#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CPTP	80772	mdanderson.org	37	1	1262874	1262874	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:1262874C>T	ENST00000343938.4	+	3	787	c.376C>T	c.(376-378)Cgt>Tgt	p.R126C	GLTPD1_ENST00000464957.1_3'UTR|CPSF3L_ENST00000540437.1_5'Flank|CPSF3L_ENST00000545578.1_5'Flank|CPSF3L_ENST00000450926.2_5'Flank|CPSF3L_ENST00000421495.2_5'Flank|CPSF3L_ENST00000419704.1_5'Flank|CPSF3L_ENST00000411962.1_5'Flank|CPSF3L_ENST00000435064.1_5'Flank	NM_001029885.1	NP_001025056.1	Q5TA50	CPTP_HUMAN		126					ceramide 1-phosphate transport (GO:1902389)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide 1-phosphate binding (GO:1902387)|ceramide 1-phosphate transporter activity (GO:1902388)|glycolipid binding (GO:0051861)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;4.95e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGAGGGCCTGCGTACCAGCCC	0.741																																					p.R126C													.	.			0			c.C376T												12.0	10.0	11.0					1																	1262874		2135	4188	6323	SO:0001583	missense	80772	exon3			GGCCTGCGTACCA																												ENST00000343938.4:c.376C>T	1.37:g.1262874C>T	ENSP00000343890:p.Arg126Cys		21	0	0		23	0.13	3	NM_001029885	22	0.00	0	Q4G0E6|Q7L5A4	Missense_Mutation	SNP	ENST00000343938.4	37	CCDS30555.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.561969	0.45590	.	.	ENSG00000224051	ENST00000343938	.	.	.	5.16	1.96	0.26148	Glycolipid transfer protein domain (3);	0.000000	0.85682	U	0.000000	T	0.41971	0.1182	M	0.67953	2.075	0.80722	D	1	P	0.37276	0.589	B	0.32980	0.156	T	0.28522	-1.0041	9	0.35671	T	0.21	-18.9042	5.1949	0.15232	0.2557:0.5465:0.125:0.0728	.	126	Q5TA50	GLTD1_HUMAN	C	126	.	ENSP00000343890:R126C	R	+	1	0	GLTPD1	1252737	0.995000	0.38212	0.690000	0.30148	0.118000	0.20060	0.832000	0.27490	1.117000	0.41842	0.561000	0.74099	CGT			0.741	GLTPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008742.1			
CFAP74	85452	mdanderson.org	37	1	1920330	1920330	+	Silent	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:1920330G>A	ENST00000434971.2	-	3	182	c.150C>T	c.(148-150)agC>agT	p.S50S				Q69YW0	CA222_HUMAN		276										breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)	11	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CGAGTTACCTGCTGTGTCCCG	0.602																																					p.S50S													.	.			0			c.C150T												45.0	46.0	46.0					1																	1920330		1831	4074	5905	SO:0001819	synonymous_variant	85452	exon3			TTACCTGCTGTGT																												ENST00000434971.2:c.150C>T	1.37:g.1920330G>A			23	0	0		19	0.11	2	NM_001080484	0		0		Silent	SNP	ENST00000434971.2	37																																																																																						0.602	C1orf222-201	KNOWN	basic	protein_coding	protein_coding					
KIF1B	23095	broad.mit.edu	37	1	10397530	10397530	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:10397530G>T	ENST00000377086.1	+	31	3563	c.3361G>T	c.(3361-3363)Gta>Tta	p.V1121L	KIF1B_ENST00000377081.1_Missense_Mutation_p.V1121L|KIF1B_ENST00000263934.6_Missense_Mutation_p.V1075L			O60333	KIF1B_HUMAN	kinesin family member 1B	1121					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CACTTTCCGAGTAACAGTGTT	0.488																																					p.V1075L													.	KIF1B	242		0			c.G3223T												176.0	170.0	172.0					1																	10397530		2203	4300	6503	SO:0001583	missense	23095	exon29			TTCCGAGTAACAG	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3361G>T	1.37:g.10397530G>T	ENSP00000366290:p.Val1121Leu		167	0	0		197	0.02	4	NM_015074	71	0.00	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	33	5.229592	0.95173	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.77877	-1.13;-1.13;-1.13	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.87293	0.6141	M	0.64567	1.98	0.80722	D	1	P;D;D;D;D;P	0.67145	0.952;0.985;0.996;0.992;0.959;0.902	P;P;D;D;B;D	0.77557	0.829;0.729;0.99;0.989;0.437;0.927	D	0.86251	0.1649	10	0.51188	T	0.08	.	20.1346	0.98019	0.0:0.0:1.0:0.0	.	1107;1081;1121;1095;1121;1075	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	L	1121;1075;1121;1121	ENSP00000263934:V1075L;ENSP00000366290:V1121L;ENSP00000366284:V1121L	ENSP00000263934:V1075L	V	+	1	0	KIF1B	10320117	1.000000	0.71417	0.117000	0.21633	0.996000	0.88848	9.869000	0.99810	2.765000	0.95021	0.655000	0.94253	GTA			0.488	KIF1B-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000005102.1			
MFN2	9927	broad.mit.edu	37	1	12069691	12069691	+	Silent	SNP	C	C	T	rs374371748		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:12069691C>T	ENST00000235329.5	+	18	2434	c.2112C>T	c.(2110-2112)gaC>gaT	p.D704D	MFN2_ENST00000444836.1_Silent_p.D704D	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	704					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGCAAGTTGACGTCACCCGGG	0.542																																					p.D704D													.	MFN2	83		0			c.C2112T							C	,	1,4405	2.1+/-5.4	0,1,2202	99.0	96.0	97.0		2112,2112	-9.9	0.0	1		97	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MFN2	NM_001127660.1,NM_014874.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	704/758,704/758	12069691	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9927	exon18			AGTTGACGTCACC	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.2112C>T	1.37:g.12069691C>T			144	0.0069444444	1		164	0.02	4	NM_014874	155	0.00	0	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Silent	SNP	ENST00000235329.5	37	CCDS30587.1																																																																																					0.542	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006859.2		NM_014874	
NASP	4678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46073158	46073158	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:46073158C>T	ENST00000350030.3	+	6	662	c.575C>T	c.(574-576)gCa>gTa	p.A192V	NASP_ENST00000351223.3_Intron|NASP_ENST00000402363.3_Missense_Mutation_p.A194V|NASP_ENST00000537798.1_Missense_Mutation_p.A128V|NASP_ENST00000372052.4_Intron	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	192	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AGTAAATCTGCAGAGGAGCCA	0.428																																					p.A192V													.	.			0			c.C575T												48.0	51.0	50.0					1																	46073158		2203	4300	6503	SO:0001583	missense	4678	exon6			AATCTGCAGAGGA	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.575C>T	1.37:g.46073158C>T	ENSP00000255120:p.Ala192Val		179	0	0		196	0.24	47	NM_002482	531	0.28	151	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	ENST00000350030.3	37	CCDS524.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.840867	0.32513	.	.	ENSG00000132780	ENST00000527470;ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030;ENST00000470768	T;T;T	0.49139	0.81;0.79;0.8	5.11	1.96	0.26148	.	1.138890	0.06237	N	0.689709	T	0.34832	0.0911	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.15719	0.006;0.003;0.014;0.001;0.006	B;B;B;B;B	0.10450	0.003;0.005;0.005;0.001;0.005	T	0.31833	-0.9929	10	0.59425	D	0.04	1.3308	7.2233	0.26002	0.5082:0.4062:0.0:0.0856	.	128;192;92;192;194	F5H3J2;Q53H03;B4DS57;P49321;P49321-3	.;.;.;NASP_HUMAN;.	V	128;128;194;92;192;155	ENSP00000438871:A128V;ENSP00000384529:A194V;ENSP00000255120:A192V	ENSP00000345532:A92V	A	+	2	0	NASP	45845745	0.024000	0.19004	0.870000	0.34147	0.952000	0.60782	0.599000	0.24089	0.787000	0.33731	0.650000	0.86243	GCA			0.428	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000021533.2		NM_002482	
ERICH3	127254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75038768	75038768	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:75038768G>C	ENST00000326665.5	-	14	2844	c.2626C>G	c.(2626-2628)Cct>Gct	p.P876A	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		876	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGCTTTTCAGGAGCCTCATCT	0.522																																					p.P876A													C1orf173,NS,malignant_melanoma,0,1	C1orf173	0	1	0			c.C2626G												213.0	212.0	213.0					1																	75038768		2203	4300	6503	SO:0001583	missense	127254	exon14			TTTCAGGAGCCTC																												ENST00000326665.5:c.2626C>G	1.37:g.75038768G>C	ENSP00000322609:p.Pro876Ala		109	0	0		103	0.20	21	NM_001002912	0		0	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498258	0.26861	.	.	ENSG00000178965	ENST00000326665	T	0.14640	2.49	5.21	-1.77	0.07982	.	.	.	.	.	T	0.02380	0.0073	L	0.36672	1.1	0.09310	N	1	B	0.17667	0.023	B	0.17433	0.018	T	0.46386	-0.9195	9	0.24483	T	0.36	4.3564	2.7286	0.05221	0.2495:0.4232:0.2156:0.1116	.	876	Q5RHP9	CA173_HUMAN	A	876	ENSP00000322609:P876A	ENSP00000322609:P876A	P	-	1	0	C1orf173	74811356	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.629000	0.05508	-0.277000	0.09193	0.563000	0.77884	CCT			0.522	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000026516.1			
ZNF644	84146	broad.mit.edu	37	1	91403170	91403170	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:91403170G>T	ENST00000370440.1	-	4	3777	c.3560C>A	c.(3559-3561)gCt>gAt	p.A1187D	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.A1187D|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	1187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AGGAGAAATAGCAGAATTCCT	0.378																																					p.A1187D													.	ZNF644	120		0			c.C3560A												91.0	93.0	92.0					1																	91403170		2203	4299	6502	SO:0001583	missense	84146	exon4			GAAATAGCAGAAT	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3560C>A	1.37:g.91403170G>T	ENSP00000359469:p.Ala1187Asp		172	0	0		192	0.02	4	NM_201269	81	0.00	0	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	37	CCDS731.1	.	.	.	.	.	.	.	.	.	.	G	3.032	-0.199391	0.06219	.	.	ENSG00000122482	ENST00000370440;ENST00000337393	T;T	0.00574	6.47;6.47	5.84	2.64	0.31445	.	0.565153	0.20352	N	0.094028	T	0.00109	0.0003	N	0.08118	0	0.20489	N	0.999898	B	0.02656	0.0	B	0.01281	0.0	T	0.27606	-1.0069	10	0.13108	T	0.6	-0.2395	2.9246	0.05780	0.0836:0.208:0.3546:0.3537	.	1187	Q9H582	ZN644_HUMAN	D	1187	ENSP00000359469:A1187D;ENSP00000337008:A1187D	ENSP00000337008:A1187D	A	-	2	0	ZNF644	91175758	0.341000	0.24801	0.031000	0.17742	0.975000	0.68041	1.126000	0.31344	0.784000	0.33661	0.655000	0.94253	GCT			0.378	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000027846.2		NM_032186	
VCAM1	7412	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	101186170	101186170	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:101186170A>T	ENST00000294728.2	+	2	304	c.203A>T	c.(202-204)aAt>aTt	p.N68I	VCAM1_ENST00000370119.4_Intron|VCAM1_ENST00000347652.2_Missense_Mutation_p.N68I|VCAM1_ENST00000370115.1_Missense_Mutation_p.N68I	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	68	Ig-like C2-type 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AGTCCACTGAATGGGAAGGTG	0.473																																					p.N68I													.	.			0			c.A203T												94.0	82.0	86.0					1																	101186170		2203	4300	6503	SO:0001583	missense	7412	exon2			CACTGAATGGGAA	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.203A>T	1.37:g.101186170A>T	ENSP00000294728:p.Asn68Ile		189	0	0		196	0.26	50	NM_001078	12	0.00	0	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277544	0.40294	.	.	ENSG00000162692	ENST00000347652;ENST00000294728;ENST00000370115	T;T;T	0.68765	-0.35;-0.35;-0.35	5.82	3.5	0.40072	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.670270	0.16735	N	0.201657	T	0.71099	0.3300	M	0.84433	2.695	0.09310	N	1	D;D	0.76494	0.968;0.999	P;D	0.77004	0.556;0.989	T	0.63994	-0.6511	9	.	.	.	-10.165	4.4656	0.11687	0.6494:0.0:0.3506:0.0	.	68;68	P19320-2;P19320	.;VCAM1_HUMAN	I	68	ENSP00000304611:N68I;ENSP00000294728:N68I;ENSP00000359133:N68I	.	N	+	2	0	VCAM1	100958758	0.474000	0.25886	0.022000	0.16811	0.194000	0.23727	1.137000	0.31479	1.030000	0.39839	0.533000	0.62120	AAT			0.473	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030213.1		NM_001078	
GPSM2	29899	ucsc.edu	37	1	109461327	109461327	+	Silent	SNP	G	G	A	rs377658968		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:109461327G>A	ENST00000406462.2	+	13	2129	c.1356G>A	c.(1354-1356)ggG>ggA	p.G452G	GPSM2_ENST00000264126.3_Silent_p.G452G|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	452					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		GACTGAAGGGGAAAAAATACA	0.383																																					p.G452G													.	GPSM2	56		0			c.G1356A							G		0,4406		0,0,2203	96.0	98.0	97.0		1356	3.8	1.0	1		97	1,8599		0,1,4299	no	coding-synonymous	GPSM2	NM_013296.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		452/685	109461327	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	29899	exon12			GAAGGGGAAAAAA	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1356G>A	1.37:g.109461327G>A			221	0	0		260	0.01	2	NM_013296	52	0.17	9	Q5T1N8|Q6IBL7|Q8N0Z5	Silent	SNP	ENST00000406462.2	37	CCDS792.2	.	.	.	.	.	.	.	.	.	.	G	9.971	1.225404	0.22457	0.0	1.16E-4	ENSG00000121957	ENST00000441735	.	.	.	5.91	3.85	0.44370	.	0.053423	0.85682	D	0.000000	T	0.51466	0.1676	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53585	-0.8418	6	0.48119	T	0.1	-2.9929	10.3349	0.43844	0.0801:0.3853:0.5347:0.0	.	.	.	.	E	42	.	ENSP00000390629:G42E	G	+	2	0	GPSM2	109262850	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.764000	0.26532	0.701000	0.31803	0.558000	0.71614	GGA			0.383	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032400.3	rescued with RNA-seq	NM_013296	
RPTN	126638	broad.mit.edu	37	1	152127961	152127961	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:152127961C>T	ENST00000316073.3	-	3	1678	c.1614G>A	c.(1612-1614)atG>atA	p.M538I		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	538	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.M538I(2)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						CTTGTCTGTCCATCTGACTGT	0.517																																					p.M538I													RPTN,NS,carcinoma,-1,2	RPTN	123	2	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.G1614A												789.0	691.0	721.0					1																	152127961		1568	3582	5150	SO:0001583	missense	126638	exon3			TCTGTCCATCTGA	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1614G>A	1.37:g.152127961C>T	ENSP00000317895:p.Met538Ile		178	0.0112359551	2		226	0.03	6	NM_001122965	0		0	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	C	9.026	0.986041	0.18889	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.10668	2.85	4.58	-1.48	0.08745	.	0.699242	0.11116	U	0.597994	T	0.02342	0.0072	L	0.47716	1.5	0.09310	N	1	B	0.21753	0.06	B	0.17979	0.02	T	0.44267	-0.9339	10	0.32370	T	0.25	0.2313	3.0744	0.06241	0.449:0.1983:0.0:0.3527	.	538	Q6XPR3	RPTN_HUMAN	I	538;193	ENSP00000317895:M538I	ENSP00000317895:M538I	M	-	3	0	RPTN	150394585	0.000000	0.05858	0.217000	0.23759	0.005000	0.04900	-1.468000	0.02350	-0.146000	0.11274	-0.715000	0.03620	ATG			0.517	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333867.1		XM_371312	
LOR	4014	broad.mit.edu	37	1	153233515	153233515	+	Silent	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr1:153233515C>T	ENST00000368742.3	+	2	147	c.90C>T	c.(88-90)ggC>ggT	p.G30G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	30					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcggcagcggcggtggtggct	0.697																																					p.G30G													.	LOR	19		0			c.C90T												6.0	8.0	8.0					1																	153233515		1962	3919	5881	SO:0001819	synonymous_variant	4014	exon2			CAGCGGCGGTGGT	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.90C>T	1.37:g.153233515C>T			74	0	0		81	0.04	3	NM_000427	0		0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																					0.697	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039107.1		NM_000427	
NCOA4	8031	broad.mit.edu	37	10	51585536	51585536	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr10:51585536G>T	ENST00000443446.1	+	8	1864	c.1635G>T	c.(1633-1635)aaG>aaT	p.K545N	NCOA4_ENST00000374087.4_Missense_Mutation_p.K545N|NCOA4_ENST00000374082.1_Intron|NCOA4_ENST00000452682.1_Missense_Mutation_p.K561N|NCOA4_ENST00000414907.2_Missense_Mutation_p.K379N|NCOA4_ENST00000438493.1_Missense_Mutation_p.K561N|NCOA4_ENST00000430396.2_Missense_Mutation_p.K445N|NCOA4_ENST00000344348.6_Missense_Mutation_p.K545N	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	545					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						CAGGAAAGAAGATGGGCAACC	0.468			T	RET	papillary thyroid																																p.K561N				Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4	58		0			c.G1683T												67.0	73.0	71.0					10																	51585536		2202	4297	6499	SO:0001583	missense	8031	exon9			AAAGAAGATGGGC	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1635G>T	10.37:g.51585536G>T	ENSP00000390713:p.Lys545Asn		65	0	0		62	0.08	5	NM_001145261	265	0.00	0	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	G	1.663	-0.510973	0.04231	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000443446	T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16	5.84	-1.23	0.09465	.	0.513015	0.22073	N	0.065003	T	0.13970	0.0338	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.09022	0.002;0.001;0.002;0.001	B;B;B;B	0.08055	0.003;0.002;0.002;0.002	T	0.10753	-1.0616	9	.	.	.	-4.2204	1.5753	0.02623	0.237:0.3916:0.2015:0.1698	.	445;561;561;545	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	N	561;561;445;545;379;545;545	ENSP00000405146:K561N;ENSP00000395465:K561N;ENSP00000393053:K445N;ENSP00000363200:K545N;ENSP00000411018:K379N;ENSP00000344552:K545N;ENSP00000390713:K545N	.	K	+	3	2	NCOA4	51255542	0.039000	0.19947	0.257000	0.24404	0.459000	0.32528	-0.066000	0.11598	-0.108000	0.12066	0.650000	0.86243	AAG			0.468	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048052.1		NM_005437	
LRRTM3	347731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	68686864	68686864	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr10:68686864T>A	ENST00000361320.4	+	2	768	c.190T>A	c.(190-192)Tta>Ata	p.L64I	CTNNA3_ENST00000433211.2_Intron|CTNNA3_ENST00000373744.4_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	64					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						TGCTGGTTGCTTAGGTTTGTC	0.418																																					p.L64I													.	.			0			c.T190A												121.0	126.0	124.0					10																	68686864		2203	4300	6503	SO:0001583	missense	347731	exon2			GGTTGCTTAGGTT	BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.190T>A	10.37:g.68686864T>A	ENSP00000355187:p.Leu64Ile		95	0	0		69	0.16	11	NM_178011	0		0	A8K2A3|Q2NKX7|Q6N0A3	Missense_Mutation	SNP	ENST00000361320.4	37	CCDS7270.1	.	.	.	.	.	.	.	.	.	.	T	2.956	-0.215641	0.06101	.	.	ENSG00000198739	ENST00000361320;ENST00000373722	T	0.04406	3.63	5.53	4.4	0.53042	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.50627	D	0.000110	T	0.03136	0.0092	N	0.17800	0.525	0.35313	D	0.784112	B;B	0.06786	0.0;0.001	B;B	0.12156	0.0;0.007	T	0.41324	-0.9515	10	0.21014	T	0.42	.	5.7309	0.18038	0.1494:0.0804:0.0:0.7701	.	64;64	Q86VH5;Q86VH5-2	LRRT3_HUMAN;.	I	64	ENSP00000355187:L64I	ENSP00000355187:L64I	L	+	1	2	LRRTM3	68356870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.992000	0.40737	0.947000	0.37659	0.533000	0.62120	TTA			0.418	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048277.2		NM_178011	
AP2A2	161	mdanderson.org	37	11	993799	993799	+	Silent	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr11:993799C>T	ENST00000448903.2	+	13	1737	c.1596C>T	c.(1594-1596)tgC>tgT	p.C532C	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Silent_p.C533C	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	532					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCCACCTGTGCAGCGTCCCCA	0.652																																					p.C533C													.	.			0			c.C1599T												36.0	38.0	38.0					11																	993799		2168	4256	6424	SO:0001819	synonymous_variant	161	exon13			CCTGTGCAGCGTC	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1596C>T	11.37:g.993799C>T			27	0	0		31	0.10	3	NM_001242837	133	0.00	0	O75403|Q53ET1|Q96SI8	Silent	SNP	ENST00000448903.2	37	CCDS44512.1																																																																																					0.652	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000385431.2		NM_012305	
C11orf42	160298	broad.mit.edu	37	11	6231188	6231188	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr11:6231188A>C	ENST00000316375.2	+	2	231	c.181A>C	c.(181-183)Acc>Ccc	p.T61P	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	61										endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCAGCCCATACCCGCCTGGC	0.617																																					p.T61P													.	C11orf42	35		0			c.A181C												77.0	67.0	70.0					11																	6231188		2201	4296	6497	SO:0001583	missense	160298	exon2			GCCCATACCCGCC	BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.181A>C	11.37:g.6231188A>C	ENSP00000321021:p.Thr61Pro		93	0.2688172043	25		71	0.23	16	NM_173525	1	0.00	0		Missense_Mutation	SNP	ENST00000316375.2	37	CCDS7759.1	.	.	.	.	.	.	.	.	.	.	A	6.998	0.554248	0.13374	.	.	ENSG00000180878	ENST00000316375	T	0.48522	0.81	5.35	1.6	0.23607	.	0.574450	0.16944	N	0.193178	T	0.29976	0.0750	N	0.19112	0.55	0.28108	N	0.931127	P	0.39883	0.693	B	0.41332	0.354	T	0.13548	-1.0505	10	0.52906	T	0.07	-8.9523	4.2553	0.10714	0.6039:0.0:0.0858:0.3102	.	61	Q8N5U0	CK042_HUMAN	P	61	ENSP00000321021:T61P	ENSP00000321021:T61P	T	+	1	0	C11orf42	6187764	0.107000	0.21998	1.000000	0.80357	0.958000	0.62258	0.072000	0.14617	0.449000	0.26747	0.477000	0.44152	ACC			0.617	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257227.2		NM_173525	
RAB3IL1	5866	mdanderson.org	37	11	61669973	61669973	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr11:61669973G>T	ENST00000394836.2	-	8	1097	c.940C>A	c.(940-942)Cga>Aga	p.R314R	RAB3IL1_ENST00000301773.5_Silent_p.R288R	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	314					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R314*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						AGCCGGATTCGGTGGCGGCAG	0.632																																					p.R314R													RAB3IL1,NS,carcinoma,+1,2	RAB3IL1	1	2	1	Substitution - Nonsense(1)	large_intestine(1)	c.C940A												40.0	39.0	39.0					11																	61669973		2200	4299	6499	SO:0001819	synonymous_variant	5866	exon8			GGATTCGGTGGCG	AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.940C>A	11.37:g.61669973G>T			65	0	0		57	0.05	3	NM_013401	24	0.00	0	Q86V32|Q9P1Q8	Silent	SNP	ENST00000394836.2	37	CCDS8014.1																																																																																					0.632	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394917.1		NM_013401	
BSCL2	26580	mdanderson.org	37	11	62458260	62458260	+	Splice_Site	SNP	T	T	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr11:62458260T>C	ENST00000403550.1	-	9	1383	c.960A>G	c.(958-960)acA>acG	p.T320T	BSCL2_ENST00000433053.1_Splice_Site_p.T384T|BSCL2_ENST00000405837.1_Splice_Site_p.T386T|BSCL2_ENST00000278893.7_Splice_Site_p.Q273R|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|BSCL2_ENST00000421906.1_Splice_Site_p.T320T|LRRN4CL_ENST00000317449.4_5'Flank|BSCL2_ENST00000407022.3_Splice_Site_p.T320T|BSCL2_ENST00000360796.5_Splice_Site_p.T384T			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	320					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						GCGCCATACCTGTCCCTGAGG	0.572																																					p.Q273R													.	.			0			c.A818G												88.0	81.0	84.0					11																	62458260		2202	4299	6501	SO:0001630	splice_region_variant	26580	exon8			CATACCTGTCCCT		CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.961+1A>G	11.37:g.62458260T>C			74	0	0		53	0.08	4	NM_001130702	244	0.00	0	G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	ENST00000403550.1	37	CCDS8031.1	.	.	.	.	.	.	.	.	.	.	T	15.58	2.874530	0.51695	.	.	ENSG00000168000	ENST00000278893	D	0.89746	-2.56	4.99	4.99	0.66335	.	.	.	.	.	D	0.91375	0.7279	.	.	.	0.80722	D	1	D	0.54964	0.969	P	0.55011	0.766	D	0.91961	0.5579	8	0.72032	D	0.01	-1.8831	10.9936	0.47563	0.0:0.0:0.0:1.0	.	273	Q96G97-3	.	R	273	ENSP00000278893:Q273R	ENSP00000278893:Q273R	Q	-	2	0	BSCL2	62214836	1.000000	0.71417	0.997000	0.53966	0.636000	0.38137	3.726000	0.54977	2.109000	0.64355	0.459000	0.35465	CAG			0.572	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000319185.1		NM_032667	Silent
CDC42EP2	10435	broad.mit.edu;mdanderson.org	37	11	65088569	65088569	+	Missense_Mutation	SNP	G	G	T	rs377014949		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr11:65088569G>T	ENST00000544348.1	+	2	806	c.200G>T	c.(199-201)gGg>gTg	p.G67V	CDC42EP2_ENST00000279249.2_Missense_Mutation_p.G67V|CDC42EP2_ENST00000533419.1_Missense_Mutation_p.G67V			O14613	BORG1_HUMAN	CDC42 effector protein (Rho GTPase binding) 2	67					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|Rho GTPase activator activity (GO:0005100)			lung(1)	1						CTCCTGCCGGGGACCATGGTG	0.647																																					p.G67V													.	CDC42EP2	13		0			c.G200T												75.0	73.0	73.0					11																	65088569		2201	4297	6498	SO:0001583	missense	10435	exon2			TGCCGGGGACCAT	AF098290	CCDS8099.1	11q13	2008-07-18				ENSG00000149798			16263	protein-coding gene	gene with protein product	"""CRIB-containing BOGR1 protein"""	606132				10490598, 11035016	Standard	NM_006779		Approved	CEP2, BORG1	uc001odl.3	O14613		ENST00000544348.1:c.200G>T	11.37:g.65088569G>T	ENSP00000442534:p.Gly67Val		147	0	0		149	0.04	6	NM_006779	2	0.00	0	B2RD85|Q9UNS0	Missense_Mutation	SNP	ENST00000544348.1	37	CCDS8099.1	.	.	.	.	.	.	.	.	.	.	G	14.07	2.425538	0.43020	.	.	ENSG00000149798	ENST00000279249;ENST00000533419;ENST00000544348	D;D;D	0.85702	-2.02;-2.02;-2.02	5.23	5.23	0.72850	PAK-box/P21-Rho-binding (1);	0.000000	0.64402	D	0.000001	D	0.88224	0.6379	L	0.55743	1.74	0.80722	D	1	D	0.64830	0.994	D	0.63793	0.918	D	0.87374	0.2352	10	0.51188	T	0.08	-11.1984	9.6621	0.39960	0.0918:0.0:0.9082:0.0	.	67	O14613	BORG1_HUMAN	V	67	ENSP00000279249:G67V;ENSP00000431660:G67V;ENSP00000442534:G67V	ENSP00000279249:G67V	G	+	2	0	CDC42EP2	64845145	0.997000	0.39634	0.929000	0.37066	0.182000	0.23217	3.932000	0.56537	2.720000	0.93068	0.591000	0.81541	GGG			0.647	CDC42EP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387258.1		NM_006779	
IGSF9B	22997	mdanderson.org	37	11	133805639	133805639	+	Silent	SNP	C	C	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr11:133805639C>G	ENST00000321016.8	-	7	1070	c.840G>C	c.(838-840)gtG>gtC	p.V280V	IGSF9B_ENST00000533871.2_Silent_p.V280V			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	280	Ig-like 3.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TTAGGATGCGCACCCTCAGCT	0.637																																					p.V280V													.	.			0			c.G840C												24.0	28.0	26.0					11																	133805639		2105	4208	6313	SO:0001819	synonymous_variant	22997	exon7			GATGCGCACCCTC	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.840G>C	11.37:g.133805639C>G			56	0	0		38	0.08	3	NM_014987	2	0.00	0	G5EA26	Silent	SNP	ENST00000321016.8	37																																																																																						0.637	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding				XM_290502	
CACNA1C	775	broad.mit.edu	37	12	2800309	2800309	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr12:2800309G>T	ENST00000347598.4	+	49	6505	c.6505G>T	c.(6505-6507)Ggt>Tgt	p.G2169C	CACNA1C_ENST00000335762.5_Missense_Mutation_p.G2146C|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399644.1_Missense_Mutation_p.G2121C|CACNA1C_ENST00000399649.1_Missense_Mutation_p.G2127C|CACNA1C_ENST00000399591.1_Missense_Mutation_p.G2129C|CACNA1C_ENST00000399634.1_Missense_Mutation_p.G2192C|CACNA1C_ENST00000399601.1_Missense_Mutation_p.G2121C|CACNA1C_ENST00000402845.3_Missense_Mutation_p.G2140C|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399617.1_Missense_Mutation_p.G2156C|CACNA1C_ENST00000344100.3_Missense_Mutation_p.G2162C|CACNA1C_ENST00000399655.1_Missense_Mutation_p.G2121C|CACNA1C_ENST00000399637.1_Missense_Mutation_p.G2140C|CACNA1C_ENST00000399595.1_Missense_Mutation_p.G2129C|CACNA1C_ENST00000399603.1_Missense_Mutation_p.G2121C|CACNA1C_ENST00000399629.1_Missense_Mutation_p.G2138C|CACNA1C_ENST00000399606.1_Missense_Mutation_p.G2141C|CACNA1C_ENST00000399597.1_Missense_Mutation_p.G2121C|CACNA1C_ENST00000399641.1_Missense_Mutation_p.G2121C|CACNA1C_ENST00000406454.3_Missense_Mutation_p.G2192C|CACNA1C_ENST00000399638.1_Missense_Mutation_p.G2149C|CACNA1C_ENST00000399621.1_Missense_Mutation_p.G2140C|CACNA1C_ENST00000327702.7_Missense_Mutation_p.G2156C|CACNA1C-AS1_ENST00000541673.1_RNA	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2204			A -> T.		adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCGCGCGCGGGGTCGACCGAG	0.627																																					p.G2204C													.	CACNA1C	1023		0			c.G6610T												21.0	28.0	25.0					12																	2800309		1961	4123	6084	SO:0001583	missense	775	exon50			GCGCGGGGTCGAC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6505G>T	12.37:g.2800309G>T	ENSP00000266376:p.Gly2169Cys		128	0	0		209	0.02	4	NM_199460	54	0.00	0	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	2.850	-0.238487	0.05944	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37	4.49	3.57	0.40892	.	0.941163	0.08901	N	0.877252	T	0.40015	0.1100	N	0.02011	-0.69	0.09310	N	1	B;B;P;B;B;B;B;P;B;B;P;B;P;P;P;B;P;B;P;B;P;B;D;P;P	0.56287	0.26;0.004;0.525;0.0;0.001;0.001;0.001;0.927;0.0;0.0;0.853;0.0;0.525;0.948;0.698;0.001;0.525;0.0;0.853;0.0;0.933;0.001;0.975;0.924;0.525	B;B;B;B;B;B;B;P;B;B;P;B;B;P;B;B;B;B;P;B;P;B;P;P;B	0.52031	0.246;0.004;0.224;0.001;0.004;0.004;0.003;0.605;0.0;0.001;0.599;0.002;0.303;0.605;0.112;0.001;0.303;0.0;0.497;0.0;0.513;0.002;0.688;0.518;0.224	T	0.49466	-0.8937	10	0.34782	T	0.22	.	14.6908	0.69085	0.0:0.1462:0.8538:0.0	.	812;2162;2118;2204;2156;2140;2121;2138;2149;2121;2141;2121;2152;2169;2121;2156;2192;2129;2127;2129;2110;2140;2140;2121;2121	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	C	2146;2121;2121;2149;2121;2140;2140;2129;2121;2169;2141;2121;2162;2138;2156;2127;2140;2121;2192;2156;2192;2129;2022	ENSP00000336982:G2146C;ENSP00000382563:G2121C;ENSP00000382552:G2121C;ENSP00000382547:G2149C;ENSP00000382506:G2121C;ENSP00000382530:G2140C;ENSP00000382546:G2140C;ENSP00000382500:G2129C;ENSP00000382549:G2121C;ENSP00000266376:G2169C;ENSP00000382515:G2141C;ENSP00000382510:G2121C;ENSP00000341092:G2162C;ENSP00000382537:G2138C;ENSP00000329877:G2156C;ENSP00000382557:G2127C;ENSP00000385724:G2140C;ENSP00000382512:G2121C;ENSP00000382542:G2192C;ENSP00000382526:G2156C;ENSP00000385896:G2192C;ENSP00000382504:G2129C	ENSP00000323129:G2022C	G	+	1	0	CACNA1C	2670570	1.000000	0.71417	0.005000	0.12908	0.022000	0.10575	2.052000	0.41316	1.200000	0.43188	0.591000	0.81541	GGT			0.627	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317035.1		NM_000719	
SYCP3	50511	mdanderson.org	37	12	102127445	102127445	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr12:102127445G>T	ENST00000392927.3	-	6	492	c.361C>A	c.(361-363)Ctt>Att	p.L121I	SYCP3_ENST00000392924.1_Missense_Mutation_p.L121I|SYCP3_ENST00000266743.2_Missense_Mutation_p.L121I	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	121	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TCTTGGTTAAGCTTCTGCCTG	0.303																																					p.L121I													.	.			0			c.C361A												102.0	94.0	96.0					12																	102127445		2203	4300	6503	SO:0001583	missense	50511	exon6			GGTTAAGCTTCTG	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.361C>A	12.37:g.102127445G>T	ENSP00000376658:p.Leu121Ile		45	0	0		44	0.07	3	NM_153694	259	0.00	0		Missense_Mutation	SNP	ENST00000392927.3	37	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	G	9.099	1.003774	0.19199	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.68	2.66	0.31614	.	0.074248	0.53938	D	0.000042	T	0.46833	0.1413	M	0.64630	1.985	0.29662	N	0.843118	B	0.33807	0.426	B	0.43508	0.422	T	0.43845	-0.9366	9	0.33940	T	0.23	-6.0415	5.3515	0.16038	0.0708:0.1245:0.5484:0.2564	.	121	Q8IZU3	SYCP3_HUMAN	I	121	.	ENSP00000266743:L121I	L	-	1	0	SYCP3	100651576	1.000000	0.71417	0.056000	0.19401	0.005000	0.04900	2.715000	0.47210	0.719000	0.32188	0.563000	0.77884	CTT			0.303	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316478.2		NM_153694	
PXMP2	5827	mdanderson.org	37	12	133277883	133277883	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr12:133277883G>A	ENST00000317479.3	+	4	512	c.447G>A	c.(445-447)tgG>tgA	p.W149*	PXMP2_ENST00000428960.2_Nonsense_Mutation_p.W56*|PXMP2_ENST00000545677.1_Missense_Mutation_p.A21T|PXMP2_ENST00000539093.1_Missense_Mutation_p.A21T|RP13-672B3.2_ENST00000537262.1_Missense_Mutation_p.A21T|PXMP2_ENST00000543589.1_Intron	NM_018663.1	NP_061133.1	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	149						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|protein complex (GO:0043234)				large_intestine(1)|liver(2)|lung(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		GGGGCTTCTGGCCGGCGCTGA	0.612																																					p.W149X													.	.			0			c.G447A												62.0	70.0	67.0					12																	133277883		2203	4300	6503	SO:0001587	stop_gained	5827	exon4			CTTCTGGCCGGCG		CCDS9279.1	12q24	2010-08-18	2002-08-29		ENSG00000176894	ENSG00000176894			9716	protein-coding gene	gene with protein product			"""peroxisomal membrane protein 2 (22kD)"""			11590176	Standard	NM_018663		Approved	PMP22	uc001ukt.3	Q9NR77	OTTHUMG00000168019	ENST00000317479.3:c.447G>A	12.37:g.133277883G>A	ENSP00000321271:p.Trp149*		35	0	0		45	0.07	3	NM_018663	86	0.02	2		Nonsense_Mutation	SNP	ENST00000317479.3	37	CCDS9279.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.16|15.16	2.751951|2.751951	0.49362|0.49362	.|.	.|.	ENSG00000176894;ENSG00000176894;ENSG00000256632|ENSG00000176894	ENST00000545677;ENST00000539093;ENST00000537262|ENST00000317479;ENST00000428960	.|.	.|.	.|.	5.31|5.31	5.31|5.31	0.75309|0.75309	.|.	.|0.056499	.|0.85682	.|D	.|0.000000	T|.	0.41650|.	0.1168|.	.|.	.|.	.|.	0.34498|0.34498	D|D	0.705772|0.705772	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.38929|.	-0.9638|.	5|.	0.87932|0.06757	D|T	0|0.87	.|.	16.8178|16.8178	0.85738|0.85738	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	T|X	21|149;56	.|.	ENSP00000444486:A21T|ENSP00000321271:W149X	A|W	+|+	1|3	0|0	RP13-672B3.2;PXMP2|PXMP2	131787956|131787956	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.135000|0.135000	0.20990|0.20990	7.995000|7.995000	0.88328|0.88328	2.650000|2.650000	0.89964|0.89964	0.514000|0.514000	0.50259|0.50259	GCC|TGG			0.612	PXMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397553.1		NM_018663	
ATP8A2	51761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	26436476	26436476	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr13:26436476G>A	ENST00000381655.2	+	33	3255	c.3113G>A	c.(3112-3114)tGg>tAg	p.W1038*	ATP8A2_ENST00000255283.8_Nonsense_Mutation_p.W973*|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	998					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		ATGCTGACCTGGCTGGTGTTT	0.527																																					p.W1038X													.	.			0			c.G3113A												166.0	155.0	158.0					13																	26436476		2020	4175	6195	SO:0001587	stop_gained	51761	exon33			TGACCTGGCTGGT	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3113G>A	13.37:g.26436476G>A	ENSP00000371070:p.Trp1038*		115	0	0		110	0.38	42	NM_016529	1	0.00	0	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Nonsense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	40	8.434176	0.98810	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.2203	0.89899	0.0:0.0:1.0:0.0	.	.	.	.	X	1038;973;818	.	ENSP00000255283:W973X	W	+	2	0	ATP8A2	25334476	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	9.010000	0.93611	2.586000	0.87340	0.655000	0.94253	TGG			0.527	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044236.2		NM_016529	
KBTBD6	89890	mdanderson.org	37	13	41705572	41705572	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr13:41705572C>T	ENST00000379485.1	-	1	1310	c.1076G>A	c.(1075-1077)tGt>tAt	p.C359Y	KBTBD6_ENST00000499385.2_Missense_Mutation_p.C293Y	NM_152903.4	NP_690867.3	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain containing 6	359										NS(1)|breast(1)|endometrium(8)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(4)|urinary_tract(4)	43		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		GTATGGATCACAGCAGAGAAA	0.507																																					p.C359Y													.	.			0			c.G1076A												96.0	96.0	96.0					13																	41705572		2203	4300	6503	SO:0001583	missense	89890	exon1			GGATCACAGCAGA	AK056633	CCDS9376.1	13q13.3	2013-01-08			ENSG00000165572	ENSG00000165572		"""BTB/POZ domain containing"""	25340	protein-coding gene	gene with protein product						12477932	Standard	NM_152903		Approved	DKFZp547E1912	uc001uxu.1	Q86V97	OTTHUMG00000016786	ENST00000379485.1:c.1076G>A	13.37:g.41705572C>T	ENSP00000368799:p.Cys359Tyr		181	0.0110497238	2		208	0.07	15	NM_152903	48	0.00	0	Q5T6Y8|Q8N8L0|Q8NDM5|Q96MP6	Missense_Mutation	SNP	ENST00000379485.1	37	CCDS9376.1	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.564218	0.00134	.	.	ENSG00000165572	ENST00000379485;ENST00000499385	T;T	0.60040	0.22;0.22	3.8	-1.25	0.09405	Kelch-type beta propeller (1);	0.199615	0.46145	N	0.000311	T	0.18467	0.0443	N	0.02181	-0.65	0.28572	N	0.910572	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.29549	-1.0008	10	0.02654	T	1	.	3.9259	0.09263	0.1713:0.3332:0.0:0.4955	.	293;359	F5GZN7;Q86V97	.;KBTB6_HUMAN	Y	359;293	ENSP00000368799:C359Y;ENSP00000444326:C293Y	ENSP00000368799:C359Y	C	-	2	0	KBTBD6	40603572	0.785000	0.28726	0.994000	0.49952	0.294000	0.27393	-0.179000	0.09768	-0.179000	0.10654	-0.379000	0.06801	TGT			0.507	KBTBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044657.1		NM_152903	
EMC9	51016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24608338	24608338	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr14:24608338G>T	ENST00000419198.2	-	5	788	c.508C>A	c.(508-510)Cag>Aag	p.Q170K	EMC9_ENST00000558200.1_5'Flank|EMC9_ENST00000216799.4_Missense_Mutation_p.Q170K|RP11-468E2.5_ENST00000558478.1_lincRNA|EMC9_ENST00000560403.1_Missense_Mutation_p.Q96K			Q9Y3B6	EMC9_HUMAN	ER membrane protein complex subunit 9	170						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)											ACAAGGTGCTGGTGGGCCCGA	0.557																																					p.Q170K													.	.			0			c.C508A												108.0	103.0	104.0					14																	24608338		2203	4300	6503	SO:0001583	missense	51016	exon6			GGTGCTGGTGGGC	BF346999	CCDS9613.1	14q12	2012-05-30	2012-05-30	2012-05-30	ENSG00000100908	ENSG00000100908			20273	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 122"", ""family with sequence similarity 158, member A"""	C14orf122, FAM158A		22119785	Standard	NM_016049		Approved	CGI-112	uc001wmi.3	Q9Y3B6	OTTHUMG00000028796	ENST00000419198.2:c.508C>A	14.37:g.24608338G>T	ENSP00000403210:p.Gln170Lys		196	0	0		268	0.18	47	NM_016049	56	0.13	7	D3DS60|Q9BUM3	Missense_Mutation	SNP	ENST00000419198.2	37	CCDS9613.1	.	.	.	.	.	.	.	.	.	.	g	11.42	1.633078	0.29068	.	.	ENSG00000100908	ENST00000419198;ENST00000216799	T;T	0.39997	1.05;1.05	5.4	3.45	0.39498	.	0.475999	0.23245	N	0.050308	T	0.20700	0.0498	N	0.14661	0.345	0.27163	N	0.961119	B	0.27013	0.166	B	0.25291	0.059	T	0.17776	-1.0358	10	0.08381	T	0.77	-15.5678	8.4571	0.32906	0.0:0.1464:0.5638:0.2898	.	170	Q9Y3B6	F158A_HUMAN	K	170	ENSP00000403210:Q170K;ENSP00000216799:Q170K	ENSP00000216799:Q170K	Q	-	1	0	FAM158A	23678178	0.865000	0.29922	1.000000	0.80357	0.944000	0.59088	1.288000	0.33296	1.454000	0.47793	0.655000	0.94253	CAG			0.557	EMC9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071917.4		NM_016049	
DDHD1	80821	broad.mit.edu	37	14	53513556	53513556	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr14:53513556A>G	ENST00000323669.5	-	13	2632	c.2633T>C	c.(2632-2634)cTt>cCt	p.L878P	DDHD1_ENST00000555621.1_5'Flank|DDHD1_ENST00000357758.3_Missense_Mutation_p.L850P|DDHD1_ENST00000395606.1_Missense_Mutation_p.L857P	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	878	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					TAAAAGAAAAAGGGCAACATC	0.428																																					p.L878P													.	DDHD1	202		0			c.T2633C												151.0	131.0	138.0					14																	53513556		2203	4300	6503	SO:0001583	missense	0	exon13			AGAAAAAGGGCAA	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.2633T>C	14.37:g.53513556A>G	ENSP00000327104:p.Leu878Pro		390	0.0051282051	2		443	0.01	4	NM_001160148	86	0.00	0	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.434184	0.83776	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	5.92	5.92	0.95590	DDHD (2);	0.110472	0.64402	D	0.000007	T	0.77922	0.4203	M	0.69358	2.11	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.85130	0.977;0.997;0.986	T	0.78484	-0.2186	9	0.51188	T	0.08	-12.5987	16.3634	0.83296	1.0:0.0:0.0:0.0	.	857;878;850	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	P	878;857;850;749	.	ENSP00000327104:L878P	L	-	2	0	DDHD1	52583306	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.255000	0.78338	2.270000	0.75569	0.459000	0.35465	CTT			0.428	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000276901.1			
CDKN3	1033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	54884583	54884583	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr14:54884583C>A	ENST00000543789.2	+	6	524	c.434C>A	c.(433-435)aCt>aAt	p.T145N	CDKN3_ENST00000442975.2_Missense_Mutation_p.L116I|CDKN3_ENST00000458126.2_Missense_Mutation_p.L155I|CDKN3_ENST00000335183.6_Missense_Mutation_p.L156I|CDKN3_ENST00000395577.2_Missense_Mutation_p.L110I|CDKN3_ENST00000556102.2_Missense_Mutation_p.L156I|CDKN3_ENST00000556305.1_3'UTR			Q00526	CDK3_HUMAN	cyclin-dependent kinase inhibitor 3	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|G0 to G1 transition (GO:0045023)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|stomach(1)	3						TTGTCTCCTACTATACCTGTC	0.418																																					p.L156I	Pancreas(40;634 1012 9382 49950 52462)												.	.			0			c.C466A												79.0	61.0	67.0					14																	54884583		2203	4300	6503	SO:0001583	missense	1033	exon7			CTCCTACTATACC	U02681	CCDS9716.1, CCDS45109.1	14q22	2011-08-25	2008-08-01		ENSG00000100526	ENSG00000100526		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1791	protein-coding gene	gene with protein product	"""kinase associated phosphatase"", ""cyclin-dependent kinase inhibitor"", ""CDK2-associated dual specificity phosphatase"""	123832				8242750, 7698009	Standard	NM_005192		Approved	KAP, CDI1	uc001xap.3	Q16667	OTTHUMG00000140302	ENST00000543789.2:c.434C>A	14.37:g.54884583C>A	ENSP00000440404:p.Thr145Asn		150	0	0		186	0.06	11	NM_005192	94	0.14	13		Missense_Mutation	SNP	ENST00000543789.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.00|16.00	2.997472|2.997472	0.54147|0.54147	.|.	.|.	ENSG00000100526|ENSG00000100526	ENST00000335183;ENST00000442975;ENST00000458126;ENST00000556102;ENST00000439312;ENST00000395577|ENST00000543789	T;T;T;T;T|.	0.36520|.	1.97;1.97;1.25;1.97;1.97|.	6.17|6.17	5.29|5.29	0.74685|0.74685	Cyclin-dependent kinase inhibitor 3, bac/eukaryotic (1);Protein-tyrosine/Dual-specificity phosphatase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62514|0.62514	0.2434|0.2434	L|L	0.51422|0.51422	1.61|1.61	0.45150|0.45150	D|D	0.99816|0.99816	P;P;D|.	0.67145|.	0.821;0.946;0.996|.	P;P;D|.	0.75020|.	0.807;0.888;0.985|.	T|T	0.60551|0.60551	-0.7241|-0.7241	10|5	0.66056|.	D|.	0.02|.	-13.5043|-13.5043	13.7518|13.7518	0.62912|0.62912	0.0:0.9297:0.0:0.0703|0.0:0.9297:0.0:0.0703	.|.	116;151;156|.	Q16667-2;F8WDR6;Q16667|.	.;.;CDKN3_HUMAN|.	I|N	156;116;155;156;151;110|145	ENSP00000335357:L156I;ENSP00000415333:L116I;ENSP00000396451:L155I;ENSP00000450711:L156I;ENSP00000378944:L110I|.	ENSP00000216414:L55I|.	L|T	+|+	1|2	2|0	CDKN3|CDKN3	53954333|53954333	0.998000|0.998000	0.40836|0.40836	0.054000|0.054000	0.19295|0.19295	0.326000|0.326000	0.28443|0.28443	4.327000|4.327000	0.59247|0.59247	1.627000|1.627000	0.50400|0.50400	0.655000|0.655000	0.94253|0.94253	CTA|ACT			0.418	CDKN3-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000411154.1			
YLPM1	56252	broad.mit.edu	37	14	75230979	75230979	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr14:75230979G>T	ENST00000552421.1	+	1	911	c.787G>T	c.(787-789)Gag>Tag	p.E263*	YLPM1_ENST00000325680.7_Nonsense_Mutation_p.E263*|YLPM1_ENST00000238571.3_Nonsense_Mutation_p.E263*			P49750	YLPM1_HUMAN	YLP motif containing 1	263					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TGTCCAGCAAGAGCCTTTGGA	0.562																																					p.E263X													.	YLPM1	298		0			c.G787T												57.0	62.0	60.0					14																	75230979		1927	4150	6077	SO:0001587	stop_gained	56252	exon1			CAGCAAGAGCCTT	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.787G>T	14.37:g.75230979G>T	ENSP00000447921:p.Glu263*		93	0	0		125	0.04	5	NM_019589	84	0.01	1	P49752|Q96I64|Q9P1V7	Nonsense_Mutation	SNP	ENST00000552421.1	37		.	.	.	.	.	.	.	.	.	.	G	20.8	4.056324	0.76074	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571	.	.	.	4.31	4.31	0.51392	.	0.142736	0.33023	N	0.005379	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-10.0162	9.5549	0.39332	0.0:0.0:0.7905:0.2095	.	.	.	.	X	263	.	ENSP00000238571:E263X	E	+	1	0	YLPM1	74300732	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	3.542000	0.53625	2.218000	0.71995	0.655000	0.94253	GAG			0.562	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000404450.1		NM_019589	
BAHD1	22893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	40751683	40751684	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	GG	GG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr15:40751683_40751684GG>TT	ENST00000416165.1	+	2	1091_1092	c.1020_1021GG>TT	c.(1018-1023)caGGaa>caTTaa	p.340_341QE>H*	BAHD1_ENST00000561234.1_Nonsense_Mutation_p.340_341QE>H*|BAHD1_ENST00000560846.1_Nonsense_Mutation_p.340_341QE>H*	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	340	Pro-rich.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CCCCTAAGCAGGAACTGCATCA	0.668																																					p.QE340H*													.	.			0			c.G1021T																																									SO:0001587	stop_gained	22893	exon2			TAAGCAGGAACTG	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	Exception_encountered	15.37:g.40751683_40751684delinsTT	ENSP00000396976:p.Q340_E341delinsH*		96	0	0		154	0.21	33	NM_014952	117	0.00	0	Q8NDF7|Q9Y2F4	Nonsense_Mutation	DNP	ENST00000416165.1	37	CCDS10058.1																																																																																					0.668	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252248.1		NM_014952	
VPS13C	54832	broad.mit.edu	37	15	62254066	62254066	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr15:62254066G>T	ENST00000261517.5	-	35	3703	c.3630C>A	c.(3628-3630)gcC>gcA	p.A1210A	VPS13C_ENST00000395896.4_Silent_p.A1210A|VPS13C_ENST00000395898.3_Silent_p.A1167A|VPS13C_ENST00000249837.3_Silent_p.A1167A	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GAGACTCTTTGGCTGTCTGGA	0.423																																					p.A1210A													.	VPS13C	506		0			c.C3630A												45.0	48.0	47.0					15																	62254066		2203	4300	6503	SO:0001819	synonymous_variant	54832	exon35			CTCTTTGGCTGTC	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3630C>A	15.37:g.62254066G>T			86	0	0		102	0.04	4	NM_020821	6	0.00	0		Silent	SNP	ENST00000261517.5	37	CCDS32257.1																																																																																					0.423	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000415997.1		NM_017684	
MAN2C1	4123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75656927	75656927	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr15:75656927C>T	ENST00000267978.5	-	5	548	c.502G>A	c.(502-504)Gag>Aag	p.E168K	MAN2C1_ENST00000569482.1_Missense_Mutation_p.E168K|MAN2C1_ENST00000563622.1_Missense_Mutation_p.E168K|MAN2C1_ENST00000565683.1_Missense_Mutation_p.E168K|MAN2C1_ENST00000563539.1_5'UTR	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	168					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						AACATCTTCTCAGGGTCAGGG	0.592																																					p.E168K													.	.			0			c.G502A												54.0	45.0	48.0					15																	75656927		2197	4294	6491	SO:0001583	missense	4123	exon5			TCTTCTCAGGGTC	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.502G>A	15.37:g.75656927C>T	ENSP00000267978:p.Glu168Lys		86	0	0		96	0.17	16	NM_001256494	64	0.16	10	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	ENST00000267978.5	37	CCDS32298.1	.	.	.	.	.	.	.	.	.	.	c	13.57	2.275464	0.40294	.	.	ENSG00000140400	ENST00000267978;ENST00000421803	T	0.17054	2.3	4.9	2.87	0.33458	.	0.234550	0.44902	D	0.000409	T	0.09202	0.0227	N	0.20986	0.625	0.34508	D	0.706791	P;B;B	0.35033	0.481;0.349;0.349	B;B;B	0.32465	0.146;0.07;0.07	T	0.23511	-1.0186	10	0.33141	T	0.24	-16.3639	5.488	0.16761	0.0:0.6555:0.1666:0.1778	.	168;168;168	B4DH23;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	K	168	ENSP00000267978:E168K	ENSP00000267978:E168K	E	-	1	0	MAN2C1	73443980	0.944000	0.32072	0.997000	0.53966	0.371000	0.29859	1.779000	0.38624	1.061000	0.40601	0.486000	0.48141	GAG			0.592	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419965.1			
SLCO3A1	28232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	92671632	92671632	+	Silent	SNP	T	T	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr15:92671632T>C	ENST00000318445.6	+	7	1639	c.1425T>C	c.(1423-1425)tgT>tgC	p.C475C	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Silent_p.C475C	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	475	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	ATAATAACTGTGAATGCCAAA	0.532																																					p.C475C													.	.			0			c.T1425C												209.0	168.0	182.0					15																	92671632		2198	4298	6496	SO:0001819	synonymous_variant	28232	exon7			TAACTGTGAATGC	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1425T>C	15.37:g.92671632T>C			111	0	0		148	0.04	6	NM_013272	16	0.13	2	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Silent	SNP	ENST00000318445.6	37	CCDS10371.1																																																																																					0.532	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313529.1		NM_013272	
WASH3P	374666	broad.mit.edu	37	15	102516768	102516770	+	RNA	DEL	CAA	CAA	-			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr15:102516768_102516770delCAA	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GAGCAGAAACCAACAGTGTGCTT	0.542																																					.													.	.			0			.																																											0	.			AGAAACCAACAGT			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516768_102516770delCAA			9	0	0		8	0.25	2	.	14	0.00	0		RNA	DEL	ENST00000557932.1	37																																																																																						0.542	WASH3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000417608.1		NM_199163	
HMOX2	3163	broad.mit.edu;mdanderson.org	37	16	4559436	4559436	+	Silent	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr16:4559436C>T	ENST00000570646.1	+	5	1325	c.720C>T	c.(718-720)gcC>gcT	p.A240A	HMOX2_ENST00000398595.3_Silent_p.A240A|HMOX2_ENST00000458134.3_Silent_p.A240A|HMOX2_ENST00000575120.1_Silent_p.A211A|HMOX2_ENST00000219700.6_Silent_p.A240A|HMOX2_ENST00000414777.1_Silent_p.A240A|HMOX2_ENST00000406590.2_Silent_p.A240A	NM_002134.3	NP_002125.3	P30519	HMOX2_HUMAN	heme oxygenase (decycling) 2	240					cellular iron ion homeostasis (GO:0006879)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|porphyrin-containing compound metabolic process (GO:0006778)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8						TGGACCAGGCCGGCTCCACAC	0.478																																					p.A240A													.	HMOX2	22		0			c.C720T												148.0	152.0	151.0					16																	4559436		2197	4300	6497	SO:0001819	synonymous_variant	3163	exon5			CCAGGCCGGCTCC		CCDS10517.1, CCDS66931.1, CCDS73818.1	16p13.3	2008-02-05			ENSG00000103415	ENSG00000103415	1.14.99.3		5014	protein-coding gene	gene with protein product		141251				1575508	Standard	NM_002134		Approved	HO-2	uc002cwq.4	P30519	OTTHUMG00000129473	ENST00000570646.1:c.720C>T	16.37:g.4559436C>T			78	0	0		73	0.05	4	NM_001127205	205	0.00	0	A8MT35|D3DUD5|I3L430|O60605	Silent	SNP	ENST00000570646.1	37	CCDS10517.1																																																																																					0.478	HMOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251636.2			
EEF2K	29904	broad.mit.edu	37	16	22291564	22291564	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr16:22291564G>T	ENST00000263026.5	+	17	2409	c.1935G>T	c.(1933-1935)ctG>ctT	p.L645L		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	645					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		ACACTGCCCTGGAGATGACGG	0.597																																					p.L645L	NSCLC(195;1411 2157 20319 27471 51856)												.	EEF2K	142		0			c.G1935T												100.0	82.0	88.0					16																	22291564		2197	4300	6497	SO:0001819	synonymous_variant	29904	exon17			TGCCCTGGAGATG	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1935G>T	16.37:g.22291564G>T			109	0	0		87	0.03	3	NM_013302	22	0.00	0	Q8N588	Silent	SNP	ENST00000263026.5	37	CCDS10604.1																																																																																					0.597	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211580.2		NM_013302	
EARS2	124454	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23540942	23540942	+	Silent	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr16:23540942G>A	ENST00000563459.1	-	7	1239	c.1233C>T	c.(1231-1233)tgC>tgT	p.C411C	EARS2_ENST00000449606.1_Silent_p.C411C|EARS2_ENST00000564987.1_5'UTR|EARS2_ENST00000564501.1_Silent_p.C411C|EARS2_ENST00000563232.1_Silent_p.C411C			Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2, mitochondrial	411					gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|tRNA aminoacylation for mitochondrial protein translation (GO:0070127)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|glutamate-tRNA(Gln) ligase activity (GO:0050561)|tRNA binding (GO:0000049)			central_nervous_system(1)|endometrium(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(48;0.0353)		CCTGCAGGCGGCAAATGTGAC	0.582																																					p.C411C													.	EARS2	26		0			c.C1233T												54.0	57.0	56.0					16																	23540942		2040	4205	6245	SO:0001819	synonymous_variant	124454	exon7			CAGGCGGCAAATG	AB075850	CCDS42132.1	16p12.2	2014-05-06	2012-10-26		ENSG00000103356	ENSG00000103356	6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"""	29419	protein-coding gene	gene with protein product	"""glutamate tRNA ligase 2, mitochondrial"""	612799	"""glutamyl-tRNA synthetase 2, mitochondrial (putative)"""			15779907, 19805282, 22492562	Standard	NM_001083614		Approved	KIAA1970, MSE1	uc002dlt.4	Q5JPH6	OTTHUMG00000177018	ENST00000563459.1:c.1233C>T	16.37:g.23540942G>A			126	0.0079365079	1		89	0.27	24	NM_001083614	68	0.35	24	B3KTT2|D3DWF1|Q86YH3|Q8TF31	Silent	SNP	ENST00000563459.1	37	CCDS42132.1																																																																																					0.582	EARS2-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434844.1		NM_133451	
ZNF629	23361	mdanderson.org	37	16	30794137	30794137	+	Missense_Mutation	SNP	G	G	T	rs189318984	byFrequency	TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr16:30794137G>T	ENST00000262525.4	-	3	1719	c.1512C>A	c.(1510-1512)caC>caA	p.H504Q	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GCGTGCGGACGTGGGTAATAA	0.627																																					p.H504Q													.	.			0			c.C1512A												64.0	70.0	68.0					16																	30794137		2197	4300	6497	SO:0001583	missense	23361	exon3			GCGGACGTGGGTA	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1512C>A	16.37:g.30794137G>T	ENSP00000262525:p.His504Gln		61	0.0163934426	1		36	0.08	3	NM_001080417	0		0	Q15938	Missense_Mutation	SNP	ENST00000262525.4	37	CCDS45463.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366545	0.41902	.	.	ENSG00000102870	ENST00000262525	T	0.77489	-1.1	5.79	-4.28	0.03732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47093	D	0.000254	D	0.89121	0.6625	H	0.95470	3.675	0.26777	N	0.969682	D	0.76494	0.999	D	0.76071	0.987	D	0.84442	0.0583	10	0.72032	D	0.01	-32.1058	13.9915	0.64369	0.4928:0.0:0.5072:0.0	.	504	Q9UEG4	ZN629_HUMAN	Q	504	ENSP00000262525:H504Q	ENSP00000262525:H504Q	H	-	3	2	ZNF629	30701638	0.112000	0.22096	0.647000	0.29507	0.818000	0.46254	0.295000	0.19065	-0.624000	0.05611	-0.254000	0.11334	CAC			0.627	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434291.1		NM_015309	
IGHV3OR16-9	28307	broad.mit.edu	37	16	32077601	32077601	+	RNA	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr16:32077601G>A	ENST00000354689.6	+	0	216				RP11-1166P10.6_ENST00000566806.1_RNA					immunoglobulin heavy variable 3/OR16-9 (non-functional)																		CCATCTCCAGGGACAACGCCA	0.502																																					.													.	.			0			.																																											0	.			CTCCAGGGACAAC	Z29606		16p11.2	2013-12-06	2008-09-11		ENSG00000270472	ENSG00000270472		"""Immunoglobulins / IGH orphons"""	5644	other	immunoglobulin gene			"""immunoglobulin heavy variable 3/OR16-9"""				Standard			Approved	IGHV3/OR16-9			OTTHUMG00000184753		16.37:g.32077601G>A			287	0.0034843206	1		242	0.02	6	.	8	1.00	8		RNA	SNP	ENST00000354689.6	37																																																																																						0.502	IGHV3OR16-9-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000432530.2	rescued with RNA-seq		
LONP2	83752	hgsc.bcm.edu	37	16	48295639	48295639	+	Intron	SNP	C	C	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr16:48295639C>G	ENST00000285737.4	+	5	980				LONP2_ENST00000535754.1_Intron	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GGCAATATAACTCTTGCAGCT	0.378																																					.													.	.			0			.																																									SO:0001627	intron_variant	100616339	.			ATATAACTCTTGC	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.887+141C>G	16.37:g.48295639C>G			39	0	0		37	0.43	16	.	0		0		RNA	SNP	ENST00000285737.4	37	CCDS10734.1																																																																																					0.378	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256839.2		NM_031490	
KRTAP4-11	653240	mdanderson.org	37	17	39274238	39274238	+	Silent	SNP	A	A	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr17:39274238A>G	ENST00000391413.2	-	1	368	c.330T>C	c.(328-330)tgT>tgC	p.C110C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	110	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agctggggcgacagcagctgg	0.652																																					p.C110C													.	.			0			c.T330C												5.0	9.0	8.0					17																	39274238		657	1550	2207	SO:0001819	synonymous_variant	653240	exon1			GGGGCGACAGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.330T>C	17.37:g.39274238A>G			25	0	0		24	0.13	3	NM_033059	0		0	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																					0.652	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257690.1			
PYY	5697	mdanderson.org	37	17	42030492	42030492	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr17:42030492C>T	ENST00000360085.2	-	6	794	c.254G>A	c.(253-255)cGc>cAc	p.R85H	PYY_ENST00000592796.1_Missense_Mutation_p.R85H	NM_004160.4	NP_004151	P10082	PYY_HUMAN	peptide YY	85					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|digestion (GO:0007586)|eating behavior (GO:0042755)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(1)|ovary(1)	2		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		CCTGACGGGGCGGTCCTCGCC	0.622																																					p.R85H													.	.			0			c.G254A												53.0	59.0	57.0					17																	42030492		2203	4300	6503	SO:0001583	missense	5697	exon6			ACGGGGCGGTCCT		CCDS32662.1	17q21.1	2013-02-28				ENSG00000131096		"""Endogenous ligands"""	9748	protein-coding gene	gene with protein product	"""prepro-PYY"""	600781				7782089	Standard	NM_004160		Approved	PYY1	uc002ieq.3	P10082		ENST00000360085.2:c.254G>A	17.37:g.42030492C>T	ENSP00000353198:p.Arg85His		138	0	0		121	0.05	6	NM_004160	356	0.00	0	Q5U5Q6|Q6FGH8	Missense_Mutation	SNP	ENST00000360085.2	37	CCDS32662.1	.	.	.	.	.	.	.	.	.	.	C	5.576	0.291068	0.10567	.	.	ENSG00000131096	ENST00000360085	T	0.14516	2.5	4.58	-1.09	0.09904	.	.	.	.	.	T	0.04634	0.0126	.	.	.	0.09310	N	1	B	0.18610	0.029	B	0.08055	0.003	T	0.43360	-0.9396	8	0.13108	T	0.6	.	0.3766	0.00388	0.2588:0.3339:0.166:0.2412	.	85	P10082	PYY_HUMAN	H	85	ENSP00000353198:R85H	ENSP00000353198:R85H	R	-	2	0	PYY	39386018	0.001000	0.12720	0.002000	0.10522	0.107000	0.19398	-0.054000	0.11826	0.213000	0.20722	0.561000	0.74099	CGC			0.622	PYY-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000457658.1		NM_004160	
Unknown	0	bcgsc.ca	37	18	13152605	13152605	+	IGR	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr18:13152605C>T								CEP192 (27558 upstream) : RP11-794M8.2 (30795 downstream)																							TATATCTATGCCAAGAAGGTA	0.348																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TCTATGCCAAGAA																													18.37:g.13152605C>T			38	0	0		36	0.11	4	.	0		0		RNA	SNP		37																																																																																					0	0.348										
CCDC178	374864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	30913247	30913247	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr18:30913247G>C	ENST00000383096.3	-	10	952	c.770C>G	c.(769-771)gCa>gGa	p.A257G	CCDC178_ENST00000402325.1_Missense_Mutation_p.A257G|CCDC178_ENST00000406524.2_Missense_Mutation_p.A257G|CCDC178_ENST00000300227.8_Missense_Mutation_p.A257G|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Missense_Mutation_p.A257G|CCDC178_ENST00000583930.1_Missense_Mutation_p.A257G|CCDC178_ENST00000579947.1_Missense_Mutation_p.A257G			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	257																	TTGAATCTTTGCATTTGCTTC	0.333																																					p.A257G													.	.			0			c.C770G												252.0	219.0	230.0					18																	30913247		2203	4300	6503	SO:0001583	missense	374864	exon9			ATCTTTGCATTTG	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.770C>G	18.37:g.30913247G>C	ENSP00000372576:p.Ala257Gly		167	0	0		131	0.29	38	NM_001105528	0		0	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872818	0.33069	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.46451	2.46;2.46;2.46;2.46;2.46;0.87	5.32	-0.055	0.13811	.	.	.	.	.	T	0.24851	0.0603	L	0.39898	1.24	0.09310	N	1	B;B;B;B	0.09022	0.001;0.002;0.001;0.002	B;B;B;B	0.09377	0.003;0.004;0.003;0.004	T	0.23048	-1.0199	9	0.16420	T	0.52	-0.8436	0.8678	0.01207	0.1814:0.1732:0.3439:0.3015	.	257;257;257;257	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	G	257	ENSP00000385591:A257G;ENSP00000372576:A257G;ENSP00000300227:A257G;ENSP00000385867:A257G;ENSP00000385234:A257G;ENSP00000382130:A257G	ENSP00000300227:A257G	A	-	2	0	C18orf34	29167245	0.000000	0.05858	0.008000	0.14137	0.674000	0.39518	-0.419000	0.07071	0.263000	0.21812	-0.252000	0.11476	GCA			0.333	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255373.2		NM_198995	
SALL3	27164	bcgsc.ca	37	18	76754583	76754583	+	Silent	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr18:76754583C>T	ENST00000537592.2	+	2	2592	c.2592C>T	c.(2590-2592)tcC>tcT	p.S864S	SALL3_ENST00000536229.3_Silent_p.S731S|SALL3_ENST00000575389.2_Silent_p.S864S	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	864					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCCTCAAGTCCGTGGAGAACG	0.682																																					p.S864S													SALL3,NS,carcinoma,0,1	SALL3	162	1	0			c.C2592T												40.0	41.0	41.0					18																	76754583		2200	4292	6492	SO:0001819	synonymous_variant	27164	exon2			CAAGTCCGTGGAG	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2592C>T	18.37:g.76754583C>T			67	0	0		46	0.09	4	NM_171999	0		0	Q9UGH1	Silent	SNP	ENST00000537592.2	37	CCDS12013.1																																																																																					0.682	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256397.1		NM_171999	
ARHGEF1	9138	broad.mit.edu	37	19	42410875	42410875	+	Silent	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr19:42410875C>T	ENST00000354532.3	+	28	2824	c.2676C>T	c.(2674-2676)tgC>tgT	p.C892C	ARHGEF1_ENST00000599846.1_Silent_p.C948C|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.P820S|ARHGEF1_ENST00000347545.4_Silent_p.C859C|CTD-2575K13.6_ENST00000597630.1_RNA|ARHGEF1_ENST00000337665.4_Silent_p.C907C	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	892					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		AGGAATTTTGCCGCCTGAGAC	0.687																																					p.C907C													.	ARHGEF1	95		0			c.C2721T												41.0	37.0	38.0					19																	42410875		2203	4300	6503	SO:0001819	synonymous_variant	0	exon28			ATTTTGCCGCCTG	U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2676C>T	19.37:g.42410875C>T			155	0.0064516129	1		255	0.02	6	NM_199002	130	0.00	0	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	ENST00000354532.3	37	CCDS12591.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897077	0.33535	.	.	ENSG00000076928	ENST00000378152	T	0.68765	-0.35	4.09	-1.72	0.08107	.	0.327658	0.23752	N	0.044913	T	0.47248	0.1435	.	.	.	0.58432	D	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.07635	-1.0762	9	0.31617	T	0.26	-0.5746	7.2898	0.26360	0.0:0.4699:0.0:0.5301	.	820	Q6NX52	.	S	820	ENSP00000367394:P820S	ENSP00000367394:P820S	P	+	1	0	ARHGEF1	47102715	0.213000	0.23551	0.350000	0.25708	0.979000	0.70002	-1.362000	0.02595	-0.508000	0.06540	0.485000	0.47835	CCG			0.687	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000463360.1		NM_199002	
ZNF836	162962	mdanderson.org	37	19	52671321	52671321	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr19:52671321G>T	ENST00000322146.8	-	3	526	c.5C>A	c.(4-6)gCt>gAt	p.A2D	ZNF836_ENST00000597252.1_Missense_Mutation_p.A2D|CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597065.1_Missense_Mutation_p.A2D|ZNF836_ENST00000602187.1_5'UTR	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CTGTGTAAGAGCCATCCCTGA	0.388																																					p.A2D													.	.			0			c.C5A												177.0	203.0	195.0					19																	52671321		2198	4300	6498	SO:0001583	missense	162962	exon3			GTAAGAGCCATCC	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.5C>A	19.37:g.52671321G>T	ENSP00000325038:p.Ala2Asp		46	0	0		55	0.05	3	NM_001102657	14	0.00	0		Missense_Mutation	SNP	ENST00000322146.8	37	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968158	0.34754	.	.	ENSG00000196267	ENST00000322146	T	0.00902	5.56	1.37	1.37	0.22104	Krueppel-associated box (1);	.	.	.	.	T	0.02649	0.0080	L	0.53671	1.685	0.09310	N	1	D	0.64830	0.994	P	0.62885	0.908	T	0.47156	-0.9139	9	0.72032	D	0.01	.	6.1501	0.20306	0.0:0.0:1.0:0.0	.	2	Q6ZNA1	ZN836_HUMAN	D	2	ENSP00000325038:A2D	ENSP00000325038:A2D	A	-	2	0	ZNF836	57363133	0.014000	0.17966	0.062000	0.19696	0.182000	0.23217	1.056000	0.30480	1.060000	0.40578	0.491000	0.48974	GCT			0.388	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462456.1		NM_001102657	
RAB10	10890	broad.mit.edu	37	2	26257554	26257554	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr2:26257554T>C	ENST00000264710.4	+	1	576	c.77T>C	c.(76-78)cTt>cCt	p.L26P		NM_016131.4	NP_057215.3	P61026	RAB10_HUMAN	RAB10, member RAS oncogene family	26					antigen processing and presentation (GO:0019882)|axonogenesis (GO:0007409)|basolateral protein localization (GO:0061467)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum tubular network organization (GO:0071786)|endosomal transport (GO:0016197)|establishment of neuroblast polarity (GO:0045200)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|establishment of protein localization to membrane (GO:0090150)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi to plasma membrane transport (GO:0006893)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|polarized epithelial cell differentiation (GO:0030859)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum tubular network (GO:0071782)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|insulin-responsive compartment (GO:0032593)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCTGCGTCCTTTTTCGTTTT	0.537																																					p.L26P													.	RAB10	14		0			c.T77C												148.0	134.0	139.0					2																	26257554		2203	4300	6503	SO:0001583	missense	10890	exon1			GCGTCCTTTTTCG	AF106681	CCDS1720.1	2p23.3	2008-05-21			ENSG00000084733	ENSG00000084733		"""RAB, member RAS oncogene"""	9759	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein"""	612672				7688123	Standard	NM_016131		Approved		uc002rgv.3	P61026	OTTHUMG00000094796	ENST00000264710.4:c.77T>C	2.37:g.26257554T>C	ENSP00000264710:p.Leu26Pro		214	0	0		254	0.01	3	NM_016131	327	0.00	0	D6W538|O88386|Q6IA52|Q9D7X6|Q9H0T3	Missense_Mutation	SNP	ENST00000264710.4	37	CCDS1720.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284629	0.80803	.	.	ENSG00000084733	ENST00000264710	T	0.80909	-1.43	5.21	5.21	0.72293	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93245	0.7848	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95208	0.8323	10	0.87932	D	0	.	13.0672	0.59041	0.0:0.0:0.0:1.0	.	26	P61026	RAB10_HUMAN	P	26	ENSP00000264710:L26P	ENSP00000264710:L26P	L	+	2	0	RAB10	26111058	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.482000	0.81143	1.971000	0.57363	0.533000	0.62120	CTT			0.537	RAB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211610.1		NM_016131	
SCN9A	6335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	167055703	167055703	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr2:167055703C>T	ENST00000409435.1	-	26	5445	c.5446G>A	c.(5446-5448)Gca>Aca	p.A1816T	SCN9A_ENST00000409672.1_Missense_Mutation_p.A1805T|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.A1817T|SCN9A_ENST00000375387.4_Missense_Mutation_p.A1817T			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1816					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGGGTTTTGCTATGAGAAGA	0.458																																					p.A1805T													.	.			0			c.G5413A												105.0	111.0	109.0					2																	167055703		2203	4298	6501	SO:0001583	missense	6335	exon27			GTTTTGCTATGAG	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.5446G>A	2.37:g.167055703C>T	ENSP00000386330:p.Ala1816Thr		230	0	0		225	0.04	9	NM_002977	3	0.00	0	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054257	0.75960	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000012	T	0.30634	0.0771	M	0.86953	2.85	0.44555	D	0.997513	P	0.48589	0.912	P	0.52627	0.704	T	0.04767	-1.0928	10	0.72032	D	0.01	.	14.3984	0.67027	0.0:0.7375:0.2625:0.0	.	1805	E7EUN6	.	T	1805;1817;1817;1816	ENSP00000386306:A1805T;ENSP00000364536:A1817T;ENSP00000304748:A1817T;ENSP00000386330:A1816T	ENSP00000304748:A1817T	A	-	1	0	SCN9A	166763949	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.077000	0.50089	2.720000	0.93068	0.655000	0.94253	GCA			0.458	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000333639.1		NM_002977	
VPS16	64601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	2843984	2843984	+	Nonsense_Mutation	SNP	C	C	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr20:2843984C>G	ENST00000380445.3	+	15	1488	c.1416C>G	c.(1414-1416)taC>taG	p.Y472*	VPS16_ENST00000380443.3_Nonsense_Mutation_p.Y158*|PTPRA_ENST00000380393.3_5'Flank|VPS16_ENST00000481812.2_3'UTR|VPS16_ENST00000380469.3_Nonsense_Mutation_p.Y328*	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	472					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						TATGCGAGTACTTGCGCCTTC	0.572																																					p.Y472X													.	.			0			c.C1416G												104.0	91.0	95.0					20																	2843984		2203	4300	6503	SO:0001587	stop_gained	64601	exon15			CGAGTACTTGCGC	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.1416C>G	20.37:g.2843984C>G	ENSP00000369810:p.Tyr472*		67	0	0		98	0.23	23	NM_022575	120	0.08	9	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Nonsense_Mutation	SNP	ENST00000380445.3	37	CCDS13036.1	.	.	.	.	.	.	.	.	.	.	C	36	5.875356	0.97055	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000453689;ENST00000380443	.	.	.	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.3302	8.6407	0.33974	0.0:0.8984:0.0:0.1016	.	.	.	.	X	472;328;210;158	.	ENSP00000369808:Y158X	Y	+	3	2	VPS16	2791984	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.137000	0.50562	2.426000	0.82243	0.561000	0.74099	TAC			0.572	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077658.2		NM_022575	
KIAA0930	23313	bcgsc.ca	37	22	45607914	45607914	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr22:45607914G>T	ENST00000336156.5	-	2	204	c.139C>A	c.(139-141)Cgg>Agg	p.R47R	KIAA0930_ENST00000391627.2_Silent_p.R13R|KIAA0930_ENST00000443310.3_Silent_p.R29R|KIAA0930_ENST00000492273.1_Silent_p.R52R|KIAA0930_ENST00000496226.1_Silent_p.R56R|KIAA0930_ENST00000251993.7_Silent_p.R52R	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	47										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						TCGTCCTGCCGGGGAGCCCAT	0.612																																					p.R52R													.	KIAA0930	43		0			c.C154A												61.0	59.0	60.0					22																	45607914		2203	4300	6503	SO:0001819	synonymous_variant	23313	exon2			CCTGCCGGGGAGC	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.139C>A	22.37:g.45607914G>T			60	0.0166666667	1		53	0.08	4	NM_015264	53	0.00	0	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Silent	SNP	ENST00000336156.5	37	CCDS33665.1																																																																																					0.612	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321975.2		NM_001009880	
PANX2	56666	broad.mit.edu	37	22	50617594	50617594	+	Missense_Mutation	SNP	G	G	C	rs376326556		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr22:50617594G>C	ENST00000395842.2	+	3	1922	c.1922G>C	c.(1921-1923)gGc>gCc	p.G641A	PANX2_ENST00000159647.5_Intron	NM_052839.3	NP_443071.2	Q96RD6	PANX2_HUMAN	pannexin 2	641					ion transport (GO:0006811)|protein hexamerization (GO:0034214)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)	7		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		GAGGACGGGGGCCCCCGCCTG	0.677																																					p.G641A													.	PANX2	69		0			c.G1922C												32.0	31.0	31.0					22																	50617594		2200	4298	6498	SO:0001583	missense	56666	exon3			ACGGGGGCCCCCG		CCDS14085.2, CCDS54544.1	22q13.33	2011-12-05			ENSG00000073150	ENSG00000073150		"""Ion channels / Pannexins"""	8600	protein-coding gene	gene with protein product		608421				14702039, 14597722	Standard	NM_052839		Approved	hPANX2, PX2	uc003bjn.4	Q96RD6	OTTHUMG00000044649	ENST00000395842.2:c.1922G>C	22.37:g.50617594G>C	ENSP00000379183:p.Gly641Ala		115	0.052173913	6		87	0.23	20	NM_052839	7	0.29	2	B7Z684|Q96RD5|Q9UGX8	Missense_Mutation	SNP	ENST00000395842.2	37	CCDS14085.2	.	.	.	.	.	.	.	.	.	.	G	3.427	-0.116921	0.06838	.	.	ENSG00000073150	ENST00000395842;ENST00000401643	T	0.22743	1.94	3.53	-2.42	0.06542	.	0.942046	0.08511	N	0.934949	T	0.12475	0.0303	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31668	-0.9935	9	.	.	.	0.246	16.9717	0.86302	0.0:0.5969:0.4031:0.0	.	641	Q96RD6	PANX2_HUMAN	A	641;318	ENSP00000379183:G641A	.	G	+	2	0	PANX2	48959721	0.936000	0.31750	0.228000	0.23943	0.315000	0.28087	1.072000	0.30678	-0.056000	0.13221	0.313000	0.20887	GGC			0.677	PANX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000075010.3		NM_052839	
ACKR4	51554	mdanderson.org	37	3	132321047	132321047	+	3'UTR	SNP	C	C	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr3:132321047C>A	ENST00000249887.2	+	0	1902				ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000545291.1_Intron|ACAD11_ENST00000355458.3_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4						chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										AAAAAAAAAACAAACTATAAT	0.279																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	51554	.			AAAAAACAAACTA	AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.*753C>A	3.37:g.132321047C>A			337	0.0207715134	7		246	0.06	14	.	1	0.00	0	B2R9U7	RNA	SNP	ENST00000249887.2	37	CCDS3075.1																																																																																					0.279	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357238.2		NM_016557	
SHOX2	6474	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	157823772	157823772	+	Missense_Mutation	SNP	C	C	G	rs376757024		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr3:157823772C>G	ENST00000425436.3	-	1	67	c.42G>C	c.(40-42)caG>caC	p.Q14H	SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000389589.4_Missense_Mutation_p.Q14H|RSRC1_ENST00000480820.1_5'UTR|SHOX2_ENST00000441443.2_5'UTR|SHOX2_ENST00000490689.2_5'Flank|SHOX2_ENST00000483851.2_Missense_Mutation_p.Q14H	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	14					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CCTTCACTTTCTGGTCAAAAG	0.647																																					p.Q14H													.	.			0			c.G42C							C	HIS/GLN,HIS/GLN,HIS/GLN	1,3855		0,1,1927	36.0	37.0	37.0		42,42,42	3.1	1.0	3		37	0,8242		0,0,4121	no	missense,missense,missense	SHOX2	NM_001163678.1,NM_003030.4,NM_006884.3	24,24,24	0,1,6048	GG,GC,CC		0.0,0.0259,0.0083	probably-damaging,probably-damaging,probably-damaging	14/320,14/356,14/332	157823772	1,12097	1928	4121	6049	SO:0001583	missense	6474	exon1			CACTTTCTGGTCA	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.42G>C	3.37:g.157823772C>G	ENSP00000398704:p.Gln14His		354	0	0		273	0.05	14	NM_003030	0		0	O60465|O60467|O60903	Missense_Mutation	SNP	ENST00000425436.3	37	CCDS43164.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.759624	0.69763	2.59E-4	0.0	ENSG00000168779;ENSG00000168779;ENSG00000258518	ENST00000425436;ENST00000389589;ENST00000483851	D;D;D	0.97994	-4.65;-4.65;-4.65	3.99	3.09	0.35607	.	0.000000	0.64402	D	0.000012	D	0.97139	0.9065	L	0.36672	1.1	0.80722	D	1	D;D;D	0.71674	0.994;0.998;0.997	P;D;D	0.80764	0.808;0.994;0.963	D	0.96409	0.9303	10	0.72032	D	0.01	.	9.2271	0.37414	0.0:0.7588:0.1499:0.0912	.	14;14;14	O60902-2;O60902-3;O60902	.;.;SHOX2_HUMAN	H	14	ENSP00000398704:Q14H;ENSP00000374240:Q14H;ENSP00000419362:Q14H	ENSP00000374240:Q14H	Q	-	3	2	SHOX2;AC112502.1	159306466	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.296000	0.43584	1.938000	0.56188	0.561000	0.74099	CAG			0.647	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000352057.2			
IQCJ	654502	broad.mit.edu	37	3	158983108	158983108	+	Silent	SNP	T	T	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr3:158983108T>C	ENST00000451172.1	+	5	501	c.396T>C	c.(394-396)ctT>ctC	p.L132L	IQCJ_ENST00000482126.1_Silent_p.L105L|IQCJ-SCHIP1_ENST00000476809.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ-SCHIP1_ENST00000467442.1_Intron	NM_001042705.2	NP_001036170.1	Q1A5X6	IQCJ_HUMAN	IQ motif containing J	132										cervix(1)|endometrium(2)|large_intestine(2)|lung(10)	15			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			TTCTCTACCTTGACCAGCTTG	0.507																																					p.L132L													.	IQCJ	28		0			c.T396C												138.0	134.0	136.0					3																	158983108		1907	4125	6032	SO:0001819	synonymous_variant	654502	exon5			CTACCTTGACCAG	DQ309553, DQ309554	CCDS46946.1, CCDS46947.1, CCDS56290.1	3q25.32	2011-03-24			ENSG00000214216	ENSG00000214216			32406	protein-coding gene	gene with protein product		611622				17045569	Standard	NM_001042705		Approved			Q1A5X6	OTTHUMG00000166440	ENST00000451172.1:c.396T>C	3.37:g.158983108T>C			143	0.006993007	1		142	0.04	5	NM_001042705	0		0	B7ZMM2|B9EH97|Q1A5X5	Silent	SNP	ENST00000451172.1	37	CCDS46946.1																																																																																					0.507	IQCJ-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000352395.1		NM_001042705.1	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55602664	55602664	+	Splice_Site	SNP	G	G	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr4:55602664G>C	ENST00000288135.5	+	18	2582	c.2485G>C	c.(2485-2487)Gct>Cct	p.A829P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	829	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		A -> P (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A829P(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTATTACAGGCTCGACTACC	0.398		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.A829P			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,caecum,carcinoma,0,3	KIT	0	3	1	Substitution - Missense(1)	testis(1)	c.G2485C												106.0	104.0	105.0					4																	55602664		2203	4300	6503	SO:0001630	splice_region_variant	3815	exon18	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TTACAGGCTCGAC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2485-1G>C	4.37:g.55602664G>C			90	0	0		77	0.30	23	NM_000222	603	0.40	242	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.811778	0.70797	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.89343	-2.5;-2.5	5.7	5.7	0.88788	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.105093	0.41823	D	0.000804	D	0.88407	0.6428	N	0.12961	0.28	0.80722	D	1	D;D	0.63046	0.992;0.988	P;P	0.60117	0.808;0.869	D	0.87132	0.2197	9	.	.	.	.	19.4515	0.94869	0.0:0.0:1.0:0.0	.	825;829	P10721-2;P10721	.;KIT_HUMAN	P	829;825	ENSP00000288135:A829P;ENSP00000390987:A825P	.	A	+	1	0	KIT	55297421	1.000000	0.71417	0.991000	0.47740	0.020000	0.10135	7.910000	0.87451	2.683000	0.91414	0.655000	0.94253	GCT			0.398	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			Missense_Mutation
LRBA	987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	151837605	151837605	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr4:151837605G>A	ENST00000357115.3	-	7	1085	c.842C>T	c.(841-843)tCa>tTa	p.S281L	LRBA_ENST00000535741.1_Missense_Mutation_p.S281L|LRBA_ENST00000510413.1_Missense_Mutation_p.S281L|LRBA_ENST00000507224.1_Missense_Mutation_p.S281L	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	281						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TTTTCCTTTTGACTTTATTGA	0.348																																					p.S281L													.	.			0			c.C842T												72.0	67.0	69.0					4																	151837605		2203	4300	6503	SO:0001583	missense	987	exon7			CCTTTTGACTTTA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.842C>T	4.37:g.151837605G>A	ENSP00000349629:p.Ser281Leu		232	0	0		194	0.06	12	NM_006726	14	0.07	1	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	34	5.403134	0.96030	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.45	5.45	0.79879	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.088617	0.47852	D	0.000210	T	0.74473	0.3721	L	0.42245	1.32	0.80722	D	1	D;D;P	0.69078	0.997;0.996;0.925	D;D;P	0.87578	0.994;0.998;0.536	T	0.72690	-0.4217	10	0.44086	T	0.13	.	19.6558	0.95837	0.0:0.0:1.0:0.0	.	281;281;281	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	L	281	ENSP00000446299:S281L;ENSP00000421552:S281L;ENSP00000349629:S281L;ENSP00000422180:S281L	ENSP00000349629:S281L	S	-	2	0	LRBA	152057055	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.720000	0.93068	0.455000	0.32223	TCA			0.348	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000364939.1			
SNX25	83891	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	186231964	186231964	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr4:186231964C>A	ENST00000504273.1	+	7	1140	c.846C>A	c.(844-846)agC>agA	p.S282R	SNX25_ENST00000264694.8_Missense_Mutation_p.S282R|SNX25_ENST00000512853.1_3'UTR			Q9H3E2	SNX25_HUMAN	sorting nexin 25	282					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		GGCCTCAAAGCCAGAAGGTAG	0.433																																					p.S282R													.	SNX25	100		0			c.C846A												33.0	33.0	33.0					4																	186231964		2203	4300	6503	SO:0001583	missense	83891	exon7			TCAAAGCCAGAAG	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.846C>A	4.37:g.186231964C>A	ENSP00000426255:p.Ser282Arg		208	0.0048076923	1		169	0.24	41	NM_031953	21	0.10	2	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	ENST00000504273.1	37	CCDS34116.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.614048	0.28712	.	.	ENSG00000109762	ENST00000504273;ENST00000264694	T;T	0.29917	1.55;1.55	5.59	3.87	0.44632	Regulator of G protein signalling superfamily (1);	0.312185	0.36854	N	0.002369	T	0.28499	0.0705	L	0.57536	1.79	0.45015	D	0.998033	B;B	0.31227	0.215;0.314	B;B	0.30782	0.099;0.12	T	0.03306	-1.1050	10	0.25751	T	0.34	-0.7785	10.7691	0.46312	0.0:0.7901:0.0:0.2099	.	53;282	Q8N6K3;Q9H3E2	.;SNX25_HUMAN	R	282	ENSP00000426255:S282R;ENSP00000264694:S282R	ENSP00000264694:S282R	S	+	3	2	SNX25	186468958	1.000000	0.71417	0.996000	0.52242	0.537000	0.34900	1.995000	0.40767	0.720000	0.32209	0.655000	0.94253	AGC			0.433	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000360756.1		NM_031953	
UBE2QL1	134111	mdanderson.org	37	5	6449044	6449044	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr5:6449044G>A	ENST00000399816.3	+	1	309	c.38G>A	c.(37-39)cGc>cAc	p.R13H		NM_001145161.2	NP_001138633.1	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1	13					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			breast(1)|endometrium(1)	2						CTTAGCGACCGCTTCATCTCC	0.662																																					p.R13H													.	.			0			c.G38A												146.0	143.0	144.0					5																	6449044		692	1591	2283	SO:0001583	missense	134111	exon1			GCGACCGCTTCAT	AK057805	CCDS47189.1	5p15.31	2010-02-17			ENSG00000215218	ENSG00000215218			37269	protein-coding gene	gene with protein product		615832					Standard	NM_001145161		Approved	FLJ25076	uc003jdp.4	A1L167	OTTHUMG00000161683	ENST00000399816.3:c.38G>A	5.37:g.6449044G>A	ENSP00000382713:p.Arg13His		50	0	0		53	0.06	3	NM_001145161	2	0.00	0		Missense_Mutation	SNP	ENST00000399816.3	37	CCDS47189.1	.	.	.	.	.	.	.	.	.	.	G	8.576	0.881175	0.17467	.	.	ENSG00000215218	ENST00000399816	T	0.38077	1.16	4.09	3.18	0.36537	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.24890	0.0604	L	0.43152	1.355	0.32231	N	0.574022	P	0.40282	0.711	B	0.32533	0.147	T	0.35276	-0.9795	9	0.66056	D	0.02	.	5.7805	0.18304	0.1026:0.0:0.7029:0.1945	.	13	A1L167	U2QL1_HUMAN	H	13	ENSP00000382713:R13H	ENSP00000382713:R13H	R	+	2	0	UBE2QL1	6502044	1.000000	0.71417	0.998000	0.56505	0.242000	0.25591	4.103000	0.57783	0.667000	0.31107	0.423000	0.28283	CGC			0.662	UBE2QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365717.1		NM_001145161	
MAP1B	4131	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71489724	71489724	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr5:71489724C>G	ENST00000296755.7	+	5	840	c.542C>G	c.(541-543)gCc>gGc	p.A181G		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	181					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ACCCATCCTGCCAACAAAGCC	0.423																																					p.A181G	Melanoma(17;367 822 11631 31730 47712)												.	MAP1B	243		0			c.C542G												73.0	70.0	71.0					5																	71489724		2203	4300	6503	SO:0001583	missense	4131	exon5			ATCCTGCCAACAA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.542C>G	5.37:g.71489724C>G	ENSP00000296755:p.Ala181Gly		82	0	0		73	0.23	17	NM_005909	12	0.33	4	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.288232	0.23478	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.04083	3.71;3.71;3.71	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000003	T	0.04137	0.0115	N	0.16743	0.435	0.58432	D	0.999999	B;B	0.26445	0.149;0.149	B;B	0.23716	0.048;0.048	T	0.55685	-0.8102	10	0.19147	T	0.46	-20.8126	16.0764	0.80971	0.0:0.8669:0.1331:0.0	.	55;181	A2BDK6;P46821	.;MAP1B_HUMAN	G	181;198;55	ENSP00000296755:A181G;ENSP00000423444:A198G;ENSP00000423416:A55G	ENSP00000296755:A181G	A	+	2	0	MAP1B	71525480	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.944000	0.56629	2.894000	0.99253	0.591000	0.81541	GCC			0.423	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218561.6		NM_005909	
DHFR	1719	hgsc.bcm.edu;broad.mit.edu	37	5	79950296	79950296	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr5:79950296G>T	ENST00000439211.2	-	1	506	c.13C>A	c.(13-15)Cta>Ata	p.L5I	DHFR_ENST00000504396.1_5'UTR|DHFR_ENST00000511032.1_Missense_Mutation_p.L5I|MSH3_ENST00000265081.6_5'Flank|DHFR_ENST00000505337.1_Missense_Mutation_p.L5I|DHFR_ENST00000513048.1_5'UTR	NM_000791.3	NP_000782.1	P00374	DYR_HUMAN	dihydrofolate reductase	5	DHFR. {ECO:0000255|PROSITE- ProRule:PRU00660}.				folic acid metabolic process (GO:0046655)|G1/S transition of mitotic cell cycle (GO:0000082)|glycine biosynthetic process (GO:0006545)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|nucleotide biosynthetic process (GO:0009165)|one-carbon metabolic process (GO:0006730)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to methotrexate (GO:0031427)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)|tetrahydrofolate metabolic process (GO:0046653)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	dihydrofolate reductase activity (GO:0004146)|drug binding (GO:0008144)|mRNA binding (GO:0003729)|NADP binding (GO:0050661)			kidney(1)|large_intestine(1)	2		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.69e-46)|Epithelial(54;7.49e-41)|all cancers(79;1.54e-35)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Proguanil(DB01131)|Pyrimethamine(DB00205)|Trimethoprim(DB00440)|Trimetrexate(DB01157)	ATGCAGTTTAGCGAACCAACC	0.657																																					p.L5I													.	.			0			c.C13A												33.0	33.0	33.0					5																	79950296		1911	4038	5949	SO:0001583	missense	1719	exon1			AGTTTAGCGAACC		CCDS47240.1	5q11.2-q13.2	2012-10-02			ENSG00000228716	ENSG00000228716	1.5.1.3		2861	protein-coding gene	gene with protein product		126060					Standard	XM_005248455		Approved		uc003kgy.1	P00374	OTTHUMG00000162529	ENST00000439211.2:c.13C>A	5.37:g.79950296G>T	ENSP00000396308:p.Leu5Ile		160	0	0		128	0.05	6	NM_000791	1	0.00	0	B4DDD2|Q14130|Q6IRW8	Missense_Mutation	SNP	ENST00000439211.2	37	CCDS47240.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223227	0.58668	.	.	ENSG00000228716	ENST00000439211;ENST00000505337;ENST00000511032	T;T;T	0.71817	-0.6;-0.6;-0.6	4.92	1.99	0.26369	Dihydrofolate reductase domain (2);Dihydrofolate reductase-like domain (2);	.	.	.	.	T	0.72700	0.3493	L	0.43701	1.375	0.54753	D	0.999989	D;D;D	0.63046	0.992;0.96;0.96	D;D;D	0.71184	0.961;0.972;0.972	T	0.68044	-0.5513	8	.	.	.	-0.3563	5.4931	0.16787	0.2409:0.0:0.6179:0.1412	.	5;5;5	B4DM58;P00374;B0YJ76	.;DYR_HUMAN;.	I	5	ENSP00000396308:L5I;ENSP00000426474:L5I;ENSP00000422732:L5I	.	L	-	1	2	DHFR	79986052	0.586000	0.26782	0.014000	0.15608	0.015000	0.08874	0.748000	0.26305	0.646000	0.30693	-0.259000	0.10710	CTA			0.657	DHFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369450.1		NM_000791	
SLC23A1	9963	mdanderson.org	37	5	138714360	138714360	+	Missense_Mutation	SNP	C	C	T	rs115023155	byFrequency	TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr5:138714360C>T	ENST00000348729.3	-	10	1133	c.1087G>A	c.(1087-1089)Gaa>Aaa	p.E363K	SLC23A1_ENST00000353963.3_Missense_Mutation_p.E367K|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	363					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CAAATGCCTTCGGTGAAGATG	0.597													C|||	2	0.000399361	0.0	0.0	5008	,	,		16188	0.001		0.001	False		,,,				2504	0.0				p.E367K													.	.			0			c.G1099A												57.0	47.0	50.0					5																	138714360		2203	4299	6502	SO:0001583	missense	9963	exon10			TGCCTTCGGTGAA	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.1087G>A	5.37:g.138714360C>T	ENSP00000302701:p.Glu363Lys		132	0	0		103	0.05	5	NM_152685	1	0.00	0	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.543421|5.543421	0.96474|0.96474	.|.	.|.	ENSG00000170482|ENSG00000170482	ENST00000353963;ENST00000348729|ENST00000504513	T;T|.	0.22134|.	1.97;1.97|.	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87071|0.87071	0.6086|0.6086	H|H	0.95365|0.95365	3.66|3.66	0.80722|0.80722	D|D	1|1	P;D|.	0.69078|.	0.897;0.997|.	P;D|.	0.65010|.	0.713;0.931|.	D|D	0.91128|0.91128	0.4935|0.4935	10|5	0.87932|.	D|.	0|.	-28.6656|-28.6656	16.6016|16.6016	0.84817|0.84817	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	363;367|.	Q9UHI7;Q9UHI7-2|.	S23A1_HUMAN;.|.	K|Q	367;363|109	ENSP00000302851:E367K;ENSP00000302701:E363K|.	ENSP00000302701:E363K|.	E|R	-|-	1|2	0|0	SLC23A1|SLC23A1	138742259|138742259	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.964000|0.964000	0.63967|0.63967	7.603000|7.603000	0.82811|0.82811	2.424000|2.424000	0.82194|0.82194	0.561000|0.561000	0.74099|0.74099	GAA|CGA	0.006		0.597	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000374185.1		NM_152685	
ADAM19	8728	broad.mit.edu	37	5	156936422	156936422	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr5:156936422G>T	ENST00000517905.1	-	9	836	c.792C>A	c.(790-792)acC>acA	p.T264T	ADAM19_ENST00000394020.1_Silent_p.T266T|ADAM19_ENST00000430702.2_5'UTR|ADAM19_ENST00000257527.4_Silent_p.T264T			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	264	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTTCCCGTGGGTCCACACTT	0.493																																					p.T264T													.	ADAM19	216		0			c.C792A												79.0	71.0	74.0					5																	156936422		2203	4300	6503	SO:0001819	synonymous_variant	8728	exon9			CCCGTGGGTCCAC	AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.792C>A	5.37:g.156936422G>T			162	0	0		158	0.03	4	NM_033274	4	0.00	0	Q9BZL5|Q9UHP2	Silent	SNP	ENST00000517905.1	37																																																																																						0.493	ADAM19-003	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000373918.1		NM_033274	
MSX2	4488	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	174156363	174156363	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr5:174156363G>C	ENST00000239243.6	+	2	708	c.581G>C	c.(580-582)aGg>aCg	p.R194T		NM_002449.4	NP_002440.2	P35548	MSX2_HUMAN	msh homeobox 2	194				R -> S (in Ref. 1; CAA49156). {ECO:0000305}.	activation of meiosis (GO:0090427)|anagen (GO:0042640)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone trabecula formation (GO:0060346)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte development (GO:0002063)|cranial suture morphogenesis (GO:0060363)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|enamel mineralization (GO:0070166)|endochondral bone growth (GO:0003416)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|frontal suture morphogenesis (GO:0060364)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of catagen (GO:0051795)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of osteoblast differentiation (GO:0045669)|signal transduction involved in regulation of gene expression (GO:0023019)|wound healing, spreading of epidermal cells (GO:0035313)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAGAACCGAAGGGCCAAGGCG	0.527																																					p.R194T													.	MSX2	24		0			c.G581C												61.0	62.0	62.0					5																	174156363		2203	4300	6503	SO:0001583	missense	4488	exon2			ACCGAAGGGCCAA	D26145	CCDS4392.1	5q35.2	2011-06-20	2006-11-21		ENSG00000120149	ENSG00000120149		"""Homeoboxes / ANTP class : NKL subclass"""	7392	protein-coding gene	gene with protein product	"""craniosynostosis, type 2"""	123101	"""msh (Drosophila) homeo box homolog 2"", ""parietal foramina 1"", ""msh homeobox homolog 2 (Drosophila)"""	PFM1		8668339, 8786091	Standard	XM_006714868		Approved	CRS2, FPP, HOX8, MSH, PFM	uc003mcy.3	P35548	OTTHUMG00000130556	ENST00000239243.6:c.581G>C	5.37:g.174156363G>C	ENSP00000239243:p.Arg194Thr		191	0	0		174	0.14	24	NM_002449	87	0.26	23	D3DQN1|Q53XM4|Q9UD60	Missense_Mutation	SNP	ENST00000239243.6	37	CCDS4392.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072473	0.93950	.	.	ENSG00000120149	ENST00000239243	D	0.99158	-5.5	5.83	5.83	0.93111	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99674	0.9878	H	0.98965	4.385	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97424	1.0011	10	0.87932	D	0	-23.6278	20.1133	0.97917	0.0:0.0:1.0:0.0	.	194	P35548	MSX2_HUMAN	T	194	ENSP00000239243:R194T	ENSP00000239243:R194T	R	+	2	0	MSX2	174088969	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	9.807000	0.99171	2.762000	0.94881	0.591000	0.81541	AGG			0.527	MSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252981.3			
POU5F1	5460	broad.mit.edu	37	6	31138067	31138067	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr6:31138067A>G	ENST00000259915.8	-	1	403	c.331T>C	c.(331-333)Tcc>Ccc	p.S111P	POU5F1_ENST00000441888.3_Intron	NM_002701.4	NP_002692.2	Q01860	PO5F1_HUMAN	POU class 5 homeobox 1	111					anatomical structure morphogenesis (GO:0009653)|blastocyst development (GO:0001824)|BMP signaling pathway involved in heart induction (GO:0003130)|cardiac cell fate determination (GO:0060913)|cell fate commitment involved in formation of primary germ layer (GO:0060795)|endodermal cell fate specification (GO:0001714)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of gene silencing by miRNA (GO:0060965)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of asymmetric cell division (GO:0009786)|regulation of gene expression (GO:0010468)|regulation of heart induction by regulation of canonical Wnt signaling pathway (GO:0090081)|regulation of methylation-dependent chromatin silencing (GO:0090308)|regulation of transcription, DNA-templated (GO:0006355)|response to wounding (GO:0009611)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)		EWSR1/POU5F1(10)	breast(1)|large_intestine(2)|lung(3)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	13					Dopamine(DB00988)|Norepinephrine(DB00368)	GGCTCCGGGGAGGCCCCATCG	0.667			T	EWSR1	sarcoma																																p.S111P				Dom	yes		6	6p21.31	5460	"""POU domain, class 5, transcription factor 1"""		M	.	POU5F1	25		0			c.T331C												35.0	38.0	37.0					6																	31138067		1509	2708	4217	SO:0001583	missense	5460	exon1			CCGGGGAGGCCCC	Z11898	CCDS34391.1, CCDS47398.1, CCDS47398.2, CCDS75420.1	6p21.33	2011-06-20	2007-07-13		ENSG00000204531	ENSG00000204531		"""Homeoboxes / POU class"""	9221	protein-coding gene	gene with protein product		164177	"""POU domain class 5, transcription factor 1"""	OTF3		1408763	Standard	NM_002701		Approved	OCT3, Oct4, MGC22487	uc003nsv.3	Q01860	OTTHUMG00000031206	ENST00000259915.8:c.331T>C	6.37:g.31138067A>G	ENSP00000259915:p.Ser111Pro		95	0.0315789474	3		118	0.03	3	NM_002701	5002	0.00	4	A6NCS1|A6NLL8|D2IYK4|P31359|Q15167|Q15168|Q16422|Q5STF3|Q5STF4	Missense_Mutation	SNP	ENST00000259915.8	37	CCDS34391.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.548|9.548	1.115244|1.115244	0.20795|0.20795	.|.	.|.	ENSG00000204531|ENSG00000204531	ENST00000448657|ENST00000259915	.|T	.|0.26223	.|1.75	3.96|3.96	3.96|3.96	0.45880|0.45880	.|.	.|0.000000	.|0.40302	.|N	.|0.001131	T|T	0.19725|0.19725	0.0474|0.0474	L|L	0.45581|0.45581	1.43|1.43	0.80722|0.80722	D|D	1|1	.|P	.|0.45531	.|0.86	.|P	.|0.52217	.|0.693	T|T	0.01367|0.01367	-1.1373|-1.1373	5|10	.|0.36615	.|T	.|0.2	.|.	9.3822|9.3822	0.38320|0.38320	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|111	.|Q01860	.|PO5F1_HUMAN	P|P	109|111	.|ENSP00000259915:S111P	.|ENSP00000259915:S111P	L|S	-|-	2|1	0|0	POU5F1|POU5F1	31246046|31246046	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.074000|0.074000	0.17049|0.17049	4.252000|4.252000	0.58785|0.58785	1.792000|1.792000	0.52537|0.52537	0.368000|0.368000	0.22195|0.22195	CTC|TCC			0.667	POU5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076413.4		NM_002701	
LRFN2	57497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	40360629	40360629	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr6:40360629C>A	ENST00000338305.6	-	3	1965	c.1423G>T	c.(1423-1425)Gcc>Tcc	p.A475S		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	475	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					ACCACGAAGGCCTTGTTGGAG	0.587																																					p.A475S													.	.			0			c.G1423T												43.0	45.0	44.0					6																	40360629		2203	4300	6503	SO:0001583	missense	57497	exon3			CGAAGGCCTTGTT	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1423G>T	6.37:g.40360629C>A	ENSP00000345985:p.Ala475Ser		69	0	0		61	0.26	16	NM_020737	0		0	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	37	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	c	5.675	0.309040	0.10733	.	.	ENSG00000156564	ENST00000338305	T	0.53206	0.63	5.29	4.42	0.53409	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.050382	0.85682	D	0.000000	T	0.11024	0.0269	N	0.12182	0.205	0.58432	D	0.999998	B	0.13594	0.008	B	0.20184	0.028	T	0.15093	-1.0449	10	0.02654	T	1	.	12.959	0.58447	0.0:0.9201:0.0:0.0799	.	475	Q9ULH4	LRFN2_HUMAN	S	475	ENSP00000345985:A475S	ENSP00000345985:A475S	A	-	1	0	LRFN2	40468607	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.646000	0.37249	1.221000	0.43506	0.651000	0.88453	GCC			0.587	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040488.1		XM_166372	
ZNF451	26036	broad.mit.edu	37	6	57013354	57013354	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr6:57013354G>T	ENST00000370706.4	+	10	2715	c.2471G>T	c.(2470-2472)gGa>gTa	p.G824V	RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.G824V|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000586466.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.G824V|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	824					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GCTCATTTTGGATCTGAAAAA	0.403																																					p.G824V													.	ZNF451	181		0			c.G2471T												86.0	83.0	84.0					6																	57013354		2203	4300	6503	SO:0001583	missense	26036	exon10			ATTTTGGATCTGA	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2471G>T	6.37:g.57013354G>T	ENSP00000359740:p.Gly824Val		227	0.0044052863	1		241	0.02	5	NM_001031623	64	0.00	0	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	7.251	0.603141	0.13939	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.20200	2.1;2.09;2.09	5.32	2.48	0.30137	.	0.461480	0.21347	N	0.076025	T	0.10723	0.0262	L	0.57536	1.79	0.80722	D	1	P;B;B;B	0.34724	0.465;0.265;0.265;0.391	B;B;B;B	0.33521	0.165;0.107;0.107;0.107	T	0.03840	-1.0999	10	0.62326	D	0.03	-0.8407	11.2362	0.48942	0.0688:0.3785:0.5527:0.0	.	824;824;824;824	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	V	824	ENSP00000359740:G824V;ENSP00000350083:G824V;ENSP00000421645:G824V	ENSP00000350083:G824V	G	+	2	0	ZNF451	57121313	0.231000	0.23751	0.024000	0.17045	0.382000	0.30200	2.026000	0.41069	0.291000	0.22468	0.650000	0.86243	GGA			0.403	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041035.2		NM_015555	
KLHL32	114792	hgsc.bcm.edu	37	6	97424037	97424037	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr6:97424037G>T	ENST00000369261.4	+	3	551	c.188G>T	c.(187-189)tGc>tTc	p.C63F	KLHL32_ENST00000539200.1_Missense_Mutation_p.C63F|KLHL32_ENST00000536676.1_Missense_Mutation_p.C63F|KLHL32_ENST00000544166.1_5'UTR	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	63	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		CTAGCAGCATGCAGTGACTAT	0.468																																					p.C63F													.	.			0			c.G188T												95.0	75.0	82.0					6																	97424037		2203	4300	6503	SO:0001583	missense	114792	exon3			CAGCATGCAGTGA	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.188G>T	6.37:g.97424037G>T	ENSP00000358265:p.Cys63Phe		89	0	0		77	0.05	4	NM_052904	0		0	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988123	0.74589	.	.	ENSG00000186231	ENST00000369261;ENST00000536676;ENST00000539200;ENST00000369254	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	5.14	5.14	0.70334	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.74627	0.3741	L	0.51853	1.615	0.80722	D	1	D;D;P;D	0.71674	0.998;0.992;0.883;0.996	D;D;P;D	0.74023	0.971;0.982;0.691;0.914	T	0.76740	-0.2848	10	0.87932	D	0	.	18.7846	0.91949	0.0:0.0:1.0:0.0	.	63;63;63;63	B7Z4E2;B7Z346;Q96NJ5;Q6IQ08	.;.;KLH32_HUMAN;.	F	63	ENSP00000358265:C63F;ENSP00000440382:C63F;ENSP00000441527:C63F;ENSP00000358258:C63F	ENSP00000358258:C63F	C	+	2	0	KLHL32	97530758	1.000000	0.71417	0.997000	0.53966	0.912000	0.54170	9.263000	0.95617	2.674000	0.91012	0.591000	0.81541	TGC			0.468	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041570.1		NM_052904	
PBOV1	59351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138539259	138539259	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr6:138539259C>A	ENST00000527246.2	-	1	368	c.274G>T	c.(274-276)Ggt>Tgt	p.G92C	KIAA1244_ENST00000251691.4_Intron	NM_021635.2	NP_067648.1	Q9GZY1	PBOV1_HUMAN	prostate and breast cancer overexpressed 1	92						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)	1	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00055)|GBM - Glioblastoma multiforme(68;0.000674)		ATTGAGGAACCTTTCATGGTC	0.393																																					p.G92C													.	.			0			c.G274T												268.0	267.0	268.0					6																	138539259		2203	4300	6503	SO:0001583	missense	59351	exon1			AGGAACCTTTCAT	AF189269	CCDS5190.1	6q23.3	2012-02-09			ENSG00000254440	ENSG00000254440			21079	protein-coding gene	gene with protein product		605669				12553037, 11156405	Standard	NM_021635		Approved	UC28, UROC28	uc003qhv.3	Q9GZY1	OTTHUMG00000167040	ENST00000527246.2:c.274G>T	6.37:g.138539259C>A	ENSP00000432353:p.Gly92Cys		153	0	0		189	0.19	36	NM_021635	0		0		Missense_Mutation	SNP	ENST00000527246.2	37	CCDS5190.1	.	.	.	.	.	.	.	.	.	.	C	2.603	-0.292526	0.05568	.	.	ENSG00000254440	ENST00000527246	T	0.50813	0.73	3.02	1.12	0.20585	.	.	.	.	.	T	0.08846	0.0219	N	0.08118	0	0.09310	N	1	P	0.38617	0.64	B	0.33254	0.16	T	0.11084	-1.0602	9	0.87932	D	0	.	4.0686	0.09872	0.0:0.6085:0.2469:0.1446	.	92	Q9GZY1	PBOV1_HUMAN	C	92	ENSP00000432353:G92C	ENSP00000432353:G92C	G	-	1	0	PBOV1	138580952	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.132000	0.10467	0.137000	0.18759	-0.175000	0.13238	GGT			0.393	PBOV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392617.1		NM_021635	
INHBA-AS1	285954	hgsc.bcm.edu	37	7	41797988	41797988	+	RNA	SNP	A	A	G	rs549177405		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr7:41797988A>G	ENST00000415848.2	+	0	358					NR_027118.1				INHBA antisense RNA 1																		ttttttttccattcattcaac	0.393																																					.													.	.			0			.																																											285954	.			TTTTCCATTCATT			7p14.1	2012-10-12	2012-08-15		ENSG00000224116	ENSG00000224116		"""Long non-coding RNAs"""	40303	non-coding RNA	RNA, long non-coding			"""INHBA antisense RNA 1 (non-protein coding)"""				Standard	NR_027118		Approved		uc003tht.4		OTTHUMG00000155114		7.37:g.41797988A>G			9	0	0		13	0.38	5	.	0		0		RNA	SNP	ENST00000415848.2	37																																																																																						0.393	INHBA-AS1-001	KNOWN	basic	antisense	antisense		OTTHUMT00000338451.2		NR_027118	
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	77755017	77755017	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr7:77755017C>G	ENST00000354212.4	-	20	3814	c.3561G>C	c.(3559-3561)agG>agC	p.R1187S	MAGI2_ENST00000419488.1_Missense_Mutation_p.R1173S|MAGI2_ENST00000522391.1_Missense_Mutation_p.R1187S	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1187	PDZ 6. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TTACCCTCATCCTCCCATTCC	0.423																																					p.R1187S													.	.			0			c.G3561C												175.0	166.0	169.0					7																	77755017		2203	4300	6503	SO:0001583	missense	9863	exon20			CCTCATCCTCCCA	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3561G>C	7.37:g.77755017C>G	ENSP00000346151:p.Arg1187Ser		176	0	0		272	0.09	24	NM_012301	0		0	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432541	0.62844	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.19669	2.13;2.13;2.13	6.03	0.201	0.15186	PDZ/DHR/GLGF (4);	0.000000	0.40728	U	0.001037	T	0.41858	0.1177	M	0.76574	2.34	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.91635	0.994;0.999;0.996	T	0.28490	-1.0042	10	0.52906	T	0.07	.	11.6865	0.51490	0.0:0.5256:0.0:0.4744	.	1187;1173;1187	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	S	1173;1187;1187;1187	ENSP00000405766:R1173S;ENSP00000346151:R1187S;ENSP00000428389:R1187S	ENSP00000346151:R1187S	R	-	3	2	MAGI2	77592953	0.945000	0.32115	0.998000	0.56505	0.975000	0.68041	0.148000	0.16224	0.091000	0.17302	-0.794000	0.03295	AGG			0.423	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253197.3		NM_012301	
KPNA7	402569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98792933	98792933	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr7:98792933G>A	ENST00000327442.6	-	4	352	c.313C>T	c.(313-315)Cct>Tct	p.P105S		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	105					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						AGTTTCAGAGGGGGGTTCTTT	0.532																																					p.P105S													.	.			0			c.C313T												29.0	29.0	29.0					7																	98792933		692	1591	2283	SO:0001583	missense	402569	exon4			TCAGAGGGGGGTT		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.313C>T	7.37:g.98792933G>A	ENSP00000330878:p.Pro105Ser		83	0	0		110	0.12	13	NM_001145715	0		0	A4D277	Missense_Mutation	SNP	ENST00000327442.6	37	CCDS47651.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309110	0.60414	.	.	ENSG00000185467	ENST00000327442	T	0.69926	-0.44	5.58	4.69	0.59074	Armadillo-like helical (1);Armadillo-type fold (1);	0.046961	0.85682	D	0.000000	D	0.87748	0.6255	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	D	0.92133	0.5714	10	0.87932	D	0	-9.9287	15.3182	0.74099	0.0:0.1489:0.8511:0.0	.	105	A9QM74	IMA8_HUMAN	S	105	ENSP00000330878:P105S	ENSP00000330878:P105S	P	-	1	0	KPNA7	98630869	1.000000	0.71417	0.996000	0.52242	0.254000	0.26022	6.523000	0.73787	1.351000	0.45789	0.561000	0.74099	CCT			0.532	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335118.1		NM_001145715	
KLRG2	346689	mdanderson.org	37	7	139168165	139168165	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr7:139168165G>T	ENST00000340940.4	-	1	293	c.224C>A	c.(223-225)cCc>cAc	p.P75H	KLRG2_ENST00000393039.2_Missense_Mutation_p.P75H	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	75	Pro-rich.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					CGGGGACCCGGGGCGAGGCGA	0.741																																					p.P75H													.	.			0			c.C224A												4.0	6.0	6.0					7																	139168165		1682	3643	5325	SO:0001583	missense	346689	exon1			GACCCGGGGCGAG	AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.224C>A	7.37:g.139168165G>T	ENSP00000339356:p.Pro75His		14	0	0		22	0.09	2	NM_198508	88	0.00	0	Q2NL79|Q6ZTV6	Missense_Mutation	SNP	ENST00000340940.4	37	CCDS5854.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981292	0.53827	.	.	ENSG00000188883	ENST00000340940;ENST00000393039	T;T	0.53206	3.78;0.63	3.71	2.83	0.33086	.	0.326738	0.18433	U	0.141393	T	0.49355	0.1552	L	0.29908	0.895	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.64237	0.923;0.923	T	0.29549	-1.0008	10	0.87932	D	0	-3.5895	6.907	0.24315	0.1311:0.0:0.8689:0.0	.	75;75	A4D1S0-2;A4D1S0	.;KLRG2_HUMAN	H	75	ENSP00000339356:P75H;ENSP00000376759:P75H	ENSP00000339356:P75H	P	-	2	0	KLRG2	138818705	0.017000	0.18338	0.004000	0.12327	0.023000	0.10783	1.115000	0.31209	0.745000	0.32763	0.484000	0.47621	CCC			0.741	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349433.1		NM_198508	
RP1L1	94137	broad.mit.edu	37	8	10465179	10465179	+	Silent	SNP	A	A	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr8:10465179A>T	ENST00000382483.3	-	4	6652	c.6429T>A	c.(6427-6429)ccT>ccA	p.P2143P		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2223	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CTTCTGACTCAGGCTGGGCCT	0.612																																					p.P2143P													.	RP1L1	453		0			c.T6429A												158.0	172.0	167.0					8																	10465179		1908	4113	6021	SO:0001819	synonymous_variant	94137	exon4			TGACTCAGGCTGG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6429T>A	8.37:g.10465179A>T			148	0.0067567568	1		178	0.04	8	NM_178857	0		0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																					0.612	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375673.1			
KIAA1456	57604	broad.mit.edu	37	8	12879537	12879537	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr8:12879537A>G	ENST00000524591.2	+	5	1838	c.1349A>G	c.(1348-1350)aAg>aGg	p.K450R	KIAA1456_ENST00000447063.2_Intron	NM_001099677.1|NM_020844.2	NP_001093147.1|NP_065895.2	Q9P272	K1456_HUMAN	KIAA1456	450							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7						GCAGAGAAAAAGAGAGGTTGT	0.433																																					p.K450R													.	KIAA1456	20		0			c.A1349G												55.0	51.0	52.0					8																	12879537		1861	4093	5954	SO:0001583	missense	57604	exon5			AGAAAAAGAGAGG	BC035082	CCDS47808.1	8p22	2013-10-04	2011-02-23	2011-02-23	ENSG00000250305	ENSG00000250305			26725	protein-coding gene	gene with protein product		615666	"""chromosome 8 open reading frame 79"""	C8orf79		23381944	Standard	NM_020844		Approved	FLJ36980	uc010lsq.3	Q8N9K7	OTTHUMG00000165477	ENST00000524591.2:c.1349A>G	8.37:g.12879537A>G	ENSP00000432695:p.Lys450Arg		155	0.0064516129	1		181	0.03	5	NM_020844	3	0.00	0	Q96AW6	Missense_Mutation	SNP	ENST00000524591.2	37	CCDS47808.1	.	.	.	.	.	.	.	.	.	.	A	5.869	0.344408	0.11126	.	.	ENSG00000250305	ENST00000524591;ENST00000529978	T	0.11277	2.79	4.74	2.18	0.27775	.	0.345165	0.32444	N	0.006097	T	0.05868	0.0153	L	0.28400	0.85	0.23585	N	0.997351	B	0.12630	0.006	B	0.12156	0.007	T	0.41980	-0.9478	10	0.11182	T	0.66	-32.7146	3.9918	0.09539	0.6615:0.0:0.1822:0.1563	.	450	Q9P272	K1456_HUMAN	R	450;363	ENSP00000432695:K450R	ENSP00000432695:K450R	K	+	2	0	AC135352.2	12923908	0.972000	0.33761	0.720000	0.30636	0.641000	0.38312	0.730000	0.26043	0.352000	0.24053	0.528000	0.53228	AAG			0.433	KIAA1456-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383262.2		NM_001099677	
PHYHIP	9796	broad.mit.edu	37	8	22079280	22079280	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr8:22079280G>T	ENST00000321613.3	-	6	1035	c.579C>A	c.(577-579)ggC>ggA	p.G193G	PHYHIP_ENST00000454243.2_Silent_p.G193G	NM_001099335.1	NP_001092805.1	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	193										endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	10				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		GCGGGGGCTGGCCCGTGTTGA	0.622																																					p.G193G													.	PHYHIP	24		0			c.C579A												16.0	22.0	20.0					8																	22079280		1977	4149	6126	SO:0001819	synonymous_variant	9796	exon5			GGGCTGGCCCGTG	D87463	CCDS43723.1	8p21.2	2010-02-17	2006-01-09		ENSG00000168490	ENSG00000168490			16865	protein-coding gene	gene with protein product		608511	"""phytanoyl-CoA hydroxylase interacting protein"", ""DYRK1A interacting protein 3"""	DYRK1AP3		9039502, 10686344	Standard	NM_014759		Approved	KIAA0273, PAHX-AP	uc003xbj.4	Q92561	OTTHUMG00000163776	ENST00000321613.3:c.579C>A	8.37:g.22079280G>T			106	0.0094339623	1		147	0.04	6	NM_014759	3	0.00	0	D3DSR1|Q8N4I9	Silent	SNP	ENST00000321613.3	37	CCDS43723.1																																																																																					0.622	PHYHIP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000375388.1		NM_014759	
FAM83H	286077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	144810755	144810755	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr8:144810755G>T	ENST00000388913.3	-	5	1001	c.876C>A	c.(874-876)gcC>gcA	p.A292A		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	292					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CGTCCATGCGGGCCAGGGCCG	0.697																																					p.A292A													.	.			0			c.C876A												10.0	12.0	11.0					8																	144810755		1937	4101	6038	SO:0001819	synonymous_variant	286077	exon5			CATGCGGGCCAGG	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.876C>A	8.37:g.144810755G>T			48	0	0		56	0.09	5	NM_198488	1	0.00	0	A0JLS2|Q8N4W0	Silent	SNP	ENST00000388913.3	37	CCDS6410.2																																																																																					0.697	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257632.2		NM_198488	
EXOSC4	54512	mdanderson.org	37	8	145135472	145135472	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr8:145135472G>T	ENST00000316052.5	+	3	809	c.706G>T	c.(706-708)Gtg>Ttg	p.V236L	GPAA1_ENST00000361036.6_5'Flank|CTD-3065J16.9_ENST00000524499.1_RNA|GPAA1_ENST00000355091.4_5'Flank	NM_019037.2	NP_061910.1	Q9NPD3	EXOS4_HUMAN	exosome component 4	236					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)			lung(4)|prostate(1)|upper_aerodigestive_tract(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.48e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCGGCAGCATGTGCGTGAGGC	0.617																																					p.V236L													.	.			0			c.G706T												61.0	69.0	66.0					8																	145135472		2203	4300	6503	SO:0001583	missense	54512	exon3			CAGCATGTGCGTG	AF281133	CCDS6414.1	8q24.3	2004-03-26			ENSG00000178896	ENSG00000178896			18189	protein-coding gene	gene with protein product	"""exosome component Rrp41"""	606491				11110791	Standard	NM_019037		Approved	hRrp41p, FLJ20591, Rrp41p, RRP41, RRP41A, Ski6p, SKI6, p12A	uc003zau.3	Q9NPD3	OTTHUMG00000165437	ENST00000316052.5:c.706G>T	8.37:g.145135472G>T	ENSP00000315476:p.Val236Leu		12	0	0		12	0.17	2	NM_019037	50	0.00	0		Missense_Mutation	SNP	ENST00000316052.5	37	CCDS6414.1	.	.	.	.	.	.	.	.	.	.	G	4.663	0.123198	0.08931	.	.	ENSG00000178896	ENST00000316052;ENST00000527954	T	0.70631	-0.5	5.38	5.38	0.77491	.	0.079119	0.52532	D	0.000079	T	0.47210	0.1433	N	0.10685	0.025	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44651	-0.9314	10	0.11182	T	0.66	-2.3491	11.677	0.51436	0.0:0.0:0.8229:0.1771	.	236	Q9NPD3	EXOS4_HUMAN	L	236;259	ENSP00000315476:V236L	ENSP00000315476:V236L	V	+	1	0	EXOSC4	145207460	0.998000	0.40836	0.978000	0.43139	0.931000	0.56810	2.731000	0.47343	2.531000	0.85337	0.561000	0.74099	GTG			0.617	EXOSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384065.1		NM_019037	
MPDZ	8777	broad.mit.edu	37	9	13217201	13217201	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr9:13217201G>T	ENST00000319217.7	-	9	1426	c.1179C>A	c.(1177-1179)ggC>ggA	p.G393G	MPDZ_ENST00000546205.1_Silent_p.G393G|MPDZ_ENST00000541718.1_Silent_p.G393G|MPDZ_ENST00000536827.1_Silent_p.G393G|MPDZ_ENST00000381015.4_Silent_p.G393G|MPDZ_ENST00000447879.1_Silent_p.G393G|MPDZ_ENST00000381022.2_Silent_p.G393G	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	393	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CTCCAATGTAGCCAGCAATGG	0.299																																					p.G393G													.	MPDZ	324		0			c.C1179A												67.0	62.0	63.0					9																	13217201		1803	4056	5859	SO:0001819	synonymous_variant	8777	exon9			AATGTAGCCAGCA	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1179C>A	9.37:g.13217201G>T			212	0.0047169811	1		247	0.02	6	NM_003829	28	0.00	0	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	37																																																																																						0.299	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding		OTTHUMT00000055485.2		NM_003829	
STKLD1	169436	mdanderson.org	37	9	136270539	136270539	+	Silent	SNP	G	G	T	rs267602152		TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chr9:136270539G>T	ENST00000371957.3	+	18	2144	c.2037G>T	c.(2035-2037)ctG>ctT	p.L679L	C9orf96_ENST00000371955.1_Silent_p.L212L	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		679							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CTGGGGGACTGGAATAGATGT	0.552																																					p.L679L													C9orf96_ENST00000371957,NS,carcinoma,+1,1	C9orf96_ENST00000371957	1	1	0			c.G2037T												35.0	36.0	36.0					9																	136270539		2203	4300	6503	SO:0001819	synonymous_variant	169436	exon18			GGGACTGGAATAG																												ENST00000371957.3:c.2037G>T	9.37:g.136270539G>T			8	0	0		24	0.17	4	NM_153710	1	0.00	0	Q5T8U8|Q6ZMP6|Q6ZMQ5	Silent	SNP	ENST00000371957.3	37	CCDS35169.1																																																																																					0.552	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054855.1			
PPEF1	5475	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	18845542	18845542	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:18845542G>T	ENST00000361511.4	+	19	2393	c.1899G>T	c.(1897-1899)aaG>aaT	p.K633N	PPEF1_ENST00000349874.5_Missense_Mutation_p.K571N|PPEF1_ENST00000359763.6_Missense_Mutation_p.K580N|PPEF1_ENST00000543630.1_3'UTR|PPEF1_ENST00000544635.1_Missense_Mutation_p.K568N	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	633	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AGTTTTTAAAGGCTTTCTATG	0.393																																					p.K633N													.	PPEF1	89		0			c.G1899T												147.0	132.0	137.0					X																	18845542		2203	4300	6503	SO:0001583	missense	5475	exon19			TTTAAAGGCTTTC	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1899G>T	X.37:g.18845542G>T	ENSP00000354871:p.Lys633Asn		149	0.0067114094	1		251	0.03	8	NM_006240	5	0.00	0	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	CCDS14188.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.188917	0.38707	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000349874;ENST00000544635;ENST00000470157	T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64	5.31	0.959	0.19624	EF-hand-like domain (1);	0.000000	0.51477	D	0.000098	T	0.64394	0.2594	M	0.65498	2.005	0.35665	D	0.812885	B;P;P	0.44627	0.047;0.839;0.763	B;B;P	0.44897	0.032;0.347;0.463	T	0.63175	-0.6696	10	0.32370	T	0.25	-18.2483	4.1369	0.10174	0.432:0.0:0.4075:0.1605	.	571;633;605	O14829-5;O14829;O14829-3	.;PPE1_HUMAN;.	N	633;580;571;568;95	ENSP00000354871:K633N;ENSP00000352806:K580N;ENSP00000341892:K571N;ENSP00000441289:K568N;ENSP00000419273:K95N	ENSP00000341892:K571N	K	+	3	2	PPEF1	18755463	1.000000	0.71417	0.997000	0.53966	0.936000	0.57629	1.448000	0.35112	0.111000	0.17947	0.594000	0.82650	AAG			0.393	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055953.3		NM_006240	
DDX3X	1654	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	41205590	41205590	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:41205590G>C	ENST00000399959.2	+	13	2279	c.1424G>C	c.(1423-1425)cGt>cCt	p.R475P	DDX3X_ENST00000457138.2_Missense_Mutation_p.R459P|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000542215.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000441189.2_Intron	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	475	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						CATGGAGACCGTTCTCAGAGG	0.443										HNSCC(61;0.18)																											p.R475P													.	.			0			c.G1424C												113.0	107.0	109.0					X																	41205590		2200	4300	6500	SO:0001583	missense	1654	exon13			GAGACCGTTCTCA	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1424G>C	X.37:g.41205590G>C	ENSP00000382840:p.Arg475Pro		144	0	0		183	0.08	14	NM_001193416	754	0.08	57	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762698	0.89932	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.75477	-0.94;-0.94	5.41	5.41	0.78517	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.86485	0.5944	M	0.76433	2.335	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.995;0.996;0.996	D	0.88091	0.2813	10	0.87932	D	0	-8.5744	18.3066	0.90184	0.0:0.0:1.0:0.0	.	459;487;475	B4E3E8;Q59GX6;O00571	.;.;DDX3X_HUMAN	P	475;459	ENSP00000382840:R475P;ENSP00000392494:R459P	ENSP00000382840:R475P	R	+	2	0	DDX3X	41090534	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	9.807000	0.99171	2.262000	0.75019	0.600000	0.82982	CGT			0.443	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056253.1		NM_024005	
TSPYL2	64061	mdanderson.org	37	X	53111842	53111842	+	Silent	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:53111842G>T	ENST00000375442.4	+	1	294	c.162G>T	c.(160-162)gcG>gcT	p.A54A		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	54	Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						AAACGGAGGCGGCACAGGTGC	0.751																																					p.A54A													.	.			0			c.G162T												2.0	2.0	2.0					X																	53111842		1485	3222	4707	SO:0001819	synonymous_variant	64061	exon1			GGAGGCGGCACAG	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.162G>T	X.37:g.53111842G>T			17	0	0		28	0.11	3	NM_022117	7	0.00	0	O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	37	CCDS14350.1																																																																																					0.751	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056718.1		NM_022117	
NLGN3	54413	broad.mit.edu	37	X	70387352	70387352	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:70387352A>C	ENST00000358741.3	+	7	1708	c.1405A>C	c.(1405-1407)Acc>Ccc	p.T469P	NLGN3_ENST00000536169.1_Missense_Mutation_p.T429P|NLGN3_ENST00000374051.3_Missense_Mutation_p.T449P|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	469					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CAACCCTGAGACCCGCCGTAA	0.557																																					p.T469P	Esophageal Squamous(103;760 1488 16849 22250 40351)												.	NLGN3	159		0			c.A1405C												57.0	46.0	50.0					X																	70387352		2203	4300	6503	SO:0001583	missense	54413	exon7			CCTGAGACCCGCC	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1405A>C	X.37:g.70387352A>C	ENSP00000351591:p.Thr469Pro		52	0.2692307692	14		94	0.31	29	NM_181303	1	0.00	0	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	ENST00000358741.3	37	CCDS55441.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.34|19.34	3.808317|3.808317	0.70797|0.70797	.|.	.|.	ENSG00000196338|ENSG00000196338	ENST00000542063|ENST00000536169;ENST00000374051;ENST00000395855;ENST00000358741	.|T;T;T;T	.|0.68181	.|-0.31;-0.31;-0.31;-0.31	4.9|4.9	4.9|4.9	0.64082|0.64082	.|Carboxylesterase, type B (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77226|0.77226	0.4099|0.4099	L|L	0.55103|0.55103	1.725|1.725	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.994;0.998;0.993	.|D;D;D	.|0.75020	.|0.978;0.985;0.956	T|T	0.79415|0.79415	-0.1813|-0.1813	5|10	.|0.66056	.|D	.|0.02	.|.	13.7564|13.7564	0.62940|0.62940	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|429;469;449	.|D3DVV1;Q9NZ94;Q9NZ94-2	.|.;NLGN3_HUMAN;.	S|P	331|429;449;429;469	.|ENSP00000445298:T429P;ENSP00000363163:T449P;ENSP00000379196:T429P;ENSP00000351591:T469P	.|ENSP00000351591:T469P	R|T	+|+	3|1	2|0	NLGN3|NLGN3	70304077|70304077	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.139000|9.139000	0.94554|0.94554	1.822000|1.822000	0.53115|0.53115	0.413000|0.413000	0.27773|0.27773	AGA|ACC			0.557	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057121.1		NM_018977	
MORC4	79710	broad.mit.edu	37	X	106184800	106184800	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:106184800G>T	ENST00000355610.4	-	17	2997	c.2723C>A	c.(2722-2724)cCt>cAt	p.P908H	MORC4_ENST00000255495.7_Silent_p.P895P|MORC4_ENST00000535534.1_Silent_p.P643P	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	908						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						CTCCAAGTGAGGGAGGACAGA	0.522																																					p.P908H													.	MORC4	155		0			c.C2723A												142.0	103.0	116.0					X																	106184800		2203	4300	6503	SO:0001583	missense	79710	exon17			AAGTGAGGGAGGA	AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.2723C>A	X.37:g.106184800G>T	ENSP00000347821:p.Pro908His		198	0	0		259	0.02	6	NM_024657	102	0.00	0	A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	ENST00000355610.4	37	CCDS14525.2	.	.	.	.	.	.	.	.	.	.	g	16.60	3.167607	0.57476	.	.	ENSG00000133131	ENST00000355610	T	0.60171	0.21	5.07	5.07	0.68467	.	0.000000	0.56097	D	0.000024	T	0.72779	0.3503	M	0.68593	2.085	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.76072	-0.3093	10	0.87932	D	0	-7.9096	12.9086	0.58166	0.0:0.0:1.0:0.0	.	908	Q8TE76	MORC4_HUMAN	H	908	ENSP00000347821:P908H	ENSP00000347821:P908H	P	-	2	0	MORC4	106071456	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.392000	0.66272	2.104000	0.64026	0.431000	0.28591	CCT			0.522	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000057816.3		NM_024657	
TENM1	10178	broad.mit.edu;mdanderson.org	37	X	123556153	123556153	+	Silent	SNP	G	G	A			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:123556153G>A	ENST00000371130.3	-	23	4482	c.4419C>T	c.(4417-4419)tgC>tgT	p.C1473C	TENM1_ENST00000422452.2_Silent_p.C1480C|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1473					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GATCAATTTTGCAGTCACAGT	0.448																																					p.C1480C													.	.			0			c.C4440T												137.0	102.0	114.0					X																	123556153		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon24			AATTTTGCAGTCA	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4419C>T	X.37:g.123556153G>A			73	0	0		102	0.10	10	NM_001163278	3	0.00	0	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																					0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058985.1		NM_014253	
UBE2NL	389898	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	142967560	142967560	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:142967560G>T	ENST00000370494.1	+	1	388	c.358G>T	c.(358-360)Gat>Tat	p.D120Y		NM_001012989.1	NP_001013007.1	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like (gene/pseudogene)	120						extracellular vesicular exosome (GO:0070062)	acid-amino acid ligase activity (GO:0016881)			breast(1)|endometrium(1)|large_intestine(8)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(192;6.56e-05)					CAATCCAGATGATCCATTAGC	0.443																																					p.D120Y													.	UBE2NL	46		0			c.G358T												141.0	118.0	126.0					X																	142967560		2203	4300	6503	SO:0001583	missense	389898	exon1			CCAGATGATCCAT			Xq27.3	2014-06-11	2014-06-11		ENSG00000102069			"""Ubiquitin-conjugating enzymes E2"""	31710	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2N-like"""			20736409	Standard	NM_001012989		Approved		uc004fca.3	Q5JXB2	OTTHUMG00000022586	ENST00000370494.1:c.358G>T	X.37:g.142967560G>T	ENSP00000359525:p.Asp120Tyr		153	0.0065359477	1		177	0.45	79	NM_001012989	0		0	E9KL27	Missense_Mutation	SNP	ENST00000370494.1	37	CCDS35420.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751887	0.31046	.	.	ENSG00000102069	ENST00000370494	T	0.74947	-0.89	1.16	1.16	0.20824	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.32328	U	0.006258	D	0.90041	0.6890	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.89165	0.3533	10	0.87932	D	0	-2.5165	7.9726	0.30136	0.0:0.0:1.0:0.0	.	120	Q5JXB2	UE2NL_HUMAN	Y	120	ENSP00000359525:D120Y	ENSP00000359525:D120Y	D	+	1	0	UBE2NL	142795226	1.000000	0.71417	0.999000	0.59377	0.239000	0.25481	6.239000	0.72356	0.899000	0.36444	0.181000	0.17075	GAT			0.443	UBE2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058624.1		NM_001012989	
F8	2157	broad.mit.edu	37	X	154157224	154157224	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:154157224T>C	ENST00000360256.4	-	14	5041	c.4841A>G	c.(4840-4842)aAg>aGg	p.K1614R		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1614	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AATGGTATCCTTTTTCTTAAA	0.408																																					p.K1614R													.	F8	646		0			c.A4841G	GRCh37	CD057235	F8	D								186.0	182.0	184.0					X																	154157224		2203	4300	6503	SO:0001583	missense	2157	exon14			GTATCCTTTTTCT	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4841A>G	X.37:g.154157224T>C	ENSP00000353393:p.Lys1614Arg		106	0	0		164	0.02	4	NM_000132	0		0	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	t	0.840	-0.742238	0.03088	.	.	ENSG00000185010	ENST00000360256	D	0.99158	-5.5	4.85	-1.2	0.09554	.	0.706837	0.13262	N	0.401248	D	0.96377	0.8818	M	0.67953	2.075	0.09310	N	1	P	0.34462	0.454	B	0.27380	0.079	D	0.91805	0.5455	10	0.22706	T	0.39	-0.7754	4.4148	0.11450	0.3213:0.0:0.3678:0.3109	.	1614	P00451	FA8_HUMAN	R	1614	ENSP00000353393:K1614R	ENSP00000353393:K1614R	K	-	2	0	F8	153810418	0.012000	0.17670	0.000000	0.03702	0.020000	0.10135	0.665000	0.25083	-0.125000	0.11703	0.438000	0.28831	AAG			0.408	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058869.4			
IL9R	3581	broad.mit.edu	37	X	155234957	155234957	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAH3-01A-11D-A42Y-10	TCGA-2G-AAH3-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	914e1323-9f05-4117-9895-86f2ecd7a395	280dee5e-025a-4514-a742-494dcf4aca01	g.chrX:155234957G>T	ENST00000244174.5	+	6	773	c.594G>T	c.(592-594)agG>agT	p.R198S	IL9R_ENST00000540897.1_Missense_Mutation_p.R223S|IL9R_ENST00000369423.2_Missense_Mutation_p.R233S|IL9R_ENST00000424344.3_Missense_Mutation_p.R177S	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	198	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCCAGCACAGGGATCACATTG	0.577																																					p.R233S													.	IL9R	73		0			c.G699T												79.0	74.0	76.0					X																	155234957		2203	4296	6499	SO:0001583	missense	3581	exon7			GCACAGGGATCAC	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.594G>T	X.37:g.155234957G>T	ENSP00000244174:p.Arg198Ser		246	0	0		186	0.03	5	NM_176786	0		0	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Missense_Mutation	SNP	ENST00000244174.5	37	CCDS14771.4	.	.	.	.	.	.	.	.	.	.	.	8.716	0.913097	0.17907	.	.	ENSG00000124334	ENST00000244174;ENST00000424344;ENST00000455739;ENST00000369423;ENST00000540897	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	1.29	1.29	0.21616	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.498852	0.18910	N	0.127785	T	0.48660	0.1512	.	.	.	0.09310	N	1	B;B;B	0.28933	0.228;0.228;0.091	B;B;B	0.27796	0.083;0.083;0.007	T	0.37753	-0.9692	9	0.44086	T	0.13	-25.8923	5.5447	0.17057	0.0:0.0:1.0:0.0	.	177;198;233	F5H3Z0;Q01113;B9ZVT0	.;IL9R_HUMAN;.	S	198;177;177;233;223	ENSP00000244174:R198S;ENSP00000388918:R177S;ENSP00000358431:R233S;ENSP00000438112:R223S	ENSP00000244174:R198S	R	+	3	2	IL9R	154888151	0.037000	0.19845	0.139000	0.22197	0.227000	0.25037	0.833000	0.27504	0.932000	0.37266	0.287000	0.19450	AGG			0.577	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058981.1		NM_002186	
