#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PLEKHN1	84069	bcgsc.ca	37	1	909421	909421	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:909421C>A	ENST00000379409.2	+	13	1829	c.1799C>A	c.(1798-1800)gCc>gAc	p.A600D	PLEKHN1_ENST00000379410.3_Missense_Mutation_p.A548D|PLEKHN1_ENST00000379407.3_Missense_Mutation_p.A513D			Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N member 1	600										central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	9	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		CCCCCAGACGCCCCTCAGCTT	0.711																																					p.A548D													.	PLEKHN1	49		0			c.C1643A												5.0	6.0	6.0					1																	909421		2027	4076	6103	SO:0001583	missense	84069	exon14			CAGACGCCCCTCA	AL136730	CCDS4.1, CCDS53256.1	1p36.33	2013-01-11			ENSG00000187583	ENSG00000187583		"""Pleckstrin homology (PH) domain containing"""	25284	protein-coding gene	gene with protein product						11230166	Standard	NM_032129		Approved	DKFZP434H2010	uc001acd.3	Q494U1	OTTHUMG00000040756	ENST00000379409.2:c.1799C>A	1.37:g.909421C>A	ENSP00000368719:p.Ala600Asp		25	0	0		24	0.00	0	NM_032129	1	0.00	0	Q494U2|Q5SV98|Q9H0M7	Missense_Mutation	SNP	ENST00000379409.2	37		.	.	.	.	.	.	.	.	.	.	C	3.967	-0.009207	0.07727	.	.	ENSG00000187583	ENST00000379410;ENST00000379407;ENST00000379409	T;T;T	0.44482	0.93;0.92;0.93	4.26	3.33	0.38152	.	0.620727	0.16539	N	0.210056	T	0.20333	0.0489	N	0.08118	0	0.09310	N	1	B;B;B	0.26258	0.062;0.145;0.062	B;B;B	0.18561	0.022;0.022;0.015	T	0.11494	-1.0585	10	0.36615	T	0.2	-8.8721	7.3669	0.26779	0.0:0.8759:0.0:0.1241	.	513;600;548	Q494U1-3;Q494U1;Q494U1-2	.;PKHN1_HUMAN;.	D	548;513;600	ENSP00000368720:A548D;ENSP00000368717:A513D;ENSP00000368719:A600D	ENSP00000368717:A513D	A	+	2	0	PLEKHN1	899284	0.000000	0.05858	0.008000	0.14137	0.061000	0.15899	0.663000	0.25053	1.119000	0.41883	0.472000	0.43445	GCC			0.711	PLEKHN1-005	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000473256.1		NM_032129	
KIF17	57576	mdanderson.org	37	1	21044035	21044035	+	Silent	SNP	G	G	A	rs369480851		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:21044035G>A	ENST00000247986.2	-	1	475	c.165C>T	c.(163-165)gaC>gaT	p.D55D	SH2D5_ENST00000460804.1_5'Flank|KIF17_ENST00000375044.1_5'Flank|KIF17_ENST00000400463.3_Silent_p.D55D			Q9P2E2	KIF17_HUMAN	kinesin family member 17	55	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GGTAGGCGCCGTCGAAGGTGA	0.706																																					p.D55D													.	.			0			c.C165T												37.0	40.0	39.0					1																	21044035		2200	4286	6486	SO:0001819	synonymous_variant	57576	exon1			GGCGCCGTCGAAG	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.165C>T	1.37:g.21044035G>A			77	0	0		46	0.09	4	NM_020816	1	0.00	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	ENST00000247986.2	37	CCDS213.1																																																																																					0.706	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276995.1		NM_020816	
CELA3B	23436	mdanderson.org	37	1	22307358	22307358	+	Silent	SNP	C	C	T	rs7528300	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:22307358C>T	ENST00000337107.6	+	3	190	c.171C>T	c.(169-171)acC>acT	p.T57T	RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	57	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						TCTACCACACCTGTGGCGGTA	0.637											OREG0013210	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T57T													.	.			0			c.C171T												22.0	14.0	16.0					1																	22307358		2140	4128	6268	SO:0001819	synonymous_variant	23436	exon3			CCACACCTGTGGC	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.171C>T	1.37:g.22307358C>T			85	0	0	755	84	0.04	3	NM_007352	0		0	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	ENST00000337107.6	37	CCDS219.1																																																																																					0.637	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007797.1		NM_007352	
CYP4Z2P	163720	broad.mit.edu	37	1	47348892	47348892	+	RNA	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:47348892C>T	ENST00000505841.1	-	0	571					NR_002788.2		Q8N1L4	CP4Z2_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 2, pseudogene							integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)										CTTCATGATGCTGTCCAGGGT	0.493																																					.													.	.			0			.																																											0	.			ATGATGCTGTCCA	AY262057		1p33	2013-07-25	2013-05-03		ENSG00000154198	ENSG00000154198		"""Cytochrome P450s"""	24426	pseudogene	pseudogene						15059886	Standard	NR_002788		Approved	FLJ40054	uc031pmm.1	Q8N1L4	OTTHUMG00000008024		1.37:g.47348892C>T			797	0	0		748	0.01	9	.	1	0.00	0	Q66ZJ5	RNA	SNP	ENST00000505841.1	37																																																																																						0.493	CYP4Z2P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000361094.1		NR_002788	
RP11-344P13.4	0	broad.mit.edu	37	1	121245721	121245721	+	lincRNA	DEL	A	A	-			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:121245721delA	ENST00000437523.2	-	0	92																											ATAACAAaacaaaaaaaaaag	0.279																																					.													.	.			0			.																																											0	.			CAAAACAAAAAAA																													1.37:g.121245721delA			9	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000437523.2	37																																																																																						0.279	RP11-344P13.4-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000472360.1			
HIST2H3PS2	440686	broad.mit.edu	37	1	149400836	149400837	+	5'Flank	INS	-	-	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:149400836_149400837insT	ENST00000392948.2	-	0	0				RP5-998N21.10_ENST00000609879.1_RNA|HIST2H2BB_ENST00000609585.1_RNA|RP5-998N21.7_ENST00000444624.1_RNA					histone cluster 2, H3, pseudogene 2											lung(1)|ovary(1)	2						TTTAACAGAGATTTTTTTTTTT	0.337																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			ACAGAGATTTTTT	AL109948		1q21.1	2012-04-11	2006-10-11		ENSG00000203818	ENSG00000203818		"""Histones / Replication-dependent"""	32060	pseudogene	pseudogene			"""histone 2, H3, pseudogene 2"""				Standard	NG_012783		Approved	p06			OTTHUMG00000041033		1.37:g.149400847_149400847dupT	Exception_encountered		6	0	0		6	0.33	2	.	0		0		RNA	INS	ENST00000392948.2	37																																																																																						0.337	HIST2H3PS2-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000098436.3		NG_012783	
ILDR2	387597	mdanderson.org	37	1	166890129	166890129	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:166890129C>T	ENST00000271417.3	-	9	1754	c.1699G>A	c.(1699-1701)Gct>Act	p.A567T	ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.A508T|ILDR2_ENST00000525740.1_Missense_Mutation_p.A440T|ILDR2_ENST00000526687.1_Missense_Mutation_p.A459T|ILDR2_ENST00000529071.1_Missense_Mutation_p.A548T|ILDR2_ENST00000529387.1_Intron	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	567					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						GGCGACCAAGCGTAGTAGGAG	0.751																																					p.A567T													.	.			0			c.G1699A												3.0	3.0	3.0					1																	166890129		1834	3675	5509	SO:0001583	missense	387597	exon9			ACCAAGCGTAGTA	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1699G>A	1.37:g.166890129C>T	ENSP00000271417:p.Ala567Thr		20	0	0		12	0.17	2	NM_199351	5	0.00	0		Missense_Mutation	SNP	ENST00000271417.3	37	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671321	0.88348	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T	0.78707	0.44;-1.2;0.43;-1.2;-0.19	4.76	3.84	0.44239	.	0.251529	0.39834	N	0.001245	T	0.66877	0.2834	L	0.56769	1.78	0.29723	N	0.838477	D	0.60575	0.988	P	0.48795	0.59	T	0.65384	-0.6181	9	0.21540	T	0.41	.	12.9493	0.58389	0.0:0.9211:0.0:0.0789	.	567	Q71H61	ILDR2_HUMAN	T	567;440;548;459;508	ENSP00000271417:A567T;ENSP00000436120:A440T;ENSP00000436882:A548T;ENSP00000434273:A459T;ENSP00000432750:A508T	ENSP00000271417:A567T	A	-	1	0	ILDR2	165156753	1.000000	0.71417	0.967000	0.41034	0.638000	0.38207	3.840000	0.55843	0.985000	0.38656	0.555000	0.69702	GCT			0.751	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000082880.2		NM_199351	
SELP	6403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	169581527	169581527	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:169581527C>T	ENST00000263686.6	-	6	926	c.889G>A	c.(889-891)Gca>Aca	p.A297T	SELP_ENST00000458599.2_Missense_Mutation_p.A297T|SELP_ENST00000367794.2_Missense_Mutation_p.A297T|SELP_ENST00000367792.2_Missense_Mutation_p.A297T|SELP_ENST00000367793.2_Intron|SELP_ENST00000367791.2_Missense_Mutation_p.A297T|SELP_ENST00000367786.2_Missense_Mutation_p.A297T|SELP_ENST00000367788.2_Intron	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	297	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	CCAACTAATGCAAATCCCTCT	0.502																																					p.A297T													.	.			0			c.G889A												128.0	112.0	118.0					1																	169581527		2203	4300	6503	SO:0001583	missense	6403	exon6			CTAATGCAAATCC	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.889G>A	1.37:g.169581527C>T	ENSP00000263686:p.Ala297Thr		131	0	0		161	0.17	28	NM_003005	9	0.00	0	Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	CCDS1282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.508|1.508	-0.550162|-0.550162	0.03996|0.03996	.|.	.|.	ENSG00000174175|ENSG00000174175	ENST00000367795;ENST00000367790;ENST00000426706;ENST00000367789;ENST00000263686;ENST00000544572;ENST00000367794;ENST00000367792;ENST00000367791;ENST00000367786;ENST00000458599|ENST00000446728	T;T;T;T;T|.	0.63744|.	-0.06;-0.06;-0.06;-0.06;-0.06|.	5.39|5.39	-0.798|-0.798	0.10905|0.10905	Complement control module (2);Sushi/SCR/CCP (3);|.	1.575510|.	0.03852|.	N|.	0.272385|.	T|T	0.02267|0.02267	0.0070|0.0070	N|N	0.01267|0.01267	-0.92|-0.92	0.09310|0.09310	N|N	1|1	B;B;B|.	0.10296|.	0.001;0.003;0.002|.	B;B;B|.	0.15870|.	0.005;0.014;0.003|.	T|T	0.46275|0.46275	-0.9203|-0.9203	10|5	0.15066|.	T|.	0.55|.	.|.	6.8958|6.8958	0.24255|0.24255	0.0:0.4467:0.1198:0.4335|0.0:0.4467:0.1198:0.4335	.|.	297;297;297|.	Q6NUL9;P16109;G3V1U2|.	.;LYAM3_HUMAN;.|.	T|Y	297;297;296;297;297;297;297;297;297;297;282|296	ENSP00000263686:A297T;ENSP00000356768:A297T;ENSP00000356766:A297T;ENSP00000356765:A297T;ENSP00000356760:A297T|.	ENSP00000263686:A297T|.	A|C	-|-	1|2	0|0	SELP|SELP	167848151|167848151	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.104000|0.104000	0.19210|0.19210	-0.955000|-0.955000	0.03869|0.03869	-0.042000|-0.042000	0.13535|0.13535	-0.157000|-0.157000	0.13467|0.13467	GCA|TGC			0.502	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000083916.4		NM_003005	
TNR	7143	broad.mit.edu	37	1	175372735	175372735	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:175372735G>T	ENST00000367674.2	-	4	1225	c.517C>A	c.(517-519)Cct>Act	p.P173T	TNR_ENST00000263525.2_Missense_Mutation_p.P173T			Q92752	TENR_HUMAN	tenascin R	173	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CTGCAGTGAGGGATATAGTCC	0.557																																					p.P173T													.	TNR	399		0			c.C517A												70.0	72.0	71.0					1																	175372735		2203	4300	6503	SO:0001583	missense	7143	exon4			AGTGAGGGATATA	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.517C>A	1.37:g.175372735G>T	ENSP00000356646:p.Pro173Thr		90	0.0222222222	2		135	0.02	3	NM_003285	1	0.00	0	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210441	0.79240	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.30714	1.52;1.52	6.02	6.02	0.97574	.	0.059940	0.64402	D	0.000002	T	0.39332	0.1074	L	0.45352	1.415	0.58432	D	0.999995	D;D	0.59767	0.958;0.986	P;P	0.55455	0.558;0.776	T	0.01863	-1.1258	10	0.21014	T	0.42	.	14.6737	0.68964	0.0707:0.0:0.9293:0.0	.	173;173	B4DIX8;Q92752	.;TENR_HUMAN	T	173	ENSP00000356646:P173T;ENSP00000263525:P173T	ENSP00000263525:P173T	P	-	1	0	TNR	173639358	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.854000	0.86942	2.865000	0.98341	0.655000	0.94253	CCT			0.557	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084414.4		NM_003285	
TOR1AIP2	163590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	179820097	179820097	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:179820097C>T	ENST00000367612.3	-	4	823	c.436G>A	c.(436-438)Gga>Aga	p.G146R	TOR1AIP2_ENST00000609928.1_Missense_Mutation_p.G146R	NM_145034.4	NP_659471.1	Q9H496	IFG15_HUMAN	torsin A interacting protein 2	0										cervix(1)|endometrium(3)|large_intestine(1)|lung(10)|ovary(1)|skin(2)	18						GCTCCAGTTCCGTCACTCGCT	0.562																																					p.G146R													.	.			0			c.G436A												108.0	105.0	106.0					1																	179820097		2203	4300	6503	SO:0001583	missense	163590	exon5			CAGTTCCGTCACT		CCDS1334.1	1q25.2	2012-02-09			ENSG00000169905	ENSG00000169905			24055	protein-coding gene	gene with protein product		614513				15767459	Standard	NM_145034		Approved	LULL1, NET9, IFRG15	uc001gnk.3	Q8NFQ8	OTTHUMG00000035265	ENST00000367612.3:c.436G>A	1.37:g.179820097C>T	ENSP00000356584:p.Gly146Arg		152	0	0		177	0.21	38	NM_001199260	26	0.12	3	Q05BU2	Missense_Mutation	SNP	ENST00000367612.3	37	CCDS1334.1	.	.	.	.	.	.	.	.	.	.	C	2.371	-0.344239	0.05208	.	.	ENSG00000169905	ENST00000367612	T	0.24538	1.85	5.49	-3.57	0.04612	.	1.704950	0.02906	N	0.136024	T	0.17534	0.0421	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.30297	-0.9983	10	0.11794	T	0.64	0.1127	12.4933	0.55912	0.0:0.6513:0.0:0.3487	.	146	Q8NFQ8	TOIP2_HUMAN	R	146	ENSP00000356584:G146R	ENSP00000356584:G146R	G	-	1	0	TOR1AIP2	178086720	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.755000	0.04782	-1.000000	0.03438	-0.471000	0.05019	GGA			0.562	TOR1AIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085304.1		NM_145034	
CACNA1S	779	ucsc.edu	37	1	201035437	201035437	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:201035437C>T	ENST00000362061.3	-	21	2891	c.2665G>A	c.(2665-2667)Gcc>Acc	p.A889T	CACNA1S_ENST00000367338.3_Missense_Mutation_p.A889T	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	889					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGGAGATGGCACTGGACCTG	0.657																																					p.A889T													.	CACNA1S	249		0			c.G2665A												53.0	54.0	54.0					1																	201035437		2203	4300	6503	SO:0001583	missense	779	exon21			AGATGGCACTGGA	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.2665G>A	1.37:g.201035437C>T	ENSP00000355192:p.Ala889Thr		17	0	0		39	0.10	4	NM_000069	9	0.00	0	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	37	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	c	10.00	1.233152	0.22626	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98567	-5.0;-5.0	3.92	-7.03	0.01584	Ion transport (1);	0.568663	0.18574	N	0.137254	D	0.93588	0.7953	L	0.33293	1	0.28598	N	0.909307	B	0.06786	0.001	B	0.20384	0.029	T	0.82592	-0.0381	10	0.45353	T	0.12	.	7.639	0.28282	0.1008:0.4142:0.0:0.4851	.	889	Q13698	CAC1S_HUMAN	T	889	ENSP00000355192:A889T;ENSP00000356307:A889T	ENSP00000355192:A889T	A	-	1	0	CACNA1S	199302060	0.000000	0.05858	0.166000	0.22797	0.320000	0.28249	-0.307000	0.08167	-1.849000	0.01171	-1.212000	0.01626	GCC			0.657	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087049.1		NM_000069	
AVPR1B	553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	206224555	206224555	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:206224555G>A	ENST00000367126.4	+	1	580	c.115G>A	c.(115-117)Gga>Aga	p.G39R	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	39					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	GGTGGAGATCGGAGTCCTGGC	0.687																																					p.G39R													.	.			0			c.G115A												80.0	93.0	89.0					1																	206224555		2203	4300	6503	SO:0001583	missense	553	exon1			GAGATCGGAGTCC	D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.115G>A	1.37:g.206224555G>A	ENSP00000356094:p.Gly39Arg		157	0	0		182	0.23	42	NM_000707	1	1.00	1	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093761	0.36952	.	.	ENSG00000198049	ENST00000367126	T	0.28069	1.63	5.06	5.06	0.68205	.	0.426066	0.21507	N	0.073440	T	0.37046	0.0989	L	0.59436	1.845	0.09310	N	0.999999	P	0.42827	0.791	B	0.41412	0.356	T	0.36768	-0.9734	10	0.72032	D	0.01	-1.8765	18.211	0.89869	0.0:0.0:1.0:0.0	.	39	P47901	V1BR_HUMAN	R	39	ENSP00000356094:G39R	ENSP00000356094:G39R	G	+	1	0	AVPR1B	204391178	0.813000	0.29090	0.176000	0.23000	0.661000	0.39034	4.831000	0.62752	2.633000	0.89246	0.609000	0.83330	GGA			0.687	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087996.1		NM_000707	
PIGR	5284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	207110937	207110937	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr1:207110937A>C	ENST00000356495.4	-	4	731	c.548T>G	c.(547-549)gTa>gGa	p.V183G		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	183	Ig-like V-type 2.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTTGGGATTTACATAACCACT	0.478																																					p.V183G													.	.			0			c.T548G												92.0	79.0	84.0					1																	207110937		2203	4300	6503	SO:0001583	missense	5284	exon4			GGATTTACATAAC		CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.548T>G	1.37:g.207110937A>C	ENSP00000348888:p.Val183Gly		132	0	0		148	0.14	21	NM_002644	84	0.26	22	Q68D81|Q8IZY7	Missense_Mutation	SNP	ENST00000356495.4	37	CCDS1474.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.123703	0.56613	.	.	ENSG00000162896	ENST00000356495	T	0.04454	3.62	6.08	-4.25	0.03766	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.521620	0.03537	N	0.223364	T	0.14485	0.0350	M	0.73962	2.25	0.19945	N	0.999947	D	0.69078	0.997	D	0.66847	0.947	T	0.37009	-0.9724	10	0.66056	D	0.02	-24.6357	0.9742	0.01422	0.2926:0.1065:0.1874:0.4135	.	183	P01833	PIGR_HUMAN	G	183	ENSP00000348888:V183G	ENSP00000348888:V183G	V	-	2	0	PIGR	205177560	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.393000	0.07305	-1.099000	0.03034	-0.256000	0.11100	GTA			0.478	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088975.1		NM_002644	
DIP2C	22982	bcgsc.ca	37	10	415572	415572	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:415572G>T	ENST00000280886.6	-	18	2080	c.1993C>A	c.(1993-1995)Ccc>Acc	p.P665T	DIP2C_ENST00000381496.3_Splice_Site_p.P558T|DIP2C_ENST00000540204.1_5'UTR	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	665						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TCATCCGTGGGCCTGTAATGA	0.552																																					p.P665T													.	DIP2C	195		0			c.C1993A												68.0	74.0	72.0					10																	415572		2203	4300	6503	SO:0001630	splice_region_variant	22982	exon18			CCGTGGGCCTGTA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1992-1C>A	10.37:g.415572G>T			65	0	0		79	0.01	1	NM_014974	38	0.00	0	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550021	0.65311	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.11169	2.8;2.8	5.09	5.09	0.68999	AMP-dependent synthetase/ligase (1);	0.173903	0.51477	D	0.000090	T	0.36054	0.0953	M	0.86651	2.83	0.80722	D	1	P	0.49559	0.925	P	0.59825	0.864	T	0.15009	-1.0452	10	0.32370	T	0.25	-10.9011	18.8772	0.92343	0.0:0.0:1.0:0.0	.	665	Q9Y2E4	DIP2C_HUMAN	T	665;558	ENSP00000280886:P665T;ENSP00000370907:P558T	ENSP00000280886:P665T	P	-	1	0	DIP2C	405572	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	9.784000	0.99039	2.526000	0.85167	0.561000	0.74099	CCC			0.552	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046389.1		NM_014974	Missense_Mutation
C10orf54	64115	mdanderson.org	37	10	73511467	73511467	+	Silent	SNP	G	G	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:73511467G>A	ENST00000394957.3	-	6	914	c.856C>T	c.(856-858)Ctg>Ttg	p.L286L	CDH23_ENST00000224721.6_Intron	NM_022153.1	NP_071436.1	Q9H7M9	GI24_HUMAN	chromosome 10 open reading frame 54	286					BMP signaling pathway (GO:0030509)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of T cell cytokine production (GO:0002725)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of stem cell differentiation (GO:2000738)|stem cell differentiation (GO:0048863)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	9						GGAGGAGACAGGGGGGTGCTG	0.617																																					p.L286L													.	.			0			c.C856T												43.0	47.0	45.0					10																	73511467		2203	4300	6503	SO:0001819	synonymous_variant	64115	exon6			GAGACAGGGGGGT	AF193048	CCDS31218.1	10q22.1	2013-11-28			ENSG00000107738	ENSG00000107738		"""Immunoglobulin superfamily / V-set domain containing"""	30085	protein-coding gene	gene with protein product	"""stress induced secreted protein 1"""	615608				12975309	Standard	NM_022153		Approved	SISP1, GI24, B7-H5, B7H5	uc001jsd.3	Q9H7M9	OTTHUMG00000018426	ENST00000394957.3:c.856C>T	10.37:g.73511467G>A			50	0	0		43	0.07	3	NM_022153	152	0.00	0	A1L0X9|A4ZYV1|A8MVH5|Q6UXF3|Q8WUG3|Q8WYZ8	Silent	SNP	ENST00000394957.3	37	CCDS31218.1																																																																																					0.617	C10orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048548.1		NM_022153	
DUSP13	51207	mdanderson.org	37	10	76863743	76863743	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:76863743G>T	ENST00000491677.2	-	4	742	c.200C>A	c.(199-201)gCc>gAc	p.A67D	DUSP13_ENST00000607131.1_Missense_Mutation_p.A31D|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000372700.3_Intron	NM_001007271.1	NP_001007272.1	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	170					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CCCACGCTGGGCTTCCACCAT	0.647																																					p.A31D	NSCLC(174;1655 2059 12324 40663 42963)												DUSP13_ENST00000394707,NS,carcinoma,-1,1	DUSP13_ENST00000394707	-1	1	0			c.C92A												34.0	35.0	35.0					10																	76863743		2196	4297	6493	SO:0001583	missense	51207	exon2			CGCTGGGCTTCCA	AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000491677.2:c.200C>A	10.37:g.76863743G>T	ENSP00000436312:p.Ala67Asp		69	0	0		41	0.10	4	NM_001007273	2	0.00	0	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	ENST00000491677.2	37		.	.	.	.	.	.	.	.	.	.	G	12.19	1.863106	0.32884	.	.	ENSG00000079393	ENST00000491677;ENST00000372698	T	0.07327	3.2	4.41	-1.87	0.07737	.	2.918520	0.01556	N	0.019889	T	0.06096	0.0158	N	0.19112	0.55	0.20703	N	0.999867	B	0.06786	0.001	B	0.06405	0.002	T	0.39272	-0.9622	10	0.54805	T	0.06	-0.9659	4.1423	0.10200	0.4839:0.0:0.3495:0.1666	.	67	F2Z2C4	.	D	67;31	ENSP00000436312:A67D	ENSP00000361783:A31D	A	-	2	0	DUSP13	76533749	0.002000	0.14202	0.006000	0.13384	0.016000	0.09150	-0.256000	0.08757	-0.239000	0.09710	-0.140000	0.14226	GCC			0.647	DUSP13-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding					
DLG5	9231	mdanderson.org	37	10	79581552	79581552	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:79581552G>T	ENST00000372391.2	-	15	2695	c.2690C>A	c.(2689-2691)tCa>tAa	p.S897*	DLG5_ENST00000372388.2_Intron|DLG5_ENST00000459739.1_5'Flank	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	897					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			AGAGGCATCTGAGCGGAAGGA	0.667																																					p.S897X													.	.			0			c.C2690A												17.0	17.0	17.0					10																	79581552		2203	4300	6503	SO:0001587	stop_gained	9231	exon15			GCATCTGAGCGGA	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.2690C>A	10.37:g.79581552G>T	ENSP00000361467:p.Ser897*		32	0	0		17	0.12	2	NM_004747	106	0.00	0	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Nonsense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	40	8.120866	0.98665	.	.	ENSG00000151208	ENST00000372391;ENST00000372392	.	.	.	5.27	5.27	0.74061	.	0.254904	0.20836	N	0.084789	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	14.8169	0.70041	0.0:0.1438:0.8562:0.0	.	.	.	.	X	897;446	.	ENSP00000361467:S897X	S	-	2	0	DLG5	79251558	1.000000	0.71417	0.875000	0.34327	0.966000	0.64601	5.552000	0.67281	2.640000	0.89533	0.543000	0.68304	TCA			0.667	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048900.2			
IDE	3416	mdanderson.org	37	10	94214294	94214294	+	Silent	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:94214294A>G	ENST00000265986.6	-	25	3023	c.2967T>C	c.(2965-2967)ccT>ccC	p.P989P	IDE_ENST00000371581.5_Silent_p.P434P|IDE_ENST00000496903.1_5'UTR	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	989					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	GAATCACTTCAGGCTGCAAAG	0.408																																					p.P989P													.	.			0			c.T2967C												99.0	98.0	99.0					10																	94214294		2203	4300	6503	SO:0001819	synonymous_variant	3416	exon25			CACTTCAGGCTGC	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2967T>C	10.37:g.94214294A>G			82	0	0		46	0.07	3	NM_004969	51	0.00	0	B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	37	CCDS7421.1																																																																																					0.408	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049393.1		NM_004969	
VWA2	340706	bcgsc.ca	37	10	116044682	116044682	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:116044682G>A	ENST00000392982.3	+	10	1200	c.950G>A	c.(949-951)gGc>gAc	p.G317D	VWA2_ENST00000603594.1_Missense_Mutation_p.G317D			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	317	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		GGACTGGACGGCTACCAGTGC	0.602																																					p.G317D													.	VWA2	64		0			c.G950A												82.0	64.0	70.0					10																	116044682		2203	4300	6503	SO:0001583	missense	340706	exon10			TGGACGGCTACCA	AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.950G>A	10.37:g.116044682G>A	ENSP00000376708:p.Gly317Asp		59	0	0		32	0.00	0	NM_001272046	3	0.00	0	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	37		.	.	.	.	.	.	.	.	.	.	G	0.333	-0.954988	0.02285	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	D	0.92965	-3.14	5.49	0.402	0.16344	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.865563	0.10687	N	0.645644	D	0.84955	0.5587	L	0.41415	1.275	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.14023	0.01;0.006	T	0.68307	-0.5443	10	0.17832	T	0.49	.	5.4069	0.16326	0.3714:0.1514:0.4772:0.0	.	317;317	Q5GFL6;Q5GFL6-2	VWA2_HUMAN;.	D	317	ENSP00000376708:G317D	ENSP00000298715:G317D	G	+	2	0	VWA2	116034672	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.118000	0.15605	0.242000	0.21303	0.655000	0.94253	GGC			0.602	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000050456.3		NM_198496	
C10orf88	80007	mdanderson.org	37	10	124713659	124713659	+	Silent	SNP	G	G	T	rs565953327		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr10:124713659G>T	ENST00000481909.1	-	1	260	c.36C>A	c.(34-36)cgC>cgA	p.R12R	C10orf88_ENST00000368891.5_5'UTR	NM_024942.3	NP_079218.2	Q9H8K7	CJ088_HUMAN	chromosome 10 open reading frame 88	12										breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)	18		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		GCGTGGGGCGGCGGGTGAGGC	0.701																																					p.R12R													C10orf88,colon,carcinoma,-1,1	C10orf88	-1	1	0			c.C36A												10.0	14.0	13.0					10																	124713659		2171	4254	6425	SO:0001819	synonymous_variant	80007	exon1			GGGGCGGCGGGTG	AK023552	CCDS7632.1	10q26.13	2012-11-09			ENSG00000119965	ENSG00000119965			25822	protein-coding gene	gene with protein product						12477932	Standard	NM_024942		Approved	FLJ13490, Em:AC073585.5	uc001lgw.2	Q9H8K7	OTTHUMG00000019190	ENST00000481909.1:c.36C>A	10.37:g.124713659G>T			21	0	0		29	0.10	3	NM_024942	23	0.00	0	Q0P6C6|Q8N597	Silent	SNP	ENST00000481909.1	37	CCDS7632.1																																																																																					0.701	C10orf88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050807.1		NM_024942	
INSC	387755	mdanderson.org	37	11	15212344	15212344	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:15212344G>T	ENST00000379554.3	+	6	864	c.818G>T	c.(817-819)tGc>tTc	p.C273F	INSC_ENST00000528567.1_Missense_Mutation_p.C226F|INSC_ENST00000530161.1_Missense_Mutation_p.C226F|INSC_ENST00000447214.2_3'UTR|INSC_ENST00000424273.1_Missense_Mutation_p.C226F|INSC_ENST00000379556.3_Missense_Mutation_p.C226F|INSC_ENST00000525218.1_Missense_Mutation_p.C226F	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	273					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GCTCCCTTGTGCCGCATCATA	0.527																																					p.C273F													.	.			0			c.G818T												97.0	100.0	99.0					11																	15212344		1925	4141	6066	SO:0001583	missense	387755	exon6			CCTTGTGCCGCAT	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.818G>T	11.37:g.15212344G>T	ENSP00000368872:p.Cys273Phe		99	0	0		44	0.07	3	NM_001031853	9	0.00	0	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825651	0.71143	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000416761;ENST00000528567;ENST00000530161;ENST00000525218	T;T;T;T;T;T	0.48522	0.81;0.81;0.82;0.81;0.81;0.82	6.16	6.16	0.99307	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.59436	1.845	0.58432	D	0.999999	D;D;D;D	0.71674	0.998;0.994;0.995;0.995	D;P;P;P	0.66351	0.943;0.837;0.885;0.885	T	0.62426	-0.6857	10	0.52906	T	0.07	-17.5924	17.7766	0.88510	0.0:0.0:1.0:0.0	.	261;226;226;273	Q1MX18-5;Q1MX18-4;A0PJX5;Q1MX18	.;.;.;INSC_HUMAN	F	273;226;226;261;226;226;226	ENSP00000368872:C273F;ENSP00000368874:C226F;ENSP00000389161:C226F;ENSP00000435022:C226F;ENSP00000436194:C226F;ENSP00000436113:C226F	ENSP00000368872:C273F	C	+	2	0	INSC	15168920	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.302000	0.72788	2.937000	0.99478	0.650000	0.86243	TGC			0.527	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000386590.1		NM_001031853	
MACROD1	28992	mdanderson.org	37	11	63918712	63918712	+	Splice_Site	SNP	G	G	A	rs374513283		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:63918712G>A	ENST00000255681.6	-	3	582	c.516C>T	c.(514-516)gcC>gcT	p.A172A	MACROD1_ENST00000538595.1_5'UTR	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	172	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.|Substrate binding. {ECO:0000250}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						GCCACTCACCGGCGTTGACGA	0.607																																					p.A172A													.	.			0			c.C516T							G		0,4402		0,0,2201	129.0	105.0	113.0		516	-7.7	0.5	11		113	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous-near-splice	MACROD1	NM_014067.3		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		172/326	63918712	1,12995	2201	4297	6498	SO:0001630	splice_region_variant	28992	exon3			CTCACCGGCGTTG	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+1C>T	11.37:g.63918712G>A			36	0	0		24	0.08	2	NM_014067	24	0.00	0	Q9UH96	Silent	SNP	ENST00000255681.6	37	CCDS8056.1																																																																																					0.607	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396570.1		NM_014067	Silent
KRTAP5-8	57830	bcgsc.ca	37	11	71249545	71249545	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr11:71249545C>T	ENST00000398534.3	+	1	475	c.444C>T	c.(442-444)tgC>tgT	p.C148C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	148	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						AGTCCAGCTGCTGTAAGCCCT	0.607																																					p.C148C													KRTAP5-8,NS,carcinoma,0,1	KRTAP5-8	28	1	0			c.C444T												173.0	178.0	177.0					11																	71249545		2200	4294	6494	SO:0001819	synonymous_variant	57830	exon1			CAGCTGCTGTAAG	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.444C>T	11.37:g.71249545C>T			54	0	0		29	0.03	1	NM_021046	0		0	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																					0.607	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127954.1		NM_021046	
SLC38A1	81539	bcgsc.ca	37	12	46622952	46622952	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:46622952C>T	ENST00000398637.5	-	5	992	c.298G>A	c.(298-300)Gga>Aga	p.G100R	SLC38A1_ENST00000549049.1_Missense_Mutation_p.G100R|SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000439706.1_Missense_Mutation_p.G100R|SLC38A1_ENST00000546893.1_Missense_Mutation_p.G100R|SLC38A1_ENST00000552197.1_Missense_Mutation_p.G100R	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	100					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			AGTAGGATTCCAGTGTTTGCC	0.403																																					p.G100R													.	SLC38A1	58		0			c.G298A												56.0	51.0	52.0					12																	46622952		1872	4109	5981	SO:0001583	missense	81539	exon5			GGATTCCAGTGTT	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.298G>A	12.37:g.46622952C>T	ENSP00000381634:p.Gly100Arg		144	0	0		123	0.00	0	NM_030674	44	0.00	0	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	37	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310675	0.95629	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.13	5.13	0.70059	.	0.187376	0.39475	N	0.001353	D	0.82554	0.5062	M	0.86864	2.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85524	0.1205	10	0.87932	D	0	-12.3139	18.7708	0.91892	0.0:1.0:0.0:0.0	.	100;100;100	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	R	100	ENSP00000449607:G100R;ENSP00000398142:G100R;ENSP00000381634:G100R;ENSP00000447853:G100R;ENSP00000449756:G100R	ENSP00000381634:G100R	G	-	1	0	SLC38A1	44909219	1.000000	0.71417	0.933000	0.37362	0.997000	0.91878	7.609000	0.82925	2.669000	0.90835	0.591000	0.81541	GGA			0.403	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404218.2			
RAPGEF3	10411	mdanderson.org	37	12	48141596	48141596	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:48141596C>T	ENST00000449771.2	-	14	1460	c.1372G>A	c.(1372-1374)Gtc>Atc	p.V458I	RAPGEF3_ENST00000549151.1_Missense_Mutation_p.V416I|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.V416I|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.V458I|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.V416I|RAPGEF3_ENST00000405493.2_Missense_Mutation_p.V416I|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.V458I			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	458	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		TTGTTGCAGACGTAGGTGCTG	0.627																																					p.V458I													RAPGEF3,colon,carcinoma,0,1	RAPGEF3	0	1	0			c.G1372A												42.0	42.0	42.0					12																	48141596		2203	4300	6503	SO:0001583	missense	10411	exon14			TGCAGACGTAGGT	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1372G>A	12.37:g.48141596C>T	ENSP00000395708:p.Val458Ile		30	0	0		22	0.14	3	NM_001098531	27	0.00	0	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	C	7.994	0.753862	0.15778	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358	T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75	4.99	-1.69	0.08186	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.780519	0.12311	N	0.480240	T	0.18509	0.0444	N	0.02916	-0.46	0.19300	N	0.999978	B	0.06786	0.001	B	0.08055	0.003	T	0.27872	-1.0061	10	0.15066	T	0.55	.	8.3064	0.32045	0.1391:0.5728:0.0:0.2881	.	458	O95398	RPGF3_HUMAN	I	416;458;105;416;416;416;458;470;416;458	ENSP00000384521:V416I;ENSP00000395708:V458I;ENSP00000448619:V416I;ENSP00000171000:V416I;ENSP00000373864:V458I;ENSP00000448480:V416I;ENSP00000378764:V458I	ENSP00000171000:V416I	V	-	1	0	RAPGEF3	46427863	0.001000	0.12720	0.965000	0.40720	0.955000	0.61496	-1.910000	0.01584	-0.347000	0.08299	-1.004000	0.02495	GTC			0.627	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257848.1		NM_006105	
HNRNPA1	3178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	54677642	54677642	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:54677642C>T	ENST00000340913.6	+	9	1007	c.954C>T	c.(952-954)taC>taT	p.Y318Y	HNRNPA1_ENST00000547276.1_Silent_p.Y213Y|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000330752.8_Silent_p.Y253Y|HNRNPA1_ENST00000546500.1_Silent_p.Y266Y	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	318	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TTGGGAATTACAACAATCAGT	0.448																																					p.Y318Y	Colon(83;502 1289 8436 16406 24870)												.	.			0			c.C954T												124.0	129.0	127.0					12																	54677642		2018	4181	6199	SO:0001819	synonymous_variant	3178	exon9			GAATTACAACAAT	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.954C>T	12.37:g.54677642C>T			56	0	0		68	0.18	12	NM_031157	6650	0.24	1575	A8K4Z8|Q3MIB7|Q6PJZ7	Silent	SNP	ENST00000340913.6	37	CCDS44909.1																																																																																					0.448	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000405480.1		NM_031157	
RHOF	54509	broad.mit.edu	37	12	122231059	122231059	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:122231059G>T	ENST00000267205.2	-	2	853	c.225C>A	c.(223-225)gcC>gcA	p.A75A	RHOF_ENST00000545544.1_5'UTR|RHOF_ENST00000537265.1_5'UTR|AC084018.1_ENST00000539299.1_lincRNA|RHOF_ENST00000537171.1_Splice_Site_p.A75A	NM_019034.2	NP_061907.2	Q9HBH0	RHOF_HUMAN	ras homolog family member F (in filopodia)	75					actin filament organization (GO:0007015)|GTP catabolic process (GO:0006184)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(1)|ovary(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		CGCACTCACCGGCCGTGTCGT	0.716																																					p.A75A													.	RHOF	6		0			c.C225A												29.0	28.0	28.0					12																	122231059		1825	3398	5223	SO:0001630	splice_region_variant	54509	exon2			CTCACCGGCCGTG	AK000254	CCDS9222.1	12q24.31	2013-09-23	2012-02-27	2004-03-24	ENSG00000139725	ENSG00000139725			15703	protein-coding gene	gene with protein product			"""ras homolog gene family, member F (in filopodia)"""	ARHF		11084341	Standard	NM_019034		Approved	FLJ20247, RIF	uc001ubb.3	Q9HBH0	OTTHUMG00000169077	ENST00000267205.2:c.226+1C>A	12.37:g.122231059G>T			83	0	0		68	0.04	3	NM_019034	35	0.00	0	Q8WVB1|Q9NXH6	Splice_Site	SNP	ENST00000267205.2	37	CCDS9222.1																																																																																					0.716	RHOF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402165.1			Silent
NCOR2	9612	broad.mit.edu	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2	475	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			68	0.0735294118	5		85	0.06	5	NM_006312	213	0.00	1	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
MAB21L1	4081	ucsc.edu;mdanderson.org	37	13	36049616	36049616	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr13:36049616G>T	ENST00000379919.4	-	1	1216	c.660C>A	c.(658-660)ggC>ggA	p.G220G	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	220					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		AGCTCTGCTTGCCGGCCAAGG	0.642																																					p.G220G													.	MAB21L1	52		0			c.C660A												49.0	56.0	54.0					13																	36049616		2202	4299	6501	SO:0001819	synonymous_variant	4081	exon1			CTGCTTGCCGGCC	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.660C>A	13.37:g.36049616G>T			50	0	0		41	0.10	4	NM_005584	139	0.00	0	Q6I9T5	Silent	SNP	ENST00000379919.4	37	CCDS9353.1																																																																																					0.642	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044459.3		NM_005584	
Unknown	0	bcgsc.ca	37	14	19422774	19422774	+	IGR	SNP	C	C	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr14:19422774C>A								RP11-536C10.16 (8876 upstream) : MED15P1 (77071 downstream)																							CCCTGGCTCCCGGCCCCCTCC	0.697																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGCTCCCGGCCCC																													14.37:g.19422774C>A			65	0.0307692308	2		44	0.09	4	.	0		0		RNA	SNP		37																																																																																					0	0.697										
SLC8A3	6547	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	70633871	70633871	+	Silent	SNP	T	T	C			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr14:70633871T>C	ENST00000381269.2	-	2	2022	c.1269A>G	c.(1267-1269)ggA>ggG	p.G423G	SLC8A3_ENST00000528359.1_Silent_p.G423G|SLC8A3_ENST00000534137.1_Silent_p.G423G|SLC8A3_ENST00000357887.3_Silent_p.G423G|SLC8A3_ENST00000356921.2_Silent_p.G423G	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	423	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTGACATGTCTCCCCCTTTCC	0.507																																					p.G423G													.	.			0			c.A1269G												128.0	119.0	122.0					14																	70633871		2203	4300	6503	SO:0001819	synonymous_variant	6547	exon2			CATGTCTCCCCCT	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1269A>G	14.37:g.70633871T>C			103	0	0		78	0.06	5	NM_183002	16	0.00	0	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																					0.507	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390736.1			
PTPN21	11099	mdanderson.org	37	14	88945534	88945534	+	Silent	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr14:88945534A>G	ENST00000556564.1	-	13	2525	c.2241T>C	c.(2239-2241)ccT>ccC	p.P747P	PTPN21_ENST00000328736.3_Silent_p.P747P	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	747					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCAGGACGCGAGGGCAGCCAG	0.736																																					p.P747P													.	.			0			c.T2241C												20.0	19.0	20.0					14																	88945534		2196	4291	6487	SO:0001819	synonymous_variant	11099	exon13			GACGCGAGGGCAG	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.2241T>C	14.37:g.88945534A>G			47	0.0212765957	1		43	0.07	3	NM_007039	9	0.00	0		Silent	SNP	ENST00000556564.1	37	CCDS9884.1																																																																																					0.736	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000410303.1			
FAM181A	90050	broad.mit.edu	37	14	94394839	94394839	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr14:94394839A>G	ENST00000267594.5	+	3	701	c.394A>G	c.(394-396)Agg>Ggg	p.R132G	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000556222.1_Missense_Mutation_p.R70G|FAM181A_ENST00000557000.2_Missense_Mutation_p.R70G|FAM181A_ENST00000557719.1_Missense_Mutation_p.R70G	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	132										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						CTACCTGAAAAGGGGGTCTGA	0.652																																					p.R132G													.	FAM181A	42		0			c.A394G												19.0	23.0	22.0					14																	94394839		2202	4297	6499	SO:0001583	missense	90050	exon3			CTGAAAAGGGGGT	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.394A>G	14.37:g.94394839A>G	ENSP00000267594:p.Arg132Gly		59	0	0		57	0.07	4	NM_138344	10	0.00	0	B2RD39|Q96GY1	Missense_Mutation	SNP	ENST00000267594.5	37	CCDS9914.1	.	.	.	.	.	.	.	.	.	.	A	12.25	1.882274	0.33255	.	.	ENSG00000140067	ENST00000557719;ENST00000267594;ENST00000556222;ENST00000554404;ENST00000557000	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	4.74	3.57	0.40892	.	0.160951	0.29002	N	0.013450	T	0.25827	0.0629	L	0.53249	1.67	0.20563	N	0.999881	P	0.36535	0.557	B	0.33620	0.167	T	0.16188	-1.0411	10	0.54805	T	0.06	-13.0992	7.5926	0.28029	0.5154:0.3597:0.0:0.125	.	132	Q8N9Y4	F181A_HUMAN	G	70;132;70;70;121	ENSP00000451802:R70G;ENSP00000267594:R132G;ENSP00000451678:R70G;ENSP00000452393:R70G	ENSP00000267594:R132G	R	+	1	2	FAM181A	93464592	0.001000	0.12720	0.985000	0.45067	0.510000	0.34073	0.197000	0.17197	0.659000	0.30945	-0.466000	0.05196	AGG			0.652	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000412840.1		NM_138344	
SPINT1	6692	broad.mit.edu	37	15	41149071	41149071	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:41149071C>A	ENST00000344051.4	+	11	1722	c.1488C>A	c.(1486-1488)caC>caA	p.H496Q	SPINT1_ENST00000431806.1_Missense_Mutation_p.H480Q|SPINT1_ENST00000562057.1_Missense_Mutation_p.H480Q			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	496					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		AGGACTTCCACGGACACCACC	0.582																																					p.H496Q													.	SPINT1	28		0			c.C1488A												232.0	222.0	226.0					15																	41149071		2203	4300	6503	SO:0001583	missense	6692	exon11			CTTCCACGGACAC		CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.1488C>A	15.37:g.41149071C>A	ENSP00000342098:p.His496Gln		116	0	0		120	0.03	3	NM_181642	213	0.00	0	Q7Z7D2	Missense_Mutation	SNP	ENST00000344051.4	37	CCDS10067.1	.	.	.	.	.	.	.	.	.	.	C	1.397	-0.579120	0.03854	.	.	ENSG00000166145	ENST00000344051;ENST00000536281;ENST00000431806	D;D	0.95137	-3.62;-3.62	5.37	3.23	0.37069	.	1.150880	0.05926	N	0.634383	D	0.92084	0.7491	L	0.57536	1.79	0.09310	N	1	B;B;B	0.16396	0.015;0.017;0.001	B;B;B	0.20184	0.007;0.028;0.0	T	0.79614	-0.1730	10	0.21540	T	0.41	-6.1871	6.9755	0.24672	0.3229:0.5881:0.0:0.089	.	480;480;496	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	Q	496;463;480	ENSP00000342098:H496Q;ENSP00000409935:H480Q	ENSP00000342098:H496Q	H	+	3	2	SPINT1	38936363	0.017000	0.18338	0.002000	0.10522	0.003000	0.03518	0.098000	0.15189	1.226000	0.43582	0.462000	0.41574	CAC			0.582	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252359.2		NM_003710	
SPTBN5	51332	mdanderson.org	37	15	42175409	42175409	+	Silent	SNP	G	G	A	rs542166326	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:42175409G>A	ENST00000320955.6	-	9	1904	c.1677C>T	c.(1675-1677)acC>acT	p.T559T		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	559					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCCCACAGGCGGTGGACCTGG	0.642													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19899	0.0		0.001	False		,,,				2504	0.0				p.T524T													.	.			0			c.C1572T												14.0	16.0	16.0					15																	42175409		2024	4167	6191	SO:0001819	synonymous_variant	51332	exon9			ACAGGCGGTGGAC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.1677C>T	15.37:g.42175409G>A			71	0	0		50	0.06	3	NM_016642	1	0.00	0		Silent	SNP	ENST00000320955.6	37																																																																																						0.642	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000420237.1		NM_016642	
ODF3L1	161753	mdanderson.org	37	15	76019748	76019748	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:76019748T>C	ENST00000332145.2	+	4	915	c.692T>C	c.(691-693)cTc>cCc	p.L231P	DNM1P35_ENST00000501931.1_RNA	NM_175881.3	NP_787077.1	Q8IXM7	OD3L1_HUMAN	outer dense fiber of sperm tails 3-like 1	231										kidney(1)|lung(1)	2						CCTCTGGACCTCACGCCACGG	0.632																																					p.L231P													.	.			0			c.T692C												93.0	80.0	84.0					15																	76019748		2197	4294	6491	SO:0001583	missense	161753	exon4			TGGACCTCACGCC	BC039862	CCDS10285.1	15q23	2008-02-05			ENSG00000182950	ENSG00000182950			28735	protein-coding gene	gene with protein product							Standard	NM_175881		Approved	MGC48986	uc002bax.1	Q8IXM7	OTTHUMG00000142837	ENST00000332145.2:c.692T>C	15.37:g.76019748T>C	ENSP00000329584:p.Leu231Pro		75	0	0		52	0.06	3	NM_175881	4	0.00	0		Missense_Mutation	SNP	ENST00000332145.2	37	CCDS10285.1	.	.	.	.	.	.	.	.	.	.	.	1.610	-0.524370	0.04141	.	.	ENSG00000182950	ENST00000332145	T	0.30182	1.54	4.86	-0.357	0.12579	.	0.895465	0.09609	N	0.779167	T	0.13457	0.0326	N	0.11201	0.11	0.31489	N	0.666259	B	0.12013	0.005	B	0.04013	0.001	T	0.29518	-1.0009	10	0.30078	T	0.28	-15.9679	3.6441	0.08178	0.5666:0.0:0.2738:0.1596	.	231	Q8IXM7	OD3L1_HUMAN	P	231	ENSP00000329584:L231P	ENSP00000329584:L231P	L	+	2	0	ODF3L1	73806803	0.109000	0.22037	0.733000	0.30861	0.006000	0.05464	0.019000	0.13444	-0.234000	0.09782	-1.646000	0.00762	CTC			0.632	ODF3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286473.1		NM_175881	
LOC645752	645752	broad.mit.edu	37	15	78217296	78217296	+	lincRNA	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:78217296A>G	ENST00000565869.1	+	0	706				RP11-114H24.2_ENST00000567226.1_RNA																							GTGAGTGGCAACCACCAGAAG	0.527																																					.													.	.			0			.																																											0	.			GTGGCAACCACCA																													15.37:g.78217296A>G			124	0.0161290323	2		108	0.04	4	.	0		0		RNA	SNP	ENST00000565869.1	37																																																																																						0.527	RP11-114H24.7-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000421587.1			
CSPG4P5	114817	broad.mit.edu	37	15	84957462	84957466	+	RNA	DEL	GTGGC	GTGGC	-	rs578077920|rs540048240|rs376565740|rs145189308	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	GTGGC	GTGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:84957462_84957466delGTGGC	ENST00000558801.1	-	0	7263_7267									DNM1 pseudogene 51																		CACTTGTAGGGTGGCATCTGTGTGC	0.571																																					.													.	.			0			.																																											0	.			TGTAGGGTGGCAT			15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84957462_84957466delGTGGC			5	0	0		7	0.57	4	.	0		0		RNA	DEL	ENST00000558801.1	37																																																																																						0.571	DNM1P51-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000471721.1			
AKAP13	11214	bcgsc.ca	37	15	86118561	86118561	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr15:86118561G>T	ENST00000394518.2	+	6	956		c.e6+1		AKAP13_ENST00000361243.2_Splice_Site	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GCAACTAATGGTAAGTCAGAA	0.383																																					.	Melanoma(94;603 1453 3280 32295 32951)												.	AKAP13	394		0			c.861+1G>T												90.0	89.0	89.0					15																	86118561		2202	4299	6501	SO:0001630	splice_region_variant	11214	exon6			CTAATGGTAAGTC	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.861+1G>T	15.37:g.86118561G>T			116	0	0		115	0.00	0	NM_006738	0		0	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Splice_Site	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038798	0.55003	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7506	0.69522	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AKAP13	83919565	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	4.162000	0.58177	2.941000	0.99782	0.655000	0.94253	.			0.383	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000417318.1		NM_007200	Intron
ZNF174	7727	bcgsc.ca	37	16	3458752	3458752	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:3458752C>A	ENST00000268655.4	+	3	1642	c.1057C>A	c.(1057-1059)Ccc>Acc	p.P353T	ZNF174_ENST00000571936.1_Missense_Mutation_p.P353T	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	353					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						AGGAGAGAGACCCTACACGTG	0.532																																					p.P353T													.	ZNF174	32		0			c.C1057A												57.0	63.0	61.0					16																	3458752		2197	4300	6497	SO:0001583	missense	7727	exon3			GAGAGACCCTACA	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1057C>A	16.37:g.3458752C>A	ENSP00000268655:p.Pro353Thr		142	0	0		112	0.00	0	NM_003450	66	0.00	0	Q53Y68|Q9BQ34	Missense_Mutation	SNP	ENST00000268655.4	37	CCDS10504.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880733	0.51801	.	.	ENSG00000103343	ENST00000268655	T	0.56275	0.47	4.72	4.72	0.59763	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46442	D	0.000286	T	0.71264	0.3319	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73069	-0.4099	10	0.66056	D	0.02	.	16.0081	0.80377	0.0:1.0:0.0:0.0	.	353	Q15697	ZN174_HUMAN	T	353	ENSP00000268655:P353T	ENSP00000268655:P353T	P	+	1	0	ZNF174	3398753	1.000000	0.71417	0.998000	0.56505	0.367000	0.29736	5.888000	0.69758	2.906000	0.99361	0.655000	0.94253	CCC			0.532	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251510.1		NM_003450	
PAGR1	79447	mdanderson.org	37	16	29828146	29828146	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:29828146G>T	ENST00000320330.6	+	1	862	c.300G>T	c.(298-300)gcG>gcT	p.A100A	AC009133.20_ENST00000569039.1_RNA|PAGR1_ENST00000609618.1_Silent_p.A100A|AC009133.12_ENST00000564980.1_RNA|AC009133.12_ENST00000569809.1_RNA			Q9BTK6	PAGR1_HUMAN	PAXIP1 associated glutamate-rich protein 1	100	Glu-rich.					histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)											AGCTGCCTGCGGATGGGCAGC	0.682											OREG0023722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A100A													.	.			0			c.G300T												9.0	8.0	8.0					16																	29828146		2156	4253	6409	SO:0001819	synonymous_variant	79447	exon1			GCCTGCGGATGGG	BC003640	CCDS10655.1	16p11.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000185928	ENSG00000185928			28707	protein-coding gene	gene with protein product	"""glutamate-rich coactivator interacting with SRC1/NCOA1"", ""PTIP-associated 1 protein"", ""glutamate-rich coactivator associated with SRC1"""	612033	"""chromosome 16 open reading frame 53"""	C16orf53		17500065, 19039327	Standard	NM_024516		Approved	MGC4606, GAS, PA1	uc002dug.4	Q9BTK6	OTTHUMG00000132117	ENST00000320330.6:c.300G>T	16.37:g.29828146G>T			49	0	0	812	46	0.07	3	NM_024516	259	0.00	0	A2ICR6	Silent	SNP	ENST00000320330.6	37	CCDS10655.1																																																																																					0.682	PAGR1-002	PUTATIVE	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding		OTTHUMT00000473165.1		NM_024516	
CORO1A	11151	mdanderson.org	37	16	30198177	30198177	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:30198177G>T	ENST00000219150.5	+	4	667	c.362G>T	c.(361-363)cGg>cTg	p.R121L	CORO1A_ENST00000570045.1_Missense_Mutation_p.R121L|CORO1A_ENST00000565497.1_Missense_Mutation_p.R121L|RP11-455F5.5_ENST00000568506.1_RNA|RP11-455F5.5_ENST00000566144.1_RNA|RP11-455F5.5_ENST00000567153.1_RNA	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	121					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						CTGCCCCTGCGGGAGCCCGTC	0.642																																					p.R121L													.	.			0			c.G362T												28.0	33.0	31.0					16																	30198177		2197	4299	6496	SO:0001583	missense	11151	exon5			CCCTGCGGGAGCC	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.362G>T	16.37:g.30198177G>T	ENSP00000219150:p.Arg121Leu		54	0	0		37	0.08	3	NM_001193333	171	0.00	0	B2RBL1|Q2YD73	Missense_Mutation	SNP	ENST00000219150.5	37	CCDS10673.1	.	.	.	.	.	.	.	.	.	.	.	17.06	3.292372	0.59976	.	.	ENSG00000102879	ENST00000219150	T	0.01178	5.22	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.199851	0.39341	N	0.001393	T	0.01661	0.0053	N	0.19112	0.55	0.38972	D	0.958767	B;P;B	0.39376	0.059;0.67;0.003	B;P;B	0.48227	0.075;0.571;0.028	T	0.65705	-0.6103	10	0.66056	D	0.02	-10.0415	8.1642	0.31217	0.083:0.1603:0.7567:0.0	.	121;155;121	B4DJS1;Q59G88;P31146	.;.;COR1A_HUMAN	L	121	ENSP00000219150:R121L	ENSP00000219150:R121L	R	+	2	0	CORO1A	30105678	0.992000	0.36948	0.998000	0.56505	0.908000	0.53690	4.462000	0.60121	2.645000	0.89757	0.655000	0.94253	CGG			0.642	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255195.2		NM_007074	
SETD1A	9739	broad.mit.edu;mdanderson.org	37	16	30992480	30992480	+	Silent	SNP	C	C	T	rs377613466		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:30992480C>T	ENST00000262519.8	+	17	5477	c.4791C>T	c.(4789-4791)taC>taT	p.Y1597Y		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1597	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TCATCGAATACGTGGGTCAGA	0.582																																					p.Y1597Y													.	SETD1A	143		0			c.C4791T							C		0,4394		0,0,2197	118.0	107.0	111.0		4791	-3.5	1.0	16		111	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SETD1A	NM_014712.1		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		1597/1708	30992480	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	9739	exon17			CGAATACGTGGGT	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4791C>T	16.37:g.30992480C>T			72	0	0		86	0.06	5	NM_014712	188	0.01	1	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	37	CCDS32435.1																																																																																					0.582	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318244.2		NM_014712	
RLTPR	146206	mdanderson.org	37	16	67683467	67683467	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:67683467G>A	ENST00000334583.6	+	20	2192	c.1864G>A	c.(1864-1866)Ggg>Agg	p.G622R	RLTPR_ENST00000545661.1_Missense_Mutation_p.G586R	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	622	Tropomodulin-like.				cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		CAACGCCATGGGGGACGCGGG	0.701																																					p.G622R													.	.			0			c.G1864A												22.0	26.0	25.0					16																	67683467		1966	4132	6098	SO:0001583	missense	146206	exon20			GCCATGGGGGACG	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1864G>A	16.37:g.67683467G>A	ENSP00000334958:p.Gly622Arg		18	0	0		9	0.22	2	NM_001013838	7	0.00	0	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	37	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	G	35	5.496153	0.96355	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.71934	-0.61;-0.61	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.87285	0.6139	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89672	0.3884	10	0.62326	D	0.03	-8.4601	18.1015	0.89507	0.0:0.0:1.0:0.0	.	586;622	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	R	622;586	ENSP00000334958:G622R;ENSP00000441481:G586R	ENSP00000334958:G622R	G	+	1	0	RLTPR	66240968	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	9.869000	0.99810	2.390000	0.81377	0.561000	0.74099	GGG			0.701	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000467858.1		NM_001013838	
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	70913326	70913326	+	Silent	SNP	C	C	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:70913326C>G	ENST00000393567.2	-	62	10581	c.10431G>C	c.(10429-10431)gtG>gtC	p.V3477V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3477					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCACAACCGTCACTCGAGGGA	0.552																																					p.V3477V													.	.			0			c.G10431C												21.0	24.0	23.0					16																	70913326		1839	4087	5926	SO:0001819	synonymous_variant	54768	exon62			AACCGTCACTCGA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10431G>C	16.37:g.70913326C>G			81	0	0		63	0.30	19	NM_001270974	12	0.17	2	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																					0.552	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000398624.3			
ZNF469	84627	mdanderson.org	37	16	88498332	88498332	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr16:88498332C>T	ENST00000437464.1	+	2	4370	c.4370C>T	c.(4369-4371)gCc>gTc	p.A1457V	ZNF469_ENST00000565624.1_Missense_Mutation_p.A1485V	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1457	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						TTCGCATGTGCCGACCCTCCC	0.592																																					p.A1457V													.	.			0			c.C4370T												115.0	95.0	101.0					16																	88498332		692	1591	2283	SO:0001583	missense	84627	exon2			CATGTGCCGACCC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.4370C>T	16.37:g.88498332C>T	ENSP00000402343:p.Ala1457Val		59	0	0		34	0.09	3	NM_001127464	15	0.00	0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	13.56	2.275137	0.40194	.	.	ENSG00000225614	ENST00000437464	T	0.06768	3.26	4.38	-0.469	0.12142	.	.	.	.	.	T	0.03783	0.0107	N	0.19112	0.55	0.09310	N	1	P	0.35575	0.51	B	0.23275	0.045	T	0.38714	-0.9648	9	0.54805	T	0.06	.	3.4959	0.07654	0.1565:0.4672:0.2752:0.1011	.	1457	Q96JG9	ZN469_HUMAN	V	1457	ENSP00000402343:A1457V	ENSP00000402343:A1457V	A	+	2	0	ZNF469	87025833	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.767000	0.26575	0.276000	0.22118	0.561000	0.74099	GCC			0.592	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NG_012236	
KRT16P1	729252	broad.mit.edu	37	17	18345954	18345955	+	RNA	DEL	CA	CA	-	rs200950667	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:18345954_18345955delCA	ENST00000581027.1	+	0	1012									keratin 16 pseudogene 1																		TTCTCTCTCCCACAGTCTTCAC	0.614														2244	0.448083	0.3464	0.5187	5008	,	,		25130	0.371		0.5964	False		,,,				2504	0.4622				.													.	.			0			.																																											0	.			CTCTCCCACAGTC			17p11.2	2012-08-13	2010-02-25	2010-02-25	ENSG00000214856	ENSG00000214856			6420	pseudogene	pseudogene			"""keratin 14 pseudogene"""	KRT14P			Standard	NR_073414		Approved		uc010vya.2		OTTHUMG00000059249		17.37:g.18345956_18345957delCA			44	0.2954545455	13		39	0.21	8	.	0		0		RNA	DEL	ENST00000581027.1	37																																																																																						0.614	KRT16P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446576.1		NG_007001	
RHBDL3	162494	broad.mit.edu	37	17	30615824	30615824	+	Missense_Mutation	SNP	G	G	T	rs140645420		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:30615824G>T	ENST00000269051.4	+	4	322	c.308G>T	c.(307-309)cGt>cTt	p.R103L	RHBDL3_ENST00000536287.1_Missense_Mutation_p.R5L|RHBDL3_ENST00000538145.1_Missense_Mutation_p.R95L	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	103	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				AGCAACAAGCGTTCCAACAGC	0.622																																					p.R103L													.	RHBDL3	49		0			c.G308T												37.0	32.0	34.0					17																	30615824		2203	4300	6503	SO:0001583	missense	162494	exon4			ACAAGCGTTCCAA	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.308G>T	17.37:g.30615824G>T	ENSP00000269051:p.Arg103Leu		175	0.0057142857	1		209	0.02	4	NM_138328	21	0.00	0	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	ENST00000269051.4	37	CCDS32613.1	.	.	.	.	.	.	.	.	.	.	G	32	5.113351	0.94339	.	.	ENSG00000141314	ENST00000431505;ENST00000269051;ENST00000538145;ENST00000536287	T;T;T;T	0.66995	-0.24;0.39;0.78;0.81	5.69	5.69	0.88448	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.74831	0.3768	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.997;0.994;0.994	T	0.77256	-0.2655	10	0.72032	D	0.01	-9.8586	19.8011	0.96507	0.0:0.0:1.0:0.0	.	103;95;103	E9PD28;Q495Y5;P58872	.;.;RHBL3_HUMAN	L	103;103;95;5	ENSP00000394849:R103L;ENSP00000269051:R103L;ENSP00000442092:R95L;ENSP00000466508:R5L	ENSP00000269051:R103L	R	+	2	0	RHBDL3	27639937	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.476000	0.97823	2.679000	0.91253	0.561000	0.74099	CGT			0.622	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000447120.1		NM_138328	
TMEM132E	124842	mdanderson.org	37	17	32964258	32964258	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:32964258C>T	ENST00000321639.5	+	10	2290	c.1962C>T	c.(1960-1962)taC>taT	p.Y654Y		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	654						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		TCTCCCTCTACAGCCCACGAG	0.602																																					p.Y654Y													.	.			0			c.C1962T												95.0	84.0	87.0					17																	32964258		2203	4300	6503	SO:0001819	synonymous_variant	124842	exon10			CCTCTACAGCCCA	BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.1962C>T	17.37:g.32964258C>T			105	0	0		64	0.06	4	NM_207313	6	0.00	0	Q8WUF4|Q8WVA5	Silent	SNP	ENST00000321639.5	37	CCDS11283.1																																																																																					0.602	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256440.2		NM_207313	
ERBB2	2064	broad.mit.edu	37	17	37868702	37868702	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr17:37868702G>T	ENST00000269571.5	+	9	1307		c.e9+1		ERBB2_ENST00000406381.2_Splice_Site|ERBB2_ENST00000541774.1_Splice_Site|ERBB2_ENST00000445658.2_Splice_Site|ERBB2_ENST00000540147.1_Splice_Site|ERBB2_ENST00000584601.1_Splice_Site|ERBB2_ENST00000540042.1_Splice_Site|ERBB2_ENST00000578199.1_Splice_Site|ERBB2_ENST00000584450.1_Splice_Site			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2						axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GCTTTGATGGGTAAGAGTGGG	0.552		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											.				Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429		0			c.1058+1G>T												59.0	47.0	51.0					17																	37868702		2203	4300	6503	SO:0001630	splice_region_variant	2064	exon12			TGATGGGTAAGAG	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1148+1G>T	17.37:g.37868702G>T			135	0	0		128	0.03	4	NM_001005862	9	0.00	0	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Splice_Site	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512213	0.85389	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147;ENST00000540042	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7276	0.91720	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERBB2	35122228	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.848000	0.92172	2.725000	0.93324	0.591000	0.81541	.			0.552	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445621.2			Intron
MKNK2	2872	mdanderson.org	37	19	2043519	2043519	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:2043519G>T	ENST00000591601.1	-	5	437	c.402C>A	c.(400-402)taC>taA	p.Y134*	MKNK2_ENST00000250896.3_Nonsense_Mutation_p.Y134*|MKNK2_ENST00000309340.7_Nonsense_Mutation_p.Y134*|MKNK2_ENST00000588014.1_5'Flank|MKNK2_ENST00000591142.1_5'Flank|MKNK2_ENST00000591588.1_5'Flank|MKNK2_ENST00000541165.1_Nonsense_Mutation_p.Y3*			Q9HBH9	MKNK2_HUMAN	MAP kinase interacting serine/threonine kinase 2	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|cellular response to arsenic-containing substance (GO:0071243)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|hemopoiesis (GO:0030097)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(3)|large_intestine(3)|lung(3)	10		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGCACTGGTACAGCATCT	0.587																																					p.Y134X													.	.			0			c.C402A												159.0	109.0	126.0					19																	2043519		2203	4300	6503	SO:0001587	stop_gained	2872	exon6			GCACTGGTACAGC	AF125532	CCDS12079.1, CCDS12080.1	19p13.3	2012-12-20			ENSG00000099875	ENSG00000099875			7111	protein-coding gene	gene with protein product	"""Putative map kinase interacting kinase"""	605069	"""G protein-coupled receptor kinase 7"""	GPRK7		11013076	Standard	NM_199054		Approved	MNK2	uc002lus.2	Q9HBH9	OTTHUMG00000180020	ENST00000591601.1:c.402C>A	19.37:g.2043519G>T	ENSP00000467811:p.Tyr134*		82	0	0		53	0.06	3	NM_017572	152	0.00	0	Q6GPI3|Q9HBH8|Q9UHR0|Q9Y2N6	Nonsense_Mutation	SNP	ENST00000591601.1	37	CCDS12080.1	.	.	.	.	.	.	.	.	.	.	G	38	6.700397	0.97772	.	.	ENSG00000099875	ENST00000309340;ENST00000250896;ENST00000541165;ENST00000545627	.	.	.	4.47	2.19	0.27852	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0814	5.7137	0.17948	0.4211:0.0:0.5789:0.0	.	.	.	.	X	134;134;3;87	.	ENSP00000250896:Y134X	Y	-	3	2	MKNK2	1994519	0.127000	0.22367	1.000000	0.80357	0.983000	0.72400	-0.527000	0.06200	0.207000	0.20607	-0.367000	0.07326	TAC			0.587	MKNK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000449312.1		NM_199054	
VAV1	7409	mdanderson.org	37	19	6833570	6833570	+	Missense_Mutation	SNP	C	C	T	rs527259397		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:6833570C>T	ENST00000602142.1	+	17	1724	c.1642C>T	c.(1642-1644)Cgg>Tgg	p.R548W	VAV1_ENST00000599806.1_Missense_Mutation_p.R493W|VAV1_ENST00000596764.1_Missense_Mutation_p.R516W|VAV1_ENST00000539284.1_Missense_Mutation_p.R451W|VAV1_ENST00000304076.2_Missense_Mutation_p.R548W	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	548					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCGCTGCCATCGGTGCCGGGC	0.562																																					p.R548W													.	.			0			c.C1642T												114.0	111.0	112.0					19																	6833570		2203	4300	6503	SO:0001583	missense	7409	exon17			TGCCATCGGTGCC		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1642C>T	19.37:g.6833570C>T	ENSP00000472929:p.Arg548Trp		94	0	0		56	0.05	3	NM_005428	23	0.00	0	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509681	0.64522	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D;D	0.91351	-2.83;-2.83	4.73	2.47	0.30058	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.125701	0.53938	D	0.000052	D	0.93223	0.7841	M	0.64997	1.995	0.53005	D	0.999965	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74674	0.945;0.984;0.948;0.964	D	0.92145	0.5723	10	0.72032	D	0.01	.	11.0411	0.47831	0.3491:0.6509:0.0:0.0	.	451;548;493;548	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	W	548;451	ENSP00000302269:R548W;ENSP00000443242:R451W	ENSP00000302269:R548W	R	+	1	2	VAV1	6784570	0.742000	0.28228	0.752000	0.31206	0.869000	0.49853	1.441000	0.35035	0.365000	0.24400	0.491000	0.48974	CGG			0.562	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458475.1			
CERS4	79603	mdanderson.org	37	19	8326962	8326962	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:8326962G>T	ENST00000251363.5	+	12	1454	c.1154G>T	c.(1153-1155)cGt>cTt	p.R385L	CERS4_ENST00000559336.1_Missense_Mutation_p.R297L|CERS4_ENST00000559450.1_Missense_Mutation_p.R385L|CERS4_ENST00000595722.1_3'UTR|CERS4_ENST00000558331.1_Missense_Mutation_p.R334L	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	385					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GTGGCCGGGCGTCTGACCAAC	0.687																																					p.R385L													.	.			0			c.G1154T												6.0	8.0	7.0					19																	8326962		2135	4203	6338	SO:0001583	missense	79603	exon12			CCGGGCGTCTGAC		CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.1154G>T	19.37:g.8326962G>T	ENSP00000251363:p.Arg385Leu		30	0	0		21	0.14	3	NM_024552	159	0.01	1	D6W665	Missense_Mutation	SNP	ENST00000251363.5	37	CCDS12197.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118650	0.37436	.	.	ENSG00000090661	ENST00000251363	T	0.05513	3.43	4.94	-4.27	0.03744	.	6.780140	0.00166	N	0.000011	T	0.06416	0.0165	L	0.45581	1.43	0.09310	N	1	P;P	0.38827	0.649;0.649	B;B	0.32090	0.14;0.14	T	0.40942	-0.9536	10	0.27785	T	0.31	-15.0369	10.3423	0.43887	0.5916:0.0:0.4083:0.0	.	385;385	Q53HF9;Q9HA82	.;CERS4_HUMAN	L	385	ENSP00000251363:R385L	ENSP00000251363:R385L	R	+	2	0	CERS4	8232962	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.118000	0.10692	-0.671000	0.05274	-0.333000	0.08304	CGT			0.687	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419200.1		NM_024552	
BRD4	23476	mdanderson.org	37	19	15353857	15353857	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:15353857A>G	ENST00000263377.2	-	14	3244	c.3023T>C	c.(3022-3024)aTc>aCc	p.I1008T		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1008					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGGCTGTTGGATGTGGGTGGA	0.716			T	C15orf55	lethal midline carcinoma of young people																																p.I1008T				Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	.			0			c.T3023C												2.0	3.0	3.0					19																	15353857		1701	3503	5204	SO:0001583	missense	23476	exon14			TGTTGGATGTGGG	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3023T>C	19.37:g.15353857A>G	ENSP00000263377:p.Ile1008Thr		29	0.0344827586	1		24	0.13	3	NM_058243	14	0.00	0	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	A	4.055	0.007975	0.07866	.	.	ENSG00000141867	ENST00000263377	T	0.28666	1.6	4.1	4.1	0.47936	.	0.947923	0.08594	U	0.922592	T	0.19248	0.0462	N	0.14661	0.345	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.05305	-1.0893	10	0.30078	T	0.28	-10.8709	8.6195	0.33853	0.8059:0.1941:0.0:0.0	.	1008	O60885	BRD4_HUMAN	T	1008	ENSP00000263377:I1008T	ENSP00000263377:I1008T	I	-	2	0	BRD4	15214857	1.000000	0.71417	0.905000	0.35620	0.216000	0.24613	4.603000	0.61105	1.491000	0.48482	0.379000	0.24179	ATC			0.716	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000465800.3		NM_058243	
FBXO17	115290	mdanderson.org	37	19	39435736	39435736	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:39435736G>T	ENST00000292852.4	-	5	907	c.566C>A	c.(565-567)gCt>gAt	p.A189D	FBXO17_ENST00000595329.1_Missense_Mutation_p.A189D|SARS2_ENST00000448145.2_Missense_Mutation_p.A24D|CTC-360G5.8_ENST00000599996.1_Silent_p.R93R	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	189	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GTTCTCTCGAGCGCCCCACCT	0.627																																					p.A198D													.	.			0			c.C593A												53.0	50.0	51.0					19																	39435736		2203	4300	6503	SO:0001583	missense	115290	exon5			TCTCGAGCGCCCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.566C>A	19.37:g.39435736G>T	ENSP00000292852:p.Ala189Asp		87	0	0		36	0.08	3	NM_148169	161	0.00	0	Q96LQ4	Missense_Mutation	SNP	ENST00000292852.4	37	CCDS12526.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.158888	0.38119	.	.	ENSG00000104835	ENST00000448145;ENST00000392076;ENST00000292852	T;T	0.28666	1.6;1.6	4.58	4.58	0.56647	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.118955	0.35870	N	0.002926	T	0.46889	0.1416	L	0.53249	1.67	.	.	.	D;D	0.76494	0.993;0.999	D;D	0.87578	0.929;0.998	T	0.35201	-0.9798	9	0.11182	T	0.66	.	15.2292	0.73374	0.0:0.0:1.0:0.0	.	24;189	E7EX87;Q96EF6	.;FBX17_HUMAN	D	24;198;189	ENSP00000399330:A24D;ENSP00000292852:A189D	ENSP00000292852:A189D	A	-	2	0	FBXO17	44127576	1.000000	0.71417	0.889000	0.34880	0.189000	0.23516	6.026000	0.70873	2.530000	0.85305	0.467000	0.42956	GCT			0.627	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463273.1		NM_024907	
ELSPBP1	64100	mdanderson.org	37	19	48517554	48517554	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:48517554G>T	ENST00000339841.2	+	3	375	c.197G>T	c.(196-198)tGc>tTc	p.C66F	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	66	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		TGGAAGTACTGCCAGAGTGAA	0.478																																					p.C66F													ELSPBP1,brain,glioma,+1,1	ELSPBP1	1	1	0			c.G197T												145.0	126.0	133.0					19																	48517554		2203	4300	6503	SO:0001583	missense	64100	exon3			AGTACTGCCAGAG	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.197G>T	19.37:g.48517554G>T	ENSP00000340660:p.Cys66Phe		97	0	0		71	0.06	4	NM_022142	0		0	Q96RT0|Q9H4C8	Missense_Mutation	SNP	ENST00000339841.2	37	CCDS12708.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804879	0.31961	.	.	ENSG00000169393	ENST00000339841	D	0.91996	-2.95	3.27	2.23	0.28157	Fibronectin, type II, collagen-binding (4);Kringle-like fold (2);	0.000000	0.38663	N	0.001617	D	0.96442	0.8839	H	0.96111	3.77	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89321	0.3640	10	0.72032	D	0.01	.	6.2031	0.20587	0.1387:0.0:0.8613:0.0	.	66	Q96BH3	ESPB1_HUMAN	F	66	ENSP00000340660:C66F	ENSP00000340660:C66F	C	+	2	0	ELSPBP1	53209366	0.075000	0.21258	0.004000	0.12327	0.013000	0.08279	2.433000	0.44793	0.929000	0.37192	0.544000	0.68410	TGC			0.478	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465207.1			
RPL18	6141	mdanderson.org	37	19	49119198	49119198	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:49119198G>T	ENST00000549920.1	-	6	819	c.427C>A	c.(427-429)Cgc>Agc	p.R143S	RPL18_ENST00000549273.1_Missense_Mutation_p.R143S|FAM83E_ENST00000595110.1_5'Flank|FAM83E_ENST00000263266.3_5'Flank|RPL18_ENST00000552588.1_Missense_Mutation_p.R114S|RPL18_ENST00000550645.1_Intron	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18	143					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		CGGCCCTTGCGAGGACCTAGG	0.652																																					p.R143S													.	.			0			c.C427A												36.0	37.0	36.0					19																	49119198		2203	4300	6503	SO:0001583	missense	6141	exon6			CCTTGCGAGGACC	L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.427C>A	19.37:g.49119198G>T	ENSP00000447001:p.Arg143Ser		60	0	0		32	0.09	3	NM_000979	3704	0.00	1	F8VWC5|Q8WTZ6	Missense_Mutation	SNP	ENST00000549920.1	37	CCDS12726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.371362|5.371362	0.95923|0.95923	.|.	.|.	ENSG00000063177|ENSG00000063177	ENST00000549920;ENST00000552588;ENST00000549273;ENST00000550973|ENST00000084795;ENST00000546623	.|.	.|.	.|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.87237|.	0.6127|.	H|H	0.95539|0.95539	3.685|3.685	0.80722|0.80722	D|D	1|1	D|.	0.59357|.	0.985|.	P|.	0.58391|.	0.838|.	D|.	0.90792|.	0.4687|.	9|.	0.87932|.	D|.	0|.	-15.3994|-15.3994	16.7117|16.7117	0.85387|0.85387	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	143|.	Q07020|.	RL18_HUMAN|.	S|X	143;114;143;91|144;121	.|.	ENSP00000449610:R143S|.	R|S	-|-	1|2	0|0	RPL18|RPL18	53811010|53811010	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.951000|0.951000	0.60555|0.60555	5.240000|5.240000	0.65378|0.65378	2.627000|2.627000	0.88993|0.88993	0.467000|0.467000	0.42956|0.42956	CGC|TCG			0.652	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405732.2		NM_000979	
HRC	3270	mdanderson.org	37	19	49656771	49656771	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:49656771T>C	ENST00000252825.4	-	1	1910	c.1724A>G	c.(1723-1725)gAg>gGg	p.E575G	HRC_ENST00000595625.1_Missense_Mutation_p.E575G	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	575					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		ctccagcccctcctcctcctc	0.637																																					p.E575G	Melanoma(37;75 1097 24567 25669 30645)												.	.			0			c.A1724G												49.0	33.0	38.0					19																	49656771		2203	4300	6503	SO:0001583	missense	3270	exon1			AGCCCCTCCTCCT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1724A>G	19.37:g.49656771T>C	ENSP00000252825:p.Glu575Gly		63	0	0		42	0.07	3	NM_002152	15	0.00	0	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	T	4.314	0.057620	0.08339	.	.	ENSG00000130528	ENST00000252825;ENST00000391863	T	0.47177	0.85	2.41	-2.75	0.05914	.	.	.	.	.	T	0.29914	0.0748	L	0.40543	1.245	0.20821	N	0.999846	B	0.12630	0.006	B	0.12837	0.008	T	0.20974	-1.0259	9	0.27082	T	0.32	.	2.3326	0.04239	0.4091:0.2796:0.0:0.3112	.	575	P23327	SRCH_HUMAN	G	575;265	ENSP00000252825:E575G	ENSP00000252825:E575G	E	-	2	0	HRC	54348583	0.004000	0.15560	0.193000	0.23327	0.258000	0.26162	0.473000	0.22132	-0.764000	0.04651	0.232000	0.17820	GAG			0.637	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465649.1		NM_002152	
PRR12	57479	mdanderson.org	37	19	50100336	50100336	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:50100336G>T	ENST00000418929.2	+	4	2756	c.2744G>T	c.(2743-2745)aGc>aTc	p.S915I		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0	Pro-rich.						DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GCCTACCGCAGCCCCAGCCCG	0.682																																					p.S915I													.	.			0			c.G2744T												6.0	9.0	8.0					19																	50100336		1973	4084	6057	SO:0001583	missense	57479	exon4			ACCGCAGCCCCAG	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.2744G>T	19.37:g.50100336G>T	ENSP00000394510:p.Ser915Ile		98	0	0		41	0.07	3	NM_020719	96	0.00	0	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348669	0.24426	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.63	3.57	0.40892	.	0.000000	0.50627	D	0.000114	T	0.54271	0.1848	L	0.43152	1.355	0.41300	D	0.987038	B	0.06786	0.001	B	0.10450	0.005	T	0.56257	-0.8009	9	0.72032	D	0.01	-23.8515	12.9627	0.58468	0.0:0.0:0.8364:0.1636	.	915	Q9ULL5-3	.	I	915;95;95	.	ENSP00000246798:S95I	S	+	2	0	PRR12	54792148	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	2.636000	0.46545	1.133000	0.42147	0.313000	0.20887	AGC			0.682	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465915.1		NM_020719	
SIGLEC8	27181	mdanderson.org	37	19	51958842	51958842	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:51958842C>T	ENST00000321424.3	-	4	947	c.881G>A	c.(880-882)aGc>aAc	p.S294N	SIGLEC8_ENST00000597352.1_5'UTR|SIGLEC8_ENST00000430817.1_Missense_Mutation_p.S185N|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.S201N	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	294	Ig-like C2-type 2.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCGGGTCCAGCTCAGCCTGGC	0.627																																					p.S294N													SIGLEC8,NS,carcinoma,+1,1	SIGLEC8	1	1	0			c.G881A												56.0	56.0	56.0					19																	51958842		2203	4300	6503	SO:0001583	missense	27181	exon4			GTCCAGCTCAGCC	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.881G>A	19.37:g.51958842C>T	ENSP00000321077:p.Ser294Asn		91	0	0		45	0.07	3	NM_014442	5	0.00	0	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	15.42	2.827082	0.50739	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.12984	2.63;2.63;2.63	2.19	-0.435	0.12279	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.780759	0.10858	N	0.626477	T	0.37945	0.1022	M	0.88640	2.97	0.09310	N	1	D;D;D	0.89917	0.999;1.0;0.963	D;D;D	0.78314	0.978;0.991;0.931	T	0.11131	-1.0600	10	0.59425	D	0.04	.	7.5588	0.27839	0.0:0.4677:0.5322:0.0	.	185;201;294	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	N	185;294;201	ENSP00000389142:S185N;ENSP00000321077:S294N;ENSP00000339448:S201N	ENSP00000321077:S294N	S	-	2	0	SIGLEC8	56650654	0.739000	0.28196	0.086000	0.20670	0.462000	0.32619	0.923000	0.28757	-0.004000	0.14419	0.502000	0.49764	AGC			0.627	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463648.2		NM_014442	
PRPF31	26121	mdanderson.org	37	19	54629912	54629912	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:54629912C>T	ENST00000321030.4	+	9	1214	c.865C>T	c.(865-867)Cgg>Tgg	p.R289W	PRPF31_ENST00000419967.1_Missense_Mutation_p.R289W|PRPF31_ENST00000498612.1_3'UTR|AC012314.8_ENST00000452097.1_RNA|PRPF31_ENST00000391755.1_Missense_Mutation_p.R289W	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	289	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGATCTGCGGCGGAAAGCGGC	0.617																																					p.R289W													.	.			0			c.C865T												23.0	25.0	24.0					19																	54629912		2202	4299	6501	SO:0001583	missense	26121	exon9			CTGCGGCGGAAAG	AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.865C>T	19.37:g.54629912C>T	ENSP00000324122:p.Arg289Trp		84	0	0		66	0.08	5	NM_015629	201	0.00	0	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Missense_Mutation	SNP	ENST00000321030.4	37	CCDS12879.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899757	0.72754	.	.	ENSG00000105618	ENST00000321030;ENST00000263436;ENST00000419967;ENST00000391755	T;T;T	0.63744	-0.06;-0.06;-0.06	5.56	4.51	0.55191	Pre-mRNA processing ribonucleoprotein, snoRNA-binding domain (1);	0.049113	0.85682	D	0.000000	T	0.81856	0.4911	M	0.91300	3.195	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.992	D	0.85385	0.1122	10	0.66056	D	0.02	-44.8434	12.3604	0.55199	0.4162:0.5838:0.0:0.0	.	289;289	E7ESA8;Q8WWY3	.;PRP31_HUMAN	W	289	ENSP00000324122:R289W;ENSP00000405166:R289W;ENSP00000375635:R289W	ENSP00000263436:R289W	R	+	1	2	PRPF31	59321724	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.885000	0.48570	1.474000	0.48178	0.655000	0.94253	CGG			0.617	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000141417.2			
EPN1	29924	mdanderson.org	37	19	56196955	56196955	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr19:56196955G>T	ENST00000270460.6	+	3	733	c.422G>T	c.(421-423)cGg>cTg	p.R141L	EPN1_ENST00000411543.2_Missense_Mutation_p.R252L|AC010525.2_ENST00000390145.1_RNA|EPN1_ENST00000591743.1_3'UTR|EPN1_ENST00000085079.7_Missense_Mutation_p.R141L	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	141	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		GACCGGCTGCGGGAAGAGCGG	0.667																																					p.R252L													.	.			0			c.G755T												29.0	34.0	32.0					19																	56196955		2191	4291	6482	SO:0001583	missense	29924	exon4			GGCTGCGGGAAGA	AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.422G>T	19.37:g.56196955G>T	ENSP00000270460:p.Arg141Leu		37	0	0		31	0.10	3	NM_001130071	388	0.00	0	Q86ST3|Q9HA18	Missense_Mutation	SNP	ENST00000270460.6	37	CCDS46199.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721414	0.68959	.	.	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.49720	0.77;0.77;0.77	4.74	4.74	0.60224	ENTH/VHS (2);Epsin-like, N-terminal (2);	0.057992	0.64402	D	0.000004	T	0.66076	0.2753	M	0.86420	2.815	0.80722	D	1	B;D;P;P	0.76494	0.298;0.999;0.711;0.886	B;D;B;P	0.63113	0.41;0.911;0.24;0.596	T	0.70702	-0.4799	10	0.87932	D	0	-23.654	7.3169	0.26505	0.1812:0.0:0.8187:0.0	.	102;252;141;141	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	L	141;141;102;252	ENSP00000270460:R141L;ENSP00000085079:R141L;ENSP00000406209:R252L	ENSP00000085079:R141L	R	+	2	0	EPN1	60888767	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.241000	0.58707	2.639000	0.89480	0.555000	0.69702	CGG			0.667	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453610.1		NM_013333	
EML6	400954	broad.mit.edu	37	2	55106753	55106753	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:55106753A>G	ENST00000356458.6	+	16	2934	c.2414A>G	c.(2413-2415)aAg>aGg	p.K805R		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	805						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GACTGGAAAAAGGGAGAAAAG	0.403																																					p.K805R													.	EML6	85		0			c.A2414G												221.0	202.0	207.0					2																	55106753		692	1591	2283	SO:0001583	missense	400954	exon16			GGAAAAAGGGAGA		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.2414A>G	2.37:g.55106753A>G	ENSP00000348842:p.Lys805Arg		205	0	0		203	0.02	5	NM_001039753	6	0.00	0	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	37	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.949118	0.34377	.	.	ENSG00000214595	ENST00000356458	T	0.04862	3.54	5.64	4.49	0.54785	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.32970	U	0.005440	T	0.07234	0.0183	L	0.45470	1.425	0.39951	D	0.974533	B	0.13594	0.008	B	0.17979	0.02	T	0.21655	-1.0239	10	0.26408	T	0.33	.	11.0079	0.47646	0.9268:0.0:0.0732:0.0	.	805	Q6ZMW3	EMAL6_HUMAN	R	805	ENSP00000348842:K805R	ENSP00000348842:K805R	K	+	2	0	EML6	54960257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.539000	0.53604	0.985000	0.38656	0.482000	0.46254	AAG			0.403	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000324997.3		XM_001725002	
CCDC85A	114800	mdanderson.org	37	2	56411850	56411850	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:56411850G>T	ENST00000407595.2	+	1	593	c.91G>T	c.(91-93)Gcg>Tcg	p.A31S	RP11-482H16.1_ENST00000607540.1_RNA|AC007743.1_ENST00000447423.2_RNA|AC007743.1_ENST00000432793.1_RNA|AC007743.1_ENST00000596663.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	31	Ala-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ggccccgcccgcgccggTGGA	0.741																																					p.A31S													.	.			0			c.G91T												4.0	7.0	6.0					2																	56411850		1202	2442	3644	SO:0001583	missense	114800	exon1			CCGCCCGCGCCGG	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.91G>T	2.37:g.56411850G>T	ENSP00000384040:p.Ala31Ser		29	0	0		25	0.08	2	NM_001080433	3	0.00	0		Missense_Mutation	SNP	ENST00000407595.2	37	CCDS46290.1	.	.	.	.	.	.	.	.	.	.	G	2.358	-0.347287	0.05208	.	.	ENSG00000055813	ENST00000407595	.	.	.	2.55	0.578	0.17391	.	0.519804	0.19694	N	0.108188	T	0.23014	0.0556	N	0.24115	0.695	0.09310	N	0.999992	B	0.20164	0.042	B	0.23419	0.046	T	0.16867	-1.0388	9	0.20519	T	0.43	-13.3097	5.4215	0.16403	0.2957:0.0:0.7043:0.0	.	31	Q96PX6	CC85A_HUMAN	S	31	.	ENSP00000384040:A31S	A	+	1	0	CCDC85A	56265354	.	.	0.028000	0.17463	0.174000	0.22865	.	.	0.148000	0.19059	0.416000	0.27883	GCG			0.741	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324993.1			
MAT2A	4144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	85769043	85769043	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:85769043A>G	ENST00000306434.3	+	5	620	c.497A>G	c.(496-498)gAa>gGa	p.E166G	MAT2A_ENST00000490878.1_3'UTR|MAT2A_ENST00000409017.1_Missense_Mutation_p.E103G	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	166					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	AAACTGGCAGAACTACGCCGT	0.418																																					p.E166G													.	.			0			c.A497G												111.0	92.0	98.0					2																	85769043		2203	4300	6503	SO:0001583	missense	4144	exon5			TGGCAGAACTACG		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.497A>G	2.37:g.85769043A>G	ENSP00000303147:p.Glu166Gly		88	0	0		100	0.26	26	NM_005911	514	0.30	156	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	37	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.563306	0.86335	.	.	ENSG00000168906	ENST00000306434;ENST00000409017	D;D	0.83992	-1.79;-1.79	5.89	5.89	0.94794	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89639	0.6773	M	0.89214	3.015	0.80722	D	1	P;P	0.43701	0.557;0.815	P;P	0.50231	0.635;0.635	D	0.91283	0.5053	10	0.87932	D	0	-19.9176	14.263	0.66097	1.0:0.0:0.0:0.0	.	166;166	B4DEX8;P31153	.;METK2_HUMAN	G	166;103	ENSP00000303147:E166G;ENSP00000386353:E103G	ENSP00000303147:E166G	E	+	2	0	MAT2A	85622554	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.962000	0.93254	2.257000	0.74773	0.460000	0.39030	GAA			0.418	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252491.2		NM_005911	
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			153	0.0392156863	6		159	0.11	17	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
TTN	7273	broad.mit.edu	37	2	179473629	179473629	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:179473629G>A	ENST00000591111.1	-	224	47410	c.47186C>T	c.(47185-47187)cCg>cTg	p.P15729L	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P17370L|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P8430L|TTN_ENST00000460472.2_Missense_Mutation_p.P8305L|TTN_ENST00000342992.6_Missense_Mutation_p.P14802L|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P8497L|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15729					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTGGTCCCGGTGTATCTAA	0.388																																					p.P17370L													TTN_ENST00000359218,NS,carcinoma,+1,10	TTN	18412	10	0			c.C52109T												110.0	104.0	106.0					2																	179473629		1837	4079	5916	SO:0001583	missense	7273	exon274			GGTCCCGGTGTAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.47186C>T	2.37:g.179473629G>A	ENSP00000465570:p.Pro15729Leu		45	0	0		63	0.05	3	NM_001267550	0		0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	13.08	2.129271	0.37533	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	5.64	5.64	0.86602	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95404	0.8508	M	0.93106	3.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.95963	0.8963	9	0.87932	D	0	.	19.7069	0.96076	0.0:0.0:1.0:0.0	.	8305;8430;8497;15729	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	14802;8305;8497;8430;8305	ENSP00000343764:P14802L;ENSP00000434586:P8305L;ENSP00000340554:P8497L;ENSP00000352154:P8430L	ENSP00000340554:P8497L	P	-	2	0	TTN	179181874	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.807000	0.99171	2.654000	0.90174	0.563000	0.77884	CCG			0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
INO80D	54891	broad.mit.edu	37	2	206869700	206869700	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:206869700G>T	ENST00000403263.1	-	11	2880	c.2476C>A	c.(2476-2478)Cat>Aat	p.H826N	Vault_ENST00000516676.1_RNA	NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	826					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						TGGCTTCCATGGGGTGAGGAG	0.527																																					p.H826N													.	INO80D	134		0			c.C2476A												272.0	261.0	264.0					2																	206869700		2148	4265	6413	SO:0001583	missense	54891	exon11			TTCCATGGGGTGA		CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.2476C>A	2.37:g.206869700G>T	ENSP00000384198:p.His826Asn		146	0	0		122	0.02	3	NM_017759	5	0.00	0	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	ENST00000403263.1	37	CCDS46500.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576541	0.45902	.	.	ENSG00000114933	ENST00000403263;ENST00000233270	T	0.31510	1.49	5.91	5.91	0.95273	.	0.210963	0.50627	D	0.000104	T	0.23492	0.0568	N	0.14661	0.345	0.47819	D	0.999526	B	0.26547	0.152	B	0.21917	0.037	T	0.03673	-1.1014	10	0.46703	T	0.11	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	826	Q53TQ3-2	.	N	826	ENSP00000384198:H826N	ENSP00000233270:H826N	H	-	1	0	INO80D	206577945	1.000000	0.71417	0.992000	0.48379	0.854000	0.48673	9.230000	0.95299	2.793000	0.96121	0.655000	0.94253	CAT			0.527	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336459.1		NM_017759	
DYTN	391475	mdanderson.org	37	2	207559536	207559536	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:207559536C>T	ENST00000452335.2	-	8	901	c.785G>A	c.(784-786)aGc>aAc	p.S262N		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	262						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		ATGGGACTTGCTGTGAAGACC	0.398																																					p.S262N													.	.			0			c.G785A												127.0	125.0	126.0					2																	207559536		1935	4152	6087	SO:0001583	missense	391475	exon8			GACTTGCTGTGAA	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.785G>A	2.37:g.207559536C>T	ENSP00000396593:p.Ser262Asn		70	0	0		52	0.06	3	NM_001093730	0		0		Missense_Mutation	SNP	ENST00000452335.2	37	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466914	0.63625	.	.	ENSG00000232125	ENST00000452335	D	0.91686	-2.89	5.22	1.15	0.20763	Zinc finger, ZZ-type (3);	.	.	.	.	D	0.84465	0.5478	L	0.28192	0.835	0.21416	N	0.999691	B	0.14012	0.009	B	0.12837	0.008	T	0.74022	-0.3798	9	0.62326	D	0.03	2.5564	5.5962	0.17329	0.1386:0.6259:0.0:0.2356	.	262	A2CJ06	DYTN_HUMAN	N	262	ENSP00000396593:S262N	ENSP00000396593:S262N	S	-	2	0	DYTN	207267781	0.001000	0.12720	0.970000	0.41538	0.983000	0.72400	-0.193000	0.09573	0.254000	0.21573	0.561000	0.74099	AGC			0.398	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336799.1			
COL6A3	1293	bcgsc.ca	37	2	238253730	238253730	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr2:238253730G>T	ENST00000295550.4	-	34	7585	c.7133C>A	c.(7132-7134)gCc>gAc	p.A2378D	COL6A3_ENST00000472056.1_Missense_Mutation_p.A1771D|COL6A3_ENST00000346358.4_Missense_Mutation_p.A2178D|COL6A3_ENST00000409809.1_Missense_Mutation_p.A2172D|COL6A3_ENST00000347401.3_Missense_Mutation_p.A2177D|COL6A3_ENST00000353578.4_Missense_Mutation_p.A2172D	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2378	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTGGATGAGGGCACATTGCTT	0.348																																					p.A2378D													.	COL6A3	608		0			c.C7133A												86.0	84.0	85.0					2																	238253730		2203	4300	6503	SO:0001583	missense	1293	exon34			ATGAGGGCACATT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7133C>A	2.37:g.238253730G>T	ENSP00000295550:p.Ala2378Asp		164	0.006097561	1		151	0.00	0	NM_004369	1067	0.00	1	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	9.579	1.123127	0.20959	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.87966	-2.32;-2.3;-2.28;-2.28;-2.28;-2.27	5.31	1.05	0.20165	.	0.815598	0.10724	N	0.641347	T	0.82061	0.4955	N	0.12502	0.225	0.38948	D	0.958284	B;B;B;D	0.60575	0.003;0.0;0.005;0.988	B;B;B;P	0.55965	0.003;0.002;0.004;0.788	T	0.74106	-0.3772	10	0.11794	T	0.64	.	12.765	0.57386	0.0:0.5148:0.3699:0.1152	.	1771;1771;2172;2378	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	D	2378;2177;2172;1771;2172;2178	ENSP00000295550:A2378D;ENSP00000315609:A2177D;ENSP00000315873:A2172D;ENSP00000418285:A1771D;ENSP00000386844:A2172D;ENSP00000295546:A2178D	ENSP00000295550:A2378D	A	-	2	0	COL6A3	237918469	0.930000	0.31532	0.837000	0.33122	0.772000	0.43724	2.028000	0.41088	0.611000	0.30052	-0.165000	0.13383	GCC			0.348	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315790.2		NM_004369	
NINL	22981	mdanderson.org	37	20	25457291	25457291	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr20:25457291C>T	ENST00000278886.6	-	17	2709	c.2636G>A	c.(2635-2637)cGc>cAc	p.R879H	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	879					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GGCTTGCCTGCGGCGAGGCCC	0.721																																					p.R879H													NINL,NS,carcinoma,-1,1	NINL	-1	1	0			c.G2636A																																									SO:0001583	missense	22981	exon17			TGCCTGCGGCGAG		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2636G>A	20.37:g.25457291C>T	ENSP00000278886:p.Arg879His		27	0.037037037	1		22	0.14	3	NM_025176	63	0.00	0	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	C	6.191	0.403363	0.11754	.	.	ENSG00000101004	ENST00000278886	T	0.26810	1.71	1.58	0.595	0.17490	.	8.874680	0.00166	N	0.000001	T	0.14098	0.0341	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.19976	-1.0289	10	0.44086	T	0.13	16.0881	4.143	0.10203	0.0:0.7772:0.0:0.2228	.	879	Q9Y2I6	NINL_HUMAN	H	879	ENSP00000278886:R879H	ENSP00000278886:R879H	R	-	2	0	NINL	25405291	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-1.040000	0.03546	0.222000	0.20900	0.561000	0.74099	CGC			0.721	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078445.3		NM_025176	
MLLT10P1	140678	hgsc.bcm.edu	37	20	29637851	29637851	+	RNA	SNP	C	C	G	rs148007340		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr20:29637851C>G	ENST00000408392.1	+	0	139																											TCTTGGATTTCTTTCAACACC	0.368																																					.													.	.			0			.																																											140678	.			GGATTTCTTTCAA																													20.37:g.29637851C>G			10	0	0		16	0.31	5	.	24	0.00	0		RNA	SNP	ENST00000408392.1	37																																																																																						0.368	AL441988.1-201	NOVEL	basic	miRNA	miRNA					
DDX27	55661	broad.mit.edu	37	20	47858511	47858511	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr20:47858511A>G	ENST00000371764.4	+	17	2081	c.2072A>G	c.(2071-2073)aAg>aGg	p.K691R	DDX27_ENST00000484427.1_3'UTR|ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000469991.1_Intron	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	691						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCCAAAAAAAAGGGGGAGATG	0.507																																					p.K691R													.	DDX27	74		0			c.A2072G												71.0	75.0	74.0					20																	47858511		2203	4300	6503	SO:0001583	missense	55661	exon17			AAAAAAAGGGGGA	AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.2072A>G	20.37:g.47858511A>G	ENSP00000360828:p.Lys691Arg		110	0	0		110	0.04	4	NM_017895	339	0.00	1	A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	Missense_Mutation	SNP	ENST00000371764.4	37	CCDS13416.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.995783	0.74703	.	.	ENSG00000124228	ENST00000371764	T	0.01572	4.76	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.03434	0.0099	L	0.38175	1.15	0.80722	D	1	D	0.54207	0.965	P	0.50082	0.63	T	0.65269	-0.6209	10	0.30854	T	0.27	-29.335	14.1448	0.65344	1.0:0.0:0.0:0.0	.	691	Q96GQ7	DDX27_HUMAN	R	691	ENSP00000360828:K691R	ENSP00000360828:K691R	K	+	2	0	DDX27	47291918	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.872000	0.92352	2.232000	0.73038	0.397000	0.26171	AAG			0.507	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080485.1			
GAB4	128954	bcgsc.ca	37	22	17488891	17488891	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:17488891G>T	ENST00000400588.1	-	1	221	c.114C>A	c.(112-114)ggC>ggA	p.G38G	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	38										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				ACAGCACGTGGCCACTTCTCG	0.682																																					p.G38G													.	GAB4	95		0			c.C114A												16.0	21.0	19.0					22																	17488891		2081	4220	6301	SO:0001819	synonymous_variant	128954	exon1			CACGTGGCCACTT	AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.114C>A	22.37:g.17488891G>T			176	0.0056818182	1		172	0.00	0	NM_001037814	0		0		Silent	SNP	ENST00000400588.1	37	CCDS42976.1																																																																																					0.682	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000315426.1		XM_372882	
POM121L9P	29774	broad.mit.edu	37	22	24657088	24657088	+	RNA	DEL	A	A	-	rs397843151		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:24657088delA	ENST00000414583.2	+	0	2077					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		GGGAGGGAAGAGGCGGGTCCA	0.617																																					.													.	.			0			.																																											0	.			GGGAAGAGGCGGG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24657088delA			6	0	0		10	0.60	6	.	0		0		RNA	DEL	ENST00000414583.2	37																																																																																						0.617	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
POM121L9P	29774	broad.mit.edu	37	22	24657092	24657093	+	RNA	INS	-	-	AGT			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:24657092_24657093insAGT	ENST00000414583.2	+	0	2077					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		GGGAAGAGGCGGGTCCAAGTGC	0.629																																					.													.	.			0			.																																											0	.			AGAGGCGGGTCCA	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24657092_24657093insAGT			4	0	0		10	0.60	6	.	0		0		RNA	INS	ENST00000414583.2	37																																																																																						0.629	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
TFIP11	24144	mdanderson.org	37	22	26895573	26895573	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:26895573G>T	ENST00000407690.1	-	9	1109	c.826C>A	c.(826-828)Cag>Aag	p.Q276K	TFIP11_ENST00000407431.1_Missense_Mutation_p.Q276K|TFIP11_ENST00000407148.1_Missense_Mutation_p.Q276K|TFIP11_ENST00000405938.1_Missense_Mutation_p.Q276K|TFIP11_ENST00000496523.1_5'UTR	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	276					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						TAGACCTTCTGCTCCCGGCCT	0.542																																					p.Q276K													.	.			0			c.C826A												67.0	70.0	69.0					22																	26895573		2203	4300	6503	SO:0001583	missense	24144	exon10			CCTTCTGCTCCCG	AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.826C>A	22.37:g.26895573G>T	ENSP00000384421:p.Gln276Lys		64	0	0		30	0.10	3	NM_001008697	100	0.00	0	O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Missense_Mutation	SNP	ENST00000407690.1	37	CCDS13838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.151772|3.151772	0.57151|0.57151	.|.	.|.	ENSG00000100109|ENSG00000100109	ENST00000407690;ENST00000407431;ENST00000407148;ENST00000405938|ENST00000450493	T;T;T;T|.	0.44881|.	0.91;0.91;0.91;0.91|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.055362|.	0.64402|.	D|.	0.000001|.	T|T	0.61502|0.61502	0.2352|0.2352	L|L	0.39467|0.39467	1.215|1.215	0.80722|0.80722	D|D	1|1	P|.	0.49447|.	0.924|.	P|.	0.62298|.	0.9|.	T|T	0.56347|0.56347	-0.7994|-0.7994	10|5	0.09338|.	T|.	0.73|.	-41.4126|-41.4126	17.7056|17.7056	0.88308|0.88308	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	276|.	Q9UBB9|.	TFP11_HUMAN|.	K|R	276|126	ENSP00000384421:Q276K;ENSP00000383892:Q276K;ENSP00000385861:Q276K;ENSP00000384297:Q276K|.	ENSP00000384297:Q276K|.	Q|S	-|-	1|3	0|2	TFIP11|TFIP11	25225573|25225573	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.285000|9.285000	0.95894|0.95894	2.643000|2.643000	0.89663|0.89663	0.655000|0.655000	0.94253|0.94253	CAG|AGC			0.542	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320750.1		NM_001008697	
SHANK3	85358	mdanderson.org	37	22	51169219	51169219	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr22:51169219G>T	ENST00000414786.2	+	23	4887	c.4660G>T	c.(4660-4662)Gcc>Tcc	p.A1554S	SHANK3_ENST00000445220.2_Missense_Mutation_p.A1570S|SHANK3_ENST00000262795.3_Missense_Mutation_p.A1575S			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1559					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		gggcggcggggccTCGTACTC	0.756																																					p.A1545S													.	.			0			c.G4633T												1.0	1.0	1.0					22																	51169219		389	908	1297	SO:0001583	missense	85358	exon22			GGCGGGGCCTCGT	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4660G>T	22.37:g.51169219G>T	ENSP00000464552:p.Ala1554Ser		15	0	0		12	0.17	2	NM_033517	21	0.00	0	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	G	12.38	1.921902	0.33908	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.32988	1.43;1.43	3.95	3.95	0.45737	.	0.259510	0.37809	N	0.001939	T	0.15262	0.0368	N	0.19112	0.55	0.25377	N	0.988645	P	0.34977	0.478	B	0.27380	0.079	T	0.11227	-1.0596	10	0.32370	T	0.25	.	7.3727	0.26810	0.1187:0.0:0.8813:0.0	.	1575	F2Z3L0	.	S	1575;1570	ENSP00000442518:A1575S;ENSP00000446078:A1570S	ENSP00000442518:A1575S	A	+	1	0	SHANK3	49516085	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.772000	0.62324	2.046000	0.60703	0.561000	0.74099	GCC			0.756	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000316674.2		NM_001080420	
NUP210	23225	mdanderson.org	37	3	13373825	13373825	+	Silent	SNP	C	C	T	rs147322542		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:13373825C>T	ENST00000254508.5	-	29	3985	c.3903G>A	c.(3901-3903)tcG>tcA	p.S1301S		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1301					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					ATGAGTTGGGCGACATTAATA	0.483																																					p.S1301S													.	.			0			c.G3903A							C		2,4404	4.2+/-10.8	0,2,2201	271.0	262.0	265.0		3903	-4.7	1.0	3	dbSNP_134	265	0,8600		0,0,4300	no	coding-synonymous	NUP210	NM_024923.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		1301/1888	13373825	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	23225	exon29			GTTGGGCGACATT	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.3903G>A	3.37:g.13373825C>T			69	0	0		53	0.06	3	NM_024923	147	0.00	0	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	ENST00000254508.5	37	CCDS33704.1																																																																																			0		0.483	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340085.1		NM_024923	
MRPS25	64432	bcgsc.ca	37	3	15094113	15094115	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:15094113_15094115delCTC	ENST00000253686.2	-	4	495_497	c.355_357delGAG	c.(355-357)gagdel	p.E119del	MRPS25_ENST00000449354.2_Intron|MRPS25_ENST00000496484.1_5'Flank|MRPS25_ENST00000444840.2_In_Frame_Del_p.89_90RR>R	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	119						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(1)	2						GCTGCTTTTTCTCCTCCTCCTCT	0.586																																					p.119_119del													.	MRPS25	14		0			c.355_357del									1,4265		0,1,2132						4.7	0.8			140	1,8253		0,1,4126	no	coding	MRPS25	NM_022497.3		0,2,6258	A1A1,A1R,RR		0.0121,0.0234,0.016				2,12518				SO:0001651	inframe_deletion	64432	exon4			CTTTTTCTCCTCC	AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.355_357delGAG	3.37:g.15094122_15094124delCTC	ENSP00000253686:p.Glu119del		106	0	0		89	0.00	0	NM_022497	153	0.00	0	B4DFJ5|B4DQG6|Q9H7P5	In_Frame_Del	DEL	ENST00000253686.2	37	CCDS2622.1																																																																																					0.586	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252076.2		NM_022497	
SCN11A	11280	broad.mit.edu	37	3	38991741	38991741	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr3:38991741T>C	ENST00000302328.3	-	1	311	c.113A>G	c.(112-114)aAg>aGg	p.K38R	SCN11A_ENST00000450244.1_Missense_Mutation_p.K38R|SCN11A_ENST00000456224.3_Missense_Mutation_p.K38R|SCN11A_ENST00000444237.2_Missense_Mutation_p.K38R	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	38					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTAGACTTCTTTTTCTCCTT	0.517																																					p.K38R													.	SCN11A	296		0			c.A113G												140.0	134.0	136.0					3																	38991741		2203	4300	6503	SO:0001583	missense	11280	exon1			GACTTCTTTTTCT	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.113A>G	3.37:g.38991741T>C	ENSP00000307599:p.Lys38Arg		135	0	0		131	0.03	4	NM_014139	9	0.00	0	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	T	8.406	0.843145	0.16963	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.96685	-4.09;-4.09;-4.04;-3.95	5.41	4.24	0.50183	.	0.674126	0.15566	N	0.255690	D	0.92844	0.7724	L	0.43923	1.385	0.23872	N	0.996602	B	0.02656	0.0	B	0.09377	0.004	D	0.84759	0.0761	10	0.36615	T	0.2	.	8.3468	0.32277	0.0:0.1006:0.0:0.8994	.	38	Q9UI33	SCNBA_HUMAN	R	38	ENSP00000307599:K38R;ENSP00000400945:K38R;ENSP00000416757:K38R;ENSP00000408028:K38R	ENSP00000307599:K38R	K	-	2	0	SCN11A	38966745	0.914000	0.31030	0.561000	0.28357	0.052000	0.14988	2.371000	0.44248	0.881000	0.35993	0.533000	0.62120	AAG			0.517	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109746.4		NM_014139	
Unknown	0	bcgsc.ca	37	4	9405207	9405207	+	IGR	SNP	T	T	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr4:9405207T>A								RP11-1396O13.13 (14498 upstream) : RNA5SP153 (7696 downstream)																							AAATCCATGTTGGGAGATGTT	0.488																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CCATGTTGGGAGA																													4.37:g.9405207T>A			212	0.0094339623	2		222	0.04	8	.	0		0		RNA	SNP		37																																																																																					0	0.488										
MAML3	55534	broad.mit.edu	37	4	140640915	140640915	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr4:140640915C>T	ENST00000509479.2	-	5	3835	c.2979G>A	c.(2977-2979)ggG>ggA	p.G993G	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GTCTCGGCTGCCCAGCTTGAA	0.587																																					p.G989G													.	MAML3	192		0			c.G2967A												42.0	45.0	44.0					4																	140640915		2085	4209	6294	SO:0001819	synonymous_variant	55534	exon6			CGGCTGCCCAGCT	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.2979G>A	4.37:g.140640915C>T			72	0	0		49	0.06	3	NM_018717	29	0.00	0		Silent	SNP	ENST00000509479.2	37	CCDS54805.1																																																																																					0.587	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364934.2			
CLGN	1047	bcgsc.ca	37	4	141311836	141311836	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr4:141311836G>T	ENST00000325617.5	-	14	2138	c.1698C>A	c.(1696-1698)atC>atA	p.I566I	CLGN_ENST00000414773.1_Silent_p.I566I|CLGN_ENST00000537281.1_Silent_p.I566I	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	566					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					GCCCTTCTATGATTTCAATTT	0.323																																					p.I566I													.	CLGN	76		0			c.C1698A												180.0	165.0	170.0					4																	141311836		2202	4298	6500	SO:0001819	synonymous_variant	1047	exon15			TTCTATGATTTCA	D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.1698C>A	4.37:g.141311836G>T			186	0	0		152	0.00	0	NM_001130675	168	0.00	0	B3KS90|B4DXV8|D3DNY8	Silent	SNP	ENST00000325617.5	37	CCDS3751.1																																																																																					0.323	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257272.2		NM_004362	
ADCY2	108	bcgsc.ca	37	5	7743791	7743791	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:7743791C>T	ENST00000338316.4	+	15	1971	c.1882C>T	c.(1882-1884)Ctg>Ttg	p.L628L	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Silent_p.L448L	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	628					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						AACGTCCGTCCTGGGCATCTC	0.498																																					p.L628L													.	ADCY2	337		0			c.C1882T												360.0	321.0	334.0					5																	7743791		2203	4300	6503	SO:0001819	synonymous_variant	108	exon15			TCCGTCCTGGGCA	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1882C>T	5.37:g.7743791C>T			201	0	0		126	0.00	0	NM_020546	13	0.00	0	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																					0.498	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206930.2		NM_020546	
NADK2	133686	mdanderson.org	37	5	36197730	36197730	+	Missense_Mutation	SNP	G	G	T	rs368195000		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:36197730G>T	ENST00000381937.4	-	11	1102	c.1103C>A	c.(1102-1104)cCg>cAg	p.P368Q	NADK2_ENST00000506945.1_Missense_Mutation_p.P227Q|NADK2_ENST00000514504.1_Missense_Mutation_p.P336Q|NADK2_ENST00000397338.1_Missense_Mutation_p.P205Q|NADK2_ENST00000282512.3_Missense_Mutation_p.P205Q|NADK2_ENST00000511613.1_5'UTR	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	368					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										TGGTTCTTCCGGACTGTAGAG	0.358																																					p.P368Q													.	.			0			c.C1103A												82.0	76.0	78.0					5																	36197730		2203	4300	6503	SO:0001583	missense	133686	exon11			TCTTCCGGACTGT	BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.1103C>A	5.37:g.36197730G>T	ENSP00000371362:p.Pro368Gln		73	0	0		47	0.06	3	NM_001085411	74	0.00	0	B5MC93|Q6UTX5|Q96NM0	Missense_Mutation	SNP	ENST00000381937.4	37	CCDS47197.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.612558	0.87258	.	.	ENSG00000152620	ENST00000397338;ENST00000282512;ENST00000381937;ENST00000506945;ENST00000514504	.	.	.	5.74	4.84	0.62591	ATP-NAD kinase, PpnK-type, all-beta (1);	0.049703	0.85682	D	0.000000	D	0.82986	0.5156	M	0.86178	2.8	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.997	D;D;D	0.74023	0.943;0.982;0.916	D	0.85416	0.1140	9	0.66056	D	0.02	-13.912	16.1937	0.82011	0.0:0.0:0.8664:0.1336	.	227;336;368	B7Z8V7;Q4G0N4-2;Q4G0N4	.;.;NAKD1_HUMAN	Q	205;205;368;227;336	.	ENSP00000282512:P205Q	P	-	2	0	NADKD1	36233487	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.871000	0.92346	2.702000	0.92279	0.591000	0.81541	CCG			0.358	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367541.1		NM_153013	
NADK2	133686	bcgsc.ca	37	5	36211999	36211999	+	Silent	SNP	A	A	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:36211999A>T	ENST00000381937.4	-	7	806	c.807T>A	c.(805-807)ctT>ctA	p.L269L	NADK2_ENST00000506945.1_Silent_p.L106L|NADK2_ENST00000514504.1_Silent_p.L269L|NADK2_ENST00000397338.1_Silent_p.L106L|NADK2_ENST00000282512.3_Silent_p.L106L|NADK2_ENST00000511613.1_5'UTR	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	269					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										TCACTGGCAGAAGTTGGGGTC	0.368																																					p.L269L													.	NADKD1	47		0			c.T807A												121.0	125.0	124.0					5																	36211999		2203	4300	6503	SO:0001819	synonymous_variant	133686	exon7			TGGCAGAAGTTGG	BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.807T>A	5.37:g.36211999A>T			82	0	0		49	0.00	0	NM_001085411	68	0.00	0	B5MC93|Q6UTX5|Q96NM0	Silent	SNP	ENST00000381937.4	37	CCDS47197.1																																																																																					0.368	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367541.1		NM_153013	
PCDHGA8	9708	hgsc.bcm.edu	37	5	140773214	140773214	+	Silent	SNP	A	A	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:140773214A>T	ENST00000398604.2	+	1	834	c.834A>T	c.(832-834)gcA>gcT	p.A278A	PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	278	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A278A(1)		endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAAGTGGCATACAAATTCC	0.423																																					p.A278A													PCDHGA8,NS,carcinoma,0,1	PCDHGA8	0	1	1	Substitution - coding silent(1)	kidney(1)	c.A834T												71.0	75.0	74.0					5																	140773214		1847	4096	5943	SO:0001819	synonymous_variant	9708	exon1			AGTGGCATACAAA	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.834A>T	5.37:g.140773214A>T			145	0	0		100	0.04	4	NM_014004	2	0.00	0	A7MCZ4|O15039	Silent	SNP	ENST00000398604.2	37	CCDS47291.1																																																																																					0.423	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376972.1		NM_032088	
TNIP1	10318	mdanderson.org	37	5	150436453	150436453	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr5:150436453C>T	ENST00000389378.2	-	6	1089	c.501G>A	c.(499-501)acG>acA	p.T167T	TNIP1_ENST00000522226.1_Silent_p.T167T|TNIP1_ENST00000523200.1_Silent_p.T167T|TNIP1_ENST00000524280.1_Silent_p.T167T|TNIP1_ENST00000518977.1_Silent_p.T167T|TNIP1_ENST00000521591.1_Silent_p.T167T|TNIP1_ENST00000520931.1_Silent_p.T114T|TNIP1_ENST00000315050.7_Silent_p.T167T|TNIP1_ENST00000523338.1_Silent_p.T167T	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	167	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACACACTCAGCGTGGTCTCCA	0.667																																					p.T167T													.	.			0			c.G501A												35.0	36.0	36.0					5																	150436453		2203	4299	6502	SO:0001819	synonymous_variant	10318	exon6			ACTCAGCGTGGTC	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.501G>A	5.37:g.150436453C>T			48	0	0		24	0.08	2	NM_001252385	127	0.00	0	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Silent	SNP	ENST00000389378.2	37	CCDS34280.1																																																																																					0.667	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374914.1		NM_006058	
TBP	6908	hgsc.bcm.edu;mdanderson.org	37	6	170871016	170871016	+	Silent	SNP	G	G	A	rs542031948		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr6:170871016G>A	ENST00000392092.2	+	3	471	c.192G>A	c.(190-192)caG>caA	p.Q64Q	TBP_ENST00000230354.6_Silent_p.Q64Q|TBP_ENST00000540980.1_Silent_p.Q44Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	64	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		aacaacaacagcagcagcagc	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14897	0.0		0.0	False		,,,				2504	0.0				p.Q64Q													TBP,NS,carcinoma,0,2	TBP	0	2	0			c.G192A												31.0	35.0	33.0					6																	170871016		2202	4292	6494	SO:0001819	synonymous_variant	6908	exon3			ACAACAGCAGCAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.192G>A	6.37:g.170871016G>A			80	0.0125	1		86	0.07	6	NM_003194	93	0.00	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																					0.557	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000043271.2		NM_003194	
ELFN1	392617	mdanderson.org	37	7	1785645	1785645	+	Silent	SNP	C	C	T	rs535141936	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:1785645C>T	ENST00000424383.2	+	3	1900	c.1413C>T	c.(1411-1413)taC>taT	p.Y471Y	ELFN1_ENST00000541472.1_Silent_p.Y471Y|ELFN1_ENST00000561626.1_Silent_p.Y471Y			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	471					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						AGCTCAAGTACGGGCCAGAGC	0.726													C|||	2	0.000399361	0.0008	0.0	5008	,	,		13222	0.0		0.001	False		,,,				2504	0.0				p.Y471Y													.	.			0			c.C1413T												7.0	8.0	7.0					7																	1785645		677	1569	2246	SO:0001819	synonymous_variant	392617	exon2			CAAGTACGGGCCA		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.1413C>T	7.37:g.1785645C>T			40	0	0		50	0.06	3	NM_001128636	16	0.00	0	H3BS57	Silent	SNP	ENST00000424383.2	37	CCDS59046.1																																																																																					0.726	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322893.2		NM_001128636	
PSPH	5723	broad.mit.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:56085002C>T	ENST00000395471.3	-	6	1151	c.346G>A	c.(346-348)Gta>Ata	p.V116I	PSPH_ENST00000459834.1_Intron|PSPH_ENST00000275605.3_Missense_Mutation_p.V116I			P78330	SERB_HUMAN	phosphoserine phosphatase	116					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.V116I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393																																					p.V116I													PSPH,NS,carcinoma,0,2	PSPH	23	2	1	Substitution - Missense(1)	lung(1)	c.G346A												87.0	75.0	79.0					7																	56085002		2203	4300	6503	SO:0001583	missense	5723	exon6			GCTCTACAATACT	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.346G>A	7.37:g.56085002C>T	ENSP00000378854:p.Val116Ile		498	0.0020080321	1		451	0.01	6	NM_004577	77	0.00	0	B2RCR5|Q7Z3S5	Missense_Mutation	SNP	ENST00000395471.3	37	CCDS5522.1	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432510	0.25813	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.81908	-1.55;-1.55;-1.55	4.85	4.85	0.62838	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.05124	-0.11	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.18263	0.021;0.021	T	0.62992	-0.6736	10	0.02654	T	1	-16.2549	17.1115	0.86676	0.0:1.0:0.0:0.0	.	116;116	Q53EY1;P78330	.;SERB_HUMAN	I	116	ENSP00000275605:V116I;ENSP00000378854:V116I;ENSP00000398653:V116I	ENSP00000275605:V116I	V	-	1	0	PSPH	56052496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.551000	0.82182	2.297000	0.77311	0.579000	0.79373	GTA			0.393	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343304.1		NM_004577	
PHKG1	5260	mdanderson.org	37	7	56146188	56146188	+	IGR	SNP	C	C	T	rs149838149	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:56146188C>T	ENST00000297373.2	-	0	1431				SUMF2_ENST00000395436.2_Missense_Mutation_p.R274W|SUMF2_ENST00000434526.2_Missense_Mutation_p.R289W|SUMF2_ENST00000413756.1_Missense_Mutation_p.R270W|SUMF2_ENST00000437307.2_Missense_Mutation_p.R201W|SUMF2_ENST00000342190.6_Intron|SUMF2_ENST00000395435.2_Missense_Mutation_p.R205W|SUMF2_ENST00000275607.9_Missense_Mutation_p.R182W	NM_001258460.1|NM_006213.4	NP_001245389.1|NP_006204.1	Q16816	PHKG1_HUMAN	phosphorylase kinase, gamma 1 (muscle)						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|tau-protein kinase activity (GO:0050321)			endometrium(1)|large_intestine(1)|lung(5)	7	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TCACCGGGCCCGGGTCACCAC	0.637													C|||	5	0.000998403	0.0023	0.0	5008	,	,		18068	0.002		0.0	False		,,,				2504	0.0				p.R289W	Melanoma(184;580 2064 5329 24177 35303)												.	.			0			c.C865T							C	TRP/ARG,TRP/ARG,,TRP/ARG,TRP/ARG	4,4402	6.2+/-15.9	0,4,2199	29.0	27.0	28.0		820,613,,544,865	4.2	1.0	7	dbSNP_134	28	1,8595	1.2+/-3.3	0,1,4297	yes	missense,missense,intron,missense,missense	SUMF2	NM_001042469.1,NM_001042470.1,NM_001130069.2,NM_001146333.1,NM_015411.2	101,101,,101,101	0,5,6496	TT,TC,CC		0.0116,0.0908,0.0385	,,,,	274/306,205/237,,182/214,289/321	56146188	5,12997	2203	4298	6501	SO:0001628	intergenic_variant	25870	exon8			CGGGCCCGGGTCA	X80590	CCDS5525.1, CCDS59057.1	7p11.2	2009-07-10			ENSG00000164776	ENSG00000164776	2.7.11.19		8930	protein-coding gene	gene with protein product		172470		PHKG		8530014	Standard	NM_001258459		Approved		uc011kdb.2	Q16816	OTTHUMG00000023869		7.37:g.56146188C>T			70	0.0142857143	1		86	0.06	5	NM_015411	300	0.03	10	B7Z1D0|F5H2S1|Q75LP5	Missense_Mutation	SNP	ENST00000297373.2	37	CCDS5525.1	4	0.0018315018315018315	3	0.006097560975609756	0	0.0	0	0.0	1	0.0013192612137203166	C	24.0	4.487213	0.84854	9.08E-4	1.16E-4	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000275607;ENST00000395435;ENST00000413952;ENST00000437307;ENST00000413756;ENST00000451338	D;D;D;D;D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19;-4.19;-4.19;-4.19;-4.19	5.08	4.21	0.49690	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	.	.	.	.	D	0.98046	0.9356	H	0.97516	4.02	0.47584	D	0.999463	P;D;D;D	0.89917	0.819;1.0;1.0;1.0	B;D;D;D	0.85130	0.226;0.997;0.994;0.997	D	0.95988	0.8983	9	0.87932	D	0	.	9.4876	0.38940	0.0:0.8184:0.0:0.1816	.	186;274;292;270	Q8NBJ7-5;A8MXB9;E7EMF9;Q8NBJ7	.;.;.;SUMF2_HUMAN	W	274;289;182;205;292;201;270;287	ENSP00000378824:R274W;ENSP00000400922:R289W;ENSP00000275607:R182W;ENSP00000378823:R205W;ENSP00000414434:R292W;ENSP00000415989:R201W;ENSP00000406445:R270W;ENSP00000410796:R287W	ENSP00000275607:R182W	R	+	1	2	SUMF2	56113682	0.999000	0.42202	0.999000	0.59377	0.997000	0.91878	2.321000	0.43805	1.272000	0.44329	0.655000	0.94253	CGG	0.001		0.637	PHKG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251587.1		NM_006213	
WBSCR17	64409	mdanderson.org	37	7	71177063	71177063	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:71177063G>T	ENST00000333538.5	+	11	2363	c.1729G>T	c.(1729-1731)Gct>Tct	p.A577S	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	577	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCGGGGCCTGGCTGGCATCGA	0.607																																					p.A577S													.	.			0			c.G1729T												80.0	82.0	81.0					7																	71177063		2203	4300	6503	SO:0001583	missense	64409	exon11			GGCCTGGCTGGCA	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1729G>T	7.37:g.71177063G>T	ENSP00000329654:p.Ala577Ser		67	0	0		70	0.06	4	NM_022479	29	0.00	0	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	7.276	0.608203	0.14002	.	.	ENSG00000185274	ENST00000333538	T	0.26957	1.7	5.26	2.26	0.28386	Ricin B-related lectin (1);Ricin B lectin (3);	0.196282	0.45606	D	0.000359	T	0.12646	0.0307	N	0.14661	0.345	0.29360	N	0.864718	B	0.10296	0.003	B	0.16722	0.016	T	0.23368	-1.0190	10	0.09590	T	0.72	.	10.7203	0.46036	0.0:0.1293:0.6326:0.2381	.	577	Q6IS24	GLTL3_HUMAN	S	577	ENSP00000329654:A577S	ENSP00000329654:A577S	A	+	1	0	WBSCR17	70814999	1.000000	0.71417	0.995000	0.50966	0.924000	0.55760	2.512000	0.45485	1.172000	0.42781	0.563000	0.77884	GCT			0.607	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252006.1		NM_022479	
GTF2IRD1	9569	mdanderson.org	37	7	74005172	74005172	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:74005172A>G	ENST00000265755.3	+	24	2855	c.2462A>G	c.(2461-2463)aAc>aGc	p.N821S	GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.N806S|GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.N838S|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.N806S	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	821					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTGGGCCTGAACCGGCCGGTG	0.602																																					p.N838S													.	.			0			c.A2513G												35.0	33.0	34.0					7																	74005172		2203	4300	6503	SO:0001583	missense	9569	exon24			GCCTGAACCGGCC	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2462A>G	7.37:g.74005172A>G	ENSP00000265755:p.Asn821Ser		74	0	0		56	0.05	3	NM_001199207	182	0.00	0	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773524	0.69992	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.57	5.57	0.84162	.	0.104141	0.64402	D	0.000004	T	0.22742	0.0549	N	0.04203	-0.255	0.48040	D	0.99957	B;P;P;B	0.46784	0.208;0.884;0.542;0.151	B;P;B;B	0.53146	0.112;0.719;0.232;0.026	T	0.10823	-1.0613	10	0.09084	T	0.74	-27.4196	13.4627	0.61235	1.0:0.0:0.0:0.0	.	838;806;821;806	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	S	821;838;806;806	ENSP00000265755:N821S;ENSP00000397566:N838S;ENSP00000408477:N806S;ENSP00000418383:N806S	ENSP00000265755:N821S	N	+	2	0	GTF2IRD1	73643108	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.543000	0.90651	2.127000	0.65507	0.459000	0.35465	AAC			0.602	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252654.2		NM_016328	
ADCK2	90956	broad.mit.edu	37	7	140373547	140373548	+	In_Frame_Ins	INS	-	-	ACCTCAGGCCCA			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:140373547_140373548insACCTCAGGCCCA	ENST00000072869.4	+	1	595_596	c.417_418insACCTCAGGCCCA	c.(418-420)acc>ACCTCAGGCCCAacc	p.140_140T>TSGPT	ADCK2_ENST00000476491.1_In_Frame_Ins_p.140_140T>TSGPT	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	140						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					AAGCCACCGAGACCTCAGGCCC	0.589																																					p.E139delinsETSGP													.	ADCK2	37		0			c.417_418insACCTCAGGCCCA																																									SO:0001652	inframe_insertion	90956	exon1			CACCGAGACCTCA	AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.418_429dupACCTCAGGCCCA	7.37:g.140373547_140373548insACCTCAGGCCCA	Exception_encountered		118	0	0		91	0.08	7	NM_052853	73	0.00	0	Q96CN6|Q9Y6T5	In_Frame_Ins	INS	ENST00000072869.4	37	CCDS5861.1																																																																																					0.589	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348734.1		NM_052853	
ZNF398	57541	broad.mit.edu	37	7	148876752	148876752	+	Silent	SNP	T	T	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr7:148876752T>G	ENST00000475153.1	+	6	2055	c.1788T>G	c.(1786-1788)ggT>ggG	p.G596G	ZNF398_ENST00000540950.1_Silent_p.G601G|ZNF398_ENST00000420008.2_Silent_p.G425G|ZNF398_ENST00000491174.1_Silent_p.G425G|ZNF398_ENST00000426851.2_Silent_p.G425G|ZNF398_ENST00000483892.1_Silent_p.G425G|ZNF398_ENST00000335901.4_Silent_p.G425G			Q8TD17	ZN398_HUMAN	zinc finger protein 398	596					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			GCTGTGGGGGTGATAGTGACC	0.587																																					p.G596G													.	ZNF398	54		0			c.T1788G												60.0	62.0	62.0					7																	148876752		2203	4300	6503	SO:0001819	synonymous_variant	0	exon6			TGGGGGTGATAGT	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.1788T>G	7.37:g.148876752T>G			68	0.1323529412	9		59	0.20	12	NM_170686	24	0.00	0	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Silent	SNP	ENST00000475153.1	37	CCDS5894.1																																																																																					0.587	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352722.2			
Unknown	0	bcgsc.ca	37	8	56962832	56962832	+	IGR	SNP	A	A	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr8:56962832A>G								RN7SL323P (27960 upstream) : RPS20 (17021 downstream)																							GATTTTCAGTATGTCTAATCT	0.373																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTCAGTATGTCTA																													8.37:g.56962832A>G			188	0	0		223	0.00	0	.	45	0.00	0		RNA	SNP		37																																																																																					0	0.373										
BX088651.1	0	bcgsc.ca	37	9	44402012	44402012	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:44402012C>G	ENST00000540551.1	-	1	415	c.244G>C	c.(244-246)Gct>Cct	p.A82P	RP11-475I24.3_ENST00000435586.1_lincRNA																							CCCAGCGGAGCGCCCGGCACG	0.657																																					.													.	.			0			.																																									SO:0001583	missense	0	.			GCGGAGCGCCCGG																												ENST00000540551.1:c.244G>C	9.37:g.44402012C>G	ENSP00000469774:p.Ala82Pro		77	0.0909090909	7		57	0.16	9	.	25	0.12	3		RNA	SNP	ENST00000540551.1	37																																																																																						0.657	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding					
WNK2	65268	mdanderson.org	37	9	96055381	96055381	+	Silent	SNP	C	C	A			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:96055381C>A	ENST00000297954.4	+	23	5745	c.5745C>A	c.(5743-5745)tcC>tcA	p.S1915S	WNK2_ENST00000427277.2_Silent_p.S1490S|WNK2_ENST00000356055.3_Silent_p.S240S|WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000395477.2_Silent_p.S1878S|WNK2_ENST00000349097.3_Silent_p.S1527S	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1915					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CCCAGTCGTCCTACATCAGCA	0.607																																					p.S1878S													.	.			0			c.C5634A												30.0	32.0	32.0					9																	96055381		2203	4299	6502	SO:0001819	synonymous_variant	65268	exon22			GTCGTCCTACATC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.5745C>A	9.37:g.96055381C>A			57	0	0		47	0.06	3	NM_006648	82	0.00	0	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.259|8.259	0.810816|0.810816	0.16537|0.16537	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000432730;ENST00000448251;ENST00000453718	.|.	.|.	.|.	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	.|.	.|.	.|.	.|.	T|T	0.69151|0.69151	0.3079|0.3079	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.68281|0.68281	-0.5450|-0.5450	4|4	.|.	.|.	.|.	.|.	13.8691|13.8691	0.63608|0.63608	0.2249:0.7751:0.0:0.0|0.2249:0.7751:0.0:0.0	.|.	.|.	.|.	.|.	I|H	1482|1874;675;400	.|.	.|.	L|P	+|+	1|2	2|0	WNK2|WNK2	95095202|95095202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.830000|0.830000	0.47004|0.47004	1.127000|1.127000	0.31357|0.31357	2.265000|2.265000	0.75225|0.75225	0.561000|0.561000	0.74099|0.74099	CTA|CCT			0.607	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000317359.1		NM_006648	
LRRC37A5P	652972	broad.mit.edu	37	9	114370698	114370698	+	RNA	DEL	A	A	-			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:114370698delA	ENST00000374304.1	-	0	506							Q49AS3	L37A5_HUMAN	leucine rich repeat containing 37, member A5, pseudogene																		TTTTAGTGAGAAAAAAAAAAG	0.348																																					.													.	.			0			.																																											0	.			AGTGAGAAAAAAA	BC031236		9q31.3	2012-10-16	2012-03-07	2012-03-07	ENSG00000204173	ENSG00000204173			23369	pseudogene	pseudogene			"""chromosome 9 open reading frame 29"""	C9orf29			Standard	NR_034087		Approved		uc022bly.1	Q49AS3	OTTHUMG00000020494		9.37:g.114370698delA			8	0	0		6	0.33	2	.	0		0	Q5JVP0	RNA	DEL	ENST00000374304.1	37																																																																																						0.348	LRRC37A5P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000053655.2		NR_034087	
DFNB31	25861	bcgsc.ca	37	9	117185777	117185777	+	Silent	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:117185777G>T	ENST00000362057.3	-	7	1611	c.1443C>A	c.(1441-1443)ggC>ggA	p.G481G	DFNB31_ENST00000265134.6_Silent_p.G98G|DFNB31_ENST00000374059.3_Silent_p.G130G	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	481					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGAAATGGTGCCTCTCACCT	0.642																																					p.G481G													.	DFNB31	100		0			c.C1443A												65.0	63.0	64.0					9																	117185777		2203	4300	6503	SO:0001819	synonymous_variant	25861	exon7			AATGGTGCCTCTC	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1443C>A	9.37:g.117185777G>T			102	0	0		89	0.01	1	NM_001173425	74	0.00	0	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	ENST00000362057.3	37	CCDS6806.1																																																																																					0.642	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053776.2		NM_015404	
TOR2A	27433	mdanderson.org	37	9	130495633	130495633	+	Intron	SNP	C	C	A	rs564754	byFrequency	TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:130495633C>A	ENST00000373284.5	-	3	640				TOR2A_ENST00000472723.1_5'UTR|TOR2A_ENST00000336067.6_Intron|TOR2A_ENST00000458505.3_3'UTR|TOR2A_ENST00000373281.5_Missense_Mutation_p.W208C	NM_001085347.2	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A						chaperone mediated protein folding requiring cofactor (GO:0051085)|protein homooligomerization (GO:0051260)	endoplasmic reticulum lumen (GO:0005788)	ATP binding (GO:0005524)			NS(1)|endometrium(2)	3						AGTGGCCCCCCCACTGTGCCC	0.602																																					p.W208C													.	.			0			c.G624T												50.0	49.0	49.0					9																	130495633		2203	4300	6503	SO:0001627	intron_variant	27433	exon3			GCCCCCCCACTGT	AA873275	CCDS6876.1, CCDS43879.1, CCDS48024.1	9q34.11	2010-08-20			ENSG00000160404	ENSG00000160404			11996	protein-coding gene	gene with protein product		608052				10644435	Standard	NM_001085347		Approved	FLJ14771, TORP1	uc004brs.4	Q5JU69	OTTHUMG00000020706	ENST00000373284.5:c.593+30G>T	9.37:g.130495633C>A			118	0	0		97	0.03	3	NM_130459	19	0.00	0	A4FU12|A4FU13|Q3ZCN9|Q3ZCP0|Q5JU68|Q66K87|Q6UXW6|Q8NAN5|Q96SL7	Missense_Mutation	SNP	ENST00000373284.5	37	CCDS43879.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495875	0.26774	.	.	ENSG00000160404	ENST00000373281	T	0.69040	-0.37	5.39	-1.4	0.08968	.	.	.	.	.	T	0.49029	0.1533	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.34153	-0.9840	7	0.38643	T	0.18	.	5.8881	0.18892	0.137:0.2686:0.5145:0.0798	.	208	Q5JU69-2	.	C	208	ENSP00000362378:W208C	ENSP00000362378:W208C	W	-	3	0	TOR2A	129535454	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.060000	0.03475	-0.643000	0.05473	-0.311000	0.09066	TGG			0.602	TOR2A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054205.1		NM_130459	
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	139370740	139370740	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:139370740G>T	ENST00000371706.3	-	1	827	c.794C>A	c.(793-795)aCa>aAa	p.T265K	SEC16A_ENST00000313050.7_Missense_Mutation_p.T443K|SEC16A_ENST00000431893.2_Missense_Mutation_p.T265K|SEC16A_ENST00000290037.6_Missense_Mutation_p.T265K			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	265					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TGTGCTCGCTGTGTCACCCCA	0.607																																					p.T443K													.	.			0			c.C1328A												49.0	58.0	55.0					9																	139370740		2105	4244	6349	SO:0001583	missense	9919	exon3			CTCGCTGTGTCAC	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.794C>A	9.37:g.139370740G>T	ENSP00000360771:p.Thr265Lys		137	0	0		128	0.58	74	NM_014866	95	0.59	56	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	G	7.188	0.590941	0.13812	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T	0.22539	1.98;1.95;1.95;1.95	5.46	-1.44	0.08856	.	1.360100	0.04382	N	0.360888	T	0.14056	0.0340	L	0.34521	1.04	0.09310	N	0.999997	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.002;0.001	T	0.27502	-1.0072	10	0.29301	T	0.29	0.7021	2.8997	0.05701	0.1658:0.4283:0.2272:0.1787	.	443;265;265;70	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	K	443;265;265;265;70	ENSP00000325827:T443K;ENSP00000360771:T265K;ENSP00000290037:T265K;ENSP00000387583:T265K	ENSP00000290037:T265K	T	-	2	0	SEC16A	138490561	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	0.873000	0.28052	0.053000	0.16036	-0.136000	0.14681	ACA			0.607	SEC16A-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000055077.1		XM_088459	
MAMDC4	158056	mdanderson.org	37	9	139752857	139752857	+	Missense_Mutation	SNP	T	T	G	rs374940023		TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chr9:139752857T>G	ENST00000317446.2	+	22	2730	c.2680T>G	c.(2680-2682)Tgt>Ggt	p.C894G	MAMDC4_ENST00000445819.1_Missense_Mutation_p.C973G|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TGCAGGTTCCTGTGATTTTGA	0.672																																					p.C894G													.	.			0			c.T2680G												56.0	64.0	62.0					9																	139752857		2200	4300	6500	SO:0001583	missense	158056	exon22			GGTTCCTGTGATT	AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.2680T>G	9.37:g.139752857T>G	ENSP00000319388:p.Cys894Gly		16	0	0		17	0.12	2	NM_206920	28	0.00	0		Missense_Mutation	SNP	ENST00000317446.2	37	CCDS7010.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	17.11|17.11	3.304722|3.304722	0.60305|0.60305	.|.	.|.	ENSG00000177943|ENSG00000177943	ENST00000317446;ENST00000445819|ENST00000413647	T;T|.	0.12255|.	2.7;2.7|.	5.04|5.04	5.04|5.04	0.67666|0.67666	Concanavalin A-like lectin/glucanase (1);MAM domain (3);|.	0.000000|.	0.64402|.	D|.	0.000007|.	D|D	0.86900|0.86900	0.6044|0.6044	H|H	0.96301|0.96301	3.8|3.8	0.41857|0.41857	D|D	0.990204|0.990204	B;D|.	0.69078|.	0.181;0.997|.	B;D|.	0.71184|.	0.414;0.972|.	D|D	0.91015|0.91015	0.4853|0.4853	10|5	0.87932|.	D|.	0|.	-15.5217|-15.5217	13.5881|13.5881	0.61944|0.61944	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	973;894|.	Q6UXC1;Q6UXC1-2|.	AEGP_HUMAN;.|.	G|R	894;973|958	ENSP00000319388:C894G;ENSP00000411339:C973G|.	ENSP00000319388:C894G|.	C|L	+|+	1|2	0|0	MAMDC4|MAMDC4	138872678|138872678	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.630000|0.630000	0.37929|0.37929	3.781000|3.781000	0.55394|0.55394	1.904000|1.904000	0.55121|0.55121	0.454000|0.454000	0.30748|0.30748	TGT|CTG			0.672	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000254642.3		NM_206920	
MT-ND4	4538	broad.mit.edu	37	M	11014	11014	+	Silent	SNP	C	C	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chrM:11014C>T	ENST00000361381.2	+	1	255	c.255C>T	c.(253-255)tcC>tcT	p.S85S	MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	85					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						CGCCACTTATCCAGCGAACCA	0.438																																					p.S85S													.	.			0			c.C255T																																									SO:0001819	synonymous_variant	4538	exon1			CTTATCCAGTGAA			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.255C>T	M.37:g.11014C>T			14	0	0		3	1.00	3	ENST00000361381	0		0	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	37																																																																																						0.438	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024035	
PTCHD1	139411	broad.mit.edu	37	X	23398203	23398203	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGY-01A-11D-A42Y-10	TCGA-2G-AAGY-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	da2a7140-5541-4d62-8d1a-eb9ecab13e93	83598a70-86fa-44e5-833c-6d397c4dd186	g.chrX:23398203G>T	ENST00000379361.4	+	2	1707	c.847G>T	c.(847-849)Gcc>Tcc	p.A283S		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	283	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						GGTTACCATGGCCATCCTGTG	0.572																																					p.A283S													.	PTCHD1	213		0			c.G847T												147.0	124.0	132.0					X																	23398203		2203	4300	6503	SO:0001583	missense	139411	exon2			ACCATGGCCATCC	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.847G>T	X.37:g.23398203G>T	ENSP00000368666:p.Ala283Ser		112	0	0		194	0.03	5	NM_173495	0		0	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451158	0.63290	.	.	ENSG00000165186	ENST00000379361	D	0.92858	-3.12	4.86	4.86	0.63082	Sterol-sensing domain (1);	0.051865	0.85682	D	0.000000	D	0.93275	0.7857	L	0.33485	1.01	0.53688	D	0.999973	D;B	0.89917	1.0;0.022	D;B	0.78314	0.991;0.068	D	0.92212	0.5777	10	0.30854	T	0.27	.	17.4049	0.87470	0.0:0.0:1.0:0.0	.	178;283	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	S	283	ENSP00000368666:A283S	ENSP00000368666:A283S	A	+	1	0	PTCHD1	23308124	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.208000	0.95075	2.381000	0.81170	0.600000	0.82982	GCC			0.572	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056047.2		NM_173495	
