#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PLEKHN1	84069	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	906518	906518	+	Missense_Mutation	SNP	C	C	T	rs199724483		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:906518C>T	ENST00000379409.2	+	6	824	c.794C>T	c.(793-795)gCg>gTg	p.A265V	PLEKHN1_ENST00000379407.3_Missense_Mutation_p.A225V|PLEKHN1_ENST00000379410.3_Missense_Mutation_p.A213V			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	265										central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CTGCGGACGGCGTCAGGGCAC	0.692													C|||	1	0.000199681	0.0008	0.0	5008	,	,		11748	0.0		0.0	False		,,,				2504	0.0				p.A225V													PLEKHN1,NS,carcinoma,0,1	PLEKHN1	0	1	0			c.C674T																																									SO:0001583	missense	84069	exon7			GGACGGCGTCAGG	AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.794C>T	1.37:g.906518C>T	ENSP00000368719:p.Ala265Val		76	0	0		77	0.06	5	NM_001160184	1	0.00	0	Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	ENST00000379409.2	37		4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	C	7.867	0.727229	0.15439	.	.	ENSG00000187583	ENST00000379410;ENST00000379407;ENST00000379409	T;T;T	0.52526	0.66;0.76;0.7	4.55	-1.28	0.09318	.	0.483412	0.19714	N	0.107751	T	0.21718	0.0523	L	0.44542	1.39	0.09310	N	1	B;B;B	0.23891	0.009;0.093;0.093	B;B;B	0.14578	0.008;0.011;0.011	T	0.11324	-1.0592	10	0.49607	T	0.09	.	0.9855	0.01445	0.1399:0.3513:0.2061:0.3027	.	225;265;213	Q494U1-3;Q494U1;Q494U1-2	.;PKHN1_HUMAN;.	V	213;225;265	ENSP00000368720:A213V;ENSP00000368717:A225V;ENSP00000368719:A265V	ENSP00000368717:A225V	A	+	2	0	PLEKHN1	896381	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.721000	0.04963	-0.068000	0.12953	0.387000	0.25754	GCG	0.002		0.692	PLEKHN1-005	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000473256.1		NM_032129	
TP73	7161	ucsc.edu	37	1	3644260	3644260	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:3644260C>T	ENST00000378295.4	+	8	1066	c.911C>T	c.(910-912)gCt>gTt	p.A304V	TP73_ENST00000378290.4_Missense_Mutation_p.A233V|TP73_ENST00000604479.1_Missense_Mutation_p.A304V|TP73_ENST00000378288.4_Missense_Mutation_p.A255V|TP73_ENST00000604074.1_Missense_Mutation_p.A304V|TP73_ENST00000378285.1_Missense_Mutation_p.A255V|TP73_ENST00000603362.1_Missense_Mutation_p.A304V|TP73_ENST00000378280.1_Missense_Mutation_p.A255V|TP73_ENST00000346387.4_Missense_Mutation_p.A304V|TP73_ENST00000354437.4_Missense_Mutation_p.A304V|TP73_ENST00000357733.3_Missense_Mutation_p.A304V	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	304	DNA-binding. {ECO:0000255}.				activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		GACCGAAAAGCTGATGAGGAC	0.677																																					p.A304V													.	TP73	54		0			c.C911T												18.0	20.0	19.0					1																	3644260		2174	4280	6454	SO:0001583	missense	7161	exon8			GAAAAGCTGATGA	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.911C>T	1.37:g.3644260C>T	ENSP00000367545:p.Ala304Val		35	0	0		34	0.12	4	NM_005427	7	0.00	0	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Missense_Mutation	SNP	ENST00000378295.4	37	CCDS49.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485101	0.63962	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387;ENST00000378288;ENST00000378285;ENST00000378280;ENST00000378290	D;D;D;D;D;D;D;D	0.99795	-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78;-6.78	4.57	4.57	0.56435	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99603	0.9856	M	0.67397	2.05	0.80722	D	1	D;D;D;D;D;D	0.71674	0.99;0.998;0.979;0.988;0.994;0.99	P;P;P;B;P;P	0.62435	0.665;0.902;0.506;0.432;0.77;0.726	D	0.97679	1.0171	10	0.62326	D	0.03	-12.9723	16.3785	0.83418	0.0:1.0:0.0:0.0	.	255;255;255;255;304;304	B7Z8Z1;O15350-10;O15350-9;O15350-8;O15350-2;O15350	.;.;.;.;.;P73_HUMAN	V	304;304;304;304;255;255;255;233	ENSP00000367545:A304V;ENSP00000346423:A304V;ENSP00000350366:A304V;ENSP00000340740:A304V;ENSP00000367537:A255V;ENSP00000367534:A255V;ENSP00000367529:A255V;ENSP00000367539:A233V	ENSP00000340740:A304V	A	+	2	0	TP73	3634120	1.000000	0.71417	0.116000	0.21606	0.030000	0.12068	7.553000	0.82203	2.096000	0.63516	0.466000	0.42574	GCT			0.677	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001468.4		NM_005427	
SERINC2	347735	mdanderson.org	37	1	31898760	31898760	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:31898760G>T	ENST00000373709.3	+	5	760	c.610G>T	c.(610-612)Ggc>Tgc	p.G204C	SERINC2_ENST00000536384.1_Splice_Site_p.G208C|SERINC2_ENST00000373710.1_Splice_Site_p.G213C|SERINC2_ENST00000536859.1_Splice_Site_p.G208C|SERINC2_ENST00000491976.1_3'UTR	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	204					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CTGGTACGCAGGTCAGTGCTG	0.632																																					p.G213C													.	.			0			c.G637T												56.0	40.0	45.0					1																	31898760		2203	4300	6503	SO:0001630	splice_region_variant	347735	exon6			TACGCAGGTCAGT	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.610+1G>T	1.37:g.31898760G>T			38	0	0		41	0.07	3	NM_001199038	41	0.00	0	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	ENST00000373709.3	37	CCDS30662.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.664271	0.67700	.	.	ENSG00000168528	ENST00000373710;ENST00000536859;ENST00000373709;ENST00000536384	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	4.11	4.11	0.48088	.	0.178652	0.47852	D	0.000213	T	0.34658	0.0905	M	0.63843	1.955	0.80722	D	1	D;D;D	0.71674	0.996;0.996;0.998	D;D;D	0.72075	0.95;0.95;0.976	T	0.16958	-1.0385	10	0.87932	D	0	-30.2265	16.4667	0.84081	0.0:0.0:1.0:0.0	.	208;213;204	B4DJK5;E7EUZ9;Q96SA4	.;.;SERC2_HUMAN	C	213;208;204;208	ENSP00000362814:G213C;ENSP00000444307:G208C;ENSP00000362813:G204C;ENSP00000439048:G208C	ENSP00000362813:G204C	G	+	1	0	SERINC2	31671347	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	9.523000	0.98034	2.290000	0.77057	0.491000	0.48974	GGC			0.632	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000010680.1		NM_018565	Missense_Mutation
GJA9	81025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	39340765	39340766	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	GT	GT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:39340765_39340766delGT	ENST00000360786.3	-	1	1257_1258	c.1005_1006delAC	c.(1003-1008)acacttfs	p.L336fs	RP5-864K19.4_ENST00000443161.1_RNA|GJA9_ENST00000454994.2_Frame_Shift_Del_p.L336fs|MYCBP_ENST00000397572.2_5'Flank|GJA9_ENST00000357771.3_Frame_Shift_Del_p.L336fs|RP5-864K19.4_ENST00000433671.2_RNA|RP5-864K19.4_ENST00000456813.1_RNA|MYCBP_ENST00000489803.1_5'UTR			P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	336					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			CTAGTACTAAGTGTGGAAATCT	0.327																																					p.336_336del													.	GJA9	55		0			c.1006_1007del																																									SO:0001589	frameshift_variant	81025	exon2			TACTAAGTGTGGA	AF179597	CCDS432.1	1p34	2008-02-05	2007-11-06	2007-11-06	ENSG00000131233	ENSG00000131233		"""Ion channels / Gap junction proteins (connexins)"""	19155	protein-coding gene	gene with protein product	"""connexin 59"""	611923	"""gap junction protein, alpha 10, 59kDa"""	GJA10			Standard	NM_030772		Approved	CX59, CX58	uc021olr.1	P57773	OTTHUMG00000000482	ENST00000360786.3:c.1005_1006delAC	1.37:g.39340767_39340768delGT	ENSP00000354020:p.Leu336fs		114	0	0		142	0.23	33	NM_030772	0		0	B2R722|B3KVQ2|Q5TA63|Q96KG0	Frame_Shift_Del	DEL	ENST00000360786.3	37	CCDS432.1																																																																																					0.327	GJA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001205.1		NM_030772	
PTBP2	58155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	97235325	97235325	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:97235325T>A	ENST00000426398.2	+	4	225	c.182T>A	c.(181-183)cTt>cAt	p.L61H	PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000609116.1_Missense_Mutation_p.L61H|PTBP2_ENST00000370197.1_Missense_Mutation_p.L61H|PTBP2_ENST00000541987.1_Missense_Mutation_p.L30H|PTBP2_ENST00000394184.3_Missense_Mutation_p.L72H|PTBP2_ENST00000370198.1_Missense_Mutation_p.L61H	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	61	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TCTCGTGTACTTCATATTCGA	0.343																																					p.L61H													.	.			0			c.T182A												118.0	128.0	124.0					1																	97235325		2203	4300	6503	SO:0001583	missense	58155	exon4			GTGTACTTCATAT	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.182T>A	1.37:g.97235325T>A	ENSP00000412788:p.Leu61His		192	0	0		209	0.26	55	NM_021190	33	0.45	15	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	CCDS754.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.867112	0.91511	.	.	ENSG00000117569	ENST00000236228;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184;ENST00000541987;ENST00000394176	T;T;T;T;T;T	0.81330	0.6;0.61;0.61;0.6;0.61;-1.48	5.94	5.94	0.96194	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.130636	0.53938	D	0.000057	D	0.89757	0.6807	M	0.88450	2.955	0.58432	D	0.999998	D;D;D;D;D;D;D	0.76494	0.996;0.975;0.985;0.996;0.998;0.998;0.999	D;P;P;D;D;D;D	0.70016	0.91;0.62;0.601;0.928;0.967;0.967;0.957	D	0.91717	0.5386	10	0.87932	D	0	-4.2011	16.4075	0.83691	0.0:0.0:0.0:1.0	.	69;72;61;61;61;61;83	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3;Q59G43	.;.;.;PTBP2_HUMAN;.;.;.	H	61;61;61;61;72;30;51	ENSP00000236228:L61H;ENSP00000359217:L61H;ENSP00000359216:L61H;ENSP00000412788:L61H;ENSP00000377738:L72H;ENSP00000442475:L30H	ENSP00000236228:L61H	L	+	2	0	PTBP2	97007913	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.948000	0.87774	2.275000	0.75901	0.528000	0.53228	CTT			0.343	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000029453.1			
POGZ	23126	broad.mit.edu	37	1	151378739	151378739	+	Silent	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:151378739C>T	ENST00000271715.2	-	19	3086	c.2772G>A	c.(2770-2772)ccG>ccA	p.P924P	POGZ_ENST00000531094.1_Silent_p.P862P|POGZ_ENST00000392723.1_Silent_p.P871P|POGZ_ENST00000368863.2_Silent_p.P829P|POGZ_ENST00000361398.3_Silent_p.P871P|POGZ_ENST00000409503.1_Silent_p.P915P|POGZ_ENST00000491586.1_Silent_p.P880P|POGZ_ENST00000540984.1_Silent_p.P286P	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	924	Pro-rich.				kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTAAAGCCTGCGGGTGAGTGG	0.592																																					p.P924P													POGZ_ENST00000491586,NS,carcinoma,0,2	POGZ	211	2	0			c.G2772A												77.0	76.0	76.0					1																	151378739		2203	4300	6503	SO:0001819	synonymous_variant	23126	exon19			AGCCTGCGGGTGA	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.2772G>A	1.37:g.151378739C>T			186	0	0		189	0.02	4	NM_015100	129	0.01	1	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Silent	SNP	ENST00000271715.2	37	CCDS997.1																																																																																					0.592	POGZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000034915.2		NM_207171	
FCRLB	127943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161693309	161693309	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr1:161693309C>T	ENST00000367948.2	+	5	420	c.205C>T	c.(205-207)Ccc>Tcc	p.P69S	FCRLB_ENST00000367946.3_Missense_Mutation_p.P69S|FCRLB_ENST00000392158.1_Missense_Mutation_p.P69S|FCRLB_ENST00000336830.5_Missense_Mutation_p.P69S|FCRLB_ENST00000367944.3_Missense_Mutation_p.P62S|FCRLB_ENST00000367945.1_Missense_Mutation_p.P62S			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	69	Ig-like C2-type 1.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CCTACTTCTGCCCTCTCACAA	0.562																																					p.P69S													FCRLB,NS,carcinoma,-2,1	FCRLB	-2	1	0			c.C205T												113.0	105.0	108.0					1																	161693309		2203	4300	6503	SO:0001583	missense	127943	exon3			CTTCTGCCCTCTC	AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.205C>T	1.37:g.161693309C>T	ENSP00000356925:p.Pro69Ser		201	0.0049751244	1		177	0.19	33	NM_001002901	0		0	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Missense_Mutation	SNP	ENST00000367948.2	37	CCDS30927.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995916	0.74703	.	.	ENSG00000162746	ENST00000367948;ENST00000367946;ENST00000367945;ENST00000336830;ENST00000367944;ENST00000392158	T;T;T;T;T;T	0.11169	2.8;2.8;2.8;2.8;2.8;2.8	5.61	4.64	0.57946	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.126603	0.36409	N	0.002619	T	0.09555	0.0235	N	0.21583	0.68	0.35270	D	0.780351	P;D;D;D;D	0.76494	0.949;0.999;0.986;0.999;0.997	B;P;P;P;D	0.63033	0.31;0.896;0.793;0.896;0.91	T	0.06770	-1.0808	10	0.44086	T	0.13	.	11.6703	0.51396	0.0:0.8217:0.1782:0.0	.	62;62;69;69;69	Q6BAA4-3;Q6BAA4-5;Q6BAA4-2;Q6BAA4-4;Q6BAA4	.;.;.;.;FCRLB_HUMAN	S	69;69;62;69;62;69	ENSP00000356925:P69S;ENSP00000356923:P69S;ENSP00000356922:P62S;ENSP00000338598:P69S;ENSP00000356921:P62S;ENSP00000375999:P69S	ENSP00000338598:P69S	P	+	1	0	FCRLB	159959933	0.987000	0.35691	0.998000	0.56505	0.922000	0.55478	1.899000	0.39818	2.629000	0.89072	0.655000	0.94253	CCC			0.562	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083585.1		NM_152378	
FAM208B	54906	mdanderson.org	37	10	5789791	5789791	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr10:5789791G>T	ENST00000328090.5	+	15	5032	c.4407G>T	c.(4405-4407)caG>caT	p.Q1469H		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1469																	ACTTTACCCAGGTACAACAAA	0.423																																					p.Q1469H													.	.			0			c.G4407T												59.0	57.0	58.0					10																	5789791		1879	4112	5991	SO:0001583	missense	54906	exon15			TACCCAGGTACAA	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.4407G>T	10.37:g.5789791G>T	ENSP00000328426:p.Gln1469His		167	0	0		141	0.04	5	NM_017782	49	0.00	0	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896618	0.33535	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.05025	3.51	5.57	-0.128	0.13506	.	0.451574	0.20813	N	0.085208	T	0.05823	0.0152	L	0.53249	1.67	0.09310	N	1	B	0.19073	0.033	B	0.17979	0.02	T	0.31308	-0.9948	10	0.66056	D	0.02	.	2.7296	0.05223	0.3334:0.0:0.3272:0.3393	.	1469	Q5VWN6	F208B_HUMAN	H	1469;664	ENSP00000328426:Q1469H	ENSP00000328426:Q1469H	Q	+	3	2	C10orf18	5829797	0.000000	0.05858	0.001000	0.08648	0.266000	0.26442	0.095000	0.15127	-0.067000	0.12976	0.655000	0.94253	CAG			0.423	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046571.2		NM_017782	
DNA2	1763	broad.mit.edu	37	10	70182359	70182359	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr10:70182359G>T	ENST00000358410.3	-	16	2455	c.2405C>A	c.(2404-2406)gCt>gAt	p.A802D	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Missense_Mutation_p.A888D	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	802	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						CATGCCAAGAGCTCTGTCAAT	0.368																																					p.A802D													.	DNA2	76		0			c.C2405A												197.0	183.0	188.0					10																	70182359		1862	4102	5964	SO:0001583	missense	1763	exon16			CCAAGAGCTCTGT	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2405C>A	10.37:g.70182359G>T	ENSP00000351185:p.Ala802Asp		111	0	0		115	0.03	4	NM_001080449	39	0.00	0	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.414|9.414	1.081168|1.081168	0.20309|0.20309	.|.	.|.	ENSG00000138346|ENSG00000138346	ENST00000399180;ENST00000358410|ENST00000440722	D;D|.	0.81821|.	-1.54;-1.54|.	5.56|5.56	1.23|1.23	0.21249|0.21249	.|.	0.394485|.	0.28647|.	N|.	0.014610|.	T|T	0.35913|0.35913	0.0948|0.0948	N|N	0.13352|0.13352	0.335|0.335	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.05954|0.05954	-1.0854|-1.0854	10|5	0.15952|.	T|.	0.53|.	.|.	9.3228|9.3228	0.37975|0.37975	0.0:0.1166:0.2648:0.6186|0.0:0.1166:0.2648:0.6186	.|.	802|.	P51530|.	DNA2L_HUMAN|.	D|R	888;802|123	ENSP00000382133:A888D;ENSP00000351185:A802D|.	ENSP00000351185:A802D|.	A|S	-|-	2|3	0|2	DNA2|DNA2	69852365|69852365	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.353000|2.353000	0.44089|0.44089	0.625000|0.625000	0.30304|0.30304	0.650000|0.650000	0.86243|0.86243	GCT|AGC			0.368	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000048334.2			
NPFFR1	64106	mdanderson.org	37	10	72014735	72014735	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr10:72014735G>T	ENST00000277942.6	-	4	1270	c.1271C>A	c.(1270-1272)aCc>aAc	p.T424N		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	424					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						GGCTGGAATGGTGAGGGGCAG	0.706																																					p.T424N													.	.			0			c.C1271A												6.0	7.0	7.0					10																	72014735		1992	4136	6128	SO:0001583	missense	64106	exon4			GGAATGGTGAGGG	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.1271C>A	10.37:g.72014735G>T	ENSP00000277942:p.Thr424Asn		12	0	0		15	0.13	2	NM_022146	0		0	A2RRF0|Q8NGR0|Q96RN3	Missense_Mutation	SNP	ENST00000277942.6	37	CCDS53539.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239545	0.22711	.	.	ENSG00000148734	ENST00000449957;ENST00000277942	T;T	0.69175	-0.38;-0.38	5.24	3.27	0.37495	.	0.891026	0.09845	N	0.748400	T	0.54191	0.1843	L	0.34521	1.04	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.46978	-0.9152	10	0.52906	T	0.07	.	7.4912	0.27462	0.0:0.3376:0.5152:0.1472	.	424	Q9GZQ6	NPFF1_HUMAN	N	422;424	ENSP00000401171:T422N;ENSP00000277942:T424N	ENSP00000277942:T424N	T	-	2	0	NPFFR1	71684741	0.484000	0.25964	0.904000	0.35570	0.922000	0.55478	2.174000	0.42482	1.145000	0.42336	0.563000	0.77884	ACC			0.706	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048504.2		NM_022146	
NSMCE4A	54780	mdanderson.org	37	10	123734659	123734659	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr10:123734659G>T	ENST00000369023.3	-	1	73	c.22C>A	c.(22-24)Cgc>Agc	p.R8S	NSMCE4A_ENST00000369017.5_Missense_Mutation_p.R8S|NSMCE4A_ENST00000489266.1_5'UTR|NSMCE4A_ENST00000538652.1_5'Flank	NM_001167865.1|NM_017615.2	NP_001161337.1|NP_060085.2	Q9NXX6	NSE4A_HUMAN	non-SMC element 4 homolog A (S. cerevisiae)	8					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of response to DNA damage stimulus (GO:2001022)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	6		all_neural(114;0.138)|Glioma(114;0.222)				tctggcccgcggccgcTGCTG	0.726																																					p.R8S													.	.			0			c.C22A																																									SO:0001583	missense	54780	exon1			GCCCGCGGCCGCT	AF258584	CCDS7624.1	10q26.13	2007-05-17	2006-11-24	2006-11-24	ENSG00000107672	ENSG00000107672			25935	protein-coding gene	gene with protein product		612987	"""chromosome 10 open reading frame 86"""	C10orf86		15752197	Standard	NM_017615		Approved	FLJ20003, bA500G22.3, NSE4A	uc001lfs.3	Q9NXX6	OTTHUMG00000019180	ENST00000369023.3:c.22C>A	10.37:g.123734659G>T	ENSP00000358019:p.Arg8Ser		15	0	0		10	0.20	2	NM_017615	3	0.00	0	Q5SQQ5|Q6P673|Q8WY66|Q9BS90	Missense_Mutation	SNP	ENST00000369023.3	37	CCDS7624.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372241	0.42003	.	.	ENSG00000107672	ENST00000369023;ENST00000369017	T;T	0.44881	0.91;2.1	3.44	2.46	0.29980	.	0.392028	0.18828	N	0.130059	T	0.27454	0.0674	N	0.08118	0	0.80722	D	1	P;P	0.42518	0.754;0.782	P;B	0.46685	0.524;0.4	T	0.10474	-1.0628	10	0.66056	D	0.02	-2.727	7.936	0.29931	0.0:0.0:0.7576:0.2424	.	8;8	Q9NXX6-2;Q9NXX6	.;NSE4A_HUMAN	S	8	ENSP00000358019:R8S;ENSP00000358013:R8S	ENSP00000358013:R8S	R	-	1	0	NSMCE4A	123724649	0.998000	0.40836	0.980000	0.43619	0.361000	0.29550	1.410000	0.34691	1.750000	0.51863	0.455000	0.32223	CGC			0.726	NSMCE4A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050749.1		NM_017615	
MUC2	4583	mdanderson.org	37	11	1093437	1093437	+	Silent	SNP	G	G	C			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:1093437G>C	ENST00000441003.2	+	30	5283	c.5256G>C	c.(5254-5256)acG>acC	p.T1752T	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Silent_p.T40T|MUC2_ENST00000359061.5_Silent_p.T1719T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1752T(1)|p.T1719T(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaccaccacggtgaccccaa	0.632																																					p.T1752T													MUC2_ENST00000441003,NS,carcinoma,0,4	MUC2_ENST00000441003	0	4	2	Substitution - coding silent(2)	kidney(2)	c.G5256C												180.0	207.0	198.0					11																	1093437		2046	4038	6084	SO:0001819	synonymous_variant	4583	exon30			CACCACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5256G>C	11.37:g.1093437G>C			41	0	0		29	0.14	4	NM_002457	0		0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																						0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
RCN1	5954	mdanderson.org	37	11	32112827	32112827	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:32112827G>A	ENST00000054950.3	+	1	378	c.85G>A	c.(85-87)Gcc>Acc	p.A29T	RCN1_ENST00000532942.1_Intron	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	29					camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					GGTTCTGCGGGCCAAGCCCAC	0.746																																					p.A29T													.	.			0			c.G85A												3.0	3.0	3.0					11																	32112827		1641	3127	4768	SO:0001583	missense	5954	exon1			CTGCGGGCCAAGC	D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.85G>A	11.37:g.32112827G>A	ENSP00000054950:p.Ala29Thr		64	0	0		56	0.05	3	NM_002901	104	0.00	0	B7Z1M1|D3DR00	Missense_Mutation	SNP	ENST00000054950.3	37	CCDS7876.1	.	.	.	.	.	.	.	.	.	.	g	18.83	3.707513	0.68615	.	.	ENSG00000049449	ENST00000054950;ENST00000400416	T	0.50001	0.76	3.66	3.66	0.41972	.	6.162270	0.01661	U	0.025125	T	0.42743	0.1216	L	0.34521	1.04	0.27911	N	0.938611	P	0.37781	0.608	B	0.37943	0.261	T	0.36529	-0.9744	10	0.28530	T	0.3	-10.6154	10.6004	0.45362	0.0:0.0:0.8072:0.1928	.	29	Q15293	RCN1_HUMAN	T	29	ENSP00000054950:A29T	ENSP00000054950:A29T	A	+	1	0	RCN1	32069403	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	3.682000	0.54656	1.880000	0.54463	0.187000	0.17357	GCC			0.746	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388510.1		NM_002901	
EXT2	2132	bcgsc.ca	37	11	44130752	44130752	+	Missense_Mutation	SNP	G	G	T	rs563383543	byFrequency	TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:44130752G>T	ENST00000343631.3	+	3	674	c.545G>T	c.(544-546)cGa>cTa	p.R182L	EXT2_ENST00000358681.4_Missense_Mutation_p.R182L|EXT2_ENST00000529186.1_3'UTR|EXT2_ENST00000533608.1_Missense_Mutation_p.R182L|EXT2_ENST00000395673.3_Missense_Mutation_p.R215L			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	182					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						AGGTGGGATCGAGGTACGAAT	0.443			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses				G|||	4	0.000798722	0.0	0.0	5008	,	,		18160	0.0		0.0	False		,,,				2504	0.0041				p.R215L			yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	EXT2_ENST00000358681,NS,carcinoma,0,6	EXT2	129	6	0			c.G644T												106.0	105.0	105.0					11																	44130752		2203	4300	6503	SO:0001583	missense	2132	exon3	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	GGGATCGAGGTAC		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.545G>T	11.37:g.44130752G>T	ENSP00000342656:p.Arg182Leu		76	0	0		75	0.07	5	NM_000401	84	0.00	0	B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	ENST00000343631.3	37	CCDS7908.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.549205	0.65311	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93	5.48	5.48	0.80851	.	0.128841	0.52532	D	0.000073	D	0.97879	0.9303	M	0.67397	2.05	0.58432	D	0.999999	B;P;P;P;P	0.39696	0.362;0.677;0.626;0.683;0.683	B;P;B;P;P	0.45406	0.219;0.479;0.347;0.479;0.479	D	0.97945	1.0328	10	0.38643	T	0.18	3.7097	19.3624	0.94446	0.0:0.0:1.0:0.0	.	182;182;182;182;195	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	L	182;182;215;182	ENSP00000431173:R182L;ENSP00000351509:R182L;ENSP00000379032:R215L;ENSP00000342656:R182L	ENSP00000342656:R182L	R	+	2	0	EXT2	44087328	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.232000	0.58645	2.567000	0.86603	0.655000	0.94253	CGA			0.443	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390074.1		NM_000401	
BRMS1	25855	mdanderson.org	37	11	66109598	66109598	+	Silent	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:66109598G>T	ENST00000359957.3	-	2	268	c.108C>A	c.(106-108)ggC>ggA	p.G36G	RP11-867G23.12_ENST00000526655.1_RNA|BRMS1_ENST00000425825.2_Silent_p.G36G	NM_015399.3	NP_056214.1	Q9HCU9	BRMS1_HUMAN	breast cancer metastasis suppressor 1	36					apoptotic process (GO:0006915)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of anoikis (GO:2000210)|positive regulation of protein deacetylation (GO:0090312)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)			large_intestine(1)|liver(1)|lung(1)|prostate(1)|skin(1)	5						CTGTCTGGCTGCCGCTCCGCT	0.562																																					p.G36G	GBM(7;55 307 2662 20856 28942)												.	.			0			c.C108A												148.0	111.0	124.0					11																	66109598		2200	4295	6495	SO:0001819	synonymous_variant	25855	exon2			CTGGCTGCCGCTC	AF147350	CCDS8135.1, CCDS44654.1	11q13-q13.2	2008-02-05				ENSG00000174744			17262	protein-coding gene	gene with protein product		606259				10850410	Standard	XM_005273883		Approved	DKFZP564A063	uc001oho.1	Q9HCU9		ENST00000359957.3:c.108C>A	11.37:g.66109598G>T			54	0	0		56	0.07	4	NM_001024957	170	0.00	0	Q6IAI2	Silent	SNP	ENST00000359957.3	37	CCDS8135.1																																																																																					0.562	BRMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392958.2		NM_015399	
PITPNM1	9600	mdanderson.org	37	11	67259714	67259714	+	Silent	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:67259714G>A	ENST00000534749.1	-	23	3713	c.3525C>T	c.(3523-3525)caC>caT	p.H1175H	PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000356404.3_Silent_p.H1175H|PITPNM1_ENST00000436757.2_Silent_p.H1174H			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	1175					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						AGGCATGCGAGTGCGAGCCCG	0.667																																					p.H1175H	GBM(28;144 709 4607 5525)												.	.			0			c.C3525T												23.0	24.0	24.0					11																	67259714		2198	4289	6487	SO:0001819	synonymous_variant	9600	exon24			ATGCGAGTGCGAG	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.3525C>T	11.37:g.67259714G>A			73	0	0		44	0.07	3	NM_004910	49	0.00	0	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	37	CCDS31620.1																																																																																					0.667	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395520.1		NM_004910	
SHANK2	22941	hgsc.bcm.edu;mdanderson.org	37	11	70332654	70332654	+	Nonsense_Mutation	SNP	G	G	T	rs375960981		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:70332654G>T	ENST00000423696.2	-	15	2643	c.2607C>A	c.(2605-2607)taC>taA	p.Y869*	SHANK2_ENST00000449833.2_Nonsense_Mutation_p.Y653*|SHANK2_ENST00000409161.1_Nonsense_Mutation_p.Y652*|SHANK2_ENST00000338508.4_Nonsense_Mutation_p.Y1249*			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	869					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TGGTATCAATGTAAAGAGGTT	0.622																																					p.Y660X													.	.			0			c.C1980A												82.0	90.0	87.0					11																	70332654		2200	4294	6494	SO:0001587	stop_gained	22941	exon10			ATCAATGTAAAGA	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2607C>A	11.37:g.70332654G>T	ENSP00000394536:p.Tyr869*		131	0	0		96	0.04	4	NM_133266	0		0	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Nonsense_Mutation	SNP	ENST00000423696.2	37		.	.	.	.	.	.	.	.	.	.	G	37	6.454313	0.97581	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	.	.	.	4.88	1.99	0.26369	.	0.106709	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.662	0.28409	0.4071:0.0:0.5929:0.0	.	.	.	.	X	653;652;527;1249;869;887;872	.	ENSP00000294018:Y872X	Y	-	3	2	SHANK2	70010302	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	0.640000	0.24705	0.476000	0.27440	0.561000	0.74099	TAC			0.622	SHANK2-203	KNOWN	basic	protein_coding	protein_coding				NM_012309	
NEU3	10825	mdanderson.org	37	11	74716883	74716883	+	Silent	SNP	A	A	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:74716883A>G	ENST00000544263.1	+	4	803	c.633A>G	c.(631-633)acA>acG	p.T211T	NEU3_ENST00000532963.1_3'UTR|NEU3_ENST00000545272.1_Silent_p.T135T|NEU3_ENST00000531509.1_Silent_p.T244T|NEU3_ENST00000529024.1_Intron|NEU3_ENST00000294064.4_Silent_p.T244T			Q9UQ49	NEUR3_HUMAN	sialidase 3 (membrane sialidase)	211					carbohydrate metabolic process (GO:0005975)|ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-sialidase activity (GO:0016997)|exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(2)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						TAGGGGTCACATGGCACCATG	0.507																																					p.T244T													.	.			0			c.A732G												100.0	97.0	98.0					11																	74716883		1987	4179	6166	SO:0001819	synonymous_variant	10825	exon3			GGTCACATGGCAC	AB008185	CCDS44682.1	11q13.5	2008-02-05				ENSG00000162139			7760	protein-coding gene	gene with protein product		604617				10405317	Standard	NM_006656		Approved		uc001ovw.3	Q9UQ49		ENST00000544263.1:c.633A>G	11.37:g.74716883A>G			47	0	0		43	0.07	3	NM_006656	10	0.00	0	A8K327|Q9NQE1	Silent	SNP	ENST00000544263.1	37																																																																																						0.507	NEU3-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_006656	
BCO2	83875	mdanderson.org	37	11	112071435	112071435	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr11:112071435G>T	ENST00000357685.5	+	7	1100	c.965G>T	c.(964-966)gGg>gTg	p.G322V	BCO2_ENST00000532593.1_Missense_Mutation_p.G217V|BCO2_ENST00000393032.2_Missense_Mutation_p.G288V|BCO2_ENST00000531169.1_Missense_Mutation_p.G288V|BCO2_ENST00000438022.1_Missense_Mutation_p.G288V|BCO2_ENST00000361053.4_Missense_Mutation_p.G249V|BCO2_ENST00000526088.1_Missense_Mutation_p.G288V			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	322					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TTTTCAGATGGGATAAGCTGG	0.398																																					p.G322V	GBM(177;1916 2099 21049 29541 39946)												.	.			0			c.G965T												112.0	116.0	115.0					11																	112071435		2201	4297	6498	SO:0001583	missense	83875	exon7			CAGATGGGATAAG	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.965G>T	11.37:g.112071435G>T	ENSP00000350314:p.Gly322Val		159	0	0		113	0.04	5	NM_031938	0		0	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813806	0.32053	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4;-3.4;-3.4;-3.4	5.54	2.54	0.30619	.	0.198205	0.53938	D	0.000055	D	0.92044	0.7479	L	0.58669	1.825	0.80722	D	1	B;P;B;B	0.43578	0.029;0.811;0.024;0.011	B;B;B;B	0.42625	0.189;0.393;0.144;0.042	D	0.89494	0.3759	10	0.42905	T	0.14	-22.2124	16.9348	0.86200	0.0:0.5004:0.4996:0.0	.	299;249;322;149	C9JEZ9;E9PBI8;Q9BYV7;Q8NAZ7	.;.;BCDO2_HUMAN;.	V	322;288;249;288;288;217;288	ENSP00000350314:G322V;ENSP00000376752:G288V;ENSP00000354338:G249V;ENSP00000414843:G288V;ENSP00000436615:G288V;ENSP00000431802:G217V;ENSP00000437053:G288V	ENSP00000350314:G322V	G	+	2	0	BCO2	111576645	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	1.914000	0.39966	0.262000	0.21774	0.585000	0.79938	GGG			0.398	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256570.3		NM_001037290	
DDX11	1663	ucsc.edu	37	12	31244689	31244689	+	Missense_Mutation	SNP	G	G	A	rs397842879		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr12:31244689G>A	ENST00000407793.2	+	10	1377	c.1126G>A	c.(1126-1128)Gcc>Acc	p.A376T	DDX11_ENST00000542838.1_Missense_Mutation_p.A376T|DDX11_ENST00000228264.6_Missense_Mutation_p.A350T|DDX11_ENST00000350437.4_Missense_Mutation_p.A376T|DDX11_ENST00000545668.1_Missense_Mutation_p.A376T|DDX11_ENST00000251758.5_3'UTR	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	376	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GCTGCATGCGGCCACTCGGCA	0.672										Multiple Myeloma(12;0.14)																											p.A376T													.	DDX11	188		0			c.G1126A												26.0	25.0	26.0					12																	31244689		2194	4289	6483	SO:0001583	missense	1663	exon10			CATGCGGCCACTC	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1126G>A	12.37:g.31244689G>A	ENSP00000384703:p.Ala376Thr		142	0.0352112676	5		241	0.11	26	NM_030653	98	0.12	12	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	37	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	G	7.984	0.751761	0.15778	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.71461	-0.57;1.0;-0.57;1.0;1.0	3.05	3.05	0.35203	DEAD2 (1);Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.324166	0.32703	N	0.005754	T	0.68109	0.2965	L	0.55834	1.745	0.80722	D	1	P;P;D;P;P	0.59767	0.633;0.814;0.986;0.814;0.905	P;B;P;B;B	0.49799	0.507;0.313;0.622;0.294;0.392	T	0.69300	-0.5181	10	0.56958	D	0.05	.	7.318	0.26511	0.0:0.0:0.738:0.262	.	101;350;376;376;376	Q93000;Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;.;DDX11_HUMAN;.;.	T	376;376;101;350;376;376	ENSP00000443426:A376T;ENSP00000384703:A376T;ENSP00000228264:A350T;ENSP00000440402:A376T;ENSP00000309965:A376T	ENSP00000228264:A350T	A	+	1	0	DDX11	31135956	0.935000	0.31712	0.573000	0.28510	0.048000	0.14542	1.665000	0.37449	1.535000	0.49220	0.505000	0.49811	GCC			0.672	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000399728.1		NM_030653	
NOC4L	79050	mdanderson.org	37	12	132631841	132631841	+	Missense_Mutation	SNP	G	G	T	rs375866510		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr12:132631841G>T	ENST00000330579.1	+	4	402	c.361G>T	c.(361-363)Gca>Tca	p.A121S	DDX51_ENST00000397333.3_5'Flank	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	121					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		GGCCCTCAGCGCACTCCTGAA	0.657																																					p.A121S													.	.			0			c.G361T												28.0	27.0	27.0					12																	132631841		2175	4273	6448	SO:0001583	missense	79050	exon4			CTCAGCGCACTCC		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.361G>T	12.37:g.132631841G>T	ENSP00000328854:p.Ala121Ser		60	0	0		54	0.06	3	NM_024078	155	0.00	0	Q8N2S5|Q96I14	Missense_Mutation	SNP	ENST00000330579.1	37	CCDS9277.1	.	.	.	.	.	.	.	.	.	.	G	2.742	-0.262106	0.05791	.	.	ENSG00000184967	ENST00000330579;ENST00000541954	T;T	0.68479	-0.33;1.52	4.72	2.14	0.27477	Armadillo-like helical (1);	0.295570	0.36409	N	0.002609	T	0.46308	0.1386	N	0.19112	0.55	0.09310	N	0.999997	B	0.18863	0.031	B	0.19946	0.027	T	0.25012	-1.0144	10	0.22706	T	0.39	-10.1978	8.5396	0.33384	0.8358:0.0:0.1642:0.0	.	121	Q9BVI4	NOC4L_HUMAN	S	121;88	ENSP00000328854:A121S;ENSP00000438255:A88S	ENSP00000328854:A121S	A	+	1	0	NOC4L	131197794	0.700000	0.27796	0.000000	0.03702	0.025000	0.11179	2.570000	0.45981	0.174000	0.19809	-0.701000	0.03672	GCA			0.657	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398999.1		NM_024078	
SLC46A3	283537	mdanderson.org	37	13	29284959	29284959	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr13:29284959G>T	ENST00000266943.6	-	4	1451	c.1082C>A	c.(1081-1083)aCt>aAt	p.T361N	SLC46A3_ENST00000380814.4_Missense_Mutation_p.T361N	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	361					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		TGGCACAATAGTGAAAAGGAA	0.398																																					p.T361N													.	.			0			c.C1082A												130.0	124.0	126.0					13																	29284959		2203	4300	6503	SO:0001583	missense	283537	exon4			ACAATAGTGAAAA		CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1082C>A	13.37:g.29284959G>T	ENSP00000266943:p.Thr361Asn		63	0	0		53	0.06	3	NM_181785	5	0.00	0	Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Missense_Mutation	SNP	ENST00000266943.6	37	CCDS9332.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019754	0.35606	.	.	ENSG00000139508	ENST00000266943;ENST00000380814	T;T	0.57907	0.37;0.37	5.87	1.31	0.21738	Major facilitator superfamily domain, general substrate transporter (1);	1.108970	0.06462	N	0.729520	T	0.47060	0.1425	L	0.51422	1.61	0.09310	N	1	B;B	0.32010	0.302;0.351	B;B	0.35770	0.133;0.21	T	0.34304	-0.9834	10	0.22706	T	0.39	-0.7986	6.9632	0.24610	0.3903:0.1165:0.4932:0.0	.	361;361	Q7Z3Q1-2;Q7Z3Q1	.;S46A3_HUMAN	N	361	ENSP00000266943:T361N;ENSP00000370192:T361N	ENSP00000266943:T361N	T	-	2	0	SLC46A3	28182959	0.006000	0.16342	0.000000	0.03702	0.000000	0.00434	1.637000	0.37155	-0.004000	0.14419	-0.150000	0.13652	ACT			0.398	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000276111.1		NM_181785	
RFC3	5983	broad.mit.edu	37	13	34398073	34398073	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr13:34398073T>A	ENST00000380071.3	+	3	375	c.245T>A	c.(244-246)aTt>aAt	p.I82N	RFC3_ENST00000434425.1_Missense_Mutation_p.I82N	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	82					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		AAAAAAAAAATTGAAATTAGC	0.284																																					p.I82N													.	RFC3	40		0			c.T245A												28.0	31.0	30.0					13																	34398073		2196	4285	6481	SO:0001583	missense	5983	exon3			AAAAAATTGAAAT		CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.245T>A	13.37:g.34398073T>A	ENSP00000369411:p.Ile82Asn		525	0.0019047619	1		474	0.02	10	NM_002915	111	0.00	0	C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	ENST00000380071.3	37	CCDS9352.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462673	0.84425	.	.	ENSG00000133119	ENST00000380071;ENST00000434425	T;T	0.42513	0.97;0.97	5.74	5.74	0.90152	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.046773	0.85682	D	0.000000	T	0.67268	0.2875	M	0.85197	2.74	0.80722	D	1	D;D;D	0.60160	0.987;0.977;0.977	P;D;D	0.65573	0.879;0.936;0.936	T	0.73388	-0.3998	10	0.87932	D	0	-24.8682	15.2146	0.73254	0.0:0.0:0.0:1.0	.	82;82;82	B4DKE6;C9JU95;P40938	.;.;RFC3_HUMAN	N	82	ENSP00000369411:I82N;ENSP00000401001:I82N	ENSP00000369411:I82N	I	+	2	0	RFC3	33296073	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.498000	0.81546	2.195000	0.70347	0.533000	0.62120	ATT			0.284	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044450.2		NM_002915	
CDH24	64403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23524544	23524544	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr14:23524544G>A	ENST00000267383.5	-	2	312	c.220C>T	c.(220-222)Cgg>Tgg	p.R74W	CDH24_ENST00000554034.1_Missense_Mutation_p.R74W|CDH24_ENST00000487137.2_Missense_Mutation_p.R74W|CDH24_ENST00000397359.3_Missense_Mutation_p.R74W			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	74	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		CCCTCTCCCCGGTCAACATCC	0.557											OREG0022594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R74W													CDH24_ENST00000397359,colon,carcinoma,0,2	CDH24_ENST00000397359	0	2	0			c.C220T												45.0	50.0	49.0					14																	23524544		2203	4300	6503	SO:0001583	missense	64403	exon3			CTCCCCGGTCAAC	AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.220C>T	14.37:g.23524544G>A	ENSP00000267383:p.Arg74Trp		80	0	0	764	92	0.16	15	NM_022478	20	0.20	4	D3DS44|Q86UP1|Q9NT84	Missense_Mutation	SNP	ENST00000267383.5	37	CCDS9585.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791284	0.50102	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000422751;ENST00000554034;ENST00000267383	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	3.89	-0.95	0.10372	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.72118	2.19	0.47065	D	0.999305	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.992;0.987;0.997	T	0.64546	-0.6382	10	0.87932	D	0	.	13.5074	0.61491	0.0:0.0:0.436:0.564	.	74;74;74	Q86UP0-2;Q96LQ7;Q86UP0	.;.;CAD24_HUMAN	W	74	ENSP00000380517:R74W;ENSP00000434821:R74W;ENSP00000452493:R74W;ENSP00000267383:R74W	ENSP00000267383:R74W	R	-	1	2	CDH24	22594384	0.000000	0.05858	0.994000	0.49952	0.997000	0.91878	-0.373000	0.07494	-0.490000	0.06707	0.462000	0.41574	CGG			0.557	CDH24-006	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000257241.2		NM_022478	
LRRC16B	90668	broad.mit.edu	37	14	24534300	24534300	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr14:24534300T>G	ENST00000342740.5	+	33	3368	c.3214T>G	c.(3214-3216)Tcc>Gcc	p.S1072A	LRRC16B_ENST00000334420.7_Missense_Mutation_p.S168A	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1072	Pro-rich.					cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GGGGCCGGGGTCCCCTACCAC	0.692																																					p.S1072A													.	LRRC16B	120		0			c.T3214G												9.0	11.0	10.0					14																	24534300		1717	3660	5377	SO:0001583	missense	90668	exon33			CCGGGGTCCCCTA	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.3214T>G	14.37:g.24534300T>G	ENSP00000340467:p.Ser1072Ala		84	0.0595238095	5		112	0.09	10	NM_138360	0		0	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	T	0.826	-0.747031	0.03065	.	.	ENSG00000186648	ENST00000342740;ENST00000334420	T;T	0.42131	2.57;0.98	4.75	3.59	0.41128	.	0.374607	0.19772	N	0.106410	T	0.23572	0.0570	N	0.14661	0.345	0.21861	N	0.999505	B;B	0.24963	0.115;0.007	B;B	0.24155	0.051;0.007	T	0.16364	-1.0405	10	0.25106	T	0.35	-0.3159	8.5186	0.33262	0.0:0.0:0.1962:0.8038	.	168;1072	Q8ND23-2;Q8ND23	.;LR16B_HUMAN	A	1072;168	ENSP00000340467:S1072A;ENSP00000334701:S168A	ENSP00000334701:S168A	S	+	1	0	LRRC16B	23604140	1.000000	0.71417	0.985000	0.45067	0.128000	0.20619	2.504000	0.45416	0.661000	0.30985	-0.501000	0.04562	TCC			0.692	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416527.1		NM_138360	
LTB4R	1241	broad.mit.edu	37	14	24785074	24785074	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr14:24785074T>C	ENST00000396789.4	+	2	1942	c.217T>C	c.(217-219)Ttt>Ctt	p.F73L	LTB4R_ENST00000345363.3_Missense_Mutation_p.F73L|LTB4R_ENST00000396782.2_Missense_Mutation_p.F73L	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	73					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CACTGCTCCCTTTTTCCTTCA	0.582																																					p.F73L													.	LTB4R	18		0			c.T217C												183.0	163.0	170.0					14																	24785074		2203	4300	6503	SO:0001583	missense	1241	exon2			GCTCCCTTTTTCC	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.217T>C	14.37:g.24785074T>C	ENSP00000380008:p.Phe73Leu		113	0.0088495575	1		122	0.02	3	NM_181657	61	0.00	0	Q13305|Q53XV5|Q92641|Q9BSU5	Missense_Mutation	SNP	ENST00000396789.4	37	CCDS9626.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.145293	0.37825	.	.	ENSG00000213903	ENST00000553481;ENST00000345363;ENST00000396789;ENST00000396782	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.89	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.238062	0.36200	U	0.002721	T	0.27629	0.0679	L	0.37466	1.105	0.37507	D	0.917019	B	0.17465	0.022	B	0.17433	0.018	T	0.12142	-1.0559	10	0.20046	T	0.44	.	11.3543	0.49607	0.0:0.0:0.1521:0.8479	.	73	Q15722	LT4R1_HUMAN	L	73	ENSP00000450457:F73L;ENSP00000307445:F73L;ENSP00000380008:F73L;ENSP00000380002:F73L	ENSP00000307445:F73L	F	+	1	0	LTB4R	23854914	0.279000	0.24239	0.998000	0.56505	0.991000	0.79684	0.623000	0.24447	1.009000	0.39289	0.533000	0.62120	TTT			0.582	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000073198.4			
BMP4	652	mdanderson.org	37	14	54417212	54417212	+	Silent	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr14:54417212G>A	ENST00000245451.4	-	4	1158	c.765C>T	c.(763-765)agC>agT	p.S255S	MIR5580_ENST00000580850.1_RNA|BMP4_ENST00000417573.1_Silent_p.S255S|BMP4_ENST00000559087.1_Silent_p.S255S|BMP4_ENST00000558984.1_Silent_p.S255S	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	255					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						GTAACGATCGGCTAATCCTGA	0.622																																					p.S255S													.	.			0			c.C765T												79.0	67.0	71.0					14																	54417212		2203	4300	6503	SO:0001819	synonymous_variant	652	exon4			CGATCGGCTAATC	AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.765C>T	14.37:g.54417212G>A			60	0	0		49	0.06	3	NM_130851	249	0.00	0	Q9UM80	Silent	SNP	ENST00000245451.4	37	CCDS9715.1																																																																																					0.622	BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276894.2		NM_001202	
ASB2	51676	broad.mit.edu;mdanderson.org	37	14	94417390	94417390	+	Missense_Mutation	SNP	C	C	T	rs142812400	byFrequency	TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr14:94417390C>T	ENST00000315988.4	-	4	1179	c.691G>A	c.(691-693)Gcc>Acc	p.A231T	ASB2_ENST00000555019.1_Missense_Mutation_p.A279T|MIR4506_ENST00000584693.1_RNA|ASB2_ENST00000556337.1_Intron	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	231					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CCACTCTGGGCGGCCACGAAC	0.587													C|||	2	0.000399361	0.0008	0.0	5008	,	,		20770	0.0		0.0	False		,,,				2504	0.001				p.A279T													ASB2,lower_third,carcinoma,+2,1	ASB2	71	1	0			c.G835A							C	THR/ALA,THR/ALA	0,4406		0,0,2203	153.0	141.0	145.0		835,691	4.7	1.0	14	dbSNP_134	145	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	ASB2	NM_001202429.1,NM_016150.4	58,58	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging,probably-damaging	279/636,231/588	94417390	4,13002	2203	4300	6503	SO:0001583	missense	51676	exon6			TCTGGGCGGCCAC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.691G>A	14.37:g.94417390C>T	ENSP00000320675:p.Ala231Thr		147	0	0		173	0.03	6	NM_001202429	12	0.00	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923305	0.92319	0.0	4.65E-4	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507;ENST00000556062	T;T;T;T	0.72051	-0.6;-0.6;-0.62;-0.37	5.62	4.68	0.58851	Ankyrin repeat-containing domain (3);	0.052788	0.85682	D	0.000000	D	0.83700	0.5311	M	0.80332	2.49	0.80722	D	1	D;D;D	0.89917	1.0;0.992;1.0	D;P;D	0.69824	0.966;0.711;0.966	D	0.85527	0.1207	10	0.62326	D	0.03	-28.8957	15.3418	0.74303	0.1402:0.8598:0.0:0.0	.	247;279;231	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	T	279;247;231;177;177;125	ENSP00000451575:A279T;ENSP00000320675:A231T;ENSP00000450940:A177T;ENSP00000451694:A125T	ENSP00000320675:A231T	A	-	1	0	ASB2	93487143	1.000000	0.71417	0.957000	0.39632	0.824000	0.46624	5.995000	0.70631	2.644000	0.89710	0.561000	0.74099	GCC			0.587	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000412845.1			
ST20	400410	mdanderson.org	37	15	80215384	80215384	+	Intron	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr15:80215384G>A	ENST00000485386.1	-	1	251				C15ORF37_ENST00000542003.1_5'Flank|C15orf37_ENST00000560255.1_Missense_Mutation_p.G90D|ST20-MTHFS_ENST00000479961.1_Intron|ST20-MTHFS_ENST00000494999.1_Intron			Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						AGCGGACCTGGCTGGCTACAC	0.701																																					.													.	.			0			.												27.0	32.0	30.0					15																	80215384		1859	4085	5944	SO:0001627	intron_variant	283687	.			GACCTGGCTGGCT	AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000485386.1:c.10+409C>T	15.37:g.80215384G>A			27	0	0		32	0.09	3	.	5	0.00	0		RNA	SNP	ENST00000485386.1	37	CCDS42067.1																																																																																					0.701	ST20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416729.1			
KIF7	374654	mdanderson.org	37	15	90176925	90176925	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr15:90176925G>T	ENST00000394412.3	-	12	2660	c.2584C>A	c.(2584-2586)Cgc>Agc	p.R862S		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	862					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			ACCTTGACGCGGTGCTGCCGC	0.677																																					p.R862S													.	.			0			c.C2584A																																									SO:0001583	missense	374654	exon12			TGACGCGGTGCTG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2584C>A	15.37:g.90176925G>T	ENSP00000377934:p.Arg862Ser		28	0	0		43	0.07	3	NM_198525	23	0.00	0	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	37	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920538	0.52653	.	.	ENSG00000166813	ENST00000394412	T	0.37915	1.17	5.12	5.12	0.69794	.	0.048900	0.85682	D	0.000000	T	0.44953	0.1318	M	0.70275	2.135	0.54753	D	0.999988	P;P	0.48589	0.857;0.912	P;P	0.47626	0.552;0.507	T	0.39461	-0.9613	10	0.36615	T	0.2	.	13.5026	0.61467	0.0:0.0:0.8436:0.1564	.	348;862	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	S	862	ENSP00000377934:R862S	ENSP00000377934:R862S	R	-	1	0	KIF7	87977929	1.000000	0.71417	0.990000	0.47175	0.888000	0.51559	3.265000	0.51561	2.378000	0.81104	0.491000	0.48974	CGC			0.677	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347782.1		NM_198525	
BRICD5	283870	mdanderson.org	37	16	2259985	2259985	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr16:2259985C>T	ENST00000562360.1	-	4	403	c.404G>A	c.(403-405)cGg>cAg	p.R135Q	BRICD5_ENST00000328540.3_Missense_Mutation_p.R135Q|RP11-304L19.8_ENST00000561544.1_lincRNA|BRICD5_ENST00000566018.1_3'UTR			Q6PL45	BRID5_HUMAN	BRICHOS domain containing 5	135	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					integral component of membrane (GO:0016021)											CAGGGTCTCCCGATCACTGTC	0.692																																					p.R135Q													.	.			0			c.G404A												24.0	24.0	24.0					16																	2259985		2195	4298	6493	SO:0001583	missense	283870	exon4			GTCTCCCGATCAC	BC039154	CCDS10463.1	16p13.3	2012-10-10	2012-10-10	2012-10-10	ENSG00000182685	ENSG00000182685		"""BRICHOS domain containing"""	28309	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 79"""	C16orf79		12477932	Standard	NM_182563		Approved	MGC21830	uc002cpi.2	Q6PL45	OTTHUMG00000128831	ENST00000562360.1:c.404G>A	16.37:g.2259985C>T	ENSP00000455052:p.Arg135Gln		42	0	0		58	0.09	5	NM_182563	16	0.00	0	C9J7K2|Q8IXU9	Missense_Mutation	SNP	ENST00000562360.1	37	CCDS10463.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.738291	0.30774	.	.	ENSG00000182685	ENST00000328540	T	0.78707	-1.2	5.58	2.52	0.30459	BRICHOS (2);	0.758427	0.13185	N	0.407181	T	0.60196	0.2250	.	.	.	0.09310	N	0.999999	B;B	0.31817	0.341;0.077	B;B	0.24006	0.05;0.013	T	0.41270	-0.9518	9	0.25106	T	0.35	-3.9565	7.8112	0.29232	0.0:0.7299:0.0:0.2701	.	135;135	Q6PL45;Q6PL45-2	CP079_HUMAN;.	Q	135	ENSP00000332389:R135Q	ENSP00000332389:R135Q	R	-	2	0	C16orf79	2199986	0.000000	0.05858	0.009000	0.14445	0.837000	0.47467	-0.008000	0.12788	0.287000	0.22375	0.561000	0.74099	CGG			0.692	BRICD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000435091.1		NM_182563	
ABCC1	4363	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	16225711	16225711	+	Missense_Mutation	SNP	C	C	A	rs45533037		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr16:16225711C>A	ENST00000399410.3	+	27	4060	c.3885C>A	c.(3883-3885)ttC>ttA	p.F1295L	ABCC1_ENST00000399408.2_Missense_Mutation_p.F1305L|ABCC1_ENST00000345148.5_Missense_Mutation_p.F1295L|ABCC1_ENST00000346370.5_Missense_Mutation_p.F1239L|ABCC1_ENST00000349029.5_Missense_Mutation_p.F1180L|ABCC1_ENST00000351154.5_Missense_Mutation_p.F1236L	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1295	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GAGTGGAATTCCGGAACTACT	0.582																																					p.F1295L													.	.			0			c.C3885A												58.0	60.0	59.0					16																	16225711		2007	4168	6175	SO:0001583	missense	4363	exon27			GGAATTCCGGAAC	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3885C>A	16.37:g.16225711C>A	ENSP00000382342:p.Phe1295Leu		106	0	0		113	0.10	11	NM_004996	91	0.19	17	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483708	0.44147	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67;-2.67	5.11	5.11	0.69529	ABC transporter-like (1);	0.109676	0.64402	D	0.000009	D	0.90662	0.7071	L	0.33189	0.99	0.46044	D	0.998833	B;B;B;D;B;B	0.64830	0.088;0.338;0.199;0.994;0.126;0.199	B;B;B;D;B;B	0.64237	0.053;0.26;0.086;0.923;0.04;0.086	D	0.90342	0.4360	10	0.56958	D	0.05	-34.1301	9.4489	0.38714	0.0:0.8373:0.0:0.1627	.	1180;1295;1239;1236;1295;1305	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	L	1295;1305;1239;1236;1295;1180;979	ENSP00000382342:F1295L;ENSP00000382340:F1305L;ENSP00000263019:F1239L;ENSP00000263017:F1236L;ENSP00000263014:F1295L;ENSP00000263016:F1180L	ENSP00000263014:F1295L	F	+	3	2	ABCC1	16133212	0.023000	0.18921	1.000000	0.80357	0.220000	0.24768	0.331000	0.19733	2.387000	0.81309	0.655000	0.94253	TTC			0.582	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109701.1		NM_004996	
LOC653786	653786	broad.mit.edu	37	16	22588015	22588015	+	RNA	SNP	A	A	G	rs460493	byFrequency	TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr16:22588015A>G	ENST00000550753.1	+	0	2490					NR_003676.2																						TGGCCTGAGCACATCGTCCTG	0.557													G|||	7	0.00139776	0.0015	0.0	5008	,	,		24848	0.004		0.0	False		,,,				2504	0.001				.													.	.			0			.																																											0	.			CTGAGCACATCGT																													16.37:g.22588015A>G			48	0.0208333333	1		57	0.14	8	.	22	0.09	2		RNA	SNP	ENST00000550753.1	37																																																																																						0.557	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
PRSS53	339105	mdanderson.org	37	16	31097783	31097783	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr16:31097783G>A	ENST00000280606.6	-	5	691	c.538C>T	c.(538-540)Cgt>Tgt	p.R180C		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	180	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						CTGATGAGACGCAGGCGCAGA	0.622																																					p.R180C													PRSS53,NS,carcinoma,0,1	PRSS53	0	1	0			c.C538T												38.0	44.0	42.0					16																	31097783		2075	4222	6297	SO:0001583	missense	339105	exon5			TGAGACGCAGGCG		CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.538C>T	16.37:g.31097783G>A	ENSP00000280606:p.Arg180Cys		61	0	0		43	0.07	3	NM_001039503	3	0.00	0		Missense_Mutation	SNP	ENST00000280606.6	37	CCDS42153.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724636	0.68959	.	.	ENSG00000151006	ENST00000280606	D	0.89270	-2.49	5.66	5.66	0.87406	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37178	U	0.002216	D	0.94023	0.8085	M	0.73319	2.225	0.54753	D	0.999988	D	0.89917	1.0	D	0.85130	0.997	D	0.94231	0.7476	10	0.72032	D	0.01	.	17.2498	0.87039	0.0:0.0:1.0:0.0	.	180	Q2L4Q9	PRS53_HUMAN	C	180	ENSP00000280606:R180C	ENSP00000280606:R180C	R	-	1	0	PRSS53	31005284	1.000000	0.71417	1.000000	0.80357	0.319000	0.28217	5.996000	0.70639	2.665000	0.90641	0.655000	0.94253	CGT			0.622	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000108580.4		NM_001081268	
MYH4	4622	broad.mit.edu	37	17	10368813	10368813	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr17:10368813C>A	ENST00000255381.2	-	5	561	c.451G>T	c.(451-453)Gcc>Tcc	p.A151S	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	151	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGGGGTGGGGCCTCCTGGCGC	0.502																																					p.A151S													.	MYH4	349		0			c.G451T												157.0	163.0	161.0					17																	10368813		2203	4300	6503	SO:0001583	missense	4622	exon5			GTGGGGCCTCCTG		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.451G>T	17.37:g.10368813C>A	ENSP00000255381:p.Ala151Ser		118	0.0084745763	1		190	0.04	7	NM_017533	0		0		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	35	5.501696	0.96371	.	.	ENSG00000141048;ENSG00000125414	ENST00000255381;ENST00000532288	D	0.87729	-2.29	4.95	4.95	0.65309	Myosin head, motor domain (2);	0.000000	0.37178	U	0.002217	D	0.88672	0.6500	L	0.51853	1.615	0.80722	D	1	B	0.15719	0.014	B	0.38655	0.278	D	0.86337	0.1702	10	0.87932	D	0	.	18.7315	0.91736	0.0:1.0:0.0:0.0	.	151	Q9Y623	MYH4_HUMAN	S	151	ENSP00000255381:A151S	ENSP00000431873:A151S	A	-	1	0	MYH2;MYH4	10309538	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.553000	0.82203	2.728000	0.93425	0.650000	0.86243	GCC			0.502	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252731.1		NM_017533	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		292	0.0445205479	13		307	0.06	19	NM_145301	78	0.54	42	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
MYO15A	51168	broad.mit.edu	37	17	18025400	18025400	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr17:18025400G>T	ENST00000205890.5	+	2	3624	c.3286G>T	c.(3286-3288)Gcc>Tcc	p.A1096S		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1096					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCCCATCAGGGCCCCAGAGCC	0.677																																					p.A1096S													.	MYO15A	268		0			c.G3286T												38.0	44.0	42.0					17																	18025400		1919	4117	6036	SO:0001583	missense	51168	exon2			ATCAGGGCCCCAG	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.3286G>T	17.37:g.18025400G>T	ENSP00000205890:p.Ala1096Ser		75	0.0266666667	2		94	0.11	10	NM_016239	0		0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	g	10.17	1.276576	0.23307	.	.	ENSG00000091536	ENST00000205890	D	0.88354	-2.37	4.86	-3.09	0.05331	.	.	.	.	.	T	0.77538	0.4145	L	0.27053	0.805	0.09310	N	1	B	0.24186	0.099	B	0.16722	0.016	T	0.60596	-0.7232	9	0.21014	T	0.42	.	8.0181	0.30393	0.1672:0.5352:0.2975:0.0	.	1096	Q9UKN7	MYO15_HUMAN	S	1096	ENSP00000205890:A1096S	ENSP00000205890:A1096S	A	+	1	0	MYO15A	17966125	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	-0.407000	0.07178	-0.438000	0.07232	-0.304000	0.09214	GCC			0.677	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132048.1		NM_016239	
HEXIM1	10614	broad.mit.edu	37	17	43229647	43229648	+	IGR	INS	-	-	A	rs61347123|rs66651362|rs12450963|rs141039553|rs71373537		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr17:43229647_43229648insA	ENST00000332499.2	+	0	4785				AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						tttctttatttttttttttttt	0.455																																					.													.	HEXIM1	25		0			.																																									SO:0001628	intergenic_variant	0	.			TTTATTTTTTTTT	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992			17.37:g.43229647_43229648insA			4	0	0		8	0.50	4	.	0		0	B2R8Y5	RNA	INS	ENST00000332499.2	37	CCDS11495.1																																																																																					0.455	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449821.2		NM_006460	
SDK2	54549	broad.mit.edu	37	17	71503707	71503707	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr17:71503707G>T	ENST00000392650.3	-	2	94	c.94C>A	c.(94-96)Cct>Act	p.P32T	SDK2_ENST00000388726.3_Missense_Mutation_p.P32T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	32	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GTCCGCACAGGCTCTGTCTTG	0.542																																					p.P32T													.	SDK2	219		0			c.C94A												110.0	101.0	104.0					17																	71503707		692	1591	2283	SO:0001583	missense	54549	exon2			GCACAGGCTCTGT	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.94C>A	17.37:g.71503707G>T	ENSP00000376421:p.Pro32Thr		99	0.0101010101	1		100	0.04	4	NM_001144952	2	0.00	0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387031	0.82902	.	.	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.78364	-1.17;-1.17	5.26	5.26	0.73747	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	U	0.000037	D	0.86184	0.5872	M	0.86268	2.805	0.58432	D	0.999999	B	0.31640	0.333	P	0.44422	0.449	D	0.86888	0.2046	10	0.66056	D	0.02	.	18.4629	0.90746	0.0:0.0:1.0:0.0	.	32	Q58EX2	SDK2_HUMAN	T	32	ENSP00000376421:P32T;ENSP00000373378:P32T	ENSP00000324967:P32T	P	-	1	0	SDK2	69015302	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	9.696000	0.98695	2.462000	0.83206	0.561000	0.74099	CCT			0.542	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327598.2		NM_019064	
DLGAP1	9229	mdanderson.org	37	18	3879777	3879777	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr18:3879777G>T	ENST00000315677.3	-	4	887	c.292C>A	c.(292-294)Cgc>Agc	p.R98S	DLGAP1_ENST00000515196.2_Missense_Mutation_p.R98S|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R98S|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R98S	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	98					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GCGGGGATGCGGTTCGCCTTG	0.677																																					p.R98S													.	.			0			c.C292A												46.0	47.0	47.0					18																	3879777		2203	4298	6501	SO:0001583	missense	9229	exon4			GGATGCGGTTCGC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.292C>A	18.37:g.3879777G>T	ENSP00000316377:p.Arg98Ser		29	0	0		24	0.08	2	NM_001242761	2	0.00	0	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	37	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587878	0.66105	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.32023	1.47;1.47	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.55545	0.1927	M	0.85462	2.755	0.80722	D	1	P;D;P	0.53745	0.935;0.962;0.935	B;P;P	0.53490	0.386;0.59;0.727	T	0.62950	-0.6745	10	0.87932	D	0	-23.6449	19.6689	0.95903	0.0:0.0:1.0:0.0	.	98;98;98	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	S	98	ENSP00000316377:R98S;ENSP00000445973:R98S	ENSP00000316377:R98S	R	-	1	0	DLGAP1	3869777	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	9.814000	0.99346	2.642000	0.89623	0.655000	0.94253	CGC			0.677	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254394.4			
POLRMT	5442	mdanderson.org	37	19	619054	619054	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:619054C>A	ENST00000588649.2	-	15	3294	c.3210G>T	c.(3208-3210)tgG>tgT	p.W1070C	AC005559.2_ENST00000591847.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	1070	Mediates interaction with TEFM.				gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGTGTGACCCACTCCACCA	0.667																																					p.W1070C													.	.			0			c.G3210T												52.0	48.0	49.0					19																	619054		2201	4300	6501	SO:0001583	missense	5442	exon15			TGTGACCCACTCC		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.3210G>T	19.37:g.619054C>A	ENSP00000465759:p.Trp1070Cys		69	0.0144927536	1		94	0.05	5	NM_005035	211	0.00	0	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	.	13.63	2.295160	0.40594	.	.	ENSG00000099821	ENST00000215591	T	0.71934	-0.61	4.21	4.21	0.49690	.	0.231411	0.41823	D	0.000818	D	0.89491	0.6730	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93396	0.6756	10	0.87932	D	0	-15.535	15.7617	0.78087	0.0:1.0:0.0:0.0	.	1070	O00411	RPOM_HUMAN	C	1070	ENSP00000215591:W1070C	ENSP00000215591:W1070C	W	-	3	0	POLRMT	570054	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	6.752000	0.74898	2.181000	0.69327	0.456000	0.33151	TGG			0.667	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452172.3		NM_005035	
LINGO3	645191	mdanderson.org	37	19	2290612	2290612	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:2290612G>T	ENST00000585527.1	-	1	1411	c.1164C>A	c.(1162-1164)gaC>gaA	p.D388E	LINGO3_ENST00000404279.1_Missense_Mutation_p.D388E			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	388	LRRCT.					integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						TTCGCAGCGCGTCGCCGCGCA	0.711																																					p.D388E													.	.			0			c.C1164A												7.0	8.0	8.0					19																	2290612		1975	4058	6033	SO:0001583	missense	645191	exon2			CAGCGCGTCGCCG	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1164C>A	19.37:g.2290612G>T	ENSP00000467753:p.Asp388Glu		29	0	0		23	0.09	2	NM_001101391	3	0.00	0		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	.	.	.	.	.	.	.	.	.	.	g	12.82	2.051814	0.36181	.	.	ENSG00000220008	ENST00000404279	T	0.55052	0.54	4.27	-1.99	0.07457	Cysteine-rich flanking region, C-terminal (1);	.	.	.	.	T	0.27098	0.0664	N	0.08118	0	0.26195	N	0.979521	B	0.22909	0.077	B	0.24006	0.05	T	0.19877	-1.0292	9	0.41790	T	0.15	.	5.1839	0.15174	0.4295:0.1463:0.4243:0.0	.	388	P0C6S8	LIGO3_HUMAN	E	388	ENSP00000384979:D388E	ENSP00000384979:D388E	D	-	3	2	LINGO3	2241612	0.307000	0.24500	0.864000	0.33941	0.709000	0.40893	-0.033000	0.12246	-0.042000	0.13535	0.313000	0.20887	GAC			0.711	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000451291.2		NM_001101391	
LMNB2	84823	mdanderson.org	37	19	2434504	2434504	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:2434504C>T	ENST00000582871.1	-	7	1017	c.931G>A	c.(931-933)Gct>Act	p.A311T	LMNB2_ENST00000475819.1_5'Flank|LMNB2_ENST00000325327.3_Missense_Mutation_p.A331T	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	311	Coil 2.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGATCTTCAGCGGCACTGGCC	0.672																																					p.A331T													.	.			0			c.G991A												44.0	37.0	39.0					19																	2434504		2201	4299	6500	SO:0001583	missense	84823	exon7			CTTCAGCGGCACT	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.931G>A	19.37:g.2434504C>T	ENSP00000462730:p.Ala311Thr		78	0.0128205128	1		47	0.06	3	NM_032737	308	0.00	0	O75292|Q14734|Q96DF6	Missense_Mutation	SNP	ENST00000582871.1	37		.	.	.	.	.	.	.	.	.	.	C	4.833	0.154862	0.09236	.	.	ENSG00000176619	ENST00000325327	.	.	.	4.14	4.14	0.48551	Filament (1);	0.061583	0.64402	D	0.000005	T	0.54727	0.1876	M	0.64997	1.995	0.31947	N	0.610197	B	0.22800	0.075	B	0.24006	0.05	T	0.60326	-0.7285	9	0.27082	T	0.32	.	14.9833	0.71327	0.0:1.0:0.0:0.0	.	311	Q03252	LMNB2_HUMAN	T	311	.	ENSP00000327054:A311T	A	-	1	0	LMNB2	2385504	1.000000	0.71417	0.026000	0.17262	0.282000	0.26991	4.797000	0.62503	1.855000	0.53841	0.561000	0.74099	GCT			0.672	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_032737	
EEF2	1938	mdanderson.org	37	19	3976653	3976653	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:3976653C>T	ENST00000309311.6	-	15	2564	c.2476G>A	c.(2476-2478)Gac>Aac	p.D826N		NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	826					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCTGTTGTCGAAGGGGTCT	0.632																																					p.D826N	Colon(165;1804 1908 4071 6587 18799)												.	.			0			c.G2476A												30.0	26.0	27.0					19																	3976653		2202	4299	6501	SO:0001583	missense	1938	exon15			TGTTGTCGAAGGG	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.2476G>A	19.37:g.3976653C>T	ENSP00000307940:p.Asp826Asn		28	0	0		36	0.08	3	NM_001961	8078	0.00	10	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	ENST00000309311.6	37	CCDS12117.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084899	0.76642	.	.	ENSG00000167658	ENST00000309311	T	0.64803	-0.12	5.41	5.41	0.78517	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.218928	0.45606	D	0.000360	T	0.68933	0.3055	M	0.82823	2.61	0.80722	D	1	P	0.45126	0.851	B	0.41510	0.359	T	0.75513	-0.3291	10	0.56958	D	0.05	-47.5377	18.1964	0.89823	0.0:1.0:0.0:0.0	.	826	P13639	EF2_HUMAN	N	826	ENSP00000307940:D826N	ENSP00000307940:D826N	D	-	1	0	EEF2	3927653	1.000000	0.71417	0.104000	0.21259	0.805000	0.45488	7.514000	0.81750	2.527000	0.85204	0.651000	0.88453	GAC			0.632	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457615.2		NM_001961	
LPHN1	22859	broad.mit.edu	37	19	14261858	14261858	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:14261858C>G	ENST00000340736.6	-	24	4549	c.4252G>C	c.(4252-4254)Ggc>Cgc	p.G1418R	CTB-55O6.12_ENST00000588658.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.G1413R|CTB-55O6.12_ENST00000588387.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1418	Poly-Pro.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCGGGGGGGCCGGGGGGTGCG	0.721																																					p.G1418R													LPHN1,NS,carcinoma,0,1	LPHN1	107	1	0			c.G4252C												2.0	3.0	2.0					19																	14261858		1217	2889	4106	SO:0001583	missense	22859	exon24			GGGGGCCGGGGGG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.4252G>C	19.37:g.14261858C>G	ENSP00000340688:p.Gly1418Arg		48	0.0208333333	1		40	0.13	5	NM_001008701	35	0.00	0	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.312147	0.40895	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.71341	-0.56;-0.56	3.94	3.94	0.45596	GPCR, family 2, latrophilin, C-terminal (1);	0.107189	0.38837	N	0.001553	T	0.58352	0.2116	N	0.22421	0.69	0.42714	D	0.993656	B;B	0.22276	0.054;0.067	B;B	0.25614	0.037;0.062	T	0.61510	-0.7048	10	0.72032	D	0.01	.	13.4745	0.61301	0.0:1.0:0.0:0.0	.	1413;1418	O94910-2;O94910	.;LPHN1_HUMAN	R	1418;1413	ENSP00000340688:G1418R;ENSP00000355328:G1413R	ENSP00000340688:G1418R	G	-	1	0	LPHN1	14122858	0.253000	0.23982	0.799000	0.32177	0.185000	0.23345	3.883000	0.56168	1.764000	0.52075	0.205000	0.17691	GGC			0.721	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000459696.1		NM_014921	
RPL18A	6142	mdanderson.org	37	19	17972941	17972941	+	Silent	SNP	G	G	A	rs78185444	byFrequency	TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:17972941G>A	ENST00000222247.5	+	3	318	c.237G>A	c.(235-237)ggG>ggA	p.G79G	RPL18A_ENST00000600147.1_Silent_p.G79G|SNORA68_ENST00000384437.1_RNA|RPL18A_ENST00000599898.1_Silent_p.G40G|RPL18A_ENST00000599870.1_Silent_p.G50G	NM_000980.3	NP_000971.1	Q02543	RL18A_HUMAN	ribosomal protein L18a	79					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(1)	5						AGAACTTCGGGATCTGGCTGC	0.622													G|||	15	0.00299521	0.0106	0.0014	5008	,	,		17590	0.0		0.0	False		,,,				2504	0.0				p.G79G													.	.			0			c.G237A							G		47,4359	47.5+/-82.1	0,47,2156	48.0	51.0	50.0		237	-2.1	1.0	19	dbSNP_131	50	0,8600		0,0,4300	no	coding-synonymous	RPL18A	NM_000980.2		0,47,6456	AA,AG,GG		0.0,1.0667,0.3614		79/177	17972941	47,12959	2203	4300	6503	SO:0001819	synonymous_variant	6142	exon3			CTTCGGGATCTGG	AB007175	CCDS12367.1	19p13.11	2011-04-06			ENSG00000105640	ENSG00000105640		"""L ribosomal proteins"""	10311	protein-coding gene	gene with protein product	"""60S ribosomal protein L18a"", ""ribosomal protein L18a-like protein"""	604178				9582194	Standard	NM_000980		Approved	L18A	uc002nhp.3	Q02543		ENST00000222247.5:c.237G>A	19.37:g.17972941G>A			46	0	0		50	0.06	3	NM_000980	7497	0.00	1		Silent	SNP	ENST00000222247.5	37	CCDS12367.1																																																																																			0.004		0.622	RPL18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466679.1		NM_000980	
KLHL26	55295	mdanderson.org	37	19	18779075	18779075	+	Silent	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:18779075C>T	ENST00000300976.4	+	3	958	c.868C>T	c.(868-870)Ctg>Ttg	p.L290L	KLHL26_ENST00000599006.1_Intron	NM_018316.1	NP_060786.1	Q53HC5	KLH26_HUMAN	kelch-like family member 26	290										breast(1)|central_nervous_system(1)|kidney(1)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CTACCAGGTGCTGCCCTTCCG	0.662																																					p.L290L													.	.			0			c.C868T												47.0	53.0	51.0					19																	18779075		2190	4278	6468	SO:0001819	synonymous_variant	55295	exon3			CAGGTGCTGCCCT		CCDS12384.1	19p13.11	2013-10-15	2013-02-22		ENSG00000167487	ENSG00000167487		"""Kelch-like"", ""BTB/POZ domain containing"""	25623	protein-coding gene	gene with protein product			"""kelch-like 26 (Drosophila)"""				Standard	XM_006722785		Approved		uc002njz.1	Q53HC5	OTTHUMG00000183114	ENST00000300976.4:c.868C>T	19.37:g.18779075C>T			40	0	0		37	0.08	3	NM_018316	6	0.00	0	Q8TAP0|Q9NUX3	Silent	SNP	ENST00000300976.4	37	CCDS12384.1																																																																																					0.662	KLHL26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465145.1		NM_018316	
MOGS	7841	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	74691780	74691780	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr2:74691780T>C	ENST00000233616.4	-	2	584	c.422A>G	c.(421-423)gAc>gGc	p.D141G	MOGS_ENST00000462443.1_Intron|MOGS_ENST00000535045.1_Intron|MOGS_ENST00000452063.2_Missense_Mutation_p.D35G|MOGS_ENST00000409065.1_Missense_Mutation_p.D141G	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	141					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						ACCCACACCGTCCCCCTGCTC	0.622																																					p.D141G													.	.			0			c.A422G												57.0	63.0	61.0					2																	74691780		1946	4152	6098	SO:0001583	missense	7841	exon2			ACACCGTCCCCCT	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.422A>G	2.37:g.74691780T>C	ENSP00000233616:p.Asp141Gly		145	0	0		142	0.04	6	NM_006302	113	0.00	0	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	37	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	T	33	5.235878	0.95240	.	.	ENSG00000115275	ENST00000233616;ENST00000452063;ENST00000409065;ENST00000448666;ENST00000414701	T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.76737	0.4029	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81890	-0.0725	10	0.87932	D	0	-25.6368	13.3999	0.60876	0.0:0.0:0.0:1.0	.	141	Q13724	MOGS_HUMAN	G	141;35;141;35;22	ENSP00000233616:D141G;ENSP00000388201:D35G;ENSP00000386493:D141G;ENSP00000410992:D35G;ENSP00000396298:D22G	ENSP00000233616:D141G	D	-	2	0	MOGS	74545288	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.775000	0.75018	2.254000	0.74563	0.533000	0.62120	GAC			0.622	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328382.1		NM_006302	
CCDC142	84865	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	74709738	74709738	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr2:74709738C>T	ENST00000393965.3	-	1	623	c.227G>A	c.(226-228)cGg>cAg	p.R76Q	TTC31_ENST00000442235.2_5'Flank|TTC31_ENST00000410003.1_5'Flank|CCDC142_ENST00000471713.1_Intron|CCDC142_ENST00000290418.4_Missense_Mutation_p.R76Q|TTC31_ENST00000233623.5_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	76										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						TGCGGGCCCCCGCCTCCAGGC	0.731																																					p.R76Q													.	.			0			c.G227A												14.0	16.0	15.0					2																	74709738		2080	4122	6202	SO:0001583	missense	84865	exon1			GGCCCCCGCCTCC	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.227G>A	2.37:g.74709738C>T	ENSP00000377537:p.Arg76Gln		54	0	0		54	0.22	12	NM_032779	3	0.33	1	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37		.	.	.	.	.	.	.	.	.	.	C	12.44	1.937509	0.34189	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	D;D	0.85629	-2.01;-2.01	4.44	-4.25	0.03766	.	1.083790	0.07243	N	0.864514	T	0.56441	0.1985	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.15473	0.013;0.013;0.013	B;B;B	0.06405	0.002;0.002;0.002	T	0.47548	-0.9109	9	.	.	.	-3.2453	2.0696	0.03610	0.1321:0.272:0.13:0.4658	.	76;76;76	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	Q	76	ENSP00000377537:R76Q;ENSP00000290418:R76Q	.	R	-	2	0	CCDC142	74563246	0.000000	0.05858	0.177000	0.23020	0.007000	0.05969	-0.515000	0.06290	-0.900000	0.03896	-0.254000	0.11334	CGG			0.731	CCDC142-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000328391.1		NM_032779	
ANKRD30BL	554226	mdanderson.org	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	554226	.			TGTCGTCTTCTTC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T			66	0.0303030303	2		81	0.10	8	.	0		0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				0.009		0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
C2orf57	165100	mdanderson.org	37	2	232457786	232457786	+	Missense_Mutation	SNP	G	G	A	rs369074059		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr2:232457786G>A	ENST00000313965.2	+	1	212	c.124G>A	c.(124-126)Gca>Aca	p.A42T		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	42										endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		CAGCTCTGTCGCATCCACTGA	0.567																																					p.A42T													.	.			0			c.G124A							G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	111.0	108.0	109.0		124	2.7	0.0	2		109	0,8600		0,0,4300	no	missense	C2orf57	NM_152614.2	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	42/396	232457786	1,13005	2203	4300	6503	SO:0001583	missense	165100	exon1			TCTGTCGCATCCA	BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.124G>A	2.37:g.232457786G>A	ENSP00000315557:p.Ala42Thr		86	0	0		110	0.05	5	NM_152614	0		0	Q8N4F2	Missense_Mutation	SNP	ENST00000313965.2	37	CCDS2487.1	.	.	.	.	.	.	.	.	.	.	g	14.59	2.580962	0.46006	2.27E-4	0.0	ENSG00000177673	ENST00000313965	T	0.23552	1.9	4.46	2.66	0.31614	.	1.284760	0.06027	N	0.652465	T	0.16128	0.0388	N	0.19112	0.55	0.09310	N	1	P	0.44195	0.828	B	0.40009	0.316	T	0.12578	-1.0542	10	0.13853	T	0.58	-0.6575	7.0308	0.24967	0.2091:0.0:0.7909:0.0	.	42	Q53QW1	CB057_HUMAN	T	42	ENSP00000315557:A42T	ENSP00000315557:A42T	A	+	1	0	C2orf57	232166030	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.584000	0.23864	0.627000	0.30340	-0.379000	0.06801	GCA			0.567	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256962.1		NM_152614	
AQP12B	653437	mdanderson.org	37	2	241621835	241621835	+	Silent	SNP	C	C	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr2:241621835C>A	ENST00000407834.3	-	1	482	c.420G>T	c.(418-420)ctG>ctT	p.L140L		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	128						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCAGCAGGTGCAGGTCACTGA	0.701																																					p.L140L													.	.			0			c.G420T												13.0	14.0	13.0					2																	241621835		2177	4220	6397	SO:0001819	synonymous_variant	653437	exon1			CAGGTGCAGGTCA	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.420G>T	2.37:g.241621835C>A			37	0	0		47	0.06	3	NM_001102467	0		0	A4QPB9	Silent	SNP	ENST00000407834.3	37	CCDS46560.1																																																																																					0.701	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325625.1			
MYH7B	57644	mdanderson.org	37	20	33585097	33585097	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr20:33585097C>T	ENST00000262873.7	+	30	3619	c.3527C>T	c.(3526-3528)gCa>gTa	p.A1176V		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1134						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GCAGAGCGGGCAGCCCGGGCC	0.741																																					p.A1176V													.	.			0			c.C3527T												5.0	6.0	6.0					20																	33585097		2087	4067	6154	SO:0001583	missense	57644	exon32			AGCGGGCAGCCCG	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3527C>T	20.37:g.33585097C>T	ENSP00000262873:p.Ala1176Val		43	0	0		35	0.09	3	NM_020884	14	0.00	0	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	C	35	5.557862	0.96514	.	.	ENSG00000078814	ENST00000262873	T	0.79554	-1.28	4.6	4.6	0.57074	Myosin tail (1);	0.000000	0.37669	N	0.001989	D	0.87208	0.6120	M	0.69358	2.11	0.51482	D	0.999923	D	0.56746	0.977	P	0.59703	0.862	D	0.88888	0.3344	10	0.72032	D	0.01	.	17.6074	0.88042	0.0:1.0:0.0:0.0	.	1134	A7E2Y1	MYH7B_HUMAN	V	1176	ENSP00000262873:A1176V	ENSP00000262873:A1176V	A	+	2	0	MYH7B	33048758	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.646000	0.83445	2.387000	0.81309	0.462000	0.41574	GCA			0.741	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000078833.2		NM_020884	
SLC9A8	23315	broad.mit.edu	37	20	48479536	48479536	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr20:48479536G>T	ENST00000361573.2	+	9	826	c.784G>T	c.(784-786)Gac>Tac	p.D262Y	SLC9A8_ENST00000539601.1_Missense_Mutation_p.D43Y|SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000417961.1_Missense_Mutation_p.D278Y			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	262					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			ACAAGCCCTTGACTACTTCCT	0.383																																					p.D278Y													.	SLC9A8	63		0			c.G832T												98.0	93.0	95.0					20																	48479536		2203	4300	6503	SO:0001583	missense	23315	exon9			GCCCTTGACTACT	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.784G>T	20.37:g.48479536G>T	ENSP00000354966:p.Asp262Tyr		129	0	0		171	0.03	5	NM_001260491	12	0.00	0	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	ENST00000361573.2	37	CCDS13421.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169291	0.57584	.	.	ENSG00000197818	ENST00000417961;ENST00000361573;ENST00000539601	T;T;T	0.15139	2.45;2.45;2.45	5.32	5.32	0.75619	Cation/H+ exchanger (1);	0.273881	0.39909	N	0.001223	T	0.10594	0.0259	N	0.03608	-0.345	0.80722	D	1	B	0.19935	0.04	B	0.18263	0.021	T	0.20505	-1.0273	10	0.66056	D	0.02	.	19.0024	0.92839	0.0:0.0:1.0:0.0	.	262	Q9Y2E8	SL9A8_HUMAN	Y	278;262;43	ENSP00000416418:D278Y;ENSP00000354966:D262Y;ENSP00000441716:D43Y	ENSP00000354966:D262Y	D	+	1	0	SLC9A8	47912943	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.454000	0.80714	2.462000	0.83206	0.655000	0.94253	GAC			0.383	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106483.3		XM_030524	
RBBP8NL	140893	mdanderson.org	37	20	60987688	60987688	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr20:60987688C>T	ENST00000252998.1	-	13	2024	c.1868G>A	c.(1867-1869)gGg>gAg	p.G623E		NM_080833.2	NP_543023.2	Q8NC74	RB8NL_HUMAN	RBBP8 N-terminal like	623						extracellular space (GO:0005615)											ACCTTTGTCCCCAGGCTCCGA	0.692																																					p.G623E													.	.			0			c.G1868A												68.0	72.0	71.0					20																	60987688		2203	4300	6503	SO:0001583	missense	140893	exon13			TTGTCCCCAGGCT	AL121832	CCDS13498.1	20q13.33	2012-10-30	2012-10-30	2012-10-30	ENSG00000130701	ENSG00000130701			16144	protein-coding gene	gene with protein product	"""hypothetical protein LOC140893"""		"""chromosome 20 open reading frame 151"""	C20orf151		11780052	Standard	NM_080833		Approved	dJ908M14.3	uc002ycw.2	Q8NC74	OTTHUMG00000032913	ENST00000252998.1:c.1868G>A	20.37:g.60987688C>T	ENSP00000252998:p.Gly623Glu		42	0	0		37	0.08	3	NM_080833	0		0	B2RP98|Q8N4Z9|Q9BR75|Q9H0Y9	Missense_Mutation	SNP	ENST00000252998.1	37	CCDS13498.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.488177	0.01018	.	.	ENSG00000130701	ENST00000252998	T	0.16073	2.37	3.52	-1.3	0.09259	.	1.909040	0.02494	N	0.089730	T	0.08044	0.0201	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23084	-1.0198	10	0.15952	T	0.53	0.02	4.1761	0.10353	0.0:0.5036:0.1753:0.3211	.	623	Q8NC74	CT151_HUMAN	E	623	ENSP00000252998:G623E	ENSP00000252998:G623E	G	-	2	0	C20orf151	60421083	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.712000	0.05013	-0.354000	0.08212	-0.658000	0.03865	GGG			0.692	RBBP8NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080029.1		NM_080833	
IFNAR1	3454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34715721	34715721	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr21:34715721G>A	ENST00000270139.3	+	4	676	c.524G>A	c.(523-525)gGt>gAt	p.G175D	IFNAR1_ENST00000442357.2_Missense_Mutation_p.G175D|IFNAR1_ENST00000416947.2_Missense_Mutation_p.G106D	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	175	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	AACTCTTCAGGTGTAGAAGTA	0.318																																					p.G175D	Esophageal Squamous(73;817 1211 32990 35667 42746)												.	.			0			c.G524A												124.0	132.0	129.0					21																	34715721		2203	4300	6503	SO:0001583	missense	3454	exon4			CTTCAGGTGTAGA		CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.524G>A	21.37:g.34715721G>A	ENSP00000270139:p.Gly175Asp		92	0	0		108	0.27	29	NM_000629	75	0.21	16	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	ENST00000270139.3	37	CCDS13624.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.837882	0.32513	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	T;T;T	0.28069	1.63;1.63;1.63	5.86	0.91	0.19337	Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	1.083630	0.06820	N	0.792114	T	0.09905	0.0243	N	0.03608	-0.345	0.09310	N	1	P	0.36483	0.555	B	0.24269	0.052	T	0.15954	-1.0419	10	0.13108	T	0.6	0.2848	5.4926	0.16785	0.3095:0.1332:0.5572:0.0	.	175	P17181	INAR1_HUMAN	D	106;175;175	ENSP00000395606:G106D;ENSP00000270139:G175D;ENSP00000407406:G175D	ENSP00000270139:G175D	G	+	2	0	IFNAR1	33637591	0.000000	0.05858	0.000000	0.03702	0.284000	0.27059	-0.013000	0.12678	0.107000	0.17824	0.650000	0.86243	GGT			0.318	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000139823.4			
OSBP2	23762	mdanderson.org	37	22	31266595	31266595	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr22:31266595G>T	ENST00000332585.6	+	3	1137	c.1033G>T	c.(1033-1035)Gag>Tag	p.E345*	OSBP2_ENST00000401475.1_5'UTR|OSBP2_ENST00000437268.2_Nonsense_Mutation_p.E87*|OSBP2_ENST00000382310.3_Nonsense_Mutation_p.E345*|OSBP2_ENST00000407373.1_Nonsense_Mutation_p.E172*|OSBP2_ENST00000446658.2_Nonsense_Mutation_p.E345*|OSBP2_ENST00000403222.3_Nonsense_Mutation_p.E180*	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	345					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						GATCCCATCTGAGAGTGGGGA	0.592																																					p.E345X													.	.			0			c.G1033T												53.0	61.0	59.0					22																	31266595		2131	4230	6361	SO:0001587	stop_gained	23762	exon3			CCATCTGAGAGTG		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.1033G>T	22.37:g.31266595G>T	ENSP00000332576:p.Glu345*		59	0	0		72	0.06	4	NM_030758	2	0.00	0	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Nonsense_Mutation	SNP	ENST00000332585.6	37	CCDS43002.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098042	0.76870	.	.	ENSG00000184792	ENST00000403222;ENST00000407373;ENST00000332585;ENST00000382310;ENST00000446658;ENST00000437268	.	.	.	4.64	4.64	0.57946	.	0.068540	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-35.7993	17.3175	0.87228	0.0:0.0:1.0:0.0	.	.	.	.	X	180;172;345;345;345;87	.	ENSP00000332576:E345X	E	+	1	0	OSBP2	29596595	1.000000	0.71417	0.055000	0.19348	0.907000	0.53573	9.366000	0.97143	2.419000	0.82065	0.655000	0.94253	GAG			0.592	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000321547.2		NM_030758	
SFI1	9814	mdanderson.org	37	22	32009152	32009152	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr22:32009152C>T	ENST00000400288.2	+	25	2620	c.2515C>T	c.(2515-2517)Cgg>Tgg	p.R839W	SFI1_ENST00000400289.1_Missense_Mutation_p.R757W|SFI1_ENST00000443011.1_Missense_Mutation_p.R686W|SFI1_ENST00000443326.1_Missense_Mutation_p.R757W|SFI1_ENST00000540643.1_Missense_Mutation_p.R784W|SFI1_ENST00000432498.1_Missense_Mutation_p.R808W|SFI1_ENST00000414585.1_Missense_Mutation_p.R686W	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	839					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GCAGGAGCAGCGGGCGACAGT	0.632																																					p.R839W													.	.			0			c.C2515T												36.0	45.0	42.0					22																	32009152		2111	4255	6366	SO:0001583	missense	9814	exon25			GAGCAGCGGGCGA	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2515C>T	22.37:g.32009152C>T	ENSP00000383145:p.Arg839Trp		28	0	0		33	0.09	3	NM_001007467	29	0.00	0	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	37	CCDS43004.1	.	.	.	.	.	.	.	.	.	.	C	9.200	1.028270	0.19512	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.15017	3.03;3.03;2.86;2.86;2.87;2.86;3.03;2.46	5.62	2.23	0.28157	.	0.644955	0.16732	N	0.201803	T	0.10423	0.0255	N	0.08118	0	0.22701	N	0.998835	B;D;B;B;D	0.64830	0.003;0.994;0.0;0.003;0.987	B;P;B;B;B	0.50049	0.001;0.629;0.001;0.001;0.401	T	0.12863	-1.0531	10	0.32370	T	0.25	.	5.34	0.15979	0.161:0.6653:0.0:0.1737	.	784;745;757;808;839	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3	.;.;.;.;SFI1_HUMAN	W	808;784;757;686;686;757;839;422	ENSP00000402679:R808W;ENSP00000443025:R784W;ENSP00000416469:R757W;ENSP00000397148:R686W;ENSP00000401199:R686W;ENSP00000383146:R757W;ENSP00000383145:R839W;ENSP00000398871:R422W	ENSP00000383145:R839W	R	+	1	2	SFI1	30339152	0.730000	0.28100	0.656000	0.29637	0.110000	0.19582	0.902000	0.28459	0.726000	0.32339	-0.222000	0.12452	CGG			0.632	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337180.3		NM_014775	
HCLS1	3059	broad.mit.edu	37	3	121366225	121366225	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr3:121366225G>T	ENST00000314583.3	-	4	320	c.229C>A	c.(229-231)Ccc>Acc	p.P77T	HCLS1_ENST00000428394.2_Missense_Mutation_p.P77T	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	77					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		GATGCTTTGGGCCCTGACTCC	0.458																																					p.P77T													.	HCLS1	78		0			c.C229A												209.0	200.0	203.0					3																	121366225		2203	4300	6503	SO:0001583	missense	3059	exon4			CTTTGGGCCCTGA		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.229C>A	3.37:g.121366225G>T	ENSP00000320176:p.Pro77Thr		259	0	0		253	0.02	5	NM_005335	112	0.00	0	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	ENST00000314583.3	37	CCDS3003.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.733648	0.89482	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	T;T	0.21543	2.01;2.0	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.54143	0.1840	M	0.89287	3.02	0.80722	D	1	P;D;D	0.89917	0.884;1.0;1.0	P;D;D	0.85130	0.465;0.997;0.982	T	0.56691	-0.7937	10	0.49607	T	0.09	-11.8173	17.243	0.87019	0.0:0.0:1.0:0.0	.	77;77;77	B4DTP2;E7EVW7;P14317	.;.;HCLS1_HUMAN	T	77	ENSP00000320176:P77T;ENSP00000387645:P77T	ENSP00000320176:P77T	P	-	1	0	HCLS1	122848915	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.592000	0.90828	2.937000	0.99478	0.650000	0.86243	CCC			0.458	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355144.1		NM_005335	
IGSF10	285313	mdanderson.org	37	3	151164540	151164540	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr3:151164540C>T	ENST00000282466.3	-	4	3228	c.3229G>A	c.(3229-3231)Gca>Aca	p.A1077T		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1077					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GACAATGCTGCTGTGGCAGTG	0.498																																					p.A1077T													.	.			0			c.G3229A												121.0	123.0	122.0					3																	151164540		2203	4300	6503	SO:0001583	missense	285313	exon4			ATGCTGCTGTGGC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3229G>A	3.37:g.151164540C>T	ENSP00000282466:p.Ala1077Thr		50	0	0		51	0.06	3	NM_178822	1	0.00	0	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	6.475	0.455850	0.12283	.	.	ENSG00000152580	ENST00000282466	T	0.68479	-0.33	5.46	-1.55	0.08558	.	0.918426	0.09007	N	0.862051	T	0.41166	0.1147	N	0.14661	0.345	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.22591	-1.0212	10	0.13470	T	0.59	.	5.1664	0.15088	0.1943:0.4046:0.0:0.4011	.	1077	Q6WRI0	IGS10_HUMAN	T	1077	ENSP00000282466:A1077T	ENSP00000282466:A1077T	A	-	1	0	IGSF10	152647230	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.530000	0.06179	0.003000	0.14656	-0.229000	0.12294	GCA			0.498	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357782.1		NM_178822	
CHRD	8646	broad.mit.edu	37	3	184101396	184101396	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr3:184101396G>T	ENST00000204604.1	+	12	1652	c.1406G>T	c.(1405-1407)tGc>tTc	p.C469F	CHRD_ENST00000545352.1_Missense_Mutation_p.C99F|CHRD_ENST00000348986.3_Intron|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000450923.1_Missense_Mutation_p.C469F	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	469	CHRD 3. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACTGTCCTGTGCCACATGGCT	0.627																																					p.C469F													.	CHRD	149		0			c.G1406T												79.0	62.0	68.0					3																	184101396		2203	4300	6503	SO:0001583	missense	8646	exon12			TCCTGTGCCACAT	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1406G>T	3.37:g.184101396G>T	ENSP00000204604:p.Cys469Phe		132	0.0075757576	1		119	0.05	6	NM_003741	9	0.00	0	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.543854	0.00934	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000545352;ENST00000342610	T;T;T	0.39229	1.09;1.09;1.09	4.18	4.18	0.49190	CHRD (3);	0.128095	0.56097	D	0.000029	T	0.17408	0.0418	N	0.04203	-0.255	0.35961	D	0.834637	B;B;B	0.19583	0.003;0.003;0.037	B;B;B	0.26094	0.014;0.066;0.047	T	0.19353	-1.0308	10	0.10111	T	0.7	-11.0927	5.6407	0.17562	0.1027:0.0:0.7009:0.1964	.	99;469;469	B7Z6F4;E7ESX1;Q9H2X0	.;.;CHRD_HUMAN	F	469;469;99;182	ENSP00000204604:C469F;ENSP00000408972:C469F;ENSP00000442948:C99F	ENSP00000204604:C469F	C	+	2	0	CHRD	185584090	1.000000	0.71417	1.000000	0.80357	0.204000	0.24138	3.358000	0.52284	2.039000	0.60335	0.313000	0.20887	TGC			0.627	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000280432.1		NM_003741	
ANKRD50	57182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	125599937	125599937	+	Silent	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr4:125599937C>T	ENST00000504087.1	-	3	1673	c.636G>A	c.(634-636)ggG>ggA	p.G212G	ANKRD50_ENST00000515641.1_Silent_p.G33G	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	212										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CTGCAACAGTCCCAGATAAGC	0.453																																					p.G212G													.	.			0			c.G636A												201.0	196.0	198.0					4																	125599937		2203	4300	6503	SO:0001819	synonymous_variant	57182	exon3			AACAGTCCCAGAT	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.636G>A	4.37:g.125599937C>T			151	0	0		148	0.24	36	NM_020337	11	0.36	4	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Silent	SNP	ENST00000504087.1	37	CCDS34060.1																																																																																					0.453	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364775.1		NM_020337	
ACSL1	2180	broad.mit.edu	37	4	185701510	185701510	+	Silent	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr4:185701510G>T	ENST00000515030.1	-	5	778	c.453C>A	c.(451-453)ggC>ggA	p.G151G	ACSL1_ENST00000504900.1_Silent_p.G151G|ACSL1_ENST00000281455.2_Silent_p.G151G|ACSL1_ENST00000437665.3_5'UTR|ACSL1_ENST00000454703.2_5'UTR|ACSL1_ENST00000504342.1_Silent_p.G151G|ACSL1_ENST00000513317.1_Silent_p.G151G|ACSL1_ENST00000507295.1_Intron			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	151					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GAGCAAAGATGCCAATGAACT	0.438																																					p.G151G													.	ACSL1	77		0			c.C453A												142.0	147.0	145.0					4																	185701510		2203	4300	6503	SO:0001819	synonymous_variant	2180	exon5			AAAGATGCCAATG	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.453C>A	4.37:g.185701510G>T			95	0	0		100	0.05	5	NM_001995	20	0.00	0	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Silent	SNP	ENST00000515030.1	37	CCDS3839.1																																																																																					0.438	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361112.2		NM_001995	
TRIO	7204	mdanderson.org	37	5	14488050	14488050	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr5:14488050G>T	ENST00000344204.4	+	48	7337	c.7313G>T	c.(7312-7314)cGc>cTc	p.R2438L	TRIO_ENST00000344135.5_5'Flank|TRIO_ENST00000537187.1_Intron	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2438					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					AAGGACGCGCGCGCTAGCCTG	0.726																																					p.R2438L													.	.			0			c.G7313T												2.0	3.0	3.0					5																	14488050		1589	3362	4951	SO:0001583	missense	7204	exon48			ACGCGCGCGCTAG	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.7313G>T	5.37:g.14488050G>T	ENSP00000339299:p.Arg2438Leu		34	0	0		27	0.07	2	NM_007118	12	0.00	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478357	0.44044	.	.	ENSG00000038382	ENST00000344204;ENST00000513206	T;T	0.64991	-0.13;0.12	4.75	4.75	0.60458	.	0.359711	0.28821	N	0.014021	T	0.51261	0.1664	L	0.32530	0.975	0.49582	D	0.999803	B;P	0.40602	0.248;0.723	B;B	0.38156	0.074;0.266	T	0.50101	-0.8867	10	0.25106	T	0.35	.	15.9225	0.79586	0.0:0.0:1.0:0.0	.	2438;2438	O75962-5;O75962	.;TRIO_HUMAN	L	2438;2125	ENSP00000339299:R2438L;ENSP00000426342:R2125L	ENSP00000339299:R2438L	R	+	2	0	TRIO	14541050	0.989000	0.36119	0.082000	0.20525	0.024000	0.10985	5.026000	0.64103	2.168000	0.68352	0.455000	0.32223	CGC			0.726	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253711.2		NM_007118	
IPO11	51194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	61772516	61772516	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr5:61772516G>A	ENST00000325324.6	+	9	933	c.764G>A	c.(763-765)aGt>aAt	p.S255N	IPO11_ENST00000409296.3_Missense_Mutation_p.S295N|KIF2A_ENST00000509663.2_Intron	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11	255					ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ACAGGTAGAAGTATAGGTACA	0.249																																					p.S295N													.	.			0			c.G884A												62.0	69.0	67.0					5																	61772516		2187	4270	6457	SO:0001583	missense	51194	exon9			GTAGAAGTATAGG	AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.764G>A	5.37:g.61772516G>A	ENSP00000316651:p.Ser255Asn		712	0	0		552	0.33	180	NM_001134779	26	0.31	8	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Missense_Mutation	SNP	ENST00000325324.6	37	CCDS34167.1	.	.	.	.	.	.	.	.	.	.	G	6.649	0.488227	0.12641	.	.	ENSG00000086200	ENST00000325324;ENST00000409296	T;T	0.66995	-0.24;-0.24	5.55	-3.05	0.05396	Armadillo-like helical (1);Armadillo-type fold (1);	0.570333	0.21099	N	0.080186	T	0.37019	0.0988	N	0.03154	-0.405	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.09271	-1.0682	10	0.16896	T	0.51	.	13.8652	0.63583	0.565:0.0:0.435:0.0	.	295;255	Q9UI26-2;Q9UI26	.;IPO11_HUMAN	N	255;295	ENSP00000316651:S255N;ENSP00000386992:S295N	ENSP00000316651:S255N	S	+	2	0	IPO11	61808273	0.920000	0.31207	0.882000	0.34594	0.991000	0.79684	-0.018000	0.12568	-1.099000	0.03034	-0.459000	0.05422	AGT			0.249	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335062.1		NM_016338	
PCDH12	51294	broad.mit.edu	37	5	141335641	141335641	+	Silent	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr5:141335641G>T	ENST00000231484.3	-	1	2986	c.1776C>A	c.(1774-1776)atC>atA	p.I592I	PCDH12_ENST00000512221.1_5'Flank|AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	592					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGAGTCTCGATGGGCACCA	0.592																																					p.I592I													.	PCDH12	133		0			c.C1776A												51.0	47.0	48.0					5																	141335641		2203	4300	6503	SO:0001819	synonymous_variant	51294	exon1			AGTCTCGATGGGC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1776C>A	5.37:g.141335641G>T			64	0	0		66	0.05	3	NM_016580	13	0.00	0	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	37	CCDS4269.1																																																																																					0.592	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251858.1		NM_016580	
DEK	7913	mdanderson.org	37	6	18258233	18258233	+	Missense_Mutation	SNP	G	G	T	rs200796384		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:18258233G>T	ENST00000397239.3	-	4	755	c.308C>A	c.(307-309)aCc>aAc	p.T103N	DEK_ENST00000244776.7_Missense_Mutation_p.T69N	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	103					chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			AAGTTCATCGGTTTTCTTCTT	0.338			T	NUP214	AML																																p.T103N				Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	DEK,caecum,carcinoma,+1,1	DEK	1	1	0			c.C308A												110.0	107.0	108.0					6																	18258233		2203	4299	6502	SO:0001583	missense	7913	exon4			TCATCGGTTTTCT	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.308C>A	6.37:g.18258233G>T	ENSP00000380414:p.Thr103Asn		95	0.0105263158	1		83	0.05	4	NM_003472	296	0.01	2	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.915671	0.33815	.	.	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000503715;ENST00000515742	T;T;T;T	0.45276	0.94;0.9;0.92;0.93	6.08	5.21	0.72293	.	0.358828	0.35555	N	0.003131	T	0.14013	0.0339	L	0.29908	0.895	0.25546	N	0.987138	B;B	0.22211	0.066;0.066	B;B	0.29267	0.1;0.1	T	0.15521	-1.0434	10	0.17369	T	0.5	-13.4012	10.6678	0.45741	0.0685:0.1322:0.7993:0.0	.	69;103	B4DN37;P35659	.;DEK_HUMAN	N	103;69;36;108	ENSP00000380414:T103N;ENSP00000244776:T69N;ENSP00000425399:T36N;ENSP00000423553:T108N	ENSP00000244776:T69N	T	-	2	0	DEK	18366212	1.000000	0.71417	0.896000	0.35187	0.890000	0.51754	3.850000	0.55918	1.579000	0.49836	0.591000	0.81541	ACC			0.338	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039962.4			
NFKBIL1	4795	broad.mit.edu;mdanderson.org	37	6	31526067	31526067	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:31526067G>T	ENST00000376148.4	+	4	939	c.825G>T	c.(823-825)aaG>aaT	p.K275N	NFKBIL1_ENST00000376145.4_Missense_Mutation_p.K260N	NM_005007.3	NP_004998.3	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1	275					cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of transcription factor (GO:0042994)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)	cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						GAGAACCCAAGCCAACCAGGG	0.706																																					p.K275N													.	NFKBIL1	17		0			c.G825T												11.0	10.0	10.0					6																	31526067		1491	2700	4191	SO:0001583	missense	4795	exon4			ACCCAAGCCAACC	X77909	CCDS4700.1, CCDS47399.1, CCDS47400.1	6p21.3	2010-02-17			ENSG00000204498	ENSG00000204498			7800	protein-coding gene	gene with protein product		601022		NFKBIL		8081366	Standard	NM_005007		Approved	IKBL	uc003nub.3	Q9UBC1	OTTHUMG00000031038	ENST00000376148.4:c.825G>T	6.37:g.31526067G>T	ENSP00000365318:p.Lys275Asn		63	0	0		59	0.07	4	NM_005007	133	0.00	0	A6NL91|B4DUW1|Q14625|Q5HYU4|Q5RJ72|Q5ST96|Q5STV4|Q5STV5|Q9UBX4	Missense_Mutation	SNP	ENST00000376148.4	37	CCDS4700.1	.	.	.	.	.	.	.	.	.	.	G	1.689	-0.504468	0.04261	.	.	ENSG00000204498	ENST00000376146;ENST00000376148;ENST00000376145	T;T;T	0.30182	1.54;1.54;1.54	5.06	3.21	0.36854	.	0.324996	0.29572	N	0.011766	T	0.05731	0.0150	N	0.14661	0.345	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.11329	0.006;0.004;0.004	T	0.28202	-1.0051	10	0.30078	T	0.28	-6.2197	6.3959	0.21613	0.1001:0.1989:0.701:0.0	.	252;260;275	Q5STV6;Q5STV4;Q9UBC1	.;.;IKBL1_HUMAN	N	252;275;260	ENSP00000365316:K252N;ENSP00000365318:K275N;ENSP00000365315:K260N	ENSP00000365315:K260N	K	+	3	2	NFKBIL1	31634046	0.001000	0.12720	0.277000	0.24703	0.266000	0.26442	0.594000	0.24014	1.364000	0.46038	-0.244000	0.11960	AAG			0.706	NFKBIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076036.3		NM_005007	
COL21A1	81578	hgsc.bcm.edu	37	6	56141616	56141616	+	Intron	SNP	T	T	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:56141616T>G	ENST00000370819.1	-	2	124							Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ttttttttgttttttttttga	0.443																																					.													.	.			0			.																																									SO:0001627	intron_variant	100873774	.			TTTTGTTTTTTTT	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000370819.1:c.38-94162A>C	6.37:g.56141616T>G			59	0	0		51	0.10	5	.	0		0	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	RNA	SNP	ENST00000370819.1	37																																																																																						0.443	COL21A1-002	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000041005.1			
RIMS1	22999	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	72892035	72892035	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:72892035G>T	ENST00000521978.1	+	6	861	c.861G>T	c.(859-861)aaG>aaT	p.K287N	RIMS1_ENST00000522291.1_Missense_Mutation_p.K287N|RIMS1_ENST00000520567.1_Missense_Mutation_p.K287N|RIMS1_ENST00000491071.2_Missense_Mutation_p.K287N|RIMS1_ENST00000264839.7_Missense_Mutation_p.K287N|RIMS1_ENST00000348717.5_Missense_Mutation_p.K287N|RIMS1_ENST00000517960.1_Missense_Mutation_p.K287N|RIMS1_ENST00000518273.1_Missense_Mutation_p.K287N	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	287					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GAGCCCTGAAGAGCGAGCGGA	0.537																																					p.K287N													.	RIMS1	278		0			c.G861T												34.0	40.0	38.0					6																	72892035		1866	4108	5974	SO:0001583	missense	0	exon6			CCTGAAGAGCGAG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.861G>T	6.37:g.72892035G>T	ENSP00000428417:p.Lys287Asn		370	0.0027027027	1		302	0.10	31	NM_014989	0		0	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909395	0.52439	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.14640	2.49;2.65;2.56;2.65;2.65;2.63;2.63;2.56	5.28	4.29	0.51040	.	0.000000	0.64402	D	0.000006	T	0.11281	0.0275	L	0.46157	1.445	0.80722	D	1	D	0.61697	0.99	P	0.53102	0.718	T	0.00992	-1.1488	10	0.66056	D	0.02	-12.9912	7.0747	0.25197	0.2686:0.0:0.7314:0.0	.	287	Q86UR5	RIMS1_HUMAN	N	287	ENSP00000430101:K287N;ENSP00000275037:K287N;ENSP00000264839:K287N;ENSP00000429959:K287N;ENSP00000430408:K287N;ENSP00000430502:K287N;ENSP00000430932:K287N;ENSP00000428417:K287N	ENSP00000264839:K287N	K	+	3	2	RIMS1	72948756	1.000000	0.71417	0.771000	0.31576	0.385000	0.30292	1.677000	0.37576	2.478000	0.83669	0.462000	0.41574	AAG			0.537	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374968.1			
AK9	221264	broad.mit.edu	37	6	109867322	109867322	+	Silent	SNP	T	T	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:109867322T>G	ENST00000424296.2	-	26	3049	c.2973A>C	c.(2971-2973)ccA>ccC	p.P991P	AK9_ENST00000355283.1_Silent_p.P70P|AK9_ENST00000341338.6_Silent_p.P70P	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	991					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										ATATTCTTAATGGAGGAGCCT	0.438																																					p.P991P													.	AKD1	223		0			c.A2973C												55.0	67.0	63.0					6																	109867322		2167	4289	6456	SO:0001819	synonymous_variant	221264	exon26			TCTTAATGGAGGA	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.2973A>C	6.37:g.109867322T>G			107	0.046728972	5		83	0.08	7	NM_001145128	0		0	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Silent	SNP	ENST00000424296.2	37	CCDS55048.1																																																																																					0.438	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001145128	
FNDC1	84624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	159653823	159653823	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:159653823G>A	ENST00000297267.9	+	11	2479	c.2279G>A	c.(2278-2280)cGg>cAg	p.R760Q	FNDC1_ENST00000340366.6_Missense_Mutation_p.R697Q	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	760	Ser-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCGCCATCACGGTCCACCATG	0.622																																					p.R760Q													FNDC1,colon,carcinoma,0,3	FNDC1	0	3	0			c.G2279A												42.0	45.0	44.0					6																	159653823		2152	4247	6399	SO:0001583	missense	84624	exon11			CATCACGGTCCAC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2279G>A	6.37:g.159653823G>A	ENSP00000297267:p.Arg760Gln		75	0	0		56	0.13	7	NM_032532	15	0.07	1	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	G	4.858	0.159432	0.09236	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.06294	3.32;4.13	4.91	-7.5	0.01351	.	2.365130	0.01397	N	0.013445	T	0.00875	0.0029	N	0.05124	-0.11	0.09310	N	1	B;B	0.14438	0.006;0.01	B;B	0.06405	0.002;0.001	T	0.35450	-0.9788	10	0.09338	T	0.73	0.401	16.0734	0.80951	0.8556:0.0:0.1444:0.0	.	697;760	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	Q	760;697	ENSP00000297267:R760Q;ENSP00000342460:R697Q	ENSP00000297267:R760Q	R	+	2	0	FNDC1	159573813	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.943000	0.03917	-1.618000	0.01568	-0.140000	0.14226	CGG			0.622	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042897.3		NM_032532	
DLL1	28514	mdanderson.org	37	6	170593060	170593060	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr6:170593060G>A	ENST00000366756.3	-	9	1640	c.1307C>T	c.(1306-1308)tCg>tTg	p.S436L		NM_005618.3	NP_005609.3	O00548	DLL1_HUMAN	delta-like 1 (Drosophila)	436	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|cell-cell signaling (GO:0007267)|compartment pattern specification (GO:0007386)|determination of left/right symmetry (GO:0007368)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|inner ear development (GO:0048839)|left/right axis specification (GO:0070986)|loop of Henle development (GO:0072070)|negative regulation of auditory receptor cell differentiation (GO:0045608)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of myeloid cell differentiation (GO:0045638)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|regulation of cell adhesion (GO:0030155)|somite specification (GO:0001757)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|Notch binding (GO:0005112)			NS(2)|breast(1)|endometrium(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	33		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		GTGCCTCCCCGAGAAGCCGGC	0.642																																					p.S436L													.	.			0			c.C1307T																																									SO:0001583	missense	28514	exon9			CTCCCCGAGAAGC	AF003522	CCDS5313.1	6q13-q22.33	2008-07-28	2001-12-03		ENSG00000198719	ENSG00000198719			2908	protein-coding gene	gene with protein product		606582	"""delta (Drosophila)-like 1"""				Standard	NM_005618		Approved		uc003qxm.3	O00548	OTTHUMG00000016078	ENST00000366756.3:c.1307C>T	6.37:g.170593060G>A	ENSP00000355718:p.Ser436Leu		24	0.0416666667	1		15	0.13	2	NM_005618	9	0.00	0	B2RAK7|B5M0B3|Q9NU41|Q9UJV2	Missense_Mutation	SNP	ENST00000366756.3	37	CCDS5313.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437076	0.43224	.	.	ENSG00000198719	ENST00000366756	T	0.54866	0.55	5.5	5.5	0.81552	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.281064	0.37393	N	0.002117	T	0.51483	0.1677	L	0.61218	1.895	0.45239	D	0.99824	P	0.52463	0.953	P	0.47251	0.542	T	0.57734	-0.7760	10	0.62326	D	0.03	.	19.3883	0.94566	0.0:0.0:1.0:0.0	.	436	O00548	DLL1_HUMAN	L	436	ENSP00000355718:S436L	ENSP00000355718:S436L	S	-	2	0	DLL1	170434985	1.000000	0.71417	0.909000	0.35828	0.268000	0.26511	6.570000	0.73996	2.593000	0.87608	0.655000	0.94253	TCG			0.642	DLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043254.1			
GPR146	115330	mdanderson.org	37	7	1097335	1097335	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr7:1097335C>T	ENST00000397095.1	+	2	407	c.184C>T	c.(184-186)Ccg>Tcg	p.P62S	GPR146_ENST00000297468.3_Missense_Mutation_p.P62S|C7orf50_ENST00000397100.2_Intron|C7orf50_ENST00000357429.6_Intron|C7orf50_ENST00000397098.3_Intron|RP11-449P15.1_ENST00000549241.1_RNA|C7orf50_ENST00000488073.1_Intron			Q96CH1	GP146_HUMAN	G protein-coupled receptor 146	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|ovary(1)|skin(1)	8		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CATGACCATGCCGGACGTGTA	0.677																																					p.P62S													.	.			0			c.C184T												50.0	39.0	43.0					7																	1097335		2201	4300	6501	SO:0001583	missense	115330	exon1			ACCATGCCGGACG	BC014241	CCDS5321.1	7p22.3	2012-08-21			ENSG00000164849	ENSG00000164849		"""GPCR / Class A : Orphans"""	21718	protein-coding gene	gene with protein product							Standard	NM_138445		Approved	PGR8	uc003sjy.1	Q96CH1	OTTHUMG00000023934	ENST00000397095.1:c.184C>T	7.37:g.1097335C>T	ENSP00000380283:p.Pro62Ser		35	0	0		43	0.07	3	NM_138445	3	0.00	0	Q86SP5	Missense_Mutation	SNP	ENST00000397095.1	37	CCDS5321.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.612511	0.66672	.	.	ENSG00000164849	ENST00000444847;ENST00000397095;ENST00000297468	T;T;T	0.35789	1.29;1.29;1.29	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.38824	-0.9643	10	0.31617	T	0.26	-33.611	17.4705	0.87645	0.0:1.0:0.0:0.0	.	62	Q96CH1	GP146_HUMAN	S	62	ENSP00000410743:P62S;ENSP00000380283:P62S;ENSP00000297468:P62S	ENSP00000297468:P62S	P	+	1	0	GPR146	1063861	1.000000	0.71417	0.995000	0.50966	0.933000	0.57130	7.217000	0.77982	2.387000	0.81309	0.561000	0.74099	CCG			0.677	GPR146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206855.1		NM_138445	
HOXA13	3209	mdanderson.org	37	7	27238794	27238794	+	Silent	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr7:27238794G>T	ENST00000222753.4	-	1	931	c.903C>A	c.(901-903)ctC>ctA	p.L301L	HOTTIP_ENST00000472494.1_RNA|HOTTIP_ENST00000421733.1_RNA|HOTTIP_ENST00000605136.1_RNA|HOTTIP_ENST00000521028.2_RNA	NM_000522.4	NP_000513.2	P31271	HXA13_HUMAN	homeobox A13	301					artery morphogenesis (GO:0048844)|branching involved in prostate gland morphogenesis (GO:0060442)|embryonic forelimb morphogenesis (GO:0035115)|endothelial cell fate specification (GO:0060847)|endothelial cell morphogenesis (GO:0001886)|inner ear development (GO:0048839)|male genitalia development (GO:0030539)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of BMP signaling pathway (GO:0030510)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|ventricular septum development (GO:0003281)	intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	6						TGGACTTCCAGAGGTGGGGAG	0.637			T	NUP98	AML																																p.L301L				Dom	yes		7	7p15-p14.2	3209	homeo box A13		L	.	.			0			c.C903A												59.0	59.0	59.0					7																	27238794		2203	4300	6503	SO:0001819	synonymous_variant	3209	exon1			CTTCCAGAGGTGG		CCDS5412.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106031	ENSG00000106031		"""Homeoboxes / ANTP class : HOXL subclass"""	5102	protein-coding gene	gene with protein product		142959	"""homeo box A13"""	HOX1J, HOX1		1973146, 1358459	Standard	NM_000522		Approved		uc003szb.1	P31271	OTTHUMG00000023438	ENST00000222753.4:c.903C>A	7.37:g.27238794G>T			28	0	0		37	0.08	3	NM_000522	21	0.00	0	A4D188|O43371	Silent	SNP	ENST00000222753.4	37	CCDS5412.1																																																																																					0.637	HOXA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358752.3			
ZAN	7455	broad.mit.edu	37	7	100349991	100349991	+	RNA	SNP	T	T	C	rs560599163	byFrequency	TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr7:100349991T>C	ENST00000348028.3	+	0	2428				ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S755P(5)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCCACCATCTCCCCAGAAAA	0.517													t|||	35	0.00698882	0.0038	0.0101	5008	,	,		14901	0.005		0.0129	False		,,,				2504	0.0051				.													ZAN_ENST00000542585,NS,carcinoma,0,5	ZAN	658	5	5	Substitution - Missense(5)	endometrium(4)|NS(1)	.												122.0	136.0	131.0					7																	100349991		1816	4060	5876			7455	.			ACCATCTCCCCAG	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349991T>C			100	0.03	3		124	0.10	12	.	1	0.00	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	t	5.435	0.265377	0.10294	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.63255	-0.03;0.11;-0.03	4.24	0.21	0.15231	.	.	.	.	.	T	0.29716	0.0742	N	0.01140	-0.99	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20571	-1.0271	9	0.33940	T	0.23	.	7.9077	0.29771	0.0:0.5221:0.0:0.4779	.	755;755	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	755	ENSP00000445943:S755P;ENSP00000445091:S755P;ENSP00000444427:S755P	ENSP00000423579:S755P	S	+	1	0	ZAN	100187927	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.770000	0.00371	-0.086000	0.12550	-0.766000	0.03442	TCC			0.517	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
ADAM32	203102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	39079164	39079164	+	Silent	SNP	T	T	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr8:39079164T>G	ENST00000379907.4	+	13	1396	c.1269T>G	c.(1267-1269)acT>acG	p.T423T	ADAM32_ENST00000437682.2_Silent_p.T324T|ADAM32_ENST00000519315.1_Silent_p.T317T	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	423	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			ATTTTCGAACTTGTGTACTGA	0.323																																					p.T423T													.	.			0			c.T1269G												136.0	126.0	129.0					8																	39079164		1882	4109	5991	SO:0001819	synonymous_variant	203102	exon13			TCGAACTTGTGTA	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1269T>G	8.37:g.39079164T>G			67	0	0		125	0.28	35	NM_145004	0		0	Q8TC42	Silent	SNP	ENST00000379907.4	37	CCDS47846.1																																																																																					0.323	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377089.1		NM_145004	
FRMPD1	22844	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	37746248	37746248	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr9:37746248G>A	ENST00000539465.1	+	16	4812	c.4219G>A	c.(4219-4221)Gca>Aca	p.A1407T	FRMPD1_ENST00000377765.3_Missense_Mutation_p.A1407T|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1407						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CTGCTCCAGGGCACTGAGACA	0.597																																					p.A1407T													.	FRMPD1	237		0			c.G4219A												19.0	22.0	21.0					9																	37746248		2194	4290	6484	SO:0001583	missense	22844	exon16			TCCAGGGCACTGA	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4219G>A	9.37:g.37746248G>A	ENSP00000444411:p.Ala1407Thr		32	0	0		44	0.11	5	NM_014907	0		0	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561816	0.27915	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.08102	3.13;3.13	5.67	4.58	0.56647	.	0.227351	0.38111	N	0.001815	T	0.05273	0.0140	N	0.19112	0.55	0.09310	N	0.999992	B	0.27229	0.172	B	0.21917	0.037	T	0.33420	-0.9869	10	0.32370	T	0.25	-8.4971	8.6573	0.34071	0.1763:0.0:0.8237:0.0	.	1407	Q5SYB0	FRPD1_HUMAN	T	1407	ENSP00000366995:A1407T;ENSP00000444411:A1407T	ENSP00000366995:A1407T	A	+	1	0	FRMPD1	37736248	0.988000	0.35896	0.966000	0.40874	0.277000	0.26821	0.680000	0.25306	2.672000	0.90937	0.655000	0.94253	GCA			0.597	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402969.1		NM_014907	
SECISBP2	79048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	91940430	91940430	+	Missense_Mutation	SNP	G	G	A	rs529644965		TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr9:91940430G>A	ENST00000375807.3	+	3	342	c.271G>A	c.(271-273)Gcc>Acc	p.A91T	SECISBP2_ENST00000470305.1_3'UTR|SECISBP2_ENST00000534113.2_Missense_Mutation_p.A23T|SECISBP2_ENST00000339901.4_Intron	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	91					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)	p.A91S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						TCATCCATATGCCTATTCTCC	0.398																																					p.A91T													SECISBP2,NS,carcinoma,0,1	SECISBP2	0	1	1	Substitution - Missense(1)	lung(1)	c.G271A												197.0	185.0	189.0					9																	91940430		2203	4300	6503	SO:0001583	missense	79048	exon3			CCATATGCCTATT	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.271G>A	9.37:g.91940430G>A	ENSP00000364965:p.Ala91Thr		178	0	0		163	0.33	54	NM_024077	23	0.39	9	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	37	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	G	3.750	-0.051829	0.07362	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000534113	T;T	0.72835	-0.69;-0.69	4.17	-2.93	0.05598	.	0.980712	0.08346	N	0.960039	T	0.45236	0.1332	N	0.24115	0.695	0.09310	N	1	B;B;B	0.17852	0.024;0.024;0.024	B;B;B	0.12156	0.007;0.007;0.007	T	0.35425	-0.9789	10	0.05833	T	0.94	-0.7391	4.1844	0.10392	0.3258:0.0:0.1931:0.4811	.	111;91;91	Q59H19;B4DZC7;Q96T21	.;.;SEBP2_HUMAN	T	91;111;23	ENSP00000364965:A91T;ENSP00000436650:A23T	ENSP00000364965:A91T	A	+	1	0	SECISBP2	91130250	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-0.004000	0.12878	-0.295000	0.08960	0.462000	0.41574	GCC			0.398	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052990.3		NM_024077	
PHF2	5253	mdanderson.org	37	9	96422835	96422835	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr9:96422835A>G	ENST00000359246.4	+	12	2058	c.1691A>G	c.(1690-1692)aAg>aGg	p.K564R	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	564	Lys-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CCGCCCAAGAAGGGCAAGGTG	0.617																																					p.K564R													.	.			0			c.A1691G												48.0	44.0	45.0					9																	96422835		2202	4296	6498	SO:0001583	missense	5253	exon12			CCAAGAAGGGCAA	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.1691A>G	9.37:g.96422835A>G	ENSP00000352185:p.Lys564Arg		37	0	0		20	0.10	2	NM_005392	19	0.00	0	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	37	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.362451	0.61403	.	.	ENSG00000197724	ENST00000359246	T	0.22134	1.97	3.83	3.83	0.44106	.	0.233550	0.42053	D	0.000777	T	0.29556	0.0737	N	0.22421	0.69	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.03875	-1.0996	10	0.40728	T	0.16	-10.9719	12.7694	0.57412	1.0:0.0:0.0:0.0	.	564	O75151	PHF2_HUMAN	R	564	ENSP00000352185:K564R	ENSP00000352185:K564R	K	+	2	0	PHF2	95462656	1.000000	0.71417	1.000000	0.80357	0.551000	0.35334	8.761000	0.91691	1.611000	0.50210	0.254000	0.18369	AAG			0.617	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053162.1		NM_005392	
GALNT12	79695	mdanderson.org	37	9	101589071	101589071	+	Silent	SNP	A	A	G	rs146370762	byFrequency	TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr9:101589071A>G	ENST00000375011.3	+	3	579	c.579A>G	c.(577-579)ggA>ggG	p.G193G		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	193	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				AGCTTTCGGGACTGCCCAAGG	0.637													A|||	27	0.00539137	0.0197	0.0	5008	,	,		17427	0.0		0.001	False		,,,				2504	0.0				p.G193G													.	.			0			c.A579G							A		76,4330	59.3+/-96.0	1,74,2128	41.0	39.0	40.0		579	-3.3	0.0	9	dbSNP_134	40	0,8600		0,0,4300	no	coding-synonymous	GALNT12	NM_024642.4		1,74,6428	GG,GA,AA		0.0,1.7249,0.5843		193/582	101589071	76,12930	2203	4300	6503	SO:0001819	synonymous_variant	79695	exon3			TTCGGGACTGCCC	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.579A>G	9.37:g.101589071A>G			69	0	0		42	0.07	3	NM_024642	7	0.00	0	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Silent	SNP	ENST00000375011.3	37	CCDS6737.1																																																																																			0.005		0.637	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053382.1		NM_024642	
WDR5	11091	mdanderson.org	37	9	137007545	137007545	+	Splice_Site	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr9:137007545G>A	ENST00000358625.3	+	6	615		c.e6+1		WDR5_ENST00000425041.1_Splice_Site	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		CTCAGGATCCGTAAGTGTGGC	0.517																																					.													.	.			0			c.444+1G>A												95.0	94.0	94.0					9																	137007545		2203	4300	6503	SO:0001630	splice_region_variant	11091	exon6			GGATCCGTAAGTG	AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.444+1G>A	9.37:g.137007545G>A			63	0	0		53	0.06	3	NM_017588	0		0	Q91VA5|Q9NWX7|Q9UGP9	Splice_Site	SNP	ENST00000358625.3	37	CCDS6981.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478654	0.26511	.	.	ENSG00000196363	ENST00000358625;ENST00000425041	.	.	.	3.99	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0467	0.71833	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR5	135997366	1.000000	0.71417	0.733000	0.30861	0.067000	0.16453	8.804000	0.91921	1.948000	0.56530	0.455000	0.32223	.			0.517	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254621.1		NM_052821	Intron
INPP5E	56623	mdanderson.org	37	9	139327038	139327038	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr9:139327038G>T	ENST00000371712.3	-	6	1682	c.1280C>A	c.(1279-1281)tCa>tAa	p.S427*		NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		CCCGTCACCTGCTGTGGGAAC	0.637																																					p.S427X													.	.			0			c.C1280A												51.0	36.0	41.0					9																	139327038		2089	4003	6092	SO:0001630	splice_region_variant	56623	exon6			TCACCTGCTGTGG	AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.1280-1C>A	9.37:g.139327038G>T			44	0	0		28	0.11	3	NM_019892	25	0.00	0	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Nonsense_Mutation	SNP	ENST00000371712.3	37	CCDS7000.1	.	.	.	.	.	.	.	.	.	.	G	38	6.652384	0.97734	.	.	ENSG00000148384	ENST00000371712	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	18.2483	0.89995	0.0:0.0:1.0:0.0	.	.	.	.	X	427	.	ENSP00000360777:S427X	S	-	2	0	INPP5E	138446859	1.000000	0.71417	0.933000	0.37362	0.017000	0.09413	6.848000	0.75409	2.630000	0.89119	0.455000	0.32223	TCA			0.637	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055058.1		NM_019892	Nonsense_Mutation
XG	7499	broad.mit.edu	37	X	2700164	2700164	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chrX:2700164G>A	ENST00000381174.5	+	4	410	c.185G>A	c.(184-186)gGt>gAt	p.G62D	XG_ENST00000426774.1_Missense_Mutation_p.G62D|XG_ENST00000419513.2_Missense_Mutation_p.G62D			P55808	XG_HUMAN	Xg blood group	62						integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CCCGACAGCGGTGGAAGTAAG	0.428																																					p.G62D													.	XG	22		0			c.G185A												107.0	92.0	97.0					X																	2700164		2203	4299	6502	SO:0001583	missense	7499	exon4			ACAGCGGTGGAAG	AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.185G>A	X.37:g.2700164G>A	ENSP00000370566:p.Gly62Asp		141	0	0		134	0.04	6	NM_001141920	2	0.00	0	E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	37	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926621	0.34002	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	1.16	1.16	0.20824	.	0.612043	0.13280	U	0.399836	T	0.19805	0.0476	L	0.55990	1.75	0.09310	N	1	P;D	0.56968	0.669;0.978	B;P	0.45406	0.199;0.479	T	0.11446	-1.0587	10	0.37606	T	0.19	.	5.4045	0.16314	0.0:0.0:1.0:0.0	.	62;62	P55808;P55808-3	XG_HUMAN;.	D	62;62;62;40	ENSP00000370566:G62D;ENSP00000411004:G62D;ENSP00000398503:G62D;ENSP00000430005:G40D	ENSP00000370566:G62D	G	+	2	0	XG	2710164	0.001000	0.12720	0.015000	0.15790	0.269000	0.26545	1.523000	0.35932	0.890000	0.36211	0.190000	0.17370	GGT			0.428	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000055633.2		NM_175569	
RPGR	6103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	38146264	38146264	+	Intron	SNP	C	C	G			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chrX:38146264C>G	ENST00000339363.3	-	14	2688				RPGR_ENST00000318842.7_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.S663T|RPGR_ENST00000342811.3_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000338898.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						TGCTCCTGAACTACCTTCCTC	0.527																																					p.S663T													.	.			0			c.G1988C												338.0	265.0	289.0					X																	38146264		2202	4300	6502	SO:0001627	intron_variant	6103	exon15			CCTGAACTACCTT	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+82G>C	X.37:g.38146264C>G			134	0	0		139	0.37	51	NM_001034853	0		0	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		.	.	.	.	.	.	.	.	.	.	c	5.285	0.238061	0.10023	.	.	ENSG00000156313	ENST00000378505	T	0.35789	1.29	3.0	-4.96	0.03038	.	3.583910	0.02236	U	0.065349	T	0.25754	0.0627	L	0.51422	1.61	0.09310	N	1	B	0.33494	0.414	B	0.27887	0.084	T	0.10222	-1.0639	10	0.36615	T	0.2	.	2.4884	0.04604	0.2843:0.4502:0.1404:0.125	.	663	E9PE28	.	T	663	ENSP00000367766:S663T	ENSP00000367766:S663T	S	-	2	0	RPGR	38031208	0.000000	0.05858	0.000000	0.03702	0.232000	0.25224	-0.484000	0.06528	-0.967000	0.03582	0.353000	0.21931	AGT			0.527	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_000328	
ZNF541	84215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	48024612	48024612	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAGC-01A-21D-A42Y-10	TCGA-2G-AAGC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	3a571cff-caa7-4b12-b014-4abe54978d35	2eeea093-efbd-4c6b-a84d-a56b07d5e9f8	g.chr19:48024612G>A	ENST00000391901.3	-	15	3909	c.3910C>T	c.(3910-3912)Cga>Tga	p.R1304*	ZNF541_ENST00000314121.4_Nonsense_Mutation_p.R1323*|ZNF541_ENST00000448976.1_Nonsense_Mutation_p.R1046*			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	1304					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						TGGGCATTTCGACTCTTGATC	0.582																																					.													ZNF541,NS,carcinoma,+1,1	ZNF541	1	1	0			.												120.0	102.0	108.0					19																	48024612		692	1591	2283	SO:0001587	stop_gained	84215	.			CATTTCGACTCTT	AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.3910C>T	19.37:g.48024612G>A	ENSP00000375770:p.Arg1304*		110	0	0		83	0.28	23	.	5	0.60	3	Q8NDK8	Nonsense_Mutation	SNP	ENST00000391901.3	37		.	.	.	.	.	.	.	.	.	.	G	42	9.362762	0.99148	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	.	.	.	5.86	4.82	0.62117	.	0.000000	0.45361	D	0.000369	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.7096	13.7689	0.63012	0.0:0.0:0.8465:0.1535	.	.	.	.	X	1304;1323;1046	.	ENSP00000313258:R1323X	R	-	1	2	ZNF541	52716424	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.607000	0.61133	1.453000	0.47775	0.655000	0.94253	CGA			0.582	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000280415.1		NM_032255	
