mit.edu	37	22	24657088	24657088	+	RNA	DEL	A	A	-	rs397843151		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr22:24657088delA	ENST00000414583.2	+	0	2077					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		GGGAGGGAAGAGGCGGGTCCA	0.617																																					.													.	.			0			.																																											0	.			GGGAAGAGGCGGG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24657088delA			9	0	0		11	0.27	3	.	0		0		RNA	DEL	ENST00000414583.2	37																																																																																						0.617	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
KALRN	8997	mdanderson.org	37	3	124114183	124114183	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr3:124114183G>T	ENST00000240874.3	+	12	2315	c.2158G>T	c.(2158-2160)Gag>Tag	p.E720*	KALRN_ENST00000360013.3_Nonsense_Mutation_p.E720*|KALRN_ENST00000460856.1_Nonsense_Mutation_p.E720*	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	720					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GGAGCCCAGCGAGGCCAGGTC	0.572																																					p.E720X													.	.			0			c.G2158T												35.0	29.0	31.0					3																	124114183		2203	4300	6503	SO:0001587	stop_gained	8997	exon12			CCCAGCGAGGCCA	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.2158G>T	3.37:g.124114183G>T	ENSP00000240874:p.Glu720*		47	0	0		49	0.06	3	NM_003947	4	0.00	0	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Nonsense_Mutation	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	G	39	7.651412	0.98412	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013;ENST00000439170	.	.	.	4.96	4.96	0.65561	.	0.480009	0.20334	N	0.094377	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	11.0637	0.47964	0.0:0.0:0.8152:0.1848	.	.	.	.	X	720;720;720;196	.	ENSP00000240874:E720X	E	+	1	0	KALRN	125596873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.675000	0.54605	2.756000	0.94617	0.655000	0.94253	GAG			0.572	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000258843.4		NM_003947	
Unknown	0	bcgsc.ca	37	4	49553037	49553037	+	IGR	SNP	A	A	T	rs58062155		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr4:49553037A>T								AC118282.4 (341572 upstream) : AC119751.5 (32004 downstream)																							CTAAATAAGAAGGAACTCACA	0.294																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ATAAGAAGGAACT																													4.37:g.49553037A>T			46	0.0217391304	1		110	0.18	20	.	0		0		RNA	SNP		37																																																																																					0	0.294										
FRAS1	80144	mdanderson.org	37	4	79460492	79460492	+	Silent	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr4:79460492G>T	ENST00000264895.6	+	73	11783	c.11343G>T	c.(11341-11343)gtG>gtT	p.V3781V		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3777					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCCATGATGTGCCTTTTGAGG	0.413																																					p.V3781V													.	.			0			c.G11343T												155.0	152.0	153.0					4																	79460492		1922	4146	6068	SO:0001819	synonymous_variant	80144	exon73			TGATGTGCCTTTT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11343G>T	4.37:g.79460492G>T			43	0	0		86	0.07	6	NM_025074	1	0.00	0	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	G	9.455	1.091624	0.20471	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.87	3.23	0.37069	.	.	.	.	.	T	0.54631	0.1870	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45293	-0.9271	4	.	.	.	.	6.1104	0.20097	0.2706:0.1242:0.6052:0.0	.	.	.	.	S	2010	.	.	A	+	1	0	FRAS1	79679516	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.699000	0.37804	0.393000	0.25203	0.655000	0.94253	GCC			0.413	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
SLC9B1	150159	ucsc.edu	37	4	103822298	103822298	+	Silent	SNP	C	C	T	rs3175325	byFrequency	TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr4:103822298C>T	ENST00000296422.7	-	12	1665	c.1524G>A	c.(1522-1524)caG>caA	p.Q508Q	SLC9B1_ENST00000394789.3_Intron|SLC9B1_ENST00000512651.2_5'UTR	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	508					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										ATGTTGACAACTGCAGTTTTA	0.358																																					p.Q508Q													.	.			0			c.G1524A												66.0	70.0	68.0					4																	103822298		1818	3378	5196	SO:0001819	synonymous_variant	150159	exon12			TGACAACTGCAGT	AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.1524G>A	4.37:g.103822298C>T			24	0.25	6		49	0.35	17	NM_139173	1	0.00	0	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Silent	SNP	ENST00000296422.7	37	CCDS34041.1																																																																																					0.358	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363841.1		NM_139173	
VCAN	1462	broad.mit.edu	37	5	82836890	82836890	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr5:82836890G>T	ENST00000265077.3	+	8	8633	c.8068G>T	c.(8068-8070)Gca>Tca	p.A2690S	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.A1703S|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2690	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ACTTCCCACGGCAACATCCCT	0.438																																					p.A2690S													.	VCAN	498		0			c.G8068T												105.0	97.0	100.0					5																	82836890		2203	4299	6502	SO:0001583	missense	1462	exon8			CCCACGGCAACAT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8068G>T	5.37:g.82836890G>T	ENSP00000265077:p.Ala2690Ser		64	0	0		115	0.03	4	NM_004385	130	0.00	0	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	7.426	0.637731	0.14386	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.35421	1.31;1.31	6.17	3.43	0.39272	.	0.817624	0.11043	N	0.605828	T	0.30135	0.0755	L	0.54323	1.7	0.20403	N	0.999906	B;B	0.30361	0.277;0.181	B;B	0.30495	0.116;0.054	T	0.28713	-1.0035	10	0.05620	T	0.96	.	10.2798	0.43532	0.0676:0.2551:0.6774:0.0	.	1703;2690	P13611-2;P13611	.;CSPG2_HUMAN	S	2690;1703	ENSP00000265077:A2690S;ENSP00000340062:A1703S	ENSP00000265077:A2690S	A	+	1	0	VCAN	82872646	0.185000	0.23213	0.096000	0.21009	0.067000	0.16453	1.042000	0.30303	0.474000	0.27392	-0.929000	0.02709	GCA			0.438	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000254092.3		NM_004385	
TNIP1	10318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150436337	150436337	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr5:150436337G>T	ENST00000389378.2	-	6	1205	c.617C>A	c.(616-618)tCc>tAc	p.S206Y	TNIP1_ENST00000521591.1_Missense_Mutation_p.S206Y|TNIP1_ENST00000315050.7_Missense_Mutation_p.S206Y|TNIP1_ENST00000523200.1_Missense_Mutation_p.S206Y|TNIP1_ENST00000524280.1_Missense_Mutation_p.S206Y|TNIP1_ENST00000523338.1_Missense_Mutation_p.S206Y|TNIP1_ENST00000518977.1_Missense_Mutation_p.S206Y|TNIP1_ENST00000522226.1_Missense_Mutation_p.S206Y|TNIP1_ENST00000520931.1_Missense_Mutation_p.S153Y	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	206	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGCAGAATGGAGGTGCGCTG	0.652																																					p.S206Y													.	.			0			c.C617A												42.0	38.0	39.0					5																	150436337		2203	4300	6503	SO:0001583	missense	10318	exon6			AGAATGGAGGTGC	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.617C>A	5.37:g.150436337G>T	ENSP00000374029:p.Ser206Tyr		98	0	0		77	0.16	12	NM_001252385	98	0.06	6	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616602	0.87359	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100	T;T;T;T;T;T;T;T;T;T	0.25912	2.36;2.39;2.39;2.39;2.39;2.39;2.39;2.42;2.42;1.77	5.09	5.09	0.68999	.	0.110564	0.64402	D	0.000005	T	0.53883	0.1824	M	0.76002	2.32	0.53688	D	0.999977	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.998;0.991;0.998;0.991;0.991;0.996;0.996	T	0.58329	-0.7655	10	0.87932	D	0	-19.5108	18.8607	0.92270	0.0:0.0:1.0:0.0	.	206;160;160;206;206;206;206	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	Y	153;206;206;206;163;163;168;206;206;206;206;206;163;153	ENSP00000429891:S153Y;ENSP00000374029:S206Y;ENSP00000317891:S206Y;ENSP00000428243:S206Y;ENSP00000428187:S206Y;ENSP00000430760:S206Y;ENSP00000430971:S206Y;ENSP00000429912:S206Y;ENSP00000431105:S206Y;ENSP00000428487:S153Y	ENSP00000317891:S206Y	S	-	2	0	TNIP1	150416530	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.540000	0.90641	2.525000	0.85131	0.655000	0.94253	TCC			0.652	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374914.1		NM_006058	
LOC202181	202181	broad.mit.edu	37	5	177059966	177059966	+	RNA	DEL	T	T	-	rs56016930		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr5:177059966delT	ENST00000515045.1	-	0	189					NR_026921.1																						CATAGTGGGATTTTTTTTTTT	0.358																																					.													.	.			0			.																																											0	.			GTGGGATTTTTTT																													5.37:g.177059966delT			7	0	0		10	0.50	5	.	0		0		RNA	DEL	ENST00000515045.1	37																																																																																						0.358	RP11-1277A3.2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000373167.1			
Unknown	0	bcgsc.ca	37	5	180541994	180541994	+	IGR	SNP	C	C	A			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr5:180541994C>A								BTNL9 (53471 upstream) : OR2V1 (9362 downstream)																							CAGATACCACCGGGAAGCTGT	0.507																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TACCACCGGGAAG																													5.37:g.180541994C>A			32	0	0		53	0.08	4	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.507										
ECI2	10455	mdanderson.org	37	6	4125592	4125592	+	Silent	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr6:4125592G>T	ENST00000380118.3	-	7	723	c.687C>A	c.(685-687)ggC>ggA	p.G229G	C6orf201_ENST00000430835.2_3'UTR|C6orf201_ENST00000380175.4_Intron|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000465828.1_Silent_p.G199G|ECI2_ENST00000361538.2_Silent_p.G199G|ECI2_ENST00000380125.2_Silent_p.G199G|ECI2_ENST00000413766.2_Silent_p.G62G			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	229	ECH-like.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						CTATAAAACAGCCCACAAATT	0.458																																					p.G229G													.	.			0			c.C687A												97.0	94.0	95.0					6																	4125592		2203	4300	6503	SO:0001819	synonymous_variant	10455	exon7			AAAACAGCCCACA	AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.687C>A	6.37:g.4125592G>T			66	0	0		51	0.06	3	NM_206836	46	0.00	0	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Silent	SNP	ENST00000380118.3	37	CCDS43420.2																																																																																					0.458	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039716.4		NM_006117	
ZNRD1-AS1	80862	hgsc.bcm.edu	37	6	30000857	30000857	+	RNA	SNP	A	A	G			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr6:30000857A>G	ENST00000376797.3	-	0	530				ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000421692.1_RNA|ZNRD1-AS1_ENST00000422224.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000437417.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		GATGGAATCCAAACAGATCCC	0.433																																					.													.	.			0			.																																											80862	.			GAATCCAAACAGA	AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.30000857A>G			13	0	0		41	0.15	6	.	0		0		RNA	SNP	ENST00000376797.3	37																																																																																						0.433	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	antisense		OTTHUMT00000253083.1		NR_026751	
GPR141	353345	broad.mit.edu	37	7	37780115	37780115	+	Silent	SNP	C	C	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr7:37780115C>T	ENST00000447769.1	+	4	409	c.120C>T	c.(118-120)ttC>ttT	p.F40F	GPR141_ENST00000334425.1_Silent_p.F40F|EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCATTCTTTTCCTCCTGGTGA	0.498																																					p.F40F													.	GPR141	79		0			c.C120T												107.0	110.0	109.0					7																	37780115		2203	4300	6503	SO:0001819	synonymous_variant	353345	exon1			TCTTTTCCTCCTG	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.120C>T	7.37:g.37780115C>T			100	0.06	6		170	0.09	16	NM_181791	0		0	A4D1X7|Q0VAR5|Q86SP3	Silent	SNP	ENST00000447769.1	37	CCDS5451.1																																																																																					0.498	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219943.2		NM_181791	
SCRIB	23513	mdanderson.org	37	8	144886857	144886857	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr8:144886857G>T	ENST00000320476.3	-	21	2896	c.2890C>A	c.(2890-2892)Ccc>Acc	p.P964T	SCRIB_ENST00000377533.3_Missense_Mutation_p.P883T|SCRIB_ENST00000356994.2_Missense_Mutation_p.P964T	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	964	Interaction with ARHGEF7.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCGGTGGGGGGTGAGGAATGT	0.711																																					p.P964T	Pancreas(51;966 1133 10533 14576 29674)												.	.			0			c.C2890A												17.0	18.0	18.0					8																	144886857		2198	4298	6496	SO:0001583	missense	23513	exon21			TGGGGGGTGAGGA	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.2890C>A	8.37:g.144886857G>T	ENSP00000322938:p.Pro964Thr		27	0	0		36	0.08	3	NM_182706	151	0.00	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	G	8.452	0.853258	0.17106	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533;ENST00000377539	T;T;T	0.39787	1.28;1.25;1.06	3.91	-0.359	0.12571	.	.	.	.	.	T	0.34454	0.0898	L	0.56769	1.78	0.30773	N	0.742878	B;P	0.36959	0.44;0.575	B;B	0.38755	0.05;0.281	T	0.38779	-0.9645	9	0.54805	T	0.06	.	2.3571	0.04298	0.1674:0.1212:0.491:0.2203	.	964;964	Q14160;Q14160-3	SCRIB_HUMAN;.	T	964;964;883;333	ENSP00000349486:P964T;ENSP00000322938:P964T;ENSP00000366756:P883T	ENSP00000322938:P964T	P	-	1	0	SCRIB	144958845	0.996000	0.38824	0.000000	0.03702	0.003000	0.03518	3.335000	0.52105	-0.333000	0.08476	-0.404000	0.06349	CCC			0.711	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000382215.1		NM_015356	
PGM5P2	595135	broad.mit.edu	37	9	69082757	69082758	+	lincRNA	INS	-	-	AT	rs371549424		TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr9:69082757_69082758insAT	ENST00000412376.1	-	0	1810_1811				PGM5P2_ENST00000591037.1_RNA																							TATTTTAAAACAAAGAGAAGCT	0.292																																					.													.	.			0			.																																											0	.			TTAAAACAAAGAG																													9.37:g.69082757_69082758insAT			7	0	0		10	0.40	4	.	0		0		RNA	INS	ENST00000412376.1	37																																																																																						0.292	RP11-87H9.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000143173.1			
ERCC6L2	375748	ucsc.edu;mdanderson.org	37	9	98732886	98732886	+	5'Flank	SNP	T	T	C			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr9:98732886T>C	ENST00000407474.3	+	0	0							Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2						DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										GCAGGGATCATGACAGCCACA	0.418																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	375748	.			GGATCATGACAGC	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289		9.37:g.98732886T>C	Exception_encountered		102	0	0		260	0.11	29	.	6	0.17	1	A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	ENST00000407474.3	37		.	.	.	.	.	.	.	.	.	.	T	17.66	3.445765	0.63178	.	.	ENSG00000182150	ENST00000402838	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0107	0.64495	0.0:0.0:0.0:1.0	.	.	.	.	R	32	.	.	X	+	1	0	C9orf102	97772707	1.000000	0.71417	0.946000	0.38457	0.971000	0.66376	4.079000	0.57613	2.233000	0.73108	0.454000	0.30748	TGA			0.418	ERCC6L2-201	KNOWN	basic	protein_coding	protein_coding				NM_001010895	
RAPGEF1	2889	mdanderson.org	37	9	134503341	134503341	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chr9:134503341T>C	ENST00000372189.3	-	9	1232	c.1109A>G	c.(1108-1110)gAc>gGc	p.D370G	RAPGEF1_ENST00000372195.1_Missense_Mutation_p.D387G|RAPGEF1_ENST00000481260.1_5'UTR|RAPGEF1_ENST00000372190.3_Missense_Mutation_p.D388G	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	370					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CTGCCCACTGTCCCTGTCCAG	0.607																																					p.D388G													.	.			0			c.A1163G												48.0	54.0	52.0					9																	134503341		2154	4271	6425	SO:0001583	missense	2889	exon9			CCACTGTCCCTGT	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1109A>G	9.37:g.134503341T>C	ENSP00000361263:p.Asp370Gly		52	0	0		50	0.06	3	NM_198679	85	0.00	0	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	37	CCDS48047.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.774167	0.90108	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000372191;ENST00000357686	T;T;T	0.45276	0.9;0.9;0.9	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.58177	0.2104	M	0.64997	1.995	0.54753	D	0.999983	D;D;D	0.62365	0.985;0.985;0.991	P;P;D	0.63877	0.831;0.831;0.919	T	0.57069	-0.7874	10	0.36615	T	0.2	.	14.1451	0.65347	0.0:0.0:0.0:1.0	.	387;370;388	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	G	370;387;264;370;388;350;296;65;387	ENSP00000361269:D387G;ENSP00000361263:D370G;ENSP00000361264:D388G	ENSP00000266110:D370G	D	-	2	0	RAPGEF1	133493162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.442000	0.80503	1.936000	0.56123	0.482000	0.46254	GAC			0.607	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000054759.2		NM_005312	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFY-01A-11D-A42Y-10	TCGA-2G-AAFY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6fcf0ebe-135e-4a5d-bce6-68fa0e4c3961	533341c5-782e-418a-8db9-996ff3f09e94	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P|PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4	24		0			c.T668C												57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro		165	0	0		371	0.01	5	NM_004650	94	0.00	0	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT			0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055687.1		NM_004650	
