#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MATN1	4146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	31196429	31196429	+	5'UTR	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:31196429G>A	ENST00000373765.4	-	0	5				MATN1-AS1_ENST00000454613.1_RNA|MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000414763.1_RNA|MATN1-AS1_ENST00000443076.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein						extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCCGGCACGGTTGTGGGAC	0.667																																					.													.	.			0			.												12.0	11.0	11.0					1																	31196429		1990	3872	5862	SO:0001623	5_prime_UTR_variant	4146	.			CGGCACGGTTGTG	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.-31C>T	1.37:g.31196429G>A			69	0	0		86	0.17	15	.	0		0	B2R7E3|Q5TBB9	RNA	SNP	ENST00000373765.4	37	CCDS336.1																																																																																					0.667	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010458.1		NM_002379	
GPBP1L1	60313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46124749	46124749	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:46124749T>G	ENST00000290795.3	-	3	1232	c.11A>C	c.(10-12)cAt>cCt	p.H4P	GPBP1L1_ENST00000355105.3_Missense_Mutation_p.H4P			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	4					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					AACAAAATCATGCTGCGCCAT	0.428																																					p.H4P													.	.			0			c.A11C												146.0	136.0	139.0					1																	46124749		2203	4300	6503	SO:0001583	missense	60313	exon4			AAATCATGCTGCG		CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.11A>C	1.37:g.46124749T>G	ENSP00000290795:p.His4Pro		46	0	0		85	0.09	8	NM_021639	248	0.28	69	D3DQ10|Q9H751	Missense_Mutation	SNP	ENST00000290795.3	37	CCDS528.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.042382	0.93685	.	.	ENSG00000159592	ENST00000290795;ENST00000355105	T;T	0.28666	1.6;1.6	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.56673	0.2001	M	0.69823	2.125	0.58432	D	0.999998	D	0.76494	0.999	D	0.83275	0.996	T	0.59804	-0.7385	10	0.87932	D	0	-18.5825	16.4323	0.83853	0.0:0.0:0.0:1.0	.	4	Q9HC44	GPBL1_HUMAN	P	4	ENSP00000290795:H4P;ENSP00000347224:H4P	ENSP00000290795:H4P	H	-	2	0	GPBP1L1	45897336	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.621000	0.83083	2.281000	0.76405	0.528000	0.53228	CAT			0.428	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000098375.1		NM_021639	
PLPPR5	163404	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	99470160	99470160	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:99470160G>A	ENST00000263177.4	-	1	289	c.68C>T	c.(67-69)aCg>aTg	p.T23M	LPPR5_ENST00000370188.3_Missense_Mutation_p.T23M|RP5-896L10.1_ENST00000425113.1_RNA|LPPR5_ENST00000534652.1_5'Flank	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		23						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										CAGCATCACCGTCCCTGCCAT	0.647																																					p.T23M													.	.			0			c.C68T												93.0	73.0	80.0					1																	99470160		2203	4299	6502	SO:0001583	missense	0	exon1			ATCACCGTCCCTG																												ENST00000263177.4:c.68C>T	1.37:g.99470160G>A	ENSP00000263177:p.Thr23Met		165	0	0		134	0.16	21	NM_001037317	0		0	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	ENST00000263177.4	37	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695152	0.68386	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.43294	0.95;0.95	3.87	1.88	0.25563	.	0.164835	0.53938	D	0.000058	T	0.44540	0.1298	M	0.74881	2.28	0.46416	D	0.999031	D;D	0.76494	0.999;0.999	D;P	0.67103	0.949;0.891	T	0.40720	-0.9548	10	0.46703	T	0.11	.	6.823	0.23866	0.0973:0.0:0.7275:0.1752	.	23;23	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	M	23	ENSP00000359207:T23M;ENSP00000263177:T23M	ENSP00000263177:T23M	T	-	2	0	AL161744.1	99242748	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.109000	0.94291	0.358000	0.24211	0.555000	0.69702	ACG			0.647	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000393221.1			
PHGDH	26227	mdanderson.org	37	1	120277316	120277316	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:120277316G>T	ENST00000369409.4	+	6	706	c.570G>T	c.(568-570)caG>caT	p.Q190H	PHGDH_ENST00000369407.3_Missense_Mutation_p.Q156H	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	190					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		GTGTTCAGCAGCTGCCCCTGG	0.527																																					p.Q190H													.	.			0			c.G570T												195.0	186.0	189.0					1																	120277316		2203	4300	6503	SO:0001583	missense	26227	exon6			TCAGCAGCTGCCC	BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.570G>T	1.37:g.120277316G>T	ENSP00000358417:p.Gln190His		51	0	0		36	0.08	3	NM_006623	560	0.00	0	B2RD08|Q5SZU3|Q9BQ01	Missense_Mutation	SNP	ENST00000369409.4	37	CCDS904.1	.	.	.	.	.	.	.	.	.	.	.	17.36	3.368937	0.61624	.	.	ENSG00000092621	ENST00000369409;ENST00000537497;ENST00000535091;ENST00000369407	T;T	0.80123	-1.34;-1.34	5.47	4.55	0.56014	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (1);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.69223	0.3087	N	0.14661	0.345	0.80722	D	1	D;P;P;P;D;P	0.67145	0.996;0.79;0.705;0.622;0.995;0.622	D;B;P;B;P;B	0.63381	0.914;0.381;0.6;0.274;0.86;0.274	T	0.66945	-0.5795	10	0.17369	T	0.5	-0.878	12.4031	0.55424	0.0818:0.0:0.9182:0.0	.	62;156;22;156;63;190	Q9UMY2;B3KSC3;F5GYN9;Q5SZU1;F5H634;O43175	.;.;.;.;.;SERA_HUMAN	H	190;63;22;156	ENSP00000358417:Q190H;ENSP00000358415:Q156H	ENSP00000358415:Q156H	Q	+	3	2	PHGDH	120078839	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.724000	0.61972	2.577000	0.86979	0.655000	0.94253	CAG			0.527	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033464.1		NM_006623	
BCL9	607	broad.mit.edu	37	1	147092151	147092151	+	Silent	SNP	T	T	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:147092151T>C	ENST00000234739.3	+	8	2930	c.2190T>C	c.(2188-2190)tcT>tcC	p.S730S		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	730	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GATCCAACTCTCAGATGATAC	0.537			T	"""IGH@, IGL@"""	B-ALL																																p.S730S				Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9	150		0			c.T2190C												42.0	42.0	42.0					1																	147092151		2203	4300	6503	SO:0001819	synonymous_variant	607	exon8			CAACTCTCAGATG	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.2190T>C	1.37:g.147092151T>C			86	0	0		145	0.02	3	NM_004326	42	0.00	0	Q5T489	Silent	SNP	ENST00000234739.3	37	CCDS30833.1																																																																																					0.537	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039468.1		NM_004326	
RUSC1	23623	broad.mit.edu	37	1	155292770	155292770	+	Silent	SNP	A	A	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:155292770A>C	ENST00000368352.5	+	2	1357	c.1206A>C	c.(1204-1206)ccA>ccC	p.P402P	RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368354.3_Silent_p.P402P|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368347.4_5'Flank|RUSC1_ENST00000368349.4_5'Flank|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000292254.4_5'Flank	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	402					positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CCCGGCCCCCACCCCCGCCTG	0.726																																					p.P402P													.	RUSC1	85		0			c.A1206C																																									SO:0001819	synonymous_variant	23623	exon2			GCCCCCACCCCCG	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1206A>C	1.37:g.155292770A>C			36	0.2777777778	10		36	0.47	17	NM_001105204	0		0	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																					0.726	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000039071.1			
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197115320	197115320	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr1:197115320G>T	ENST00000367409.4	-	1	504	c.248C>A	c.(247-249)cCg>cAg	p.P83Q	ASPM_ENST00000294732.7_Missense_Mutation_p.P83Q	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	83					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GTCCGCGGCCGGGAAGTGGGA	0.612																																					p.P83Q													.	.			0			c.C248A												104.0	109.0	107.0					1																	197115320		2203	4300	6503	SO:0001583	missense	259266	exon1			GCGGCCGGGAAGT	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.248C>A	1.37:g.197115320G>T	ENSP00000356379:p.Pro83Gln		71	0	0		106	0.19	20	NM_001206846	5	0.60	3	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965799	0.53507	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367406	T;T	0.62364	0.03;1.44	4.43	3.45	0.39498	.	0.094031	0.45606	D	0.000344	T	0.67392	0.2888	L	0.54323	1.7	0.33742	D	0.61954	D;B	0.59767	0.986;0.107	P;B	0.55749	0.783;0.044	T	0.74197	-0.3743	10	0.29301	T	0.29	.	13.917	0.63905	0.0:0.2024:0.7976:0.0	.	83;83	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	Q	83	ENSP00000356379:P83Q;ENSP00000294732:P83Q	ENSP00000294732:P83Q	P	-	2	0	ASPM	195381943	0.982000	0.34865	0.093000	0.20910	0.328000	0.28507	2.102000	0.41796	0.892000	0.36259	0.655000	0.94253	CCG			0.612	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000088256.1		NM_018136	
FRMD4A	55691	mdanderson.org	37	10	13698833	13698833	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr10:13698833G>T	ENST00000357447.2	-	22	3124	c.2756C>A	c.(2755-2757)gCg>gAg	p.A919E	FRMD4A_ENST00000378503.1_Missense_Mutation_p.A919E|FRMD4A_ENST00000358621.4_Missense_Mutation_p.A904E	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	919					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GGCACGGCCCGCGCCCTTGTC	0.741																																					p.A919E													FRMD4A,colon,carcinoma,0,1	FRMD4A	0	1	0			c.C2756A												26.0	26.0	26.0					10																	13698833		2199	4291	6490	SO:0001583	missense	55691	exon22			CGGCCCGCGCCCT	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2756C>A	10.37:g.13698833G>T	ENSP00000350032:p.Ala919Glu		20	0	0		18	0.11	2	NM_018027	0		0	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.481978	0.26598	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	D;D;D	0.83163	-1.69;-1.69;-1.69	3.26	3.26	0.37387	.	0.459802	0.23191	N	0.050903	T	0.68613	0.3020	N	0.08118	0	0.24690	N	0.993313	B	0.20459	0.045	B	0.22386	0.039	T	0.61978	-0.6951	10	0.45353	T	0.12	-4.5632	14.4754	0.67541	0.0:0.0:1.0:0.0	.	919	Q9P2Q2	FRM4A_HUMAN	E	904;919;919	ENSP00000351438:A904E;ENSP00000350032:A919E;ENSP00000367764:A919E	ENSP00000350032:A919E	A	-	2	0	FRMD4A	13738839	1.000000	0.71417	0.989000	0.46669	0.461000	0.32589	4.402000	0.59722	1.363000	0.46019	0.185000	0.17295	GCG			0.741	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000046889.1		NM_018027	
ARMC3	219681	broad.mit.edu	37	10	23270572	23270572	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr10:23270572G>A	ENST00000298032.5	+	10	1202	c.1118G>A	c.(1117-1119)cGg>cAg	p.R373Q	ARMC3_ENST00000409049.3_Missense_Mutation_p.R373Q|ARMC3_ENST00000376528.4_Missense_Mutation_p.R110Q|ARMC3_ENST00000409983.3_Missense_Mutation_p.R373Q	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	373						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAAGAGGTACGGGAAGCAGCA	0.438																																					p.R373Q													.	ARMC3	102		0			c.G1118A												96.0	83.0	88.0					10																	23270572		2203	4300	6503	SO:0001583	missense	219681	exon10			AGGTACGGGAAGC	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1118G>A	10.37:g.23270572G>A	ENSP00000298032:p.Arg373Gln		71	0.0281690141	2		44	0.20	9	NM_173081	0		0	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795586	0.31777	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.25	0.7	0.18099	Armadillo-like helical (1);Armadillo-type fold (1);	0.247257	0.45126	D	0.000391	T	0.16342	0.0393	N	0.17631	0.505	0.09310	N	0.999996	B;B	0.25007	0.116;0.043	B;B	0.27170	0.077;0.017	T	0.14559	-1.0468	10	0.37606	T	0.19	-25.2747	5.7172	0.17966	0.321:0.0:0.5391:0.14	.	373;373	Q5W041-4;Q5W041	.;ARMC3_HUMAN	Q	373;373;309;373;110	ENSP00000298032:R373Q;ENSP00000386943:R373Q;ENSP00000387288:R373Q;ENSP00000365711:R110Q	ENSP00000298032:R373Q	R	+	2	0	ARMC3	23310578	0.040000	0.19996	0.005000	0.12908	0.001000	0.01503	0.316000	0.19469	0.224000	0.20940	-0.918000	0.02743	CGG			0.438	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047197.2		NM_173081	
RTKN2	219790	broad.mit.edu	37	10	63995874	63995874	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr10:63995874G>T	ENST00000373789.3	-	6	733	c.637C>A	c.(637-639)Ctt>Att	p.L213I	RTKN2_ENST00000315289.2_5'UTR|RTKN2_ENST00000395265.1_Missense_Mutation_p.L213I	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	213					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					TCTTCTTGAAGCACTGAACTT	0.333																																					p.L213I													.	RTKN2	68		0			c.C637A												171.0	148.0	156.0					10																	63995874		2203	4300	6503	SO:0001583	missense	219790	exon6			CTTGAAGCACTGA	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.637C>A	10.37:g.63995874G>T	ENSP00000362894:p.Leu213Ile		98	0	0		88	0.05	4	NM_145307	4	0.00	0	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	37	CCDS7263.1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376901	0.61735	.	.	ENSG00000182010	ENST00000395265;ENST00000373789	T;T	0.37752	1.21;1.18	5.56	3.64	0.41730	.	0.130862	0.53938	D	0.000055	T	0.48589	0.1508	M	0.79926	2.475	0.23855	N	0.996652	P	0.48503	0.911	P	0.52031	0.688	T	0.40794	-0.9544	10	0.45353	T	0.12	-6.5073	8.4332	0.32771	0.1406:0.128:0.7314:0.0	.	213	Q8IZC4	RTKN2_HUMAN	I	213	ENSP00000378682:L213I;ENSP00000362894:L213I	ENSP00000362894:L213I	L	-	1	0	RTKN2	63665880	0.866000	0.29940	0.633000	0.29310	0.972000	0.66771	2.207000	0.42788	1.336000	0.45506	0.491000	0.48974	CTT			0.333	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000091618.1		NM_145307	
MUC2	4583	mdanderson.org	37	11	1093292	1093292	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:1093292C>T	ENST00000441003.2	+	30	5138	c.5111C>T	c.(5110-5112)aCc>aTc	p.T1704I	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1671I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccactacggtg	0.637																																					p.T1704I													.	.			0			c.C5111T												107.0	156.0	138.0					11																	1093292		1878	3453	5331	SO:0001583	missense	4583	exon30			CCACCACCACTAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5111C>T	11.37:g.1093292C>T	ENSP00000415183:p.Thr1704Ile		25	0.04	1		23	0.13	3	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.150	-0.394632	0.04899	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11063	2.81;2.84	1.6	-2.66	0.06077	.	2.760050	0.04005	U	0.297091	T	0.06416	0.0165	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.36286	-0.9754	9	0.36615	T	0.2	.	2.477	0.04578	0.4942:0.3128:0.0:0.1931	.	1704	E7EUV1	.	I	1704;1671	ENSP00000415183:T1704I;ENSP00000351956:T1671I	ENSP00000351956:T1671I	T	+	2	0	MUC2	1083292	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.330000	0.19715	-0.514000	0.06488	0.184000	0.17185	ACC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MUC2	4583	mdanderson.org	37	11	1093324	1093324	+	Missense_Mutation	SNP	G	G	A	rs201143282		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:1093324G>A	ENST00000441003.2	+	30	5170	c.5143G>A	c.(5143-5145)Ggc>Agc	p.G1715S	MUC2_ENST00000333592.6_Missense_Mutation_p.G3S|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.G1682S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1715S													MUC2_ENST00000441003,uveal_tract,malignant_melanoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5143A												178.0	224.0	208.0					11																	1093324		1930	3651	5581	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5143G>A	11.37:g.1093324G>A	ENSP00000415183:p.Gly1715Ser		34	0	0		29	0.07	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	7.149	0.583420	0.13749	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.11;3.17;2.32	1.64	0.221	0.15283	.	155.122000	0.02480	U	0.088379	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	9	0.19147	T	0.46	.	3.4701	0.07563	0.7575:0.0:0.2425:0.0	.	1715	E7EUV1	.	S	1715;1682;3	ENSP00000415183:G1715S;ENSP00000351956:G1682S;ENSP00000331373:G3S	ENSP00000331373:G3S	G	+	1	0	MUC2	1083324	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.131000	0.10482	-0.042000	0.13535	-1.076000	0.02234	GGC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
IL18BP	10068	mdanderson.org	37	11	71715103	71715103	+	IGR	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:71715103G>A	ENST00000393703.4	+	0	1788				NUMA1_ENST00000351960.6_Missense_Mutation_p.P920S|NUMA1_ENST00000358965.6_Missense_Mutation_p.P2042S|NUMA1_ENST00000393695.3_Missense_Mutation_p.P2056S	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein						cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						AGCTTCTTGGGTGTGTTGAGG	0.642																																					p.P2056S													.	.			0			c.C6166T												95.0	107.0	103.0					11																	71715103		2200	4293	6493	SO:0001628	intergenic_variant	4926	exon26			TCTTGGGTGTGTT	AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713		11.37:g.71715103G>A			55	0	0		67	0.10	7	NM_006185	198	0.15	29	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Missense_Mutation	SNP	ENST00000393703.4	37	CCDS8206.2	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975851	0.92982	.	.	ENSG00000137497	ENST00000351960;ENST00000358965;ENST00000393695;ENST00000359652;ENST00000536544	T;T;T	0.34667	1.35;1.83;1.82	4.94	4.94	0.65067	.	0.000000	0.51477	D	0.000085	T	0.51143	0.1657	L	0.32530	0.975	0.49798	D	0.999826	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.54423	-0.8296	10	0.87932	D	0	.	17.9643	0.89096	0.0:0.0:1.0:0.0	.	2062;2042;2056;920	Q4LE64;Q14980-2;Q14980;Q9BTE9	.;.;NUMA1_HUMAN;.	S	920;2042;2056;1605;1029	ENSP00000260051:P920S;ENSP00000351851:P2042S;ENSP00000377298:P2056S	ENSP00000260051:P920S	P	-	1	0	NUMA1	71392751	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	7.372000	0.79612	2.573000	0.86826	0.655000	0.94253	CCC			0.642	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000258012.2		NM_173042	
DSCAML1	57453	mdanderson.org	37	11	117329471	117329471	+	Splice_Site	SNP	G	G	T	rs150682070		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:117329471G>T	ENST00000321322.6	-	19	3748	c.3747C>A	c.(3745-3747)gaC>gaA	p.D1249E	DSCAML1_ENST00000527706.1_Splice_Site_p.D979E	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1189	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGACTCACCGTCCTCCTTGG	0.637																																					p.D1249E													.	.			0			c.C3747A												83.0	67.0	72.0					11																	117329471		2201	4296	6497	SO:0001630	splice_region_variant	57453	exon19			CTCACCGTCCTCC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3748+1C>A	11.37:g.117329471G>T			29	0	0		23	0.13	3	NM_020693	0		0	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.445200	0.63178	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.54071	0.59;0.59	4.08	-6.6	0.01824	Fibronectin, type III (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56804	0.2010	M	0.83483	2.645	0.58432	D	0.999992	B	0.23442	0.085	B	0.35073	0.195	T	0.55698	-0.8100	9	0.87932	D	0	.	13.7157	0.62695	0.5973:0.0:0.4027:0.0	.	1189	Q8TD84	DSCL1_HUMAN	E	979;1249;956	ENSP00000434335:D979E;ENSP00000315465:D1249E	ENSP00000315465:D1249E	D	-	3	2	DSCAML1	116834681	0.908000	0.30866	0.810000	0.32431	0.882000	0.50991	0.035000	0.13797	-1.482000	0.01860	-0.463000	0.05309	GAC			0.637	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392907.2		NM_020693	Missense_Mutation
BSX	390259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	122848423	122848423	+	Silent	SNP	G	G	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:122848423G>C	ENST00000343035.2	-	3	684	c.636C>G	c.(634-636)acC>acG	p.T212T		NM_001098169.1	NP_001091639.1	Q3C1V8	BSH_HUMAN	brain-specific homeobox	212					eating behavior (GO:0042755)|locomotory behavior (GO:0007626)|mammary gland involution (GO:0060056)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	10		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0361)		CCTCTGGCTCGGTCAGCACGA	0.726																																					p.T212T													.	.			0			c.C636G												23.0	26.0	25.0					11																	122848423		1930	4111	6041	SO:0001819	synonymous_variant	390259	exon3			TGGCTCGGTCAGC		CCDS41728.1	11q24.1	2011-07-19			ENSG00000188909	ENSG00000188909		"""Homeoboxes / ANTP class : NKL subclass"""	20450	protein-coding gene	gene with protein product		611074					Standard	NM_001098169		Approved	BSX1	uc010rzs.2	Q3C1V8	OTTHUMG00000150247	ENST00000343035.2:c.636C>G	11.37:g.122848423G>C			39	0	0		30	0.27	8	NM_001098169	0		0		Silent	SNP	ENST00000343035.2	37	CCDS41728.1																																																																																					0.726	BSX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317076.1		NM_001098169	
OR10S1	219873	mdanderson.org	37	11	123847415	123847415	+	Silent	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:123847415G>A	ENST00000531945.1	-	1	1073	c.984C>T	c.(982-984)agC>agT	p.S328S		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	328						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ATGGGGGTGGGCTGCCTGCTG	0.463																																					p.S328S													.	.			0			c.C984T												48.0	46.0	47.0					11																	123847415		2202	4299	6501	SO:0001819	synonymous_variant	219873	exon1			GGGTGGGCTGCCT	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.984C>T	11.37:g.123847415G>A			42	0	0		35	0.09	3	NM_001004474	0		0	B9EH43|Q6IEV3|Q96R78	Silent	SNP	ENST00000531945.1	37	CCDS31701.1																																																																																					0.463	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387265.2		NM_001004474	
ST14	6768	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	130068300	130068300	+	Silent	SNP	C	C	T	rs367833176		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr11:130068300C>T	ENST00000278742.5	+	13	1975	c.1557C>T	c.(1555-1557)gaC>gaT	p.D519D		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	519	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	ACAACAGCGACGAGCAGGGGT	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		13322	0.001		0.0	False		,,,				2504	0.0				p.D519D													ST14,caecum,carcinoma,0,1	ST14	0	1	0			c.C1557T							C		1,4401	2.1+/-5.4	0,1,2200	62.0	63.0	63.0		1557	-8.7	0.1	11		63	0,8594		0,0,4297	no	coding-synonymous	ST14	NM_021978.3		0,1,6497	TT,TC,CC		0.0,0.0227,0.0077		519/856	130068300	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	6768	exon13			CAGCGACGAGCAG	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1557C>T	11.37:g.130068300C>T			115	0	0		116	0.06	7	NM_021978	61	0.16	10	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Silent	SNP	ENST00000278742.5	37	CCDS8487.1																																																																																					0.662	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386119.1			
NANOG	79923	broad.mit.edu	37	12	7947397	7947397	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr12:7947397C>G	ENST00000229307.4	+	4	843	c.624C>G	c.(622-624)aaC>aaG	p.N208K	NANOG_ENST00000526286.1_Missense_Mutation_p.N192K	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	208	8 X repeats starting with a Trp in each unit.|Sufficient for transactivation activity. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		CCTGGAGCAACCAGACCCAGA	0.542																																					p.N208K													.	NANOG	30		0			c.C624G												7.0	7.0	7.0					12																	7947397		2021	4148	6169	SO:0001583	missense	79923	exon4			GAGCAACCAGACC	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.624C>G	12.37:g.7947397C>G	ENSP00000229307:p.Asn208Lys		202	0	0		310	0.09	29	NM_024865	882	0.13	119	D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	ENST00000229307.4	37	CCDS31736.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079441	0.36662	.	.	ENSG00000111704	ENST00000541267;ENST00000229307;ENST00000526286	D;D;D	0.91843	-2.81;-2.92;-2.82	3.36	3.36	0.38483	.	0.879945	0.09868	N	0.745310	D	0.91855	0.7422	M	0.68593	2.085	0.23095	N	0.998302	P	0.45594	0.862	P	0.46208	0.507	D	0.83626	0.0142	10	0.35671	T	0.21	-5.2835	11.0131	0.47673	0.0:1.0:0.0:0.0	.	208	Q9H9S0	NANOG_HUMAN	K	184;208;192	ENSP00000444434:N184K;ENSP00000229307:N208K;ENSP00000435288:N192K	ENSP00000229307:N208K	N	+	3	2	NANOG	7838664	0.007000	0.16637	0.426000	0.26672	0.190000	0.23558	1.081000	0.30791	1.811000	0.52892	0.479000	0.44913	AAC			0.542	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387480.2		NM_024865	
TAS2R46	259292	hgsc.bcm.edu	37	12	11214498	11214498	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr12:11214498T>C	ENST00000533467.1	-	1	395	c.396A>G	c.(394-396)atA>atG	p.I132M	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176887.2	NP_795368.2	P59540	T2R46_HUMAN	taste receptor, type 2, member 46	132					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		GCCCCAATAGTATCACCAGAA	0.343																																					p.I132M													.	.			0			c.A396G												97.0	98.0	98.0					12																	11214498		2021	4209	6230	SO:0001583	missense	259292	exon1			CAATAGTATCACC	AF494227	CCDS53748.1	12p13.2	2012-08-22				ENSG00000226761		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18877	protein-coding gene	gene with protein product		612774				12379855	Standard	NM_176887		Approved	T2R54	uc001qzp.1	P59540		ENST00000533467.1:c.396A>G	12.37:g.11214498T>C	ENSP00000436450:p.Ile132Met		102	0	0		144	0.05	7	NM_176887	0		0	P59548|Q645X6	Missense_Mutation	SNP	ENST00000533467.1	37	CCDS53748.1	.	.	.	.	.	.	.	.	.	.	T	0.749	-0.773502	0.02951	.	.	ENSG00000226761	ENST00000533467	T	0.00840	5.63	2.54	-5.09	0.02920	.	.	.	.	.	T	0.00754	0.0025	N	0.25245	0.725	0.09310	N	1	B	0.18013	0.025	B	0.27262	0.078	T	0.44236	-0.9341	9	0.23302	T	0.38	.	6.4017	0.21642	0.0:0.4637:0.1333:0.4029	.	132	P59540	T2R46_HUMAN	M	132	ENSP00000436450:I132M	ENSP00000436450:I132M	I	-	3	3	TAS2R46	11105765	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.764000	0.00372	-1.789000	0.01264	-1.366000	0.01203	ATA			0.343	TAS2R46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383559.1		NM_176887	
LTB4R2	56413	mdanderson.org	37	14	24780818	24780818	+	Silent	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr14:24780818G>T	ENST00000528054.1	+	1	2658	c.1041G>T	c.(1039-1041)ggG>ggT	p.G347G	CIDEB_ENST00000258807.5_5'Flank|LTB4R2_ENST00000533293.1_Silent_p.G316G|LTB4R2_ENST00000543919.1_Silent_p.G316G|LTB4R_ENST00000345363.3_5'UTR|CIDEB_ENST00000555817.1_5'Flank|CIDEB_ENST00000336557.5_5'Flank|LTB4R_ENST00000396789.4_5'Flank			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	347					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		AGGCCCGAGGGGGCGGCCGCT	0.682																																					p.G316G													.	.			0			c.G948T												34.0	44.0	40.0					14																	24780818		2197	4291	6488	SO:0001819	synonymous_variant	56413	exon2			CCGAGGGGGCGGC	AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.1041G>T	14.37:g.24780818G>T			30	0	0		20	0.15	3	NM_019839	4	0.00	0	Q5KU28|Q9NPE5	Silent	SNP	ENST00000528054.1	37																																																																																						0.682	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000073194.4			
NKX2-1	7080	bcgsc.ca	37	14	36988452	36988452	+	Silent	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr14:36988452C>T	ENST00000518149.1	-	2	716	c.111G>A	c.(109-111)ccG>ccA	p.P37P	NKX2-1-AS1_ENST00000521292.2_RNA|NKX2-1_ENST00000354822.5_Silent_p.P67P|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1_ENST00000498187.2_Silent_p.P37P|NKX2-1_ENST00000522719.2_Silent_p.P37P			P43699	NKX21_HUMAN	NK2 homeobox 1	37					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		ACGCCGCCAGCGGAGCCCCGA	0.672			A		NSCLC																																p.P67P				Dom	yes		14	14q13	7080	NK2 homeobox 1		E	.	NKX2-1	21		0			c.G201A												7.0	9.0	9.0					14																	36988452		2144	4217	6361	SO:0001819	synonymous_variant	7080	exon2			CGCCAGCGGAGCC		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.111G>A	14.37:g.36988452C>T			61	0	0		51	0.08	4	NM_001079668	0		0	D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Silent	SNP	ENST00000518149.1	37	CCDS9659.1																																																																																					0.672	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376225.2		NM_003317	
SLC8A3	6547	mdanderson.org	37	14	70512975	70512975	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr14:70512975T>C	ENST00000381269.2	-	8	3226	c.2473A>G	c.(2473-2475)Acg>Gcg	p.T825A	SLC8A3_ENST00000534137.1_Missense_Mutation_p.T822A|SLC8A3_ENST00000356921.2_Missense_Mutation_p.T819A|SLC8A3_ENST00000357887.3_Missense_Mutation_p.T823A|SLC8A3_ENST00000394330.2_Missense_Mutation_p.T182A|SLC8A3_ENST00000216568.7_Missense_Mutation_p.T196A|SLC8A3_ENST00000528359.1_Missense_Mutation_p.T823A|SLC8A3_ENST00000533541.1_3'UTR	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	825					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTGCTGCCCGTCACGTTGCCA	0.592											OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T825A													.	.			0			c.A2473G												48.0	42.0	44.0					14																	70512975		2203	4300	6503	SO:0001583	missense	6547	exon8			TGCCCGTCACGTT	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2473A>G	14.37:g.70512975T>C	ENSP00000370669:p.Thr825Ala		75	0	0	1122	50	0.06	3	NM_183002	0		0	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	37	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.772104	0.90108	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000216568;ENST00000394330;ENST00000534137;ENST00000528359	T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.76	5.76	0.90799	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	T	0.80909	0.4714	M	0.83852	2.665	0.80722	D	1	D;D;D;D;D	0.76494	0.992;0.997;0.979;0.992;0.999	D;D;D;D;D	0.80764	0.986;0.994;0.982;0.987;0.973	D	0.83948	0.0315	10	0.87932	D	0	.	16.0863	0.81056	0.0:0.0:0.0:1.0	.	819;825;823;822;196	P57103-2;P57103;Q96QG2;Q96QG1;Q5K3P6	.;NAC3_HUMAN;.;.;.	A	819;825;823;196;182;822;823	ENSP00000349392:T819A;ENSP00000370669:T825A;ENSP00000350560:T823A;ENSP00000216568:T196A;ENSP00000377863:T182A;ENSP00000436688:T822A;ENSP00000433531:T823A	ENSP00000216568:T196A	T	-	1	0	SLC8A3	69582728	1.000000	0.71417	0.950000	0.38849	0.972000	0.66771	8.040000	0.89188	2.197000	0.70478	0.454000	0.30748	ACG			0.592	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390736.1			
RIN3	79890	mdanderson.org	37	14	93118316	93118316	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr14:93118316G>T	ENST00000216487.7	+	6	1081	c.922G>T	c.(922-924)Gcc>Tcc	p.A308S	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	308	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				ccccgcccctgcctgtccttt	0.731																																					p.A308S													.	.			0			c.G922T												5.0	6.0	6.0					14																	93118316		2000	3883	5883	SO:0001583	missense	79890	exon6			GCCCCTGCCTGTC	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.922G>T	14.37:g.93118316G>T	ENSP00000216487:p.Ala308Ser		22	0	0		29	0.10	3	NM_024832	3	0.00	0	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	ENST00000216487.7	37	CCDS32144.1	.	.	.	.	.	.	.	.	.	.	G	2.867	-0.234769	0.05983	.	.	ENSG00000100599	ENST00000216487	T	0.05580	3.42	4.33	3.4	0.38934	.	1.477230	0.04055	N	0.305435	T	0.06280	0.0162	L	0.36672	1.1	0.23168	N	0.998188	B;B	0.26635	0.084;0.155	B;B	0.24155	0.051;0.051	T	0.45160	-0.9280	10	0.07644	T	0.81	-1.8306	7.5622	0.27857	0.096:0.1706:0.7334:0.0	.	233;308	Q6ZRC2;Q8TB24	.;RIN3_HUMAN	S	308	ENSP00000216487:A308S	ENSP00000216487:A308S	A	+	1	0	RIN3	92188069	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-0.106000	0.10890	0.768000	0.33290	0.313000	0.20887	GCC			0.731	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412269.1			
LOC101927079	101927079	broad.mit.edu	37	15	22332432	22332432	+	RNA	SNP	C	C	T	rs376977769		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr15:22332432C>T	ENST00000558896.1	+	0	239																											AAGATTCTAACGTGACAGAAC	0.343																																					.													.	.			0			.																																											0	.			TTCTAACGTGACA																													15.37:g.22332432C>T			46	0.0434782609	2		40	0.08	3	.	0		0		RNA	SNP	ENST00000558896.1	37																																																																																						0.343	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping		OTTHUMT00000417625.1			
LOC101927079	101927079	broad.mit.edu	37	15	22332442	22332442	+	RNA	SNP	C	C	T	rs575019353	byFrequency	TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr15:22332442C>T	ENST00000558896.1	+	0	249																											CGTGACAGAACTTGTTCTTCT	0.353													.|||	16	0.00319489	0.0038	0.0014	5008	,	,		29766	0.0		0.005	False		,,,				2504	0.0051				.													.	.			0			.																																											0	.			ACAGAACTTGTTC																													15.37:g.22332442C>T			52	0.0384615385	2		44	0.07	3	.	0		0		RNA	SNP	ENST00000558896.1	37																																																																																						0.353	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping		OTTHUMT00000417625.1			
NANOGP8	388112	bcgsc.ca	37	15	35377147	35377147	+	IGR	SNP	A	A	G			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr15:35377147A>G								RP11-463I20.2 (73755 upstream) : RP11-323I15.5 (14075 downstream)																							CCATGGAGGAAGGAAGAGGAG	0.478																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	388112	.			GGAGGAAGGAAGA																													15.37:g.35377147A>G			90	0.0111111111	1		77	0.16	12	.	511	0.88	448		RNA	SNP		37																																																																																					0	0.478										
TCF12	6938	mdanderson.org	37	15	57574716	57574716	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr15:57574716G>T	ENST00000267811.5	+	19	2284	c.1980G>T	c.(1978-1980)gaG>gaT	p.E660D	TCF12_ENST00000452095.2_Missense_Mutation_p.E680D|TCF12_ENST00000343827.3_Missense_Mutation_p.E490D|TCF12_ENST00000559710.1_Missense_Mutation_p.E294D|TCF12_ENST00000543579.1_Missense_Mutation_p.E514D|TCF12_ENST00000333725.5_Missense_Mutation_p.E684D|TCF12_ENST00000559703.1_Missense_Mutation_p.E317D|TCF12_ENST00000557843.1_Missense_Mutation_p.E660D|TCF12_ENST00000537840.1_Missense_Mutation_p.E424D|TCF12_ENST00000438423.2_Missense_Mutation_p.E684D	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	660					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TATCGGCAGAGCCGCCAACCA	0.473			T	TEC	extraskeletal myxoid chondrosarcoma																																p.E684D				Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	.	.			0			c.G2052T												131.0	129.0	130.0					15																	57574716		2192	4292	6484	SO:0001583	missense	6938	exon20			GGCAGAGCCGCCA	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1980G>T	15.37:g.57574716G>T	ENSP00000267811:p.Glu660Asp		40	0	0		28	0.11	3	NM_207037	20	0.00	0	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	ENST00000267811.5	37	CCDS10159.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388603	0.61956	.	.	ENSG00000140262	ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827;ENST00000543417	T;T;T;T;T;T;T	0.20881	2.64;2.65;2.64;2.65;2.39;2.04;2.37	5.82	5.82	0.92795	.	0.091723	0.85682	D	0.000000	T	0.15046	0.0363	N	0.02315	-0.6	0.52099	D	0.999946	B;B;B;D;D;B;B;B	0.61080	0.048;0.361;0.003;0.983;0.989;0.041;0.024;0.041	B;B;B;P;P;B;B;B	0.51415	0.023;0.041;0.006;0.621;0.669;0.028;0.012;0.028	T	0.29882	-0.9997	10	0.10636	T	0.68	-7.6776	20.1142	0.97922	0.0:0.0:1.0:0.0	.	294;514;424;680;514;490;660;684	B4DZP2;B4DH96;B4E1W1;E9PGY0;F5GY10;Q99081-2;Q99081;Q99081-3	.;.;.;.;.;.;HTF4_HUMAN;.	D	660;684;680;684;514;424;490;272	ENSP00000267811:E660D;ENSP00000388940:E684D;ENSP00000396881:E680D;ENSP00000331057:E684D;ENSP00000440017:E514D;ENSP00000444696:E424D;ENSP00000342459:E490D	ENSP00000267811:E660D	E	+	3	2	TCF12	55362008	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.178000	0.50879	2.765000	0.95021	0.650000	0.86243	GAG			0.473	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000255069.3		NM_003205	
ACAN	176	hgsc.bcm.edu	37	15	89399983	89399983	+	Missense_Mutation	SNP	G	G	T	rs529296210	byFrequency	TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr15:89399983G>T	ENST00000561243.1	+	11	4167	c.4167G>T	c.(4165-4167)gaG>gaT	p.E1389D	ACAN_ENST00000559004.1_Missense_Mutation_p.E1389D|ACAN_ENST00000352105.7_Missense_Mutation_p.E1389D|ACAN_ENST00000439576.2_Missense_Mutation_p.E1389D			P16112	PGCA_HUMAN	aggrecan	1389	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTGGAGTAGAGGACATCAGCG	0.537													-|||	8	0.00159744	0.0	0.0014	5008	,	,		22389	0.0		0.005	False		,,,				2504	0.002				p.E1389D													AGC1,NS,carcinoma,+2,4	AGC1	2	4	0			c.G4167T												30.0	26.0	27.0					15																	89399983		1663	3381	5044	SO:0001583	missense	176	exon12			AGTAGAGGACATC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.4167G>T	15.37:g.89399983G>T	ENSP00000453342:p.Glu1389Asp		49	0.0408163265	2		55	0.05	3	NM_001135	3	0.00	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	-	9.260	1.042974	0.19748	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.96073	-3.9;-3.9	3.52	-2.6	0.06190	.	.	.	.	.	D	0.94850	0.8336	M	0.80982	2.52	0.09310	N	1	D;D	0.57571	0.98;0.98	P;P	0.57548	0.823;0.823	D	0.86179	0.1605	9	0.13470	T	0.59	.	1.6618	0.02793	0.1876:0.1326:0.4438:0.236	.	1389;1389	E7ENV9;E7EX88	.;.	D	1389;1389;1275	ENSP00000387356:E1389D;ENSP00000341615:E1389D	ENSP00000268134:E1275D	E	+	3	2	ACAN	87200987	0.048000	0.20356	0.000000	0.03702	0.101000	0.19017	1.422000	0.34826	-0.347000	0.08299	-0.424000	0.05967	GAG			0.537	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416267.2		NM_001135	
ZNF75A	7627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3367499	3367499	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr16:3367499C>G	ENST00000574298.1	+	6	994	c.521C>G	c.(520-522)tCt>tGt	p.S174C	ZNF75A_ENST00000498240.2_3'UTR	NM_153028.2	NP_694573.1	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	174					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|lung(7)|prostate(1)	12						AGAGTTAGCTCTGACCTTATT	0.383																																					p.S174C													.	.			0			c.C521G												81.0	79.0	79.0					16																	3367499		2197	4300	6497	SO:0001583	missense	7627	exon6			TTAGCTCTGACCT	X91826	CCDS10501.1	16p13.11	2013-01-08			ENSG00000162086	ENSG00000162086		"""Zinc fingers, C2H2-type"", ""-"""	13146	protein-coding gene	gene with protein product		601473				8661144	Standard	NM_153028		Approved	FLJ31529	uc002cut.4	Q96N20	OTTHUMG00000129356	ENST00000574298.1:c.521C>G	16.37:g.3367499C>G	ENSP00000459566:p.Ser174Cys		146	0	0		195	0.19	37	NM_153028	100	0.32	32	Q0VDI8|Q92669	Missense_Mutation	SNP	ENST00000574298.1	37	CCDS10501.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.202946	0.58234	.	.	ENSG00000162086	ENST00000293995	.	.	.	4.57	3.6	0.41247	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44285	D	0.000464	T	0.54775	0.1879	M	0.80028	2.48	0.26965	N	0.96573	B	0.22414	0.069	B	0.19946	0.027	T	0.56649	-0.7944	9	0.66056	D	0.02	.	12.5959	0.56470	0.0:0.8312:0.1688:0.0	.	174	Q96N20	ZN75A_HUMAN	C	174	.	ENSP00000293995:S174C	S	+	2	0	ZNF75A	3307500	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.207000	0.17395	1.253000	0.44018	0.557000	0.71058	TCT			0.383	ZNF75A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251506.2		NM_153028	
CAPNS2	84290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55601279	55601279	+	Missense_Mutation	SNP	T	T	A	rs567078741		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr16:55601279T>A	ENST00000457326.2	+	1	696	c.611T>A	c.(610-612)aTg>aAg	p.M204K	LPCAT2_ENST00000262134.5_Intron|LPCAT2_ENST00000565056.1_Intron	NM_032330.1	NP_115706.1	Q96L46	CPNS2_HUMAN	calpain, small subunit 2	204	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|large_intestine(1)|lung(3)|prostate(2)	7						GATGGAGATATGGATTTTAAC	0.478																																					p.M204K													.	.			0			c.T611A												189.0	186.0	187.0					16																	55601279		1954	4158	6112	SO:0001583	missense	84290	exon1			GAGATATGGATTT	AY052551	CCDS54010.1	16q12.2	2013-01-10						"""EF-hand domain containing"""	16371	protein-coding gene	gene with protein product						11853546	Standard	NM_032330		Approved	MGC12536, MGC14804	uc002eid.1	Q96L46		ENST00000457326.2:c.611T>A	16.37:g.55601279T>A	ENSP00000400882:p.Met204Lys		119	0	0		131	0.15	19	NM_032330	0		0	Q9BPV4	Missense_Mutation	SNP	ENST00000457326.2	37	CCDS54010.1	.	.	.	.	.	.	.	.	.	.	T	19.66	3.868728	0.72065	.	.	ENSG00000256812	ENST00000457326	T	0.47177	0.85	5.98	5.98	0.97165	EF-hand-like domain (1);	.	.	.	.	T	0.67655	0.2916	M	0.85777	2.775	0.58432	D	0.999999	D	0.55385	0.971	P	0.55011	0.766	T	0.73972	-0.3814	9	0.87932	D	0	.	16.4781	0.84144	0.0:0.0:0.0:1.0	.	204	Q96L46	CPNS2_HUMAN	K	204	ENSP00000400882:M204K	ENSP00000400882:M204K	M	+	2	0	CAPNS2	54158780	1.000000	0.71417	0.996000	0.52242	0.275000	0.26752	7.698000	0.84413	2.288000	0.76882	0.528000	0.53228	ATG			0.478	CAPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396391.1		NM_032330	
CNTNAP4	85445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	76555039	76555039	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr16:76555039T>C	ENST00000476707.1	+	15	2516	c.2377T>C	c.(2377-2379)Tca>Cca	p.S793P	CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S789P|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S741P|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S717P			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	790	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CAAAACAGGATCATTTTGGAA	0.303																																					p.S717P													CNTNAP4_ENST00000478060,NS,carcinoma,-1,2	CNTNAP4_ENST00000478060	-1	2	0			c.T2149C												165.0	154.0	157.0					16																	76555039		1805	4074	5879	SO:0001583	missense	85445	exon15			ACAGGATCATTTT	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.2377T>C	16.37:g.76555039T>C	ENSP00000417628:p.Ser793Pro		73	0.0136986301	1		76	0.33	25	NM_138994	0		0	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	T	8.693	0.907883	0.17833	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	4.99	3.9	0.45041	Concanavalin A-like lectin/glucanase (1);	0.464118	0.16048	N	0.232099	T	0.06005	0.0156	.	.	.	0.09310	N	1	B;B;B	0.15930	0.007;0.015;0.003	B;B;B	0.16289	0.013;0.013;0.015	T	0.36138	-0.9760	9	0.29301	T	0.29	.	1.2153	0.01913	0.259:0.0875:0.2265:0.427	.	717;793;790	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	P	789;741;717;793	ENSP00000306893:S789P;ENSP00000439733:S741P;ENSP00000418741:S717P;ENSP00000417628:S793P	ENSP00000306893:S789P	S	+	1	0	CNTNAP4	75112540	0.523000	0.26274	0.104000	0.21259	0.887000	0.51463	1.416000	0.34759	0.952000	0.37798	0.459000	0.35465	TCA			0.303	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000348216.1		NM_033401	
CPNE7	27132	bcgsc.ca	37	16	89643986	89643986	+	Missense_Mutation	SNP	G	G	A	rs369719899		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr16:89643986G>A	ENST00000268720.5	+	2	344	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	CPNE7_ENST00000319518.8_Missense_Mutation_p.V72M	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	72	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		CCTGCATCCCGTGTTCTCCAA	0.632																																					p.V72M													.	CPNE7	56		0			c.G214A							G	MET/VAL,MET/VAL	0,4338		0,0,2169	129.0	77.0	95.0		214,214	3.5	0.2	16		95	2,8530		0,2,4264	no	missense,missense	CPNE7	NM_014427.4,NM_153636.2	21,21	0,2,6433	AA,AG,GG		0.0234,0.0,0.0155	possibly-damaging,possibly-damaging	72/634,72/559	89643986	2,12868	2169	4266	6435	SO:0001583	missense	27132	exon2			CATCCCGTGTTCT	AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.214G>A	16.37:g.89643986G>A	ENSP00000268720:p.Val72Met		61	0	0		58	0.07	4	NM_153636	7	0.00	0		Missense_Mutation	SNP	ENST00000268720.5	37	CCDS10980.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638447	0.47153	0.0	2.34E-4	ENSG00000178773	ENST00000319518;ENST00000268720	T;T	0.72942	-0.7;-0.7	4.48	3.52	0.40303	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.129094	0.51477	N	0.000094	T	0.80763	0.4685	M	0.84683	2.71	0.32152	N	0.584106	D;P	0.65815	0.995;0.695	P;B	0.56960	0.81;0.095	D	0.84162	0.0429	10	0.46703	T	0.11	-21.1061	11.3672	0.49679	0.0915:0.0:0.9085:0.0	.	72;72	Q9UBL6-2;Q9UBL6	.;CPNE7_HUMAN	M	72	ENSP00000317374:V72M;ENSP00000268720:V72M	ENSP00000268720:V72M	V	+	1	0	CPNE7	88171487	1.000000	0.71417	0.206000	0.23566	0.378000	0.30076	4.383000	0.59600	0.850000	0.35239	-0.258000	0.10820	GTG			0.632	CPNE7-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000269929.2			
RPL26	6154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	8280958	8280958	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:8280958C>A	ENST00000584164.1	-	4	753	c.362G>T	c.(361-363)cGg>cTg	p.R121L	RPL26_ENST00000582556.1_Missense_Mutation_p.R121L|RPL26_ENST00000293842.5_Missense_Mutation_p.R121L|RP11-849F2.7_ENST00000582471.1_Intron|RPL26_ENST00000583011.1_Missense_Mutation_p.R121L|KRBA2_ENST00000396267.1_5'Flank|RP11-849F2.5_ENST00000580537.1_RNA|RP11-849F2.5_ENST00000579904.1_RNA|RPL26_ENST00000585176.1_5'UTR|RP11-849F2.5_ENST00000585181.1_RNA			P61254	RL26_HUMAN	ribosomal protein L26	121					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			skin(1)|urinary_tract(1)	2						TTTGGCTTTCCGTTCGAGGAT	0.373																																					p.R121L													.	.			0			c.G362T												86.0	92.0	90.0					17																	8280958		2203	4299	6502	SO:0001583	missense	6154	exon4			GCTTTCCGTTCGA		CCDS11142.1	17p13	2011-04-06			ENSG00000161970	ENSG00000161970		"""L ribosomal proteins"""	10327	protein-coding gene	gene with protein product		603704				8479925	Standard	XM_005256749		Approved	L26	uc002glh.1	P61254	OTTHUMG00000108191	ENST00000584164.1:c.362G>T	17.37:g.8280958C>A	ENSP00000463784:p.Arg121Leu		15	0	0		10	0.40	4	NM_000987	11087	0.31	3407	B2R4F0|D3DTR8|Q02877|Q6IPY2	Missense_Mutation	SNP	ENST00000584164.1	37	CCDS11142.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597405	0.66332	.	.	ENSG00000161970	ENST00000293842	.	.	.	4.41	4.41	0.53225	Translation protein SH3-like (1);Ribosomal protein L24, SH3-like (1);	0.183995	0.48286	D	0.000191	T	0.74442	0.3717	M	0.89163	3.01	0.80722	D	1	B	0.30870	0.298	B	0.36092	0.217	T	0.79188	-0.1906	9	0.66056	D	0.02	.	14.8643	0.70404	0.0:1.0:0.0:0.0	.	121	P61254	RL26_HUMAN	L	121	.	ENSP00000293842:R121L	R	-	2	0	RPL26	8221683	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	7.682000	0.84083	2.152000	0.67230	0.585000	0.79938	CGG			0.373	RPL26-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442322.1		NM_000987	
MYH10	4628	mdanderson.org	37	17	8526560	8526560	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:8526560G>T	ENST00000269243.4	-	2	143	c.5C>A	c.(4-6)gCg>gAg	p.A2E	MYH10_ENST00000379980.4_Missense_Mutation_p.A2E|MYH10_ENST00000360416.3_Missense_Mutation_p.A2E|MYH10_ENST00000396239.1_Missense_Mutation_p.A2E	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	2					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						AGTTCTCTGCGCCATTGTAAA	0.433																																					p.A2E													.	.			0			c.C5A												40.0	37.0	38.0					17																	8526560		2203	4300	6503	SO:0001583	missense	4628	exon2			CTCTGCGCCATTG	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5C>A	17.37:g.8526560G>T	ENSP00000269243:p.Ala2Glu		34	0	0		39	0.08	3	NM_005964	32	0.00	0	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307847	0.81247	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980;ENST00000411957	D;D;D;D;T	0.86164	-2.06;-2.08;-2.08;-2.06;-1.34	4.92	4.92	0.64577	.	0.133962	0.51477	D	0.000100	T	0.80308	0.4599	N	0.08118	0	0.51012	D	0.999906	B;B;B	0.34147	0.311;0.438;0.311	B;B;B	0.39904	0.166;0.313;0.166	T	0.83033	-0.0161	10	0.87932	D	0	.	17.9243	0.88977	0.0:0.0:1.0:0.0	.	2;2;2	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	E	2	ENSP00000269243:A2E;ENSP00000353590:A2E;ENSP00000379539:A2E;ENSP00000369315:A2E;ENSP00000408220:A2E	ENSP00000269243:A2E	A	-	2	0	MYH10	8467285	1.000000	0.71417	0.965000	0.40720	0.861000	0.49209	8.913000	0.92730	2.554000	0.86153	0.561000	0.74099	GCG			0.433	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000227001.2			
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		168	0.0178571429	3		157	0.03	4	NM_145301	40	0.20	8	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2	rescued with RNA-seq	NM_145301	
THRA	7067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38244622	38244622	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:38244622G>A	ENST00000264637.4	+	8	1431	c.851G>A	c.(850-852)cGg>cAg	p.R284Q	THRA_ENST00000394121.4_Missense_Mutation_p.R284Q|THRA_ENST00000584985.1_Missense_Mutation_p.R284Q|THRA_ENST00000546243.1_Missense_Mutation_p.R284Q|THRA_ENST00000450525.2_Missense_Mutation_p.R284Q	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	284	Ligand-binding.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R284P(2)		endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GCTGTCAAGCGGGAGCAGCTC	0.607																																					p.R284Q													THRA_ENST00000450525,NS,carcinoma,0,1	THRA_ENST00000450525	0	1	2	Substitution - Missense(2)	lung(2)	c.G851A												103.0	96.0	98.0					17																	38244622		2203	4300	6503	SO:0001583	missense	7067	exon8			TCAAGCGGGAGCA	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.851G>A	17.37:g.38244622G>A	ENSP00000264637:p.Arg284Gln		58	0	0		62	0.23	14	NM_001190918	18	0.28	5	A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	ENST00000264637.4	37	CCDS11360.1	.	.	.	.	.	.	.	.	.	.	g	29.4	5.005385	0.93287	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.96459	-4.02;-4.02;-4.02;-4.02	4.97	4.97	0.65823	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.94528	0.8238	L	0.52206	1.635	0.58432	D	0.999997	D;P;P	0.53619	0.961;0.864;0.471	B;B;B	0.41666	0.345;0.363;0.024	D	0.95336	0.8434	10	0.87932	D	0	.	17.0857	0.86611	0.0:0.0:1.0:0.0	.	284;284;284	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	Q	284	ENSP00000377679:R284Q;ENSP00000264637:R284Q;ENSP00000395641:R284Q;ENSP00000443972:R284Q	ENSP00000264637:R284Q	R	+	2	0	THRA	35498148	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.956000	0.87863	2.304000	0.77564	0.486000	0.48141	CGG			0.607	THRA-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000257160.2			
ITGA2B	3674	mdanderson.org	37	17	42460945	42460945	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:42460945G>T	ENST00000262407.5	-	12	1157	c.1126C>A	c.(1126-1128)Ctc>Atc	p.L376I	ITGA2B_ENST00000353281.4_Missense_Mutation_p.L376I|ITGA2B_ENST00000377068.3_Missense_Mutation_p.L61I	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	376					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GTCAGCAGGAGGCTGGGGGCA	0.637																																					p.L376I													.	.			0			c.C1126A												21.0	20.0	20.0					17																	42460945		2201	4297	6498	SO:0001583	missense	3674	exon12			GCAGGAGGCTGGG		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.1126C>A	17.37:g.42460945G>T	ENSP00000262407:p.Leu376Ile		58	0	0		47	0.06	3	NM_000419	7	0.00	0	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	37	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.381917	0.61845	.	.	ENSG00000005961	ENST00000262407;ENST00000353281;ENST00000377068	T;T;T	0.72394	-0.65;-0.65;-0.65	5.8	4.83	0.62350	.	0.281428	0.19107	N	0.122554	T	0.66015	0.2747	N	0.21142	0.635	0.33637	D	0.60682	P	0.45569	0.861	P	0.51918	0.684	T	0.68029	-0.5517	10	0.15066	T	0.55	.	14.2356	0.65925	0.0:0.1493:0.8507:0.0	.	376	P08514	ITA2B_HUMAN	I	376;376;61	ENSP00000262407:L376I;ENSP00000340536:L376I;ENSP00000366268:L61I	ENSP00000262407:L376I	L	-	1	0	ITGA2B	39816471	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.980000	0.49321	1.437000	0.47472	0.561000	0.74099	CTC			0.637	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439823.1			
CRHR1	1394	mdanderson.org	37	17	43898754	43898754	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:43898754G>T	ENST00000398285.3	+	4	275	c.275G>T	c.(274-276)aGc>aTc	p.S92I	CRHR1_ENST00000339069.5_Intron|CRHR1_ENST00000577353.1_Missense_Mutation_p.S92I|CRHR1_ENST00000293493.7_5'UTR|CRHR1_ENST00000314537.5_Missense_Mutation_p.S92I|CRHR1_ENST00000352855.5_Missense_Mutation_p.S52I	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	92					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		GCCAATGGCAGCTGGGCCGCC	0.637																																					p.S92I	Ovarian(110;57 1568 10207 38216 49865)												.	.			0			c.G275T												53.0	60.0	58.0					17																	43898754		1964	4156	6120	SO:0001583	missense	1394	exon4			ATGGCAGCTGGGC	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.275G>T	17.37:g.43898754G>T	ENSP00000381333:p.Ser92Ile		32	0	0		32	0.09	3	NM_001145148	0		0	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	37	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.984385	0.35036	.	.	ENSG00000120088	ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T	0.54675	0.62;0.56;0.62;1.02	4.84	3.87	0.44632	GPCR, family 2, extracellular hormone receptor domain (3);	0.106301	0.64402	D	0.000004	T	0.57489	0.2057	L	0.60455	1.87	0.80722	D	1	B;P;B;B	0.36909	0.257;0.573;0.257;0.257	B;P;B;B	0.45794	0.139;0.493;0.211;0.139	T	0.62905	-0.6755	10	0.72032	D	0.01	.	12.9137	0.58195	0.0:0.1776:0.8224:0.0	.	92;92;52;92	P34998-4;P34998;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.	I	92;92;92;52	ENSP00000381333:S92I;ENSP00000326060:S92I;ENSP00000239167:S92I;ENSP00000344068:S52I	ENSP00000326060:S92I	S	+	2	0	CRHR1	41254535	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.173000	0.58249	1.404000	0.46819	0.655000	0.94253	AGC			0.637	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000441241.3			
RN7SKP94	106480365	broad.mit.edu	37	17	55867021	55867021	+	lincRNA	DEL	C	C	-			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr17:55867021delC	ENST00000580960.1	-	0	254				RN7SKP94_ENST00000411044.1_RNA																							gctagaacctccaaacaagct	0.517																																					.													.	.			0			.																																											0	.			GAACCTCCAAACA																													17.37:g.55867021delC			6	0	0		5	0.40	2	.	0		0		RNA	DEL	ENST00000580960.1	37																																																																																						0.517	RP11-60A24.3-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000443300.1			
PTPRS	5802	mdanderson.org	37	19	5212050	5212050	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:5212050G>T	ENST00000587303.1	-	31	5080	c.4981C>A	c.(4981-4983)Ctc>Atc	p.L1661I	PTPRS_ENST00000588012.1_Missense_Mutation_p.L1623I|PTPRS_ENST00000353284.2_Missense_Mutation_p.L1214I|PTPRS_ENST00000592099.1_Missense_Mutation_p.L1214I|PTPRS_ENST00000357368.4_Missense_Mutation_p.L1661I|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.L1641I|PTPRS_ENST00000372412.4_Missense_Mutation_p.L1662I|PTPRS_ENST00000348075.2_Missense_Mutation_p.L1623I			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1661					cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TAGGCATAGAGGCTGCGTGCG	0.627																																					p.L1661I													.	.			0			c.C4981A												58.0	53.0	54.0					19																	5212050		2203	4300	6503	SO:0001583	missense	5802	exon32			CATAGAGGCTGCG	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4981C>A	19.37:g.5212050G>T	ENSP00000467537:p.Leu1661Ile		44	0	0		35	0.09	3	NM_002850	46	0.00	0	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844930	0.71603	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	2.47	2.47	0.30058	.	0.000000	0.52532	U	0.000073	T	0.62804	0.2458	M	0.86420	2.815	0.80722	D	1	D;P;D;D;P;D	0.62365	0.991;0.75;0.963;0.967;0.938;0.965	D;P;D;D;D;D	0.87578	0.998;0.895;0.997;0.967;0.994;0.992	T	0.72030	-0.4413	10	0.87932	D	0	.	13.3072	0.60359	0.0:0.0:1.0:0.0	.	1243;1214;1218;1623;1661;1256	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	I	1256;1662;1661;1661;1652;1641;1623;1243;1218;1214	ENSP00000361489:L1662I;ENSP00000349932:L1661I;ENSP00000262963:L1641I;ENSP00000269907:L1623I;ENSP00000327313:L1214I	ENSP00000262963:L1641I	L	-	1	0	PTPRS	5163050	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.650000	0.83521	1.399000	0.46721	0.478000	0.44815	CTC			0.627	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000450762.2			
MAP1S	55201	broad.mit.edu;mdanderson.org	37	19	17838362	17838362	+	Silent	SNP	C	C	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:17838362C>A	ENST00000324096.4	+	5	2320	c.2169C>A	c.(2167-2169)ggC>ggA	p.G723G	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Silent_p.G697G|MAP1S_ENST00000597681.1_3'UTR	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	723	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the microtubule-organizing center localization.|Pro-rich.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CGCTGCGTGGCCCCCGGGCGC	0.682																																					p.G723G													.	MAP1S	74		0			c.C2169A												18.0	16.0	17.0					19																	17838362		2199	4295	6494	SO:0001819	synonymous_variant	55201	exon5			GCGTGGCCCCCGG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2169C>A	19.37:g.17838362C>A			23	0	0		28	0.32	9	NM_018174	67	0.45	30	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	37	CCDS32954.1																																																																																					0.682	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466027.1		NM_018174	
KLHL26	55295	mdanderson.org	37	19	18779747	18779747	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:18779747G>T	ENST00000300976.4	+	3	1630	c.1540G>T	c.(1540-1542)Ggg>Tgg	p.G514W	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	514										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CTATGCCCTCGGGGGCCGCAT	0.687																																					p.G514W													KLHL26,NS,carcinoma,0,1	KLHL26	0	1	0			c.G1540T												40.0	40.0	40.0					19																	18779747		2202	4297	6499	SO:0001583	missense	55295	exon3			GCCCTCGGGGGCC		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.1540G>T	19.37:g.18779747G>T	ENSP00000300976:p.Gly514Trp		19	0	0		18	0.11	2	NM_018316	4	0.50	2	Q8TAP0|Q9NUX3	Missense_Mutation	SNP	ENST00000300976.4	37	CCDS12384.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192872	0.58017	.	.	ENSG00000167487	ENST00000300976	D	0.84660	-1.88	4.49	4.49	0.54785	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.95348	0.8490	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97391	0.9989	9	.	.	.	.	16.1797	0.81890	0.0:0.0:1.0:0.0	.	514	Q53HC5	KLH26_HUMAN	W	514	ENSP00000300976:G514W	.	G	+	1	0	KLHL26	18640747	1.000000	0.71417	0.063000	0.19743	0.624000	0.37722	9.558000	0.98132	2.060000	0.61445	0.462000	0.41574	GGG			0.687	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465145.1		NM_018316	
LIPE-AS1	100996307	broad.mit.edu	37	19	42988997	42988997	+	RNA	DEL	A	A	-	rs35619678		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:42988997delA	ENST00000594688.1	+	0	1450				LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000593740.2_RNA|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000596116.1_RNA	NR_073179.1				LIPE antisense RNA 1																		TTTTTTTCTTAAAaaaaaaaa	0.348																																					.													.	.			0			.																																											0	.			TTTCTTAAAAAAA	AK096849, BM974950		19q13.2	2013-05-21			ENSG00000213904	ENSG00000213904		"""Long non-coding RNAs"""	48589	non-coding RNA	RNA, long non-coding							Standard	NR_073179		Approved				OTTHUMG00000182815		19.37:g.42988997delA			4	0	0		7	0.43	3	.	0		0		RNA	DEL	ENST00000594688.1	37																																																																																						0.348	LIPE-AS1-004	KNOWN	basic	antisense	antisense		OTTHUMT00000464099.1		NR_073179	
ALDH16A1	126133	mdanderson.org	37	19	49971739	49971739	+	Silent	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:49971739G>T	ENST00000293350.4	+	15	2203	c.2040G>T	c.(2038-2040)ctG>ctT	p.L680L	ALDH16A1_ENST00000455361.2_Silent_p.L629L|CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000540132.1_Silent_p.L517L|ALDH16A1_ENST00000433981.2_Silent_p.L515L	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	680						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		TCGTGTCCCTGCTGGCTCCCG	0.692																																					p.L680L													.	.			0			c.G2040T												139.0	146.0	143.0					19																	49971739		2203	4300	6503	SO:0001819	synonymous_variant	126133	exon15			GTCCCTGCTGGCT	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2040G>T	19.37:g.49971739G>T			13	0	0		18	0.11	2	NM_153329	141	0.00	0	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Silent	SNP	ENST00000293350.4	37	CCDS12766.1																																																																																					0.692	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465358.1		NM_153329	
FCGRT	2217	mdanderson.org	37	19	50028780	50028780	+	Missense_Mutation	SNP	C	C	T	rs200666118		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:50028780C>T	ENST00000221466.5	+	6	1424	c.938C>T	c.(937-939)gCg>gTg	p.A313V	FCGRT_ENST00000599988.1_Missense_Mutation_p.A47V|FCGRT_ENST00000426395.3_Missense_Mutation_p.A313V|FCGRT_ENST00000596975.1_Missense_Mutation_p.A221V|RCN3_ENST00000270645.3_5'Flank	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	313					antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		CTCACGGCAGCGGCTGTAGGA	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		17157	0.0		0.001	False		,,,				2504	0.0				p.A313V													FCGRT,NS,carcinoma,0,1	FCGRT	0	1	0			c.C938T							C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	74.0	63.0	67.0		938,938	-8.3	0.0	19		67	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FCGRT	NM_004107.4,NM_001136019.2	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	313/366,313/366	50028780	1,13005	2203	4300	6503	SO:0001583	missense	2217	exon5			CGGCAGCGGCTGT	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.938C>T	19.37:g.50028780C>T	ENSP00000221466:p.Ala313Val		42	0	0		40	0.08	3	NM_004107	308	0.00	0	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	CCDS12770.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	4.847	0.157445	0.09236	0.0	1.16E-4	ENSG00000104870	ENST00000221466;ENST00000426395	T;T	0.00700	5.82;5.82	4.73	-8.27	0.01017	.	1.561140	0.04316	N	0.349887	T	0.00440	0.0014	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.50541	-0.8816	10	0.62326	D	0.03	.	3.7306	0.08491	0.108:0.2483:0.1076:0.536	.	313	P55899	FCGRN_HUMAN	V	313	ENSP00000221466:A313V;ENSP00000410798:A313V	ENSP00000221466:A313V	A	+	2	0	FCGRT	54720592	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.689000	0.05144	-1.463000	0.01904	-0.244000	0.11960	GCG	0		0.607	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465267.1			
MYH14	79784	mdanderson.org	37	19	50781397	50781397	+	Missense_Mutation	SNP	C	C	T	rs372367091		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:50781397C>T	ENST00000596571.1	+	27	3760	c.3760C>T	c.(3760-3762)Cgg>Tgg	p.R1254W	MYH14_ENST00000376970.2_Missense_Mutation_p.R1287W|MYH14_ENST00000601313.1_Missense_Mutation_p.R1295W|MYH14_ENST00000262269.8_Missense_Mutation_p.R1295W|MYH14_ENST00000598205.1_Missense_Mutation_p.R1262W|MYH14_ENST00000425460.1_Missense_Mutation_p.R1262W|MYH14_ENST00000440075.2_Missense_Mutation_p.R1295W			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1254					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GTCCGAGCTGCGGGCAGAACT	0.647																																					p.R1295W													.	.			0			c.C3883T							C	TRP/ARG,TRP/ARG,TRP/ARG	1,4093		0,1,2046	22.0	27.0	26.0		3784,3883,3760	2.7	0.2	19		26	0,8398		0,0,4199	no	missense,missense,missense	MYH14	NM_001077186.1,NM_001145809.1,NM_024729.3	101,101,101	0,1,6245	TT,TC,CC		0.0,0.0244,0.0080	possibly-damaging,possibly-damaging,possibly-damaging	1262/2004,1295/2037,1254/1996	50781397	1,12491	2047	4199	6246	SO:0001583	missense	79784	exon30			GAGCTGCGGGCAG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.3760C>T	19.37:g.50781397C>T	ENSP00000472819:p.Arg1254Trp		32	0	0		35	0.09	3	NM_001145809	10	0.00	0	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815942	0.50527	2.44E-4	0.0	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	3.78	2.7	0.31948	Myosin tail (1);	.	.	.	.	T	0.77698	0.4169	L	0.32530	0.975	0.09310	N	1	D;D;D	0.61080	0.989;0.969;0.961	P;P;P	0.61940	0.896;0.871;0.797	T	0.64740	-0.6336	9	0.87932	D	0	.	6.3156	0.21188	0.2211:0.5822:0.1967:0.0	.	1295;1254;1262	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	W	1254;1295;1287;1262;1254;1295	ENSP00000406273:R1295W;ENSP00000366169:R1287W;ENSP00000407879:R1262W;ENSP00000262269:R1295W	ENSP00000262269:R1295W	R	+	1	2	MYH14	55473209	0.000000	0.05858	0.175000	0.22980	0.993000	0.82548	-0.511000	0.06321	0.891000	0.36235	0.462000	0.41574	CGG			0.647	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464710.2		NM_024729	
KLK7	5650	mdanderson.org	37	19	51485168	51485168	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:51485168G>T	ENST00000391807.1	-	3	177	c.76C>A	c.(76-78)Cag>Aag	p.Q26K	KLK7_ENST00000336317.4_Intron|KLK7_ENST00000597707.1_5'UTR|KLK7_ENST00000595820.1_Missense_Mutation_p.Q26K|KLK7_ENST00000595638.1_5'Flank|CTB-147C22.9_ENST00000594512.1_RNA	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	26					epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		TTGTCACCCTGGGCTGGATGG	0.597																																					p.Q26K													KLK7,colon,carcinoma,+2,1	KLK7	2	1	0			c.C76A												52.0	48.0	50.0					19																	51485168		2203	4300	6503	SO:0001583	missense	5650	exon3			CACCCTGGGCTGG	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.76C>A	19.37:g.51485168G>T	ENSP00000375683:p.Gln26Lys		58	0.0172413793	1		48	0.06	3	NM_139277	0		0	A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	37	CCDS12812.1	.	.	.	.	.	.	.	.	.	.	g	5.431	0.264748	0.10294	.	.	ENSG00000169035	ENST00000304045;ENST00000391807	D	0.92752	-3.1	4.39	-8.78	0.00824	.	.	.	.	.	T	0.81278	0.4789	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.65833	-0.6072	9	0.62326	D	0.03	.	11.8866	0.52606	0.0:0.6501:0.1422:0.2077	.	26	P49862	KLK7_HUMAN	K	26	ENSP00000375683:Q26K	ENSP00000304791:Q26K	Q	-	1	0	KLK7	56176980	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.346000	0.07760	-0.804000	0.04410	-1.328000	0.01277	CAG			0.597	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464344.1		NM_005046	
ZNF497	162968	mdanderson.org	37	19	58867669	58867669	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr19:58867669C>A	ENST00000311044.3	-	3	1521	c.1333G>T	c.(1333-1335)Gcc>Tcc	p.A445S	A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG_ENST00000263100.3_5'Flank|ZNF497_ENST00000425453.3_Missense_Mutation_p.A445S|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|CTD-2619J13.9_ENST00000599952.1_RNA	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		CTGCAGTGGGCGCAGACGAAC	0.701																																					p.A445S													.	.			0			c.G1333T												11.0	12.0	12.0					19																	58867669		2195	4293	6488	SO:0001583	missense	162968	exon3			AGTGGGCGCAGAC	AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.1333G>T	19.37:g.58867669C>A	ENSP00000311183:p.Ala445Ser		28	0	0		30	0.10	3	NM_198458	2	0.00	0	Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Missense_Mutation	SNP	ENST00000311044.3	37	CCDS12977.1	.	.	.	.	.	.	.	.	.	.	C	3.430	-0.116226	0.06881	.	.	ENSG00000174586	ENST00000311044;ENST00000425453	T;T	0.16324	2.35;2.35	0.912	-0.21	0.13176	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06005	0.0156	N	0.03983	-0.305	0.19575	N	0.999965	B	0.19200	0.034	B	0.24701	0.055	T	0.42103	-0.9471	9	0.21014	T	0.42	.	2.6239	0.04924	0.0:0.327:0.2651:0.4078	.	445	Q6ZNH5	ZN497_HUMAN	S	445	ENSP00000311183:A445S;ENSP00000402815:A445S	ENSP00000311183:A445S	A	-	1	0	ZNF497	63559481	0.000000	0.05858	0.044000	0.18714	0.577000	0.36160	-3.622000	0.00412	-0.041000	0.13558	0.195000	0.17529	GCC			0.701	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466942.2		NM_198458	
LINC01317	104355287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	33952333	33952333	+	lincRNA	SNP	G	G	A	rs77831373	byFrequency	TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:33952333G>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							AGAGGAGGACGGACAGCAAGG	0.617																																					.													.	.			0			.																																											151325	.			GAGGACGGACAGC																													2.37:g.33952333G>A			30	0	0		33	0.27	9	.	0		0		RNA	SNP	ENST00000366209.2	37																																																																																						0.617	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	lincRNA		OTTHUMT00000325406.1			
RANBP2	5903	broad.mit.edu	37	2	109382805	109382805	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:109382805delT	ENST00000283195.6	+	20	5936	c.5810delT	c.(5809-5811)attfs	p.I1937fs		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1937					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CGTGGTGTGATTTTTGGCCAA	0.413																																					p.I1937fs													.	RANBP2	488		0			c.5810delT												93.0	111.0	105.0					2																	109382805		2195	4282	6477	SO:0001589	frameshift_variant	5903	exon20			GTGTGATTTTTGG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.5810delT	2.37:g.109382805delT	ENSP00000283195:p.Ile1937fs		1255	0	0		1320	0.01	7	NM_006267	23	0.00	0	Q13074|Q15280|Q53TE2|Q59FH7	Frame_Shift_Del	DEL	ENST00000283195.6	37	CCDS2079.1																																																																																					0.413	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253594.1		NM_006267	
EPB41L5	57669	mdanderson.org	37	2	120844774	120844774	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:120844774G>T	ENST00000263713.5	+	11	1045	c.831G>T	c.(829-831)aaG>aaT	p.K277N	EPB41L5_ENST00000331393.4_Missense_Mutation_p.K277N|EPB41L5_ENST00000443902.2_Missense_Mutation_p.K277N|EPB41L5_ENST00000443124.1_Missense_Mutation_p.K277N|EPB41L5_ENST00000452780.1_Missense_Mutation_p.K277N	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	277	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TGGATTTTAAGAAGAATAAAT	0.269																																					p.K277N													.	.			0			c.G831T												68.0	77.0	74.0					2																	120844774		2197	4299	6496	SO:0001583	missense	57669	exon11			TTTTAAGAAGAAT	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.831G>T	2.37:g.120844774G>T	ENSP00000263713:p.Lys277Asn		56	0	0		48	0.06	3	NM_001184938	23	0.00	0	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	37	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483199	0.63962	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	4.91	4.03	0.46877	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.92835	0.7721	H	0.95151	3.63	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.87578	0.986;0.996;0.991;0.998	D	0.93318	0.6690	10	0.87932	D	0	.	10.426	0.44378	0.158:0.0:0.842:0.0	.	277;277;277;277	Q9HCM4-3;Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;.;E41L5_HUMAN	N	277	ENSP00000263713:K277N;ENSP00000393856:K277N;ENSP00000329687:K277N;ENSP00000393722:K277N;ENSP00000390439:K277N	ENSP00000263713:K277N	K	+	3	2	EPB41L5	120561244	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.884000	0.56175	1.076000	0.40961	-0.136000	0.14681	AAG			0.269	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000254230.2		NM_020909	
LCT	3938	mdanderson.org	37	2	136545926	136545926	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:136545926G>T	ENST00000264162.2	-	17	5762	c.5752C>A	c.(5752-5754)Caa>Aaa	p.Q1918K		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1918					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AATTCCTGTTGGCTTCGTTGT	0.458																																					p.Q1918K													.	.			0			c.C5752A												244.0	232.0	236.0					2																	136545926		2203	4300	6503	SO:0001583	missense	3938	exon17			CCTGTTGGCTTCG	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.5752C>A	2.37:g.136545926G>T	ENSP00000264162:p.Gln1918Lys		54	0	0		45	0.07	3	NM_002299	2	0.00	0	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225357	0.39300	.	.	ENSG00000115850	ENST00000264162	T	0.26067	1.76	5.82	4.03	0.46877	.	0.801296	0.11609	N	0.546984	T	0.22898	0.0553	L	0.54323	1.7	0.09310	N	1	B	0.21905	0.062	B	0.21708	0.036	T	0.28170	-1.0052	10	0.33141	T	0.24	-2.2628	4.6324	0.12507	0.0824:0.1512:0.6091:0.1572	.	1918	P09848	LPH_HUMAN	K	1918	ENSP00000264162:Q1918K	ENSP00000264162:Q1918K	Q	-	1	0	LCT	136262396	0.940000	0.31905	0.529000	0.27951	0.156000	0.22039	2.438000	0.44837	0.804000	0.34136	0.655000	0.94253	CAA			0.458	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254657.1		NM_002299	
SCN9A	6335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	167085326	167085326	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:167085326C>G	ENST00000409435.1	-	21	4080	c.4081G>C	c.(4081-4083)Gca>Cca	p.A1361P	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000409672.1_Missense_Mutation_p.A1350P|SCN9A_ENST00000375387.4_Missense_Mutation_p.A1362P|SCN9A_ENST00000303354.6_Missense_Mutation_p.A1362P			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1361					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTTGACTTGCAGGAAACCGT	0.398																																					p.A1350P													.	.			0			c.G4048C												227.0	232.0	230.0					2																	167085326		2057	4224	6281	SO:0001583	missense	6335	exon22			GACTTGCAGGAAA	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4081G>C	2.37:g.167085326C>G	ENSP00000386330:p.Ala1361Pro		111	0	0		111	0.05	6	NM_002977	0		0	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	C	9.733	1.162726	0.21538	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.96168	-3.9;-3.93;-3.93;-3.93	5.3	-8.13	0.01073	.	2.841100	0.00871	N	0.002031	D	0.89619	0.6767	N	0.17674	0.51	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.79936	-0.1593	10	0.36615	T	0.2	.	11.4943	0.50400	0.0:0.4747:0.3064:0.2189	.	1350	E7EUN6	.	P	1350;1362;1362;1361	ENSP00000386306:A1350P;ENSP00000364536:A1362P;ENSP00000304748:A1362P;ENSP00000386330:A1361P	ENSP00000304748:A1362P	A	-	1	0	SCN9A	166793572	0.000000	0.05858	0.000000	0.03702	0.527000	0.34593	-5.027000	0.00158	-1.458000	0.01916	-0.484000	0.04775	GCA			0.398	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000333639.1		NM_002977	
TTN	7273	bcgsc.ca	37	2	179480494	179480494	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:179480494G>T	ENST00000591111.1	-	208	43635	c.43411C>A	c.(43411-43413)Cta>Ata	p.L14471I	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L7172I|TTN_ENST00000460472.2_Missense_Mutation_p.L7047I|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L7239I|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L16112I|TTN_ENST00000342992.6_Missense_Mutation_p.L13544I			Q8WZ42	TITIN_HUMAN	titin	14471	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGAATTCTAGATCAGTCACA	0.383																																					p.L16112I													.	TTN	18412		0			c.C48334A												80.0	74.0	75.0					2																	179480494		1844	4090	5934	SO:0001583	missense	7273	exon258			ATTCTAGATCAGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43411C>A	2.37:g.179480494G>T	ENSP00000465570:p.Leu14471Ile		146	0	0		161	0.04	6	NM_001267550	1	0.00	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.24	1.877514	0.33162	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55234	0.53;0.53;0.53;0.53	5.96	4.05	0.47172	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50633	0.1627	L	0.45698	1.435	0.33264	D	0.560141	P;P;P;P	0.44659	0.84;0.84;0.84;0.84	P;P;P;P	0.44673	0.457;0.457;0.457;0.457	T	0.64149	-0.6475	9	0.87932	D	0	.	11.6993	0.51560	0.1511:0.0:0.8489:0.0	.	7047;7172;7239;14471	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	13544;7047;7239;7172;7047	ENSP00000343764:L13544I;ENSP00000434586:L7047I;ENSP00000340554:L7239I;ENSP00000352154:L7172I	ENSP00000340554:L7239I	L	-	1	2	TTN	179188739	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	6.559000	0.73946	0.744000	0.32741	0.655000	0.94253	CTA			0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
GULP1	51454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189452633	189452633	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr2:189452633C>T	ENST00000409580.1	+	12	1514	c.800C>T	c.(799-801)gCa>gTa	p.A267V	GULP1_ENST00000409805.1_Missense_Mutation_p.A164V|GULP1_ENST00000409609.1_Missense_Mutation_p.A267V|GULP1_ENST00000409830.1_Missense_Mutation_p.A267V|GULP1_ENST00000359135.3_Missense_Mutation_p.A267V|GULP1_ENST00000409843.1_Missense_Mutation_p.A267V			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1	267					apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			TGTGGAGCAGCAGATTTCCCT	0.373																																					p.A267V	Pancreas(178;563 2065 20199 42378 52815)												.	.			0			c.C800T												102.0	103.0	103.0					2																	189452633		2203	4300	6503	SO:0001583	missense	51454	exon11			GAGCAGCAGATTT	AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.800C>T	2.37:g.189452633C>T	ENSP00000386289:p.Ala267Val		317	0	0		289	0.17	48	NM_016315	14	0.29	4	B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	Missense_Mutation	SNP	ENST00000409580.1	37	CCDS2295.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.11|19.11	3.764606|3.764606	0.69878|0.69878	.|.	.|.	ENSG00000144366|ENSG00000144366	ENST00000409843;ENST00000409830;ENST00000409805;ENST00000359135;ENST00000409580;ENST00000409609|ENST00000451191;ENST00000433052	T;T;T;T;T|.	0.46451|.	0.87;0.89;0.89;0.89;0.89|.	5.6|5.6	4.72|4.72	0.59763|0.59763	.|.	0.216900|.	0.47455|.	D|.	0.000233|.	T|.	0.61813|.	0.2377|.	L|L	0.46157|0.46157	1.445|1.445	0.39919|0.39919	D|D	0.974138|0.974138	P;P;B;B|.	0.41848|.	0.763;0.664;0.03;0.1|.	B;B;B;B|.	0.38500|.	0.085;0.275;0.033;0.022|.	T|.	0.61277|.	-0.7095|.	10|.	0.27785|.	T|.	0.31|.	-1.7295|-1.7295	15.4384|15.4384	0.75165|0.75165	0.0:0.1454:0.8546:0.0|0.0:0.1454:0.8546:0.0	.|.	164;91;267;267|.	E9PB86;Q59EC1;Q9UBP9;B8ZZ72|.	.;.;GULP1_HUMAN;.|.	V|X	267;267;164;267;267;267|92;152	ENSP00000387144:A267V;ENSP00000386732:A267V;ENSP00000352047:A267V;ENSP00000386289:A267V;ENSP00000386867:A267V|.	ENSP00000352047:A267V|.	A|Q	+|+	2|1	0|0	GULP1|GULP1	189160878|189160878	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	5.782000|5.782000	0.68973|0.68973	1.368000|1.368000	0.46115|0.46115	-0.340000|-0.340000	0.08031|0.08031	GCA|CAG			0.373	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335722.1		NM_016315	
VSX1	30813	mdanderson.org	37	20	25060101	25060101	+	Silent	SNP	G	G	T	rs199995626		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr20:25060101G>T	ENST00000376709.4	-	2	737	c.474C>A	c.(472-474)acC>acA	p.T158T	VSX1_ENST00000444511.2_Silent_p.T158T|VSX1_ENST00000451258.1_Silent_p.T158T|VSX1_ENST00000429762.3_Silent_p.T158T|VSX1_ENST00000424574.1_Silent_p.T158T|VSX1_ENST00000376707.3_Silent_p.T158T	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	158					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						TCTTGCCCAAGGTGGGGGATG	0.552																																					p.T158T													.	.			0			c.C474A												65.0	50.0	55.0					20																	25060101		2203	4300	6503	SO:0001819	synonymous_variant	30813	exon2			GCCCAAGGTGGGG	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.474C>A	20.37:g.25060101G>T			60	0	0		52	0.06	3	NM_001256271	0		0	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Silent	SNP	ENST00000376709.4	37	CCDS13168.1																																																																																					0.552	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078384.3			
ZNF831	128611	mdanderson.org	37	20	57767767	57767767	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr20:57767767G>T	ENST00000371030.2	+	1	1693	c.1693G>T	c.(1693-1695)Gcc>Tcc	p.A565S		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	565							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGTCAGACAGGCCGCGGTGGA	0.716																																					p.A565S													.	.			0			c.G1693T												7.0	9.0	8.0					20																	57767767		1885	4023	5908	SO:0001583	missense	128611	exon1			AGACAGGCCGCGG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1693G>T	20.37:g.57767767G>T	ENSP00000360069:p.Ala565Ser		22	0	0		21	0.10	2	NM_178457	0		0	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310429	0.40895	.	.	ENSG00000124203	ENST00000371030	T	0.11169	2.8	5.21	4.25	0.50352	.	.	.	.	.	T	0.13286	0.0322	L	0.58101	1.795	0.24424	N	0.994609	D	0.53151	0.958	B	0.44108	0.441	T	0.15578	-1.0432	9	0.49607	T	0.09	-6.9447	7.539	0.27727	0.2465:0.0:0.7535:0.0	.	565	Q5JPB2	ZN831_HUMAN	S	565	ENSP00000360069:A565S	ENSP00000360069:A565S	A	+	1	0	ZNF831	57201162	0.799000	0.28903	0.999000	0.59377	0.742000	0.42306	1.267000	0.33050	2.423000	0.82170	0.655000	0.94253	GCC			0.716	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000079916.2		NM_178457	
ADAMTS5	11096	mdanderson.org	37	21	28338584	28338584	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr21:28338584G>T	ENST00000284987.5	-	1	248	c.127C>A	c.(127-129)Ccc>Acc	p.P43T		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	43					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						CGCCGGCGGGGCTGGGCGGCT	0.771																																					p.P43T	Esophageal Squamous(53;683 1080 10100 14424 45938)												.	.			0			c.C127A												5.0	5.0	5.0					21																	28338584		1398	2957	4355	SO:0001583	missense	11096	exon1			GGCGGGGCTGGGC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.127C>A	21.37:g.28338584G>T	ENSP00000284987:p.Pro43Thr		23	0	0		17	0.12	2	NM_007038	0		0	Q52LV4|Q9UKP2	Missense_Mutation	SNP	ENST00000284987.5	37	CCDS13579.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.057811	0.55325	.	.	ENSG00000154736	ENST00000284987	T	0.12879	2.64	4.17	3.29	0.37713	.	0.185011	0.26784	N	0.022510	T	0.09158	0.0226	L	0.36672	1.1	0.28285	N	0.923822	B	0.06786	0.001	B	0.11329	0.006	T	0.29912	-0.9996	10	0.15499	T	0.54	.	6.2277	0.20718	0.0981:0.0:0.718:0.1838	.	43	Q9UNA0	ATS5_HUMAN	T	43	ENSP00000284987:P43T	ENSP00000284987:P43T	P	-	1	0	ADAMTS5	27260455	1.000000	0.71417	0.996000	0.52242	0.932000	0.56968	3.932000	0.56537	0.945000	0.37605	0.563000	0.77884	CCC			0.771	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171648.1			
DEPDC5	9681	broad.mit.edu	37	22	32302245	32302245	+	Missense_Mutation	SNP	G	G	A	rs370366925		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr22:32302245G>A	ENST00000382112.3	+	42	4617	c.4547G>A	c.(4546-4548)cGg>cAg	p.R1516Q	DEPDC5_ENST00000400246.1_Missense_Mutation_p.G1505S|DEPDC5_ENST00000400248.2_Missense_Mutation_p.R1494Q|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R1494Q|DEPDC5_ENST00000382111.2_Missense_Mutation_p.G1505S|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R1503Q|DEPDC5_ENST00000535622.1_Missense_Mutation_p.R1425Q|DEPDC5_ENST00000539165.1_Missense_Mutation_p.R342Q|DEPDC5_ENST00000382105.2_3'UTR	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1525					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)	p.R1494Q(1)|p.R1425Q(1)		breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GGGCAGCAGCGGCGGCGGCGG	0.607																																					p.R1525Q													DEPDC5_ENST00000535622,NS,carcinoma,0,1	DEPDC5	266	1	2	Substitution - Missense(2)	endometrium(2)	c.G4574A							G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,3897		0,1,1948	31.0	36.0	34.0		4547,4574,4274,4481	4.0	1.0	22		34	0,8270		0,0,4135	no	missense,missense,missense,missense	DEPDC5	NM_001136029.2,NM_001242896.1,NM_001242897.1,NM_014662.3	43,43,43,43	0,1,6083	AA,AG,GG		0.0,0.0257,0.0082	probably-damaging,probably-damaging,probably-damaging,probably-damaging	1516/1595,1525/1604,1425/1504,1494/1573	32302245	1,12167	1949	4135	6084	SO:0001583	missense	9681	exon43			AGCAGCGGCGGCG	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4547G>A	22.37:g.32302245G>A	ENSP00000371546:p.Arg1516Gln		178	0	0		193	0.03	5	NM_001242896	38	0.05	2	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	37	CCDS46692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.511871|4.511871	0.85389|0.85389	2.57E-4|2.57E-4	0.0|0.0	ENSG00000100150|ENSG00000100150	ENST00000400246;ENST00000382111|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000382112;ENST00000400248;ENST00000539165	T;T|T;T;T;T;T	0.21191|0.32023	2.02;2.02|1.47;1.9;1.9;1.91;1.9	4.99|4.99	3.96|3.96	0.45880|0.45880	.|.	.|0.091579	.|0.44483	.|D	.|0.000449	T|T	0.45756|0.45756	0.1358|0.1358	L|L	0.46157|0.46157	1.445|1.445	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D;D;D	.|0.76494	.|0.999;0.998;0.998;0.999;0.997	.|D;D;D;D;D	.|0.75484	.|0.978;0.945;0.986;0.978;0.968	T|T	0.24119|0.24119	-1.0169|-1.0169	7|10	0.87932|0.25106	D|T	0|0.35	.|.	14.0559|14.0559	0.64769|0.64769	0.0:0.0:0.8478:0.1522|0.0:0.0:0.8478:0.1522	.|.	.|1525;1425;1503;1516;1494	.|B9EGN9;B4DH93;O75140-4;A8MPX9;O75140	.|.;.;.;.;DEPD5_HUMAN	S|Q	1505|1425;1503;1494;1425;1516;1494;342	ENSP00000383105:G1505S;ENSP00000371545:G1505S|ENSP00000440210:R1425Q;ENSP00000266091:R1503Q;ENSP00000383108:R1494Q;ENSP00000371546:R1516Q;ENSP00000383107:R1494Q	ENSP00000371545:G1505S|ENSP00000266091:R1503Q	G|R	+|+	1|2	0|0	DEPDC5|DEPDC5	30632245|30632245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.191000|9.191000	0.94940|0.94940	1.225000|1.225000	0.43566|0.43566	0.462000|0.462000	0.41574|0.41574	GGC|CGG			0.607	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000129087.1	rescued with RNA-seq	NM_014662	
SLC6A6	6533	hgsc.bcm.edu	37	3	14508094	14508094	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr3:14508094C>T	ENST00000454876.2	+	7	1132	c.803C>T	c.(802-804)cCg>cTg	p.P268L	SLC6A6_ENST00000360861.3_Missense_Mutation_p.P268L			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	268					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						CTGACGCTGCCGGGCGCGGGC	0.617																																					p.P268L													SLC6A6,NS,malignant_melanoma,0,2	SLC6A6	0	2	0			c.C803T												89.0	75.0	80.0					3																	14508094		2203	4300	6503	SO:0001583	missense	6533	exon7			CGCTGCCGGGCGC		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.803C>T	3.37:g.14508094C>T	ENSP00000398063:p.Pro268Leu		36	0	0		31	0.06	2	NM_003043	20	0.00	0	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	37	CCDS33705.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.797092	0.90453	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	T;T	0.78595	-1.19;-1.19	4.55	4.55	0.56014	.	0.108366	0.64402	D	0.000004	D	0.91690	0.7373	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94440	0.7657	10	0.87932	D	0	.	17.6676	0.88207	0.0:1.0:0.0:0.0	.	268	P31641	SC6A6_HUMAN	L	268	ENSP00000398063:P268L;ENSP00000354107:P268L	ENSP00000354107:P268L	P	+	2	0	SLC6A6	14483098	1.000000	0.71417	0.961000	0.40146	0.739000	0.42172	7.813000	0.86123	2.241000	0.73720	0.491000	0.48974	CCG			0.617	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340507.1		NM_003043	
SUCLG2	8801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	67578573	67578573	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr3:67578573C>T	ENST00000307227.5	-	4	427	c.400G>A	c.(400-402)Ggt>Agt	p.G134S	SUCLG2_ENST00000493112.1_Missense_Mutation_p.G134S|SUCLG2_ENST00000492795.1_Missense_Mutation_p.G134S	NM_003848.3	NP_003839.2	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	134	ATP-grasp.				cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	ACTTTCACACCTTCTTTTGGA	0.348																																					p.G134S													SUCLG2_ENST00000493112,NS,carcinoma,0,3	SUCLG2_ENST00000493112	0	3	0			c.G400A												123.0	106.0	111.0					3																	67578573		1834	4074	5908	SO:0001583	missense	8801	exon4			TCACACCTTCTTT	AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000307227.5:c.400G>A	3.37:g.67578573C>T	ENSP00000307432:p.Gly134Ser		75	0	0		72	0.10	7	NM_001177599	17	0.35	6	C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	ENST00000307227.5	37	CCDS43104.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.415462|5.415462	0.96092|0.96092	.|.	.|.	ENSG00000172340|ENSG00000172340	ENST00000493112;ENST00000307227;ENST00000541608;ENST00000492795|ENST00000460567	T;T;T|.	0.75050|.	-0.9;-0.9;-0.9|.	5.95|5.95	5.95|5.95	0.96441|0.96441	ATP-grasp fold, subdomain 1 (1);ATP-grasp fold, succinyl-CoA synthetase-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87140|0.87140	0.6103|0.6103	M|M	0.92738|0.92738	3.34|3.34	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.89028|0.89028	0.3440|0.3440	10|5	0.87932|.	D|.	0|.	.|.	20.3921|20.3921	0.98947|0.98947	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	86;134|.	F5H4S7;Q96I99|.	.;SUCB2_HUMAN|.	S|K	134;134;86;134|25	ENSP00000419325:G134S;ENSP00000307432:G134S;ENSP00000417589:G134S|.	ENSP00000307432:G134S|.	G|R	-|-	1|2	0|0	SUCLG2|SUCLG2	67661263|67661263	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.625000|7.625000	0.83145|0.83145	2.822000|2.822000	0.97130|0.97130	0.650000|0.650000	0.86243|0.86243	GGT|AGG			0.348	SUCLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351993.1		NM_003848	
CHMP2B	25978	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	87289878	87289878	+	Missense_Mutation	SNP	C	C	G	rs138886714	byFrequency	TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr3:87289878C>G	ENST00000263780.4	+	2	302	c.64C>G	c.(64-66)Cga>Gga	p.R22G	CHMP2B_ENST00000494980.1_Missense_Mutation_p.R22G|CHMP2B_ENST00000471660.1_Intron|CHMP2B_ENST00000472024.1_3'UTR	NM_014043.3	NP_054762.2	Q9UQN3	CHM2B_HUMAN	charged multivesicular body protein 2B	22					cell death (GO:0008219)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	12	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		TCGAGAGTTACGAGGTACACA	0.323																																					p.R22G													.	.			0			c.C64G												101.0	103.0	102.0					3																	87289878		2203	4300	6503	SO:0001583	missense	25978	exon2			GAGTTACGAGGTA	BC001553	CCDS2918.1, CCDS58840.1	3p12.1	2011-09-21	2011-09-21		ENSG00000083937	ENSG00000083937		"""Charged multivesicular body proteins"""	24537	protein-coding gene	gene with protein product	"""VPS2 homolog B (S. cerevisiae)"""	609512	"""chromatin modifying protein 2B"""			11559748	Standard	NM_014043		Approved	DKFZP564O123, CHMP2.5, VPS2B	uc003dqp.4	Q9UQN3	OTTHUMG00000158982	ENST00000263780.4:c.64C>G	3.37:g.87289878C>G	ENSP00000263780:p.Arg22Gly		281	0	0		252	0.21	52	NM_014043	81	0.21	17	B4DJG8|Q53HC7|Q9Y4U6	Missense_Mutation	SNP	ENST00000263780.4	37	CCDS2918.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644820	0.47258	.	.	ENSG00000083937	ENST00000263780;ENST00000494980	T;T	0.74737	-0.87;-0.87	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.79215	0.4408	M	0.74389	2.26	0.80722	D	1	P	0.38711	0.643	P	0.46237	0.508	T	0.80612	-0.1305	10	0.56958	D	0.05	-13.3005	12.4664	0.55762	0.2816:0.7184:0.0:0.0	.	22	Q9UQN3	CHM2B_HUMAN	G	22	ENSP00000263780:R22G;ENSP00000418920:R22G	ENSP00000263780:R22G	R	+	1	2	CHMP2B	87372568	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.986000	0.49370	2.542000	0.85734	0.650000	0.86243	CGA			0.323	CHMP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352779.2		NM_014043	
DIRC2	84925	hgsc.bcm.edu	37	3	122579034	122579034	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr3:122579034C>A	ENST00000261038.5	+	7	1521	c.1123C>A	c.(1123-1125)Cta>Ata	p.L375I		NM_032839.2	NP_116228.1	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2	375					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)				endometrium(2)|large_intestine(1)|lung(14)|prostate(1)	18				GBM - Glioblastoma multiforme(114;0.0614)		CATCACACACCTACCTTTAAC	0.413																																					p.L375I													.	.			0			c.C1123A												135.0	123.0	127.0					3																	122579034		2203	4300	6503	SO:0001583	missense	84925	exon7			ACACACCTACCTT	AK027690	CCDS3018.1	3q21.1	2013-05-22			ENSG00000138463	ENSG00000138463		"""Solute carriers"""	16628	protein-coding gene	gene with protein product	"""renal cell carcinoma 4"", ""disrupted in renal cancer protein 2"""	602773				11912179	Standard	NM_032839		Approved	FLJ14784, RCC4	uc003efw.4	Q96SL1	OTTHUMG00000159553	ENST00000261038.5:c.1123C>A	3.37:g.122579034C>A	ENSP00000261038:p.Leu375Ile		122	0	0		124	0.04	5	NM_032839	47	0.00	0	A8K561|Q8NBX9	Missense_Mutation	SNP	ENST00000261038.5	37	CCDS3018.1	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698054	0.68386	.	.	ENSG00000138463	ENST00000261038	T	0.59083	0.29	6.08	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.49389	0.1554	L	0.39326	1.205	0.80722	D	1	P	0.35481	0.504	B	0.36534	0.227	T	0.48080	-0.9066	10	0.37606	T	0.19	.	12.3141	0.54946	0.0:0.9175:0.0:0.0825	.	375	Q96SL1	DIRC2_HUMAN	I	375	ENSP00000261038:L375I	ENSP00000261038:L375I	L	+	1	2	DIRC2	124061724	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.049000	0.64244	1.557000	0.49525	0.591000	0.81541	CTA			0.413	DIRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356180.2		NM_032839	
PLXNA1	5361	mdanderson.org	37	3	126734047	126734047	+	Silent	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr3:126734047G>T	ENST00000393409.2	+	14	2898	c.2898G>T	c.(2896-2898)gtG>gtT	p.V966V	PLXNA1_ENST00000251772.4_Silent_p.V943V	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	966	IPT/TIG 2.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TCTACCGTGTGAGCCCCTCCC	0.637																																					p.V966V													.	.			0			c.G2898T												66.0	68.0	68.0					3																	126734047		2203	4300	6503	SO:0001819	synonymous_variant	5361	exon14			CCGTGTGAGCCCC	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2898G>T	3.37:g.126734047G>T			51	0	0		45	0.07	3	NM_032242	12	0.00	0		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																					0.637	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356451.1		NM_032242	
GFM1	85476	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	158376767	158376767	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr3:158376767G>T	ENST00000486715.1	+	9	1497	c.1140G>T	c.(1138-1140)aaG>aaT	p.K380N	GFM1_ENST00000478576.1_Missense_Mutation_p.K380N|GFM1_ENST00000264263.5_Missense_Mutation_p.K399N	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			AGCTAAAGAAGGGTGACACCA	0.443																																					p.K380N													.	.			0			c.G1140T												134.0	121.0	125.0					3																	158376767		2203	4300	6503	SO:0001583	missense	85476	exon9			AAAGAAGGGTGAC	AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.1140G>T	3.37:g.158376767G>T	ENSP00000419038:p.Lys380Asn		58	0	0		70	0.07	5	NM_024996	42	0.00	0		Missense_Mutation	SNP	ENST00000486715.1	37	CCDS33885.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806465	0.70682	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.66995	-0.24;-0.24;-0.24	5.81	3.71	0.42584	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.82504	0.5051	M	0.90922	3.16	0.80722	D	1	D;P;D	0.56287	0.968;0.938;0.975	P;P;P	0.62089	0.885;0.898;0.898	D	0.86154	0.1589	10	0.87932	D	0	-18.2823	11.9373	0.52880	0.2333:0.0:0.7667:0.0	.	399;380;380	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	N	380;380;399	ENSP00000419038:K380N;ENSP00000418755:K380N;ENSP00000264263:K399N	ENSP00000264263:K399N	K	+	3	2	GFM1	159859461	0.997000	0.39634	1.000000	0.80357	0.956000	0.61745	0.337000	0.19841	1.461000	0.47929	0.655000	0.94253	AAG			0.443	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352271.1		NM_024996	
KLB	152831	bcgsc.ca	37	4	39448347	39448347	+	Silent	SNP	C	C	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr4:39448347C>A	ENST00000257408.4	+	4	2098	c.2001C>A	c.(1999-2001)gcC>gcA	p.A667A		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	667	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CATCGACGGCCGAGGCCTTCC	0.627																																					p.A667A													.	KLB	95		0			c.C2001A												53.0	54.0	53.0					4																	39448347		2202	4300	6502	SO:0001819	synonymous_variant	152831	exon4			GACGGCCGAGGCC	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2001C>A	4.37:g.39448347C>A			34	0	0		42	0.10	4	NM_175737	0		0	Q2M3K8	Silent	SNP	ENST00000257408.4	37	CCDS3451.1																																																																																					0.627	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250429.1		NM_175737	
BMP2K	55589	broad.mit.edu	37	4	79793947	79793947	+	Silent	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr4:79793947C>T	ENST00000335016.5	+	13	1954	c.1788C>T	c.(1786-1788)gcC>gcT	p.A596A	BMP2K_ENST00000502871.1_Silent_p.A596A	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	596					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						CCTATAGTGCCAATAGGCAAG	0.403																																					p.A596A													.	BMP2K	169		0			c.C1788T												86.0	88.0	87.0					4																	79793947		2203	4300	6503	SO:0001819	synonymous_variant	55589	exon13			TAGTGCCAATAGG	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1788C>T	4.37:g.79793947C>T			154	0	0		109	0.05	5	NM_017593	3	0.00	0	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	C	7.062	0.566522	0.13560	.	.	ENSG00000138756	ENST00000502613	.	.	.	5.54	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.0401	12.2501	0.54593	0.3763:0.6237:0.0:0.0	.	.	.	.	X	289	.	.	Q	+	1	0	BMP2K	80012971	0.999000	0.42202	1.000000	0.80357	0.608000	0.37181	1.067000	0.30616	1.434000	0.47414	0.591000	0.81541	CAA			0.403	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_017593	
CYP2U1	113612	mdanderson.org	37	4	108853024	108853024	+	Silent	SNP	G	G	T	rs145192019		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr4:108853024G>T	ENST00000332884.6	+	1	500	c.225G>T	c.(223-225)gtG>gtT	p.V75V	CYP2U1_ENST00000513302.1_3'UTR|RP11-286E11.1_ENST00000499098.1_RNA|RP11-286E11.1_ENST00000513071.1_RNA|CYP2U1_ENST00000508453.1_5'UTR	NM_183075.2	NP_898898.1	Q7Z449	CP2U1_HUMAN	cytochrome P450, family 2, subfamily U, polypeptide 1	75					arachidonic acid metabolic process (GO:0019369)|cell death (GO:0008219)|omega-hydroxylase P450 pathway (GO:0097267)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|large_intestine(2)|lung(4)|skin(2)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000128)		TCGGTCACGTGCTGCTGCCTC	0.731																																					p.V75V													.	.			0			c.G225T												7.0	9.0	8.0					4																	108853024		1990	3864	5854	SO:0001819	synonymous_variant	113612	exon1			TCACGTGCTGCTG	BC012027	CCDS34047.1	4q25	2012-11-23			ENSG00000155016	ENSG00000155016		"""Cytochrome P450s"""	20582	protein-coding gene	gene with protein product	"""spastic paraplegia 49"""	610670				14975754, 14660610	Standard	XM_005262717		Approved	SPG49	uc003hyp.3	Q7Z449	OTTHUMG00000161084	ENST00000332884.6:c.225G>T	4.37:g.108853024G>T			39	0	0		20	0.10	2	NM_183075	1	0.00	0	B2RMV7|Q96EQ6	Silent	SNP	ENST00000332884.6	37	CCDS34047.1																																																																																					0.731	CYP2U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363691.2		NM_183075	
TAS2R1	50834	mdanderson.org	37	5	9629567	9629567	+	Missense_Mutation	SNP	G	G	T	rs185412063	byFrequency	TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr5:9629567G>T	ENST00000382492.2	-	1	896	c.578C>A	c.(577-579)gCt>gAt	p.A193D	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	193					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						GAGCAAAACAGCAAAAAGGAA	0.483													G|||	3	0.000599042	0.0	0.0029	5008	,	,		18287	0.0		0.001	False		,,,				2504	0.0				p.A193D													.	.			0			c.C578A							G	ASP/ALA	0,4406		0,0,2203	60.0	68.0	65.0		578	4.8	0.0	5		65	1,8599	1.2+/-3.3	0,1,4299	no	missense	TAS2R1	NM_019599.2	126	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	193/300	9629567	1,13005	2203	4300	6503	SO:0001583	missense	50834	exon1			AAAACAGCAAAAA	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.578C>A	5.37:g.9629567G>T	ENSP00000371932:p.Ala193Asp		57	0	0		44	0.07	3	NM_019599	0		0	Q646G8	Missense_Mutation	SNP	ENST00000382492.2	37	CCDS3876.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	G	17.21	3.332262	0.60853	0.0	1.16E-4	ENSG00000169777	ENST00000382492	T	0.38401	1.14	5.65	4.78	0.61160	.	0.337773	0.27315	N	0.019933	T	0.48624	0.1510	M	0.76574	2.34	0.09310	N	1	D	0.64830	0.994	D	0.66497	0.944	T	0.49283	-0.8956	9	.	.	.	.	12.1257	0.53915	0.0815:0.0:0.9185:0.0	.	193	Q9NYW7	TA2R1_HUMAN	D	193	ENSP00000371932:A193D	.	A	-	2	0	TAS2R1	9682567	0.478000	0.25917	0.004000	0.12327	0.004000	0.04260	4.501000	0.60393	1.620000	0.50308	0.655000	0.94253	GCT	0.001		0.483	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206988.2			
SLC23A1	9963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	138713761	138713761	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr5:138713761C>T	ENST00000348729.3	-	12	1402	c.1356G>A	c.(1354-1356)atG>atA	p.M452I	SLC23A1_ENST00000503919.1_5'Flank|SLC23A1_ENST00000353963.3_Missense_Mutation_p.M456I	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	452				DM -> AL (in Ref. 1; AAC78804). {ECO:0000305}.	brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	GAGAGGAGTTCATGTCCACAA	0.562																																					p.M456I													.	.			0			c.G1368A												93.0	78.0	83.0					5																	138713761		2203	4300	6503	SO:0001583	missense	9963	exon12			GGAGTTCATGTCC	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1356G>A	5.37:g.138713761C>T	ENSP00000302701:p.Met452Ile		76	0	0		83	0.17	14	NM_152685	1	0.00	0	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691140	0.68271	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881	T;T	0.16743	2.32;2.32	5.3	5.3	0.74995	.	0.086008	0.85682	D	0.000000	T	0.17874	0.0429	L	0.38733	1.17	0.50467	D	0.999872	B;B	0.31752	0.121;0.338	B;B	0.35971	0.215;0.187	T	0.02288	-1.1182	10	0.72032	D	0.01	0.2453	14.3748	0.66867	0.0:0.8522:0.1478:0.0	.	452;456	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	I	456;452;113	ENSP00000302851:M456I;ENSP00000302701:M452I	ENSP00000343584:M113I	M	-	3	0	SLC23A1	138741660	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.520000	0.45554	2.763000	0.94921	0.561000	0.74099	ATG			0.562	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000374185.1		NM_152685	
PCDHB13	56123	mdanderson.org	37	5	140595340	140595340	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr5:140595340G>T	ENST00000341948.4	+	1	1832	c.1645G>T	c.(1645-1647)Gtg>Ttg	p.V549L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	549	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGGTGCGCGTGGTGGTGCT	0.716																																					p.V549L													PCDHB13,NS,neuroblastoma,-2,1	PCDHB13	-2	1	0			c.G1645T												34.0	38.0	37.0					5																	140595340		2202	4298	6500	SO:0001583	missense	56123	exon1			GTGCGCGTGGTGG	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1645G>T	5.37:g.140595340G>T	ENSP00000345491:p.Val549Leu		24	0	0		44	0.07	3	NM_018933	1	0.00	0	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	-	14.79	2.641360	0.47153	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.61040	0.14	3.0	-0.23	0.13090	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.45316	0.1336	L	0.46614	1.455	0.09310	N	0.999999	P	0.42203	0.773	P	0.44561	0.453	T	0.28459	-1.0043	9	0.20046	T	0.44	.	1.3841	0.02236	0.2837:0.1441:0.4253:0.1468	.	549	Q9Y5F0	PCDBD_HUMAN	L	549;549;495	ENSP00000345491:V549L	ENSP00000345491:V549L	V	+	1	0	PCDHB13	140575524	0.425000	0.25498	0.040000	0.18447	0.002000	0.02628	0.600000	0.24104	-0.204000	0.10235	-0.556000	0.04195	GTG			0.716	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251810.1		NM_018933	
PCDHGA9	56107	bcgsc.ca;mdanderson.org	37	5	140782626	140782626	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr5:140782626C>A	ENST00000573521.1	+	1	107	c.107C>A	c.(106-108)cCt>cAt	p.P36H	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTCAGTGCCTGAAGAGACA	0.592																																					p.P36H													.	PCDHGA9	110		0			c.C107A												59.0	69.0	65.0					5																	140782626		2096	4258	6354	SO:0001583	missense	56107	exon1			CAGTGCCTGAAGA	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.107C>A	5.37:g.140782626C>A	ENSP00000460274:p.Pro36His		78	0	0		103	0.05	5	NM_032089	0		0	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1																																																																																					0.592	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437105.1		NM_018921	
IRF4	3662	broad.mit.edu;bcgsc.ca	37	6	393255	393255	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:393255G>T	ENST00000380956.4	+	2	229	c.103G>T	c.(103-105)Ggc>Tgc	p.G35C	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	35					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		GATCGACAGCGGCAAGTACCC	0.667			T	IGH@	MM																																p.G35C				Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65		0			c.G103T												35.0	35.0	35.0					6																	393255		2201	4298	6499	SO:0001583	missense	3662	exon2			GACAGCGGCAAGT	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.103G>T	6.37:g.393255G>T	ENSP00000370343:p.Gly35Cys		127	0.0078740157	1		149	0.16	24	NM_001195286	5	0.00	0	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386498	0.82902	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.98150	-4.75	4.58	4.58	0.56647	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.098877	0.64402	D	0.000001	D	0.98207	0.9407	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.996;0.981	D	0.98314	1.0525	10	0.54805	T	0.06	-28.3311	12.1244	0.53909	0.0829:0.0:0.9171:0.0	.	35;35;35	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	C	35;65	ENSP00000370343:G35C	ENSP00000370343:G35C	G	+	1	0	IRF4	338255	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.841000	0.69409	2.399000	0.81585	0.306000	0.20318	GGC			0.667	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043638.1			
BAG6	7917	mdanderson.org	37	6	31610608	31610608	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:31610608G>T	ENST00000375964.6	-	14	2264	c.1951C>A	c.(1951-1953)Cag>Aag	p.Q651K	BAG6_ENST00000404765.2_Missense_Mutation_p.Q681K|BAG6_ENST00000211379.5_Missense_Mutation_p.Q645K|BAG6_ENST00000439687.2_Intron|BAG6_ENST00000470875.1_5'UTR|BAG6_ENST00000375976.4_Missense_Mutation_p.Q645K|BAG6_ENST00000362049.6_Missense_Mutation_p.Q645K	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	651	Pro-rich.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CCACTCACCTGCAAGAAGTCA	0.592																																					p.Q651K													.	.			0			c.C1951A												30.0	24.0	26.0					6																	31610608		2203	4300	6503	SO:0001583	missense	7917	exon14			TCACCTGCAAGAA	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1951C>A	6.37:g.31610608G>T	ENSP00000365131:p.Gln651Lys		18	0	0		33	0.09	3	NM_004639	156	0.00	0	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888626	0.91814	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000362049;ENST00000437771	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.46229	0.1382	L	0.34521	1.04	0.80722	D	1	D;P;P	0.61080	0.989;0.865;0.811	D;P;P	0.67725	0.953;0.824;0.879	T	0.40270	-0.9572	10	0.51188	T	0.08	.	18.4089	0.90545	0.0:0.0:1.0:0.0	.	645;651;645	F8VXY4;P46379;P46379-2	.;BAG6_HUMAN;.	K	645;651;645;681;645;681	ENSP00000365143:Q645K;ENSP00000365131:Q651K;ENSP00000211379:Q645K;ENSP00000384494:Q681K;ENSP00000354875:Q645K;ENSP00000397978:Q681K	ENSP00000211379:Q645K	Q	-	1	0	BAG6	31718587	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.135000	0.89608	2.647000	0.89833	0.558000	0.71614	CAG			0.592	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_080703	
DDAH2	23564	broad.mit.edu	37	6	31695404	31695404	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:31695404G>T	ENST00000375789.2	-	5	1287	c.657C>A	c.(655-657)gaC>gaA	p.D219E	DDAH2_ENST00000375787.2_Missense_Mutation_p.D219E|DDAH2_ENST00000375792.3_Missense_Mutation_p.D219E|DDAH2_ENST00000480913.1_5'UTR			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	219					arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	GAAAGAGACAGTCAGCAGCTG	0.587																																					p.D219E													.	DDAH2	15		0			c.C657A												183.0	157.0	166.0					6																	31695404		1511	2709	4220	SO:0001583	missense	23564	exon6			GAGACAGTCAGCA	AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212	ENST00000375789.2:c.657C>A	6.37:g.31695404G>T	ENSP00000364945:p.Asp219Glu		54	0	0		71	0.04	3	NM_013974	162	0.00	0	A2BEZ7	Missense_Mutation	SNP	ENST00000375789.2	37	CCDS4718.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983233	0.74474	.	.	ENSG00000213722	ENST00000437288;ENST00000375789;ENST00000375787;ENST00000375792;ENST00000416410;ENST00000436437	.	.	.	5.0	2.21	0.28008	.	0.051405	0.85682	D	0.000000	T	0.23886	0.0578	L	0.36672	1.1	0.32868	D	0.508817	P	0.36587	0.559	B	0.42959	0.403	T	0.07790	-1.0754	9	0.62326	D	0.03	-30.484	7.0206	0.24912	0.3641:0.0:0.6359:0.0	.	219	O95865	DDAH2_HUMAN	E	108;219;219;219;219;219	.	ENSP00000364943:D219E	D	-	3	2	DDAH2	31803383	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.577000	0.46042	0.695000	0.31675	0.655000	0.94253	GAC			0.587	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076432.2			
MDGA1	266727	mdanderson.org	37	6	37611668	37611668	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:37611668G>T	ENST00000434837.3	-	14	3631	c.2453C>A	c.(2452-2454)gCa>gAa	p.A818E	MDGA1_ENST00000505425.1_Missense_Mutation_p.A818E|MDGA1_ENST00000297153.7_Missense_Mutation_p.A822E|MDGA1_ENST00000510077.1_5'Flank	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	818	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						CACTAACCTTGCACGGTCCCC	0.587																																					p.A818E													.	.			0			c.C2453A												77.0	84.0	81.0					6																	37611668		2066	4204	6270	SO:0001583	missense	266727	exon14			AACCTTGCACGGT	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2453C>A	6.37:g.37611668G>T	ENSP00000402584:p.Ala818Glu		62	0	0		50	0.06	3	NM_153487	13	0.00	0	A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	37	CCDS47417.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.239898|4.239898	0.79912|0.79912	.|.	.|.	ENSG00000112139|ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425|ENST00000418178	T;T;T|.	0.03524|.	3.9;3.9;3.9|.	5.8|5.8	4.93|4.93	0.64822|0.64822	Concanavalin A-like lectin/glucanase (1);MAM domain (3);|.	0.000000|.	0.49916|.	D|.	0.000127|.	D|D	0.85008|0.85008	0.5599|0.5599	H|H	0.97440|0.97440	4.005|4.005	0.49687|0.49687	D|D	0.99981|0.99981	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.76575|.	0.988;0.986|.	D|D	0.89827|0.89827	0.3993|0.3993	10|5	0.87932|.	D|.	0|.	.|.	12.4709|12.4709	0.55785|0.55785	0.0769:0.0:0.9231:0.0|0.0769:0.0:0.9231:0.0	.|.	818;818|.	Q8NFP4-2;Q8NFP4|.	.;MDGA1_HUMAN|.	E|K	818;822;818|128	ENSP00000402584:A818E;ENSP00000297153:A822E;ENSP00000422042:A818E|.	ENSP00000297153:A822E|.	A|Q	-|-	2|1	0|0	MDGA1|MDGA1	37719646|37719646	1.000000|1.000000	0.71417|0.71417	0.053000|0.053000	0.19242|0.19242	0.788000|0.788000	0.44548|0.44548	9.593000|9.593000	0.98250|0.98250	1.451000|1.451000	0.47736|0.47736	0.655000|0.655000	0.94253|0.94253	GCA|CAA			0.587	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040419.3			
PM20D2	135293	mdanderson.org	37	6	89862893	89862893	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:89862893G>T	ENST00000275072.4	+	3	841	c.746G>T	c.(745-747)tGg>tTg	p.W249L		NM_001010853.1	NP_001010853.1	Q8IYS1	P20D2_HUMAN	peptidase M20 domain containing 2	249						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|skin(1)	12		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)		AAACCAACCTGGAGAGTTCAT	0.353																																					p.W249L													.	.			0			c.G746T												92.0	85.0	88.0					6																	89862893		2203	4300	6503	SO:0001583	missense	135293	exon3			CAACCTGGAGAGT	BC035036	CCDS34499.1	6q15	2014-07-14	2007-11-14	2007-11-14	ENSG00000146281	ENSG00000146281			21408	protein-coding gene	gene with protein product	"""&#946;-alanyl-lysine dipeptidase"""	615913	"""aminoacylase 1-like 2"""	ACY1L2		24891507	Standard	NM_001010853		Approved	bA63L7.3	uc003pmz.4	Q8IYS1	OTTHUMG00000015193	ENST00000275072.4:c.746G>T	6.37:g.89862893G>T	ENSP00000275072:p.Trp249Leu		45	0	0		45	0.07	3	NM_001010853	2	0.00	0	B4DYJ2|Q5T7J9|Q6MZV2|Q86XD9	Missense_Mutation	SNP	ENST00000275072.4	37	CCDS34499.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572285	0.86542	.	.	ENSG00000146281	ENST00000275072	T	0.50548	0.74	5.57	5.57	0.84162	Peptidase M20, dimerisation (2);	0.000000	0.85682	D	0.000000	T	0.54631	0.1870	M	0.64080	1.96	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.47548	-0.9109	10	0.10111	T	0.7	-6.1722	19.5579	0.95358	0.0:0.0:1.0:0.0	.	249	Q8IYS1	P20D2_HUMAN	L	249	ENSP00000275072:W249L	ENSP00000275072:W249L	W	+	2	0	PM20D2	89919612	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.916000	0.92745	2.624000	0.88883	0.655000	0.94253	TGG			0.353	PM20D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041477.1		NM_001010853	
SOGA3	387104	mdanderson.org	37	6	127836914	127836914	+	Silent	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:127836914G>A	ENST00000525778.1	-	2	1591	c.846C>T	c.(844-846)aaC>aaT	p.N282N	SOGA3_ENST00000368268.2_Silent_p.N282N|SOGA3_ENST00000465909.2_Silent_p.N282N|SOGA3_ENST00000556132.1_Silent_p.N282N|SOGA3_ENST00000481848.2_Silent_p.N282N			Q5TF21	SOGA3_HUMAN	SOGA family member 3	282					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TGCCGCCGCCGTTCTTAGCGT	0.692																																					p.N282N													.	.			0			c.C846T												10.0	14.0	13.0					6																	127836914		1549	3636	5185	SO:0001819	synonymous_variant	387104	exon2			GCCGCCGTTCTTA	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.846C>T	6.37:g.127836914G>A			21	0	0		16	0.13	2	NM_001012279	0		0		Silent	SNP	ENST00000525778.1	37	CCDS43505.1																																																																																					0.692	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388246.1		NM_001012279	
NHSL1	57224	broad.mit.edu;mdanderson.org	37	6	138751679	138751679	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr6:138751679G>T	ENST00000427025.2	-	5	4443	c.3815C>A	c.(3814-3816)gCa>gAa	p.A1272E	NHSL1_ENST00000343505.5_Missense_Mutation_p.A1268E	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	1272										breast(2)|endometrium(4)|kidney(1)	7						CATGGATCCTGCAGCTCCTCC	0.612																																					p.A1272E													.	NHSL1	99		0			c.C3815A												42.0	45.0	44.0					6																	138751679		692	1591	2283	SO:0001583	missense	57224	exon5			GATCCTGCAGCTC	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.3815C>A	6.37:g.138751679G>T	ENSP00000394546:p.Ala1272Glu		48	0	0		50	0.08	4	NM_020464	13	0.00	0	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	ENST00000427025.2	37	CCDS55063.1	.	.	.	.	.	.	.	.	.	.	G	6.554	0.470442	0.12461	.	.	ENSG00000135540	ENST00000427025;ENST00000343505	T;T	0.36878	1.23;1.71	4.74	3.86	0.44501	.	0.601466	0.16258	N	0.222365	T	0.11750	0.0286	L	0.54323	1.7	0.27149	N	0.961458	B;B	0.28128	0.201;0.201	B;B	0.20955	0.022;0.032	T	0.17961	-1.0352	10	0.08599	T	0.76	-7.5102	9.1312	0.36846	0.1686:0.0:0.8314:0.0	.	1268;1272	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	E	1272;1268	ENSP00000394546:A1272E;ENSP00000344672:A1268E	ENSP00000344672:A1268E	A	-	2	0	NHSL1	138793372	0.928000	0.31464	0.979000	0.43373	0.333000	0.28666	1.523000	0.35932	2.171000	0.68590	0.561000	0.74099	GCA			0.612	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000043700.2		XM_050421	
MEOX2	4223	mdanderson.org	37	7	15725827	15725827	+	Silent	SNP	C	C	A	rs372066707|rs374499365		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr7:15725827C>A	ENST00000262041.5	-	1	610	c.201G>T	c.(199-201)ggG>ggT	p.G67G	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	67					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtggtggtgCCCCCTGTGAT	0.577																																					p.G67G	Esophageal Squamous(140;197 1769 16409 18257 29929)												.	.			0			c.G201T												34.0	33.0	33.0					7																	15725827		2203	4300	6503	SO:0001819	synonymous_variant	4223	exon1			GTGGTGCCCCCTG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.201G>T	7.37:g.15725827C>A			38	0	0		53	0.06	3	NM_005924	1	0.00	0	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	37	CCDS34605.1																																																																																					0.577	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000326058.2		NM_005924	
SEPT7P2	641977	hgsc.bcm.edu	37	7	45798636	45798636	+	RNA	SNP	A	A	G			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr7:45798636A>G	ENST00000429741.1	-	0	396									septin 7 pseudogene 2																		CAGTACCCCAAATACACTGGA	0.383																																					.													.	.			0			.																																											641977	.			ACCCCAAATACAC	AL133216		7p12.3	2010-03-24	2010-03-24	2010-03-24	ENSG00000214765	ENSG00000214765			32339	pseudogene	pseudogene		611563	"""septin 7B"", ""septin 13"""	SEPT7B, SEPT13		15915442	Standard	NR_024271		Approved	DKFZp313J1114	uc003tnf.4		OTTHUMG00000155423		7.37:g.45798636A>G			40	0	0		45	0.11	5	.	0		0		RNA	SNP	ENST00000429741.1	37																																																																																						0.383	SEPT7P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000340060.1		NR_024271	
DGKI	9162	broad.mit.edu;mdanderson.org	37	7	137266651	137266651	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr7:137266651G>T	ENST00000288490.5	-	15	1587	c.1587C>A	c.(1585-1587)aaC>aaA	p.N529K	DGKI_ENST00000446122.1_Missense_Mutation_p.N529K|DGKI_ENST00000424189.2_Missense_Mutation_p.N529K|DGKI_ENST00000453654.2_Missense_Mutation_p.N229K	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	529					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GGCTGAAGTAGTTATTGAAAA	0.443																																					p.N529K													DGKI_ENST00000288490,NS,carcinoma,0,2	DGKI	335	2	0			c.C1587A												113.0	112.0	112.0					7																	137266651		2203	4299	6502	SO:0001583	missense	9162	exon15			GAAGTAGTTATTG	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1587C>A	7.37:g.137266651G>T	ENSP00000288490:p.Asn529Lys		44	0	0		50	0.06	3	NM_004717	1	0.00	0	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.662094	0.67700	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.66099	-0.19;-0.19;-0.19	5.6	-0.604	0.11626	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.79736	0.4497	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80670	-0.1279	10	0.87932	D	0	.	10.7483	0.46194	0.4866:0.0:0.5134:0.0	.	229;529	E9PFX6;O75912	.;DGKI_HUMAN	K	229;477;529;529;529	ENSP00000392161:N229K;ENSP00000288490:N529K;ENSP00000399131:N529K	ENSP00000288490:N529K	N	-	3	2	DGKI	136917191	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	1.938000	0.40203	-0.052000	0.13311	-0.312000	0.09012	AAC			0.443	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341286.3		NM_004717	
TRIM24	8805	mdanderson.org	37	7	138266446	138266446	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr7:138266446G>T	ENST00000343526.4	+	17	2938	c.2723G>T	c.(2722-2724)tGt>tTt	p.C908F	TRIM24_ENST00000415680.2_Missense_Mutation_p.C874F			O15164	TIF1A_HUMAN	tripartite motif containing 24	908					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						GCTTAGAAGTGTGAGCGCCTA	0.323																																					p.C908F	Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)												.	.			0			c.G2723T												86.0	87.0	86.0					7																	138266446		2203	4300	6503	SO:0001583	missense	8805	exon17			AGAAGTGTGAGCG	AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.2723G>T	7.37:g.138266446G>T	ENSP00000340507:p.Cys908Phe		40	0	0		44	0.07	3	NM_015905	118	0.00	0	A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	ENST00000343526.4	37	CCDS5847.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629662	0.87660	.	.	ENSG00000122779	ENST00000343526;ENST00000536822;ENST00000415680	T;T	0.35973	1.28;1.28	5.78	5.78	0.91487	Bromodomain (4);	0.000000	0.85682	D	0.000000	T	0.72070	0.3415	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78555	-0.2159	10	0.87932	D	0	-12.4153	19.9704	0.97284	0.0:0.0:1.0:0.0	.	908;874	O15164;O15164-2	TIF1A_HUMAN;.	F	908;819;874	ENSP00000340507:C908F;ENSP00000390829:C874F	ENSP00000340507:C908F	C	+	2	0	TRIM24	137916986	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.082000	0.94059	2.894000	0.99253	0.591000	0.81541	TGT			0.323	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341814.1		NM_015905	
PARP12	64761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	139756947	139756947	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr7:139756947G>A	ENST00000263549.3	-	3	1342	c.469C>T	c.(469-471)Caa>Taa	p.Q157*		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	157						nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					TTGTAATGTTGGCAAATCTGT	0.498																																					p.Q157X													.	.			0			c.C469T												82.0	90.0	87.0					7																	139756947		2203	4300	6503	SO:0001587	stop_gained	64761	exon3			AATGTTGGCAAAT	AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.469C>T	7.37:g.139756947G>A	ENSP00000263549:p.Gln157*		44	0	0		40	0.28	11	NM_022750	29	0.10	3	Q9H610|Q9NP36|Q9NTI3	Nonsense_Mutation	SNP	ENST00000263549.3	37	CCDS5857.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255208	0.95336	.	.	ENSG00000059378	ENST00000263549	.	.	.	5.61	3.66	0.41972	.	0.658913	0.15735	N	0.247229	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	3.2471	0.06801	0.1471:0.2549:0.4681:0.1298	.	.	.	.	X	157	.	ENSP00000263549:Q157X	Q	-	1	0	PARP12	139403416	0.082000	0.21442	0.998000	0.56505	0.952000	0.60782	0.221000	0.17680	1.348000	0.45733	0.544000	0.68410	CAA			0.498	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348413.1		NM_022750	
LAPTM4B	55353	mdanderson.org	37	8	98817595	98817595	+	Silent	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr8:98817595G>T	ENST00000521545.2	+	2	348	c.114G>T	c.(112-114)gtG>gtT	p.V38V	LAPTM4B_ENST00000445593.2_Silent_p.V129V			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	182					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			TCAATGCTGTGGTACTGTTGA	0.373																																					p.V129V													.	.			0			c.G387T												140.0	131.0	134.0					8																	98817595		2203	4300	6503	SO:0001819	synonymous_variant	55353	exon2			TGCTGTGGTACTG	AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.114G>T	8.37:g.98817595G>T			27	0	0		53	0.06	3	NM_018407	578	0.00	0	Q3ZCV5|Q7L909|Q86VH8|Q9H060	Silent	SNP	ENST00000521545.2	37		.	.	.	.	.	.	.	.	.	.	G	9.756	1.168726	0.21621	.	.	ENSG00000104341	ENST00000517924	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	T	0.71634	0.3363	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70498	-0.4855	4	.	.	.	-27.2339	15.7363	0.77846	0.0:0.0:1.0:0.0	.	.	.	.	L	92	.	.	W	+	2	0	LAPTM4B	98886771	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.235000	0.65348	2.517000	0.84864	0.655000	0.94253	TGG			0.373	LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000380016.2			
TRPS1	7227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	116599271	116599271	+	Nonsense_Mutation	SNP	G	G	T	rs142472404		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr8:116599271G>T	ENST00000220888.5	-	4	2777	c.2618C>A	c.(2617-2619)tCg>tAg	p.S873*	TRPS1_ENST00000520276.1_Nonsense_Mutation_p.S877*|TRPS1_ENST00000395715.3_Nonsense_Mutation_p.S886*|TRPS1_ENST00000519076.1_Nonsense_Mutation_p.S627*|TRPS1_ENST00000519674.1_Nonsense_Mutation_p.S873*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	873					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GTTTTCTCCCGATGCAGGATA	0.507									Langer-Giedion syndrome																												p.S886X													.	.			0			c.C2657A												54.0	55.0	54.0					8																	116599271		1826	4075	5901	SO:0001587	stop_gained	7227	exon5	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	TCTCCCGATGCAG	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2618C>A	8.37:g.116599271G>T	ENSP00000220888:p.Ser873*		59	0	0		67	0.13	9	NM_014112	1	0.00	0	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	G	39	7.456281	0.98296	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	.	.	.	5.76	5.76	0.90799	.	0.321665	0.29806	N	0.011152	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9813	0.97326	0.0:0.0:1.0:0.0	.	.	.	.	X	886;873;627;877;873	.	ENSP00000220888:S873X	S	-	2	0	TRPS1	116668446	0.996000	0.38824	0.043000	0.18650	0.489000	0.33432	7.780000	0.85658	2.726000	0.93360	0.655000	0.94253	TCG			0.507	TRPS1-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000286436.3		NM_014112	
ANKRD18A	253650	mdanderson.org	37	9	38575566	38575566	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:38575566T>C	ENST00000399703.5	-	15	3245	c.2871A>G	c.(2869-2871)atA>atG	p.I957M	ANKRD18A_ENST00000607974.1_Missense_Mutation_p.I78M|ANKRD18A_ENST00000313339.3_Missense_Mutation_p.I78M|ANKRD18A_ENST00000566717.2_Missense_Mutation_p.I95M|ANKRD18A_ENST00000357072.5_5'UTR	NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	957										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						TGTTGAGTTCTATACTATTAA	0.383																																					p.I957M													.	.			0			c.A2871G												58.0	56.0	56.0					9																	38575566		692	1591	2283	SO:0001583	missense	253650	exon15			GAGTTCTATACTA	AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.2871A>G	9.37:g.38575566T>C	ENSP00000382610:p.Ile957Met		54	0	0		31	0.10	3	NM_147195	0		0	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Missense_Mutation	SNP	ENST00000399703.5	37	CCDS55311.1	.	.	.	.	.	.	.	.	.	.	T	2.926	-0.222216	0.06061	.	.	ENSG00000180071	ENST00000313339;ENST00000357072;ENST00000399703	T;T	0.30981	1.51;1.51	1.4	0.224	0.15297	.	.	.	.	.	T	0.21062	0.0507	L	0.41027	1.25	0.09310	N	1	P;B	0.43477	0.808;0.261	B;B	0.39805	0.31;0.113	T	0.15037	-1.0451	9	0.66056	D	0.02	.	3.1224	0.06396	0.0:0.2635:0.0:0.7365	.	78;957	Q6QA70;Q8IVF6	.;AN18A_HUMAN	M	78;78;957	ENSP00000326555:I78M;ENSP00000382610:I957M	ENSP00000326555:I78M	I	-	3	3	ANKRD18A	38565566	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.356000	0.07661	0.050000	0.15949	0.163000	0.16589	ATA			0.383	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052506.3			
APBA1	320	hgsc.bcm.edu	37	9	72064657	72064657	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:72064657C>T	ENST00000265381.4	-	10	2246	c.2024G>A	c.(2023-2025)gGc>gAc	p.G675D		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	675	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GGATCCCCAGCCAGACTCCAC	0.488																																					p.G675D													.	.			0			c.G2024A												92.0	82.0	85.0					9																	72064657		2203	4300	6503	SO:0001583	missense	320	exon10			CCCCAGCCAGACT	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.2024G>A	9.37:g.72064657C>T	ENSP00000265381:p.Gly675Asp		75	0	0		88	0.05	4	NM_001163	2	0.00	0	O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	37	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	C	33	5.198472	0.94997	.	.	ENSG00000107282	ENST00000265381	T	0.39592	1.07	5.78	5.78	0.91487	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.90252	3.1	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78117	-0.2329	10	0.87932	D	0	-24.7241	20.0124	0.97464	0.0:1.0:0.0:0.0	.	675	Q02410	APBA1_HUMAN	D	675	ENSP00000265381:G675D	ENSP00000265381:G675D	G	-	2	0	APBA1	71254477	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.818000	0.86416	2.749000	0.94314	0.655000	0.94253	GGC			0.488	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052589.2		NM_001163	
SEMA4D	10507	hgsc.bcm.edu;mdanderson.org	37	9	91994111	91994111	+	Silent	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:91994111G>T	ENST00000450295.1	-	16	2873	c.2097C>A	c.(2095-2097)ccC>ccA	p.P699P	SEMA4D_ENST00000422704.2_Silent_p.P699P|SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000438547.2_Silent_p.P699P|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000356444.2_Silent_p.P699P|SEMA4D_ENST00000420987.1_Intron			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	699					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GCGCAGGCTTGGGAGGAAGGG	0.602																																					p.P699P													.	.			0			c.C2097A												68.0	70.0	69.0					9																	91994111		2203	4300	6503	SO:0001819	synonymous_variant	10507	exon18			AGGCTTGGGAGGA	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.2097C>A	9.37:g.91994111G>T			67	0	0		60	0.07	4	NM_006378	77	0.00	0	B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	ENST00000450295.1	37	CCDS6685.1																																																																																					0.602	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000342411.1		NM_006378	
KIAA1958	158405	mdanderson.org	37	9	115421828	115421828	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:115421828G>T	ENST00000337530.6	+	4	1926	c.1630G>T	c.(1630-1632)Gca>Tca	p.A544S	KIAA1958_ENST00000536272.1_Missense_Mutation_p.A572S	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	544								p.A544T(1)		endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						GATGTGGCAGGCAGGGTGTCT	0.582																																					p.A544S													KIAA1958,NS,carcinoma,0,1	KIAA1958	0	1	1	Substitution - Missense(1)	lung(1)	c.G1630T												54.0	51.0	52.0					9																	115421828		2203	4300	6503	SO:0001583	missense	158405	exon4			TGGCAGGCAGGGT	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1630G>T	9.37:g.115421828G>T	ENSP00000336940:p.Ala544Ser		129	0	0		120	0.04	5	NM_133465	7	0.00	0	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	37	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	G	5.838	0.338855	0.11069	.	.	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.66	2.48	0.30137	.	.	.	.	.	T	0.12561	0.0305	N	0.03608	-0.345	0.19775	N	0.999956	B;B	0.12013	0.005;0.003	B;B	0.15870	0.014;0.004	T	0.33954	-0.9848	8	0.05436	T	0.98	.	5.4989	0.16817	0.4965:0.0:0.5035:0.0	.	572;544	B7ZKW6;Q8N8K9	.;K1958_HUMAN	S	544;572	.	ENSP00000336940:A544S	A	+	1	0	KIAA1958	114461649	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	2.797000	0.47877	0.769000	0.33313	0.655000	0.94253	GCA			0.582	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000053690.1		NM_133465	
OR1L8	138881	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	125330483	125330485	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	TCT	TCT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:125330483_125330485delTCT	ENST00000304865.2	-	1	353_355	c.272_274delAGA	c.(271-276)aagacc>acc	p.K91del		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TAGGAGATGGTCTTCTTTTCTGA	0.453																																					p.91_92del													.	OR1L8	90		0			c.273_275del																																									SO:0001651	inframe_deletion	138881	exon1			AGATGGTCTTCTT		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.272_274delAGA	9.37:g.125330486_125330488delTCT	ENSP00000306607:p.Lys91del		68	0	0		54	0.19	10	NM_001004454	0		0	A3KFM3|B9EIR6|Q6IF15|Q96R79	In_Frame_Del	DEL	ENST00000304865.2	37	CCDS35124.1																																																																																					0.453	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053939.1			
GFI1B	8328	mdanderson.org	37	9	135866307	135866307	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:135866307G>T	ENST00000339463.3	+	11	1682	c.863G>T	c.(862-864)aGc>aTc	p.S288I	GFI1B_ENST00000372122.1_Missense_Mutation_p.S288I|GFI1B_ENST00000372123.1_Missense_Mutation_p.S242I|GFI1B_ENST00000372124.1_Missense_Mutation_p.S242I|GFI1B_ENST00000534944.1_Missense_Mutation_p.S242I|GFI1B_ENST00000450530.1_Missense_Mutation_p.S288I			Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription repressor	288	Interaction with ARIH2.|Mediates interaction with GATA1.				cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K9 methylation (GO:0051574)|regulation of erythrocyte differentiation (GO:0045646)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II transcription factor binding (GO:0001085)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		TTCAGCCAGAGCTCCAACCTC	0.647																																					p.S288I													.	.			0			c.G863T												100.0	82.0	88.0					9																	135866307		2203	4300	6503	SO:0001583	missense	8328	exon7			GCCAGAGCTCCAA	AF081946	CCDS6957.1, CCDS48049.1	9q34.13	2014-09-17	2007-10-04		ENSG00000165702	ENSG00000165702		"""Zinc fingers, C2H2-type"""	4238	protein-coding gene	gene with protein product		604383	"""growth factor independent 1B (potential regulator of CDKN1A, translocated in CML)"""			9878267	Standard	NM_001135031		Approved		uc004ccg.3	Q5VTD9	OTTHUMG00000020848	ENST00000339463.3:c.863G>T	9.37:g.135866307G>T	ENSP00000344782:p.Ser288Ile		58	0	0		45	0.07	3	NM_004188	0		0	O95270|Q5VTD8|Q6FHZ2|Q6T888	Missense_Mutation	SNP	ENST00000339463.3	37	CCDS6957.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149506	0.78001	.	.	ENSG00000165702	ENST00000372124;ENST00000339463;ENST00000450530;ENST00000534944;ENST00000372123;ENST00000372122	T;T;T;T;T;T	0.31247	1.5;2.38;2.38;1.5;1.5;2.38	4.9	4.9	0.64082	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.51176	0.1659	L	0.52759	1.655	0.80722	D	1	D;D	0.65815	0.995;0.97	D;D	0.76071	0.987;0.95	T	0.53422	-0.8441	10	0.87932	D	0	-15.6879	17.4238	0.87521	0.0:0.0:1.0:0.0	.	242;288	Q5VTD9-2;Q5VTD9	.;GFI1B_HUMAN	I	242;288;288;242;242;288	ENSP00000361197:S242I;ENSP00000344782:S288I;ENSP00000409546:S288I;ENSP00000446134:S242I;ENSP00000361196:S242I;ENSP00000361195:S288I	ENSP00000344782:S288I	S	+	2	0	GFI1B	134856128	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.823000	0.86660	2.425000	0.82216	0.462000	0.41574	AGC			0.647	GFI1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393840.1		NM_004188	
RALGDS	5900	mdanderson.org	37	9	135984157	135984157	+	Nonsense_Mutation	SNP	G	G	T	rs531452456		TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chr9:135984157G>T	ENST00000372050.3	-	5	702	c.681C>A	c.(679-681)taC>taA	p.Y227*	RALGDS_ENST00000372047.3_Nonsense_Mutation_p.Y215*|RALGDS_ENST00000393157.3_Nonsense_Mutation_p.Y226*|RALGDS_ENST00000469972.1_5'UTR|RALGDS_ENST00000372062.3_Nonsense_Mutation_p.Y198*|RALGDS_ENST00000393160.3_Nonsense_Mutation_p.Y172*|RALGDS_ENST00000542690.1_Nonsense_Mutation_p.Y298*	NM_006266.2	NP_006257.1	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	227	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)		TGAGCTGCACGTAGGCCACCA	0.627			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																p.Y227X	Melanoma(189;762 2088 15384 21931 52515)			Dom	yes		9	9q34.3	5900	ral guanine nucleotide dissociation stimulator		L	.	.			0			c.C681A												88.0	75.0	79.0					9																	135984157		2203	4300	6503	SO:0001587	stop_gained	5900	exon5			CTGCACGTAGGCC	AB037729	CCDS6959.1, CCDS43897.1, CCDS65172.1, CCDS65173.1, CCDS65174.1	9q34.3	2009-04-08			ENSG00000160271	ENSG00000160271			9842	protein-coding gene	gene with protein product		601619				7972015	Standard	NM_006266		Approved	RGF, RalGEF, RGDS	uc004ccr.3	Q12967	OTTHUMG00000020858	ENST00000372050.3:c.681C>A	9.37:g.135984157G>T	ENSP00000361120:p.Tyr227*		47	0	0		38	0.08	3	NM_006266	29	0.00	0	B7Z753|E7ER93|E7ERZ0|Q5T7V4|Q6KH11|Q6PCE1|Q6ZSD5|Q9HAX7|Q9HAY1|Q9HCT1|Q9P2N8	Nonsense_Mutation	SNP	ENST00000372050.3	37	CCDS6959.1	.	.	.	.	.	.	.	.	.	.	G	34	5.353227	0.95830	.	.	ENSG00000160271	ENST00000372050;ENST00000372047;ENST00000393160;ENST00000393157;ENST00000542690;ENST00000372062	.	.	.	5.67	-8.31	0.01001	.	0.205241	0.34802	N	0.003677	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6503	0.88162	0.6998:0.0:0.3002:0.0	.	.	.	.	X	227;215;172;226;298;198	.	ENSP00000361117:Y215X	Y	-	3	2	RALGDS	134973978	0.826000	0.29277	0.057000	0.19452	0.786000	0.44442	-0.131000	0.10482	-2.224000	0.00725	-1.814000	0.00607	TAC			0.627	RALGDS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054837.1		NM_006266	
CT47B1	643311	mdanderson.org	37	X	120009259	120009259	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG0-01A-11D-A42Y-10	TCGA-2G-AAG0-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	37419ab1-477a-401f-9102-079a57e05b6b	394fde22-74c9-4c8f-9c07-2b22933c92a7	g.chrX:120009259G>T	ENST00000371311.3	-	1	520	c.266C>A	c.(265-267)cCc>cAc	p.P89H		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	89										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						ctccGTCGCGGGCCCGATATC	0.721																																					p.P89H													.	.			0			c.C266A												30.0	35.0	34.0					X																	120009259		692	1590	2282	SO:0001583	missense	643311	exon1			GTCGCGGGCCCGA		CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.266C>A	X.37:g.120009259G>T	ENSP00000360360:p.Pro89His		28	0	0		37	0.08	3	NM_001145718	0		0	A6NM97	Missense_Mutation	SNP	ENST00000371311.3	37	CCDS48161.1	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829188	0.32329	.	.	ENSG00000236446	ENST00000371311	.	.	.	2.43	0.579	0.17397	.	.	.	.	.	T	0.35885	0.0947	N	0.24115	0.695	0.09310	N	1	D	0.65815	0.995	P	0.61940	0.896	T	0.15093	-1.0449	8	0.59425	D	0.04	.	4.3075	0.10955	0.3723:0.0:0.6277:0.0	.	89	P0C2W7	CT47B_HUMAN	H	89	.	ENSP00000360360:P89H	P	-	2	0	CT47B1	119893287	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.307000	0.19296	0.054000	0.16065	0.171000	0.16805	CCC			0.721	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058121.1		NM_001145718	
