#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R3	83756	mdanderson.org	37	1	1267771	1267771	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr1:1267771G>T	ENST00000339381.5	+	3	892	c.860G>T	c.(859-861)aGc>aTc	p.S287I		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	287					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		TTCAACTACAGCATCAGCAGC	0.672																																					p.S287I													.	.			0			c.G860T												25.0	21.0	22.0					1																	1267771		2188	4286	6474	SO:0001583	missense	83756	exon3			ACTACAGCATCAG	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.860G>T	1.37:g.1267771G>T	ENSP00000344411:p.Ser287Ile		46	0	0		48	0.06	3	NM_152228	0		0	Q5TA49|Q8NGW9	Missense_Mutation	SNP	ENST00000339381.5	37	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	G	6.294	0.422290	0.11928	.	.	ENSG00000169962	ENST00000339381	D	0.81659	-1.52	4.6	4.6	0.57074	Extracellular ligand-binding receptor (1);	0.189436	0.47093	D	0.000260	T	0.68081	0.2962	L	0.35793	1.09	0.34962	D	0.752329	B	0.17852	0.024	B	0.19666	0.026	T	0.63642	-0.6591	10	0.06757	T	0.87	.	11.1425	0.48411	0.0847:0.0:0.9153:0.0	.	287	Q7RTX0	TS1R3_HUMAN	I	287	ENSP00000344411:S287I	ENSP00000344411:S287I	S	+	2	0	TAS1R3	1257634	0.870000	0.30015	0.834000	0.33040	0.032000	0.12392	2.687000	0.46976	2.402000	0.81655	0.561000	0.74099	AGC			0.672	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008493.1			
Unknown	0	bcgsc.ca	37	1	79215807	79215807	+	IGR	SNP	C	C	G			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr1:79215807C>G								AC104837.1 (62962 upstream) : ELTD1 (139641 downstream)																							TCCGGCATGACAGGCGAAAAG	0.478																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GCATGACAGGCGA																													1.37:g.79215807C>G			50	0	0		83	0.06	5	.	0		0		RNA	SNP		37																																																																																					0	0.478										
NOTCH2	4853	broad.mit.edu	37	1	120458445	120458445	+	Silent	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr1:120458445G>T	ENST00000256646.2	-	34	7119	c.6900C>A	c.(6898-6900)ccC>ccA	p.P2300P		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2300					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGGGGGGCAAGGGCTCCCGAG	0.622			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.P2300P				Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348		0			c.C6900A												55.0	59.0	57.0					1																	120458445		2203	4299	6502	SO:0001819	synonymous_variant	4853	exon34	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGGCAAGGGCTCC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6900C>A	1.37:g.120458445G>T			36	0	0		75	0.04	3	NM_024408	54	0.00	0	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																					0.622	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033679.1		NM_024408	
CCDC3	83643	mdanderson.org	37	10	13043391	13043391	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr10:13043391G>T	ENST00000378825.3	-	1	306	c.180C>A	c.(178-180)aaC>aaA	p.N60K	CCDC3_ENST00000378839.1_Intron	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	60						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			AGGGCAGGTGGTTGTAGAGGC	0.716																																					p.N60K													.	.			0			c.C180A												7.0	9.0	8.0					10																	13043391		2143	4242	6385	SO:0001583	missense	83643	exon1			CAGGTGGTTGTAG	BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.180C>A	10.37:g.13043391G>T	ENSP00000368102:p.Asn60Lys		42	0	0		48	0.06	3	NM_031455	10	0.00	0	Q5VYV8|Q5VYV9	Missense_Mutation	SNP	ENST00000378825.3	37	CCDS7093.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276323	0.80580	.	.	ENSG00000151468	ENST00000378825	.	.	.	4.55	3.65	0.41850	.	0.000000	0.85682	D	0.000000	T	0.71771	0.3379	M	0.74258	2.255	0.45150	D	0.998161	D	0.71674	0.998	D	0.80764	0.994	T	0.72571	-0.4253	9	0.72032	D	0.01	-8.3613	8.7305	0.34496	0.1882:0.0:0.8118:0.0	.	60	Q9BQI4	CCDC3_HUMAN	K	60	.	ENSP00000368102:N60K	N	-	3	2	CCDC3	13083397	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.857000	0.69525	0.895000	0.36342	0.561000	0.74099	AAC			0.716	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046829.1		NM_031455	
PDE3B	5140	mdanderson.org	37	11	14666437	14666437	+	Silent	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:14666437G>T	ENST00000282096.4	+	1	1169	c.816G>T	c.(814-816)gcG>gcT	p.A272A	PDE3B_ENST00000534317.1_3'UTR|PSMA1_ENST00000418988.2_5'Flank|PDE3B_ENST00000455098.2_Silent_p.A272A	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	272					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	TCAGGGAAGCGCCTCTTCATC	0.642																																					p.A272A													.	.			0			c.G816T												39.0	44.0	42.0					11																	14666437		2200	4294	6494	SO:0001819	synonymous_variant	5140	exon1			GGAAGCGCCTCTT	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.816G>T	11.37:g.14666437G>T			84	0	0		44	0.07	3	NM_000922	18	0.06	1	B7ZM37|O00639|Q14408|Q6SEI4	Silent	SNP	ENST00000282096.4	37	CCDS7817.1																																																																																					0.642	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000386974.1		NM_000922	
MYBPC3	4607	mdanderson.org	37	11	47372906	47372906	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:47372906G>A	ENST00000545968.1	-	2	230	c.176C>T	c.(175-177)aCa>aTa	p.T59I	MYBPC3_ENST00000399249.2_Missense_Mutation_p.T59I|MYBPC3_ENST00000256993.4_Missense_Mutation_p.T59I	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	59			T -> A (in CMH4). {ECO:0000269|PubMed:11815426}.		cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		TGTGCCCTCTGTGGCCAGGCC	0.642																																					p.T59I													.	.			0			c.C176T												40.0	44.0	43.0					11																	47372906		2196	4287	6483	SO:0001583	missense	4607	exon2			CCCTCTGTGGCCA	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.176C>T	11.37:g.47372906G>A	ENSP00000442795:p.Thr59Ile		69	0	0		52	0.06	3	NM_000256	0		0	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	ENST00000545968.1	37	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632764	0.29068	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.67171	-0.25;-0.25;-0.25	4.27	4.27	0.50696	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.52108	0.1714	N	0.12182	0.205	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.49476	-0.8936	9	0.52906	T	0.07	.	16.8841	0.86071	0.0:0.0:1.0:0.0	.	59	Q14896	MYPC3_HUMAN	I	59	ENSP00000442795:T59I;ENSP00000382193:T59I;ENSP00000256993:T59I	ENSP00000256993:T59I	T	-	2	0	MYBPC3	47329482	0.945000	0.32115	0.151000	0.22473	0.007000	0.05969	5.273000	0.65564	2.218000	0.71995	0.467000	0.42956	ACA			0.642	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000392271.3			
LOC440040	440040	broad.mit.edu	37	11	49831251	49831258	+	RNA	DEL	TTATTTAT	TTATTTAT	-	rs147463847|rs557033105|rs142908563|rs3974372		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	TTATTTAT	TTATTTAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:49831251_49831258delTTATTTAT	ENST00000527477.1	+	0	1518																											TCTTTCTTTCttatttatttatttattt	0.279																																					.													.	.			0			.																																											0	.			TCTTTCTTATTTA																													11.37:g.49831259_49831266delTTATTTAT			9	0	0		15	0.33	5	.	0		0		RNA	DEL	ENST00000527477.1	37																																																																																						0.279	RP11-707M1.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000391378.2			
LRP5	4041	broad.mit.edu	37	11	68207377	68207377	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:68207377A>C	ENST00000294304.7	+	21	4587	c.4481A>C	c.(4480-4482)tAc>tCc	p.Y1494S		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1494					adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCCACGCTGTACCCGCCGGTG	0.751																																					p.Y1494S													.	LRP5	136		0			c.A4481C												4.0	6.0	5.0					11																	68207377		2076	4081	6157	SO:0001583	missense	4041	exon21			CGCTGTACCCGCC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4481A>C	11.37:g.68207377A>C	ENSP00000294304:p.Tyr1494Ser		30	0.4666666667	14		11	0.45	5	NM_002335	26	0.04	1	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	37	CCDS8181.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.04|15.04	2.714453|2.714453	0.48622|0.48622	.|.	.|.	ENSG00000162337|ENSG00000162337	ENST00000529702|ENST00000294304	.|D	.|0.95482	.|-3.72	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	.|0.000000	.|0.44902	.|U	.|0.000407	D|D	0.94518|0.94518	0.8235|0.8235	M|M	0.73962|0.73962	2.25|2.25	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B	.|0.12630	.|0.006;0.006	.|B;B	.|0.13407	.|0.009;0.009	D|D	0.92927|0.92927	0.6360|0.6360	5|10	.|0.59425	.|D	.|0.04	.|.	14.4923|14.4923	0.67660|0.67660	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1494;1494	.|Q9UES7;O75197	.|.;LRP5_HUMAN	P|S	13|1494	.|ENSP00000294304:Y1494S	.|ENSP00000294304:Y1494S	T|Y	+|+	1|2	0|0	LRP5|LRP5	67963953|67963953	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.850000|0.850000	0.48378|0.48378	2.823000|2.823000	0.48081|0.48081	2.032000|2.032000	0.59987|0.59987	0.454000|0.454000	0.30748|0.30748	ACC|TAC			0.751	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395088.1		NM_002335	
SHANK2	22941	ucsc.edu	37	11	70653168	70653168	+	Silent	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:70653168G>T	ENST00000423696.2	-	3	501	c.465C>A	c.(463-465)gtC>gtA	p.V155V	SHANK2_ENST00000468619.1_5'UTR|SHANK2_ENST00000338508.4_Silent_p.V535V			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	155	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GGTATGGCTTGACAGCGACGA	0.622																																					.													.	SHANK2	340		0			.												52.0	70.0	64.0					11																	70653168		692	1591	2283	SO:0001819	synonymous_variant	22941	.			TGGCTTGACAGCG	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.465C>A	11.37:g.70653168G>T			120	0.05	6		66	0.17	11	.	0		0	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Nonsense_Mutation	SNP	ENST00000423696.2	37																																																																																						0.622	SHANK2-203	KNOWN	basic	protein_coding	protein_coding				NM_012309	
TENM4	26011	mdanderson.org	37	11	78565254	78565254	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:78565254G>T	ENST00000278550.7	-	12	2038	c.1576C>A	c.(1576-1578)Cat>Aat	p.H526N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	526					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CCTGTCTCATGGCTGGAGGGG	0.572																																					p.H526N													.	.			0			c.C1576A												29.0	32.0	31.0					11																	78565254		692	1591	2283	SO:0001583	missense	26011	exon12			TCTCATGGCTGGA	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.1576C>A	11.37:g.78565254G>T	ENSP00000278550:p.His526Asn		37	0	0		19	0.11	2	NM_001098816	8	0.00	0	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340519	0.60963	.	.	ENSG00000149256	ENST00000278550	T	0.21361	2.01	5.07	5.07	0.68467	.	0.052456	0.85682	D	0.000000	T	0.32793	0.0841	N	0.25201	0.72	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.03728	-1.1009	9	.	.	.	.	18.6486	0.91421	0.0:0.0:1.0:0.0	.	526	Q6N022	TEN4_HUMAN	N	526	ENSP00000278550:H526N	.	H	-	1	0	ODZ4	78242902	1.000000	0.71417	0.994000	0.49952	0.913000	0.54294	9.411000	0.97342	2.631000	0.89168	0.561000	0.74099	CAT			0.572	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391406.2			
GRM5	2915	mdanderson.org	37	11	88300321	88300321	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr11:88300321G>T	ENST00000305447.4	-	7	2679	c.2530C>A	c.(2530-2532)Cgc>Agc	p.R844S	GRM5_ENST00000418177.2_Missense_Mutation_p.R844S|GRM5_ENST00000455756.2_Missense_Mutation_p.R844S|GRM5_ENST00000305432.5_Missense_Mutation_p.R844S|GRM5_ENST00000393297.1_Missense_Mutation_p.R844S	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	844					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.R844S(2)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ACATGCATGCGCACCACGGTA	0.572																																					p.R844S													GRM5_ENST00000418177,NS,carcinoma,0,2	GRM5_ENST00000418177	0	2	2	Substitution - Missense(2)	lung(2)	c.C2530A												126.0	101.0	110.0					11																	88300321		2201	4299	6500	SO:0001583	missense	2915	exon8			GCATGCGCACCAC	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.2530C>A	11.37:g.88300321G>T	ENSP00000306138:p.Arg844Ser		80	0	0		37	0.08	3	NM_000842	0		0	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124026	0.77436	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.88586	-2.39;-2.36;-2.36;-2.39;-2.4	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.93930	0.8057	M	0.65975	2.015	0.54753	D	0.999984	D;D	0.71674	0.998;0.997	D;P	0.80764	0.994;0.866	D	0.92802	0.6257	9	.	.	.	.	19.8631	0.96790	0.0:0.0:1.0:0.0	.	844;844	P41594-2;P41594	.;GRM5_HUMAN	S	844	ENSP00000402912:R844S;ENSP00000405690:R844S;ENSP00000305905:R844S;ENSP00000306138:R844S;ENSP00000376975:R844S	.	R	-	1	0	GRM5	87939969	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.973000	0.88032	2.709000	0.92574	0.655000	0.94253	CGC			0.572	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000259226.1		NM_000842	
FAM60A	58516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	31440707	31440707	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr12:31440707G>A	ENST00000337682.4	-	5	735	c.367C>T	c.(367-369)Cac>Tac	p.H123Y	FAM60A_ENST00000539409.1_5'UTR|FAM60A_ENST00000395766.1_5'UTR|FAM60A_ENST00000454658.2_Missense_Mutation_p.H123Y|FAM60A_ENST00000542983.1_5'UTR	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	123					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					GTGGTACTGTGAGCATCAGAA	0.393																																					p.H123Y													.	.			0			c.C367T												69.0	65.0	66.0					12																	31440707		2203	4300	6503	SO:0001583	missense	58516	exon6			TACTGTGAGCATC	AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.367C>T	12.37:g.31440707G>A	ENSP00000337477:p.His123Tyr		47	0	0		101	0.14	14	NM_021238	670	0.17	114	D3DUV8|Q9BSZ8	Missense_Mutation	SNP	ENST00000337682.4	37	CCDS8723.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813128	0.50527	.	.	ENSG00000139146	ENST00000337682;ENST00000454658;ENST00000398170;ENST00000539004;ENST00000543615	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.83	4.83	0.62350	.	0.090945	0.85682	D	0.000000	T	0.32436	0.0829	L	0.27053	0.805	0.80722	D	1	B;B	0.14012	0.0;0.009	B;B	0.11329	0.001;0.006	T	0.07966	-1.0745	10	0.19590	T	0.45	-1.3194	18.2825	0.90103	0.0:0.0:1.0:0.0	.	123;164	Q9NP50;B7Z287	FA60A_HUMAN;.	Y	123;123;164;123;123	ENSP00000337477:H123Y;ENSP00000393279:H123Y;ENSP00000443881:H123Y;ENSP00000437363:H123Y	ENSP00000337477:H123Y	H	-	1	0	FAM60A	31331974	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.446000	0.80609	2.405000	0.81733	0.491000	0.48974	CAC			0.393	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400347.1		NM_021238	
ATF7	11016	mdanderson.org	37	12	53918523	53918523	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr12:53918523G>T	ENST00000548446.2	-	10	1095	c.983C>A	c.(982-984)cCt>cAt	p.P328H	ATF7_ENST00000328463.7_Missense_Mutation_p.P328H|RP11-793H13.10_ENST00000591834.1_Missense_Mutation_p.P317H|ATF7_ENST00000415113.1_Missense_Mutation_p.P296H|ATF7_ENST00000420353.2_Missense_Mutation_p.P317H|ATF7_ENST00000456903.4_Missense_Mutation_p.P317H|ATF7_ENST00000546661.1_5'UTR			P17544	ATF7_HUMAN	activating transcription factor 7	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	CCCAGTACTAGGGGTGGGCTG	0.587																																					p.P317H													.	.			0			c.C950A												13.0	15.0	14.0					12																	53918523		1928	4141	6069	SO:0001583	missense	11016	exon10			GTACTAGGGGTGG	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.983C>A	12.37:g.53918523G>T	ENSP00000449938:p.Pro328His		27	0	0		22	0.09	2	NM_006856	25	0.00	0	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		.	.	.	.	.	.	.	.	.	.	G	21.3	4.135561	0.77662	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.53423	0.62;0.62;0.67;0.64;0.64	5.32	5.32	0.75619	.	0.107070	0.64402	D	0.000003	T	0.65739	0.2720	L	0.54323	1.7	0.44129	D	0.996915	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.99;0.981	T	0.64457	-0.6403	10	0.56958	D	0.05	-16.0389	18.3142	0.90213	0.0:0.0:1.0:0.0	.	296;317;328	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	H	328;328;141;296;317;317	ENSP00000449938:P328H;ENSP00000329212:P328H;ENSP00000404880:P296H;ENSP00000399465:P317H;ENSP00000387406:P317H	ENSP00000304187:P141H	P	-	2	0	ATF7	52204790	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.502000	0.73695	2.941000	0.99782	0.655000	0.94253	CCT			0.587	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000406302.2		NM_001130059	
CCDC64	92558	mdanderson.org	37	12	120518734	120518734	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr12:120518734G>T	ENST00000397558.2	+	7	1352	c.1352G>T	c.(1351-1353)aGa>aTa	p.R451I	CCDC64_ENST00000257583.4_Missense_Mutation_p.R148I|CCDC64_ENST00000446727.2_Missense_Mutation_p.R122I	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	451					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAAGAGGAGAGAGACCGACTC	0.527																																					p.R451I													.	.			0			c.G1352T												73.0	79.0	77.0					12																	120518734		2051	4193	6244	SO:0001583	missense	92558	exon7			AGGAGAGAGACCG	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1352G>T	12.37:g.120518734G>T	ENSP00000380690:p.Arg451Ile		30	0	0		45	0.09	4	NM_207311	29	0.00	0	A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449920	0.84101	.	.	ENSG00000135127	ENST00000397558;ENST00000446727;ENST00000548673;ENST00000257583	T;T;T	0.04862	3.54;3.58;3.56	5.32	4.42	0.53409	.	1.114610	0.06460	N	0.729305	T	0.21841	0.0526	L	0.58810	1.83	0.51233	D	0.999915	D;D;D	0.71674	0.998;0.998;0.985	P;P;P	0.62014	0.897;0.862;0.748	T	0.00250	-1.1878	10	0.62326	D	0.03	-4.3734	13.3627	0.60665	0.0756:0.0:0.9244:0.0	.	148;122;451	B4DWL0;B4DNE7;Q6ZP65	.;.;BICR1_HUMAN	I	451;122;169;148	ENSP00000380690:R451I;ENSP00000399658:R122I;ENSP00000447477:R169I	ENSP00000257583:R148I	R	+	2	0	CCDC64	119003117	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.996000	0.63914	2.492000	0.84095	0.561000	0.74099	AGA			0.527	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000403390.2		NM_207311	
RPLP0	6175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120637138	120637138	+	Silent	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr12:120637138G>A	ENST00000551150.1	-	2	520	c.205C>T	c.(205-207)Ctg>Ttg	p.L69L	RPLP0_ENST00000552292.1_5'Flank|PXN-AS1_ENST00000542265.1_RNA|RPLP0_ENST00000550296.1_5'UTR|PXN-AS1_ENST00000539446.1_RNA|RPLP0_ENST00000392514.4_Silent_p.L69L|PXN-AS1_ENST00000542314.1_RNA|PXN-AS1_ENST00000535200.1_RNA|RPLP0_ENST00000313104.5_Silent_p.L69L|PXN-AS1_ENST00000538804.1_RNA|RPLP0_ENST00000546989.1_Silent_p.L69L|RPLP0_ENST00000228306.4_Silent_p.L69L			P05388	RLA0_HUMAN	ribosomal protein, large, P0	69					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTGTTTTCCAGGTGCCCTCGG	0.582																																					p.L69L													.	.			0			c.C205T												115.0	115.0	115.0					12																	120637138		2203	4300	6503	SO:0001819	synonymous_variant	6175	exon3			TTTCCAGGTGCCC	AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.205C>T	12.37:g.120637138G>A			86	0	0		101	0.20	20	NM_053275	42352	0.29	12145	Q3B7A4|Q9BVK4	Silent	SNP	ENST00000551150.1	37	CCDS9193.1																																																																																					0.582	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403448.3		NM_053275	
SACS	26278	broad.mit.edu	37	13	23907043	23907043	+	Missense_Mutation	SNP	G	G	A	rs115155117	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:23907043G>A	ENST00000382292.3	-	9	11245	c.10972C>T	c.(10972-10974)Cgg>Tgg	p.R3658W	SACS_ENST00000382298.3_Missense_Mutation_p.R3658W|SACS_ENST00000402364.1_Missense_Mutation_p.R2908W			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3658					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GCGGGGGCCCGCTCAGGACAT	0.363													G|||	4	0.000798722	0.003	0.0	5008	,	,		18665	0.0		0.0	False		,,,				2504	0.0				p.R3658W													.	SACS	871		0			c.C10972T							G	TRP/ARG	8,4398	12.9+/-30.5	0,8,2195	43.0	50.0	47.0		10972	2.2	1.0	13	dbSNP_132	47	2,8594	2.2+/-6.3	0,2,4296	yes	missense	SACS	NM_014363.4	101	0,10,6491	AA,AG,GG		0.0233,0.1816,0.0769	probably-damaging	3658/4580	23907043	10,12992	2203	4298	6501	SO:0001583	missense	26278	exon10			GGGCCCGCTCAGG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10972C>T	13.37:g.23907043G>A	ENSP00000371729:p.Arg3658Trp		56	0	0		68	0.04	3	NM_014363	19	0.00	0	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	15.06	2.722613	0.48728	0.001816	2.33E-4	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87966	-2.17;-2.32;-2.17	6.04	2.21	0.28008	.	0.000000	0.85682	D	0.000000	D	0.89417	0.6709	L	0.29908	0.895	0.38654	D	0.951902	D	0.89917	1.0	D	0.87578	0.998	D	0.89770	0.3953	10	0.66056	D	0.02	.	17.1259	0.86714	0.0:0.0:0.3389:0.6611	.	3658	Q9NZJ4	SACS_HUMAN	W	3658;2908;3658	ENSP00000371729:R3658W;ENSP00000385844:R2908W;ENSP00000371735:R3658W	ENSP00000371729:R3658W	R	-	1	2	SACS	22805043	0.998000	0.40836	0.991000	0.47740	0.869000	0.49853	0.797000	0.26999	0.094000	0.17404	-0.309000	0.09137	CGG			0.363	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044148.3		NM_014363	
RP11-556N21.1	0	bcgsc.ca	37	13	25144704	25144704	+	RNA	SNP	T	T	C	rs71218558|rs9551120	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:25144704T>C	ENST00000453498.1	+	0	245																											TACATAGATGTGTTTAACACA	0.388													t|||	2419	0.483027	0.4924	0.4856	5008	,	,		16250	0.4276		0.3996	False		,,,				2504	0.6115				.													.	.			0			.																																											374491	.			TAGATGTGTTTAA																													13.37:g.25144704T>C			58	0.1034482759	6		42	0.60	25	.	0		0		RNA	SNP	ENST00000453498.1	37																																																																																						0.388	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000044193.1			
RP11-556N21.1	0	bcgsc.ca	37	13	25144710	25144710	+	RNA	SNP	A	A	G	rs71218558|rs3742170	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:25144710A>G	ENST00000453498.1	+	0	251																											GATGTGTTTAACACAGCCCCT	0.398													a|||	2400	0.479233	0.4871	0.4798	5008	,	,		15632	0.4246		0.3976	False		,,,				2504	0.6084				.													.	.			0			.																																											374491	.			TGTTTAACACAGC																													13.37:g.25144710A>G			59	0.1186440678	7		44	0.61	27	.	0		0		RNA	SNP	ENST00000453498.1	37																																																																																						0.398	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000044193.1			
RP11-556N21.1	0	bcgsc.ca	37	13	25144712	25144712	+	RNA	SNP	A	A	C	rs71218558|rs3742169	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:25144712A>C	ENST00000453498.1	+	0	253																											TGTGTTTAACACAGCCCCTGC	0.393													c|||	2404	0.480032	0.4879	0.4798	5008	,	,		15600	0.4266		0.3976	False		,,,				2504	0.6094				.													.	.			0			.																																											374491	.			TTTAACACAGCCC																													13.37:g.25144712A>C			63	0.126984127	8		48	0.60	29	.	0		0		RNA	SNP	ENST00000453498.1	37																																																																																						0.393	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000044193.1			
SLC25A15	10166	mdanderson.org	37	13	41373332	41373332	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:41373332G>T	ENST00000338625.4	+	3	431	c.195G>T	c.(193-195)aaG>aaT	p.K65N	SLC25A15_ENST00000478827.1_3'UTR	NM_014252.3	NP_055067.1	Q9Y619	ORNT1_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15	65					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|L-ornithine transmembrane transport (GO:1903352)|mitochondrial ornithine transport (GO:0000066)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	L-ornithine transmembrane transporter activity (GO:0000064)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|stomach(1)|urinary_tract(1)	14		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.48e-08)|Epithelial(112;7.51e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000191)|GBM - Glioblastoma multiforme(144;0.00231)|BRCA - Breast invasive adenocarcinoma(63;0.0704)	L-Ornithine(DB00129)	GCTTCTACAAGGGTACCAGTC	0.562																																					p.K65N													.	.			0			c.G195T												146.0	132.0	137.0					13																	41373332		2203	4300	6503	SO:0001583	missense	10166	exon3			CTACAAGGGTACC	AF112968	CCDS9373.1	13q14	2013-05-22			ENSG00000102743	ENSG00000102743		"""Solute carriers"""	10985	protein-coding gene	gene with protein product	"""ornithine transporter 1"""	603861		ORNT1, HHH		10369256	Standard	NM_014252		Approved	ORC1, D13S327	uc001uxn.3	Q9Y619	OTTHUMG00000016776	ENST00000338625.4:c.195G>T	13.37:g.41373332G>T	ENSP00000342267:p.Lys65Asn		172	0	0		142	0.04	5	NM_014252	34	0.00	0	Q5VZD8|Q9HC45	Missense_Mutation	SNP	ENST00000338625.4	37	CCDS9373.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396172	0.42512	.	.	ENSG00000102743	ENST00000338625;ENST00000379523;ENST00000417731	D;D	0.81821	-1.54;-1.54	4.67	2.94	0.34122	Mitochondrial carrier domain (2);	0.156761	0.56097	D	0.000023	D	0.87466	0.6184	M	0.91663	3.23	0.42614	D	0.993322	P	0.46064	0.872	P	0.51742	0.678	D	0.87396	0.2366	10	0.72032	D	0.01	.	10.1411	0.42736	0.1635:0.0:0.8365:0.0	.	65	Q9Y619	ORNT1_HUMAN	N	65	ENSP00000342267:K65N;ENSP00000415826:K65N	ENSP00000342267:K65N	K	+	3	2	SLC25A15	40271332	1.000000	0.71417	0.995000	0.50966	0.538000	0.34931	1.833000	0.39161	0.399000	0.25367	-0.122000	0.15005	AAG			0.562	SLC25A15-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276149.2		NM_014252	
ZC3H13	23091	mdanderson.org	37	13	46562935	46562935	+	Missense_Mutation	SNP	A	A	T	rs386770641|rs1134071	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:46562935A>T	ENST00000242848.4	-	9	1590	c.1242T>A	c.(1240-1242)caT>caA	p.H414Q	ZC3H13_ENST00000282007.3_Missense_Mutation_p.H414Q			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	414	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CCCTCCTTTCATGGCGTCGAT	0.418																																					p.H414Q	Esophageal Squamous(187;747 2077 11056 31291 44172)												.	.			0			c.T1242A												131.0	112.0	119.0					13																	46562935		2203	4300	6503	SO:0001583	missense	23091	exon9			CCTTTCATGGCGT	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1242T>A	13.37:g.46562935A>T	ENSP00000242848:p.His414Gln		85	0	0		62	0.03	2	NM_015070	82	0.00	0	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	37		.	.	.	.	.	.	.	.	.	.	A	11.71	1.719998	0.30503	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.32023	2.48;1.47	5.81	1.84	0.25277	.	0.000000	0.64402	D	0.000004	T	0.32071	0.0817	N	0.24115	0.695	0.09310	P	1.0	D;D	0.76494	0.998;0.999	P;D	0.66351	0.878;0.943	T	0.31971	-0.9924	9	0.16420	T	0.52	.	9.8682	0.41157	0.6557:0.0:0.3443:0.0	.	414;414	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	Q	414;414;230	ENSP00000242848:H414Q;ENSP00000282007:H414Q	ENSP00000242848:H414Q	H	-	3	2	ZC3H13	45460936	0.997000	0.39634	1.000000	0.80357	0.988000	0.76386	0.453000	0.21811	0.419000	0.25927	0.533000	0.62120	CAT			0.418	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000044789.1		NM_015070	
TRIM13	10206	hgsc.bcm.edu	37	13	50588497	50588500	+	3'UTR	DEL	ACAC	ACAC	-	rs183818674|rs35381218|rs377384125		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	ACAC	ACAC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr13:50588497_50588500delACAC	ENST00000378182.3	+	0	3159_3162				KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		atatatatatacacacacacacac	0.304																																					.													.	TRIM13	30		0			.																																									SO:0001624	3_prime_UTR_variant	10206	.			ATATATACACACA	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1200ACAC>-	13.37:g.50588505_50588508delACAC			23	0	0		27	0.59	16	.	1	0.00	0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	DEL	ENST00000378182.3	37	CCDS9423.1																																																																																					0.304	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354875.1		NM_001007278	
ATP5S	27109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	50789405	50789405	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr14:50789405C>T	ENST00000311459.7	+	3	709	c.329C>T	c.(328-330)tCt>tTt	p.S110F	ATP5S_ENST00000554438.1_3'UTR|ATP5S_ENST00000245448.6_Missense_Mutation_p.S110F|ATP5S_ENST00000426751.2_Missense_Mutation_p.S110F|ATP5S_ENST00000358473.1_Missense_Mutation_p.S82F	NM_001003803.2	NP_001003803.1	Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)	110					ATP biosynthetic process (GO:0006754)|hydrogen ion transmembrane transport (GO:1902600)|proton transport (GO:0015992)	mitochondrial inner membrane (GO:0005743)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	12	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		GCCACCGACTCTTGTATCATG	0.473																																					p.S110F													.	.			0			c.C329T												125.0	107.0	113.0					14																	50789405		2203	4300	6503	SO:0001583	missense	27109	exon3			CCGACTCTTGTAT	U79253	CCDS32075.1, CCDS32076.1, CCDS45102.1	14q21.3	2011-04-13	2010-06-11			ENSG00000125375			18799	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)"""			11744738, 8619474	Standard	NM_015684		Approved	HSU79253, ATPW	uc001wxw.2	Q99766		ENST00000311459.7:c.329C>T	14.37:g.50789405C>T	ENSP00000308334:p.Ser110Phe		122	0	0		132	0.23	30	NM_015684	59	0.37	22	A8K1U3|D9N156|Q8WWX3|Q96F77	Missense_Mutation	SNP	ENST00000311459.7	37	CCDS32075.1	.	.	.	.	.	.	.	.	.	.	C	32	5.109952	0.94292	.	.	ENSG00000125375;ENSG00000125375;ENSG00000125375;ENSG00000125375;ENSG00000258447	ENST00000245448;ENST00000426751;ENST00000311459;ENST00000358473;ENST00000553905	D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.96213	0.8765	M	0.86740	2.835	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;1.0;0.997	D	0.96283	0.9208	10	0.87932	D	0	-21.7681	20.0171	0.97481	0.0:1.0:0.0:0.0	.	82;110;110;110	Q8WXQ4;Q99766-3;Q99766;Q99766-2	.;.;ATP5S_HUMAN;.	F	110;110;110;82;82	ENSP00000245448:S110F;ENSP00000389246:S110F;ENSP00000308334:S110F;ENSP00000351258:S82F	ENSP00000245448:S110F	S	+	2	0	RP11-247L20.2;ATP5S	49859155	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.796000	0.85898	2.723000	0.93209	0.585000	0.79938	TCT			0.473	ATP5S-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000410761.1		NM_015684	
PLEKHG3	26030	mdanderson.org	37	14	65209934	65209934	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr14:65209934C>T	ENST00000394691.1	+	17	3320	c.3173C>T	c.(3172-3174)gCc>gTc	p.A1058V	PLEKHG3_ENST00000484731.2_Missense_Mutation_p.A563V|PLEKHG3_ENST00000492928.1_Intron|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.A591V|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.A1002V			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	1058							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		TCCAAGTATGCCTCCCGCGAT	0.721																																					p.A1002V													.	.			0			c.C3005T												29.0	35.0	33.0					14																	65209934		2200	4295	6495	SO:0001583	missense	26030	exon15			AGTATGCCTCCCG	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.3173C>T	14.37:g.65209934C>T	ENSP00000378183:p.Ala1058Val		36	0	0		27	0.11	3	NM_015549	16	0.00	0	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	37		.	.	.	.	.	.	.	.	.	.	C	16.22	3.060784	0.55432	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	T;T;T;T	0.64085	0.37;-0.08;1.27;1.27	5.56	4.67	0.58626	.	0.309803	0.27991	N	0.017027	T	0.65396	0.2687	L	0.59436	1.845	0.09310	N	1	P;P;P;P	0.46952	0.86;0.86;0.709;0.887	P;P;B;P	0.46585	0.453;0.453;0.185;0.521	T	0.62324	-0.6878	10	0.66056	D	0.02	.	15.4222	0.75022	0.0:0.86:0.1399:0.0	.	591;563;1058;1002	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	V	1002;1058;591;563	ENSP00000247226:A1002V;ENSP00000378183:A1058V;ENSP00000450945:A591V;ENSP00000450973:A563V	ENSP00000247226:A1002V	A	+	2	0	PLEKHG3	64279687	0.362000	0.24980	0.023000	0.16930	0.196000	0.23810	6.028000	0.70889	1.325000	0.45301	0.655000	0.94253	GCC			0.721	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000412028.1		NM_015549	
ISM2	145501	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	77950769	77950769	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr14:77950769G>A	ENST00000342219.4	-	3	580	c.524C>T	c.(523-525)gCc>gTc	p.A175V	ISM2_ENST00000493585.1_Missense_Mutation_p.A175V|ISM2_ENST00000429906.1_Missense_Mutation_p.A94V|ISM2_ENST00000393684.3_Missense_Mutation_p.A87V|ISM2_ENST00000412904.1_Intron	NM_199296.2	NP_954993.1	Q6H9L7	ISM2_HUMAN	isthmin 2	175						extracellular region (GO:0005576)				endometrium(3)|large_intestine(4)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	21						GGGAGGCGTGGCATTCCCTGG	0.597																																					p.A175V													ISM2,colon,carcinoma,+1,1	ISM2	68	1	0			c.C524T												115.0	104.0	108.0					14																	77950769		2203	4300	6503	SO:0001583	missense	145501	exon3			GGCGTGGCATTCC	AK056709	CCDS9864.1, CCDS45143.1	14q24.3	2013-05-15	2013-05-15	2008-12-23	ENSG00000100593	ENSG00000100593			23176	protein-coding gene	gene with protein product	"""thrombospondin and AMOP containing isthmin-like 1"""	612684	"""thrombospondin, type I domain-containing 3"", ""thrombospondin, type I, domain containing 3"", ""isthmin 2 homolog (zebrafish)"""	THSD3		15194193	Standard	NM_199296		Approved	FLJ32147, TAIL1	uc001xtz.3	Q6H9L7	OTTHUMG00000158563	ENST00000342219.4:c.524C>T	14.37:g.77950769G>A	ENSP00000341490:p.Ala175Val		105	0	0		129	0.05	6	NM_199296	9	0.00	0	A8K6D5|O95432|Q495U5|Q68CN3|Q86TQ7|Q86TW3|Q86TW4|Q8N501|Q8NBL0	Missense_Mutation	SNP	ENST00000342219.4	37	CCDS9864.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674889	0.47781	.	.	ENSG00000100593	ENST00000342219;ENST00000429906;ENST00000393684;ENST00000493585;ENST00000554801	T;T;T;T	0.40476	1.86;1.85;2.17;1.03	3.15	0.938	0.19500	.	0.748191	0.11190	N	0.590009	T	0.31040	0.0784	L	0.43152	1.355	0.09310	N	1	P;B	0.42518	0.782;0.421	B;B	0.34779	0.189;0.039	T	0.09207	-1.0685	10	0.33141	T	0.24	-5.0408	11.4644	0.50230	0.0:0.3143:0.6857:0.0	.	175;175	Q6H9L7-2;Q6H9L7	.;ISM2_HUMAN	V	175;94;87;175;94	ENSP00000341490:A175V;ENSP00000395387:A94V;ENSP00000377289:A87V;ENSP00000420452:A175V	ENSP00000341490:A175V	A	-	2	0	ISM2	77020522	0.004000	0.15560	0.001000	0.08648	0.160000	0.22226	0.902000	0.28459	0.429000	0.26202	0.306000	0.20318	GCC			0.597	ISM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000351309.1		NM_182509	
FAM181A	90050	mdanderson.org	37	14	94395420	94395420	+	Silent	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr14:94395420G>T	ENST00000267594.5	+	3	1282	c.975G>T	c.(973-975)ggG>ggT	p.G325G	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557000.2_Silent_p.G263G|FAM181A_ENST00000556222.1_Silent_p.G263G|FAM181A_ENST00000557719.1_Silent_p.G263G	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	325										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						ACGGCCTGGGGCAGAAGGTGT	0.647																																					p.G325G													.	.			0			c.G975T												32.0	36.0	35.0					14																	94395420		2203	4299	6502	SO:0001819	synonymous_variant	90050	exon3			CCTGGGGCAGAAG	BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.975G>T	14.37:g.94395420G>T			33	0	0		35	0.09	3	NM_138344	0		0	B2RD39|Q96GY1	Silent	SNP	ENST00000267594.5	37	CCDS9914.1																																																																																					0.647	FAM181A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000412840.1		NM_138344	
MIR381HG	378881	broad.mit.edu	37	14	101514904	101514905	+	lincRNA	DEL	GT	GT	-			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr14:101514904_101514905delGT	ENST00000553692.1	+	0	28				MIR381_ENST00000362150.1_RNA|MIR655_ENST00000362159.2_RNA|MIR487B_ENST00000385021.1_RNA|MIR539_ENST00000365690.2_RNA|MIR889_ENST00000401280.1_RNA|MIR544A_ENST00000384855.1_RNA	NR_104192.1				MIR381 host gene (non-protein coding)																		CACCTCTGGGgtgtgtgtgtgt	0.47																																					.													.	.			0			.																																											0	.			TCTGGGGTGTGTG	AA861571		14q32.31	2013-07-30	2010-01-22	2010-01-22	ENSG00000258861	ENSG00000258861		"""Long non-coding RNAs"""	20136	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 225"""		"""chromosome 14 open reading frame 89"""	C14orf89			Standard	NR_104192		Approved	NCRNA00225			OTTHUMG00000171633		14.37:g.101514914_101514915delGT			31	0	0		35	0.26	9	.	0		0		RNA	DEL	ENST00000553692.1	37																																																																																						0.470	MIR381HG-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000414538.1			
SHC4	399694	mdanderson.org	37	15	49170510	49170510	+	Intron	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr15:49170510G>A	ENST00000332408.4	-	4	1269				EID1_ENST00000560490.1_Intron|EID1_ENST00000530028.2_Missense_Mutation_p.R46H|SHC4_ENST00000396535.3_5'Flank|EID1_ENST00000558295.1_Intron|SHC4_ENST00000537958.1_5'Flank	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CGTCCCTCCCGCAGCGGGGCC	0.672																																					p.R46H													.	.			0			c.G137A												36.0	40.0	39.0					15																	49170510		2000	4150	6150	SO:0001627	intron_variant	23741	exon1			CCTCCCGCAGCGG	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.840+5934C>T	15.37:g.49170510G>A			52	0	0		39	0.08	3	NM_014335	253	0.00	0	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	8.499	0.863708	0.17250	.	.	ENSG00000255302	ENST00000530028	T	0.34072	1.38	3.59	0.584	0.17422	.	.	.	.	.	T	0.23806	0.0576	L	0.36672	1.1	0.18873	N	0.999982	B	0.06786	0.001	B	0.04013	0.001	T	0.28650	-1.0037	9	0.66056	D	0.02	.	2.2775	0.04106	0.1111:0.1932:0.4967:0.199	.	46	Q9Y6B2	EID1_HUMAN	H	46	ENSP00000431162:R46H	ENSP00000431162:R46H	R	+	2	0	EID1	46957802	0.964000	0.33143	0.005000	0.12908	0.091000	0.18340	0.995000	0.29706	0.136000	0.18733	-0.142000	0.14014	CGC			0.672	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254371.1		NM_203349	
MESP2	145873	hgsc.bcm.edu	37	15	90320132	90320132	+	Missense_Mutation	SNP	C	C	G	rs200021459	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr15:90320132C>G	ENST00000341735.3	+	1	544	c.544C>G	c.(544-546)Caa>Gaa	p.Q182E	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	182	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			ggggcaggggcaagggcaggg	0.786																																					p.Q182E													MESP2,NS,carcinoma,-2,1	MESP2	-2	1	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.C544G												3.0	3.0	3.0					15																	90320132		1229	2996	4225	SO:0001583	missense	145873	exon1			CAGGGGCAAGGGC		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.544C>G	15.37:g.90320132C>G	ENSP00000342392:p.Gln182Glu		15	0	0		32	0.06	2	NM_001039958	0		0	Q7RTU2	Missense_Mutation	SNP	ENST00000341735.3	37	CCDS42078.1	.	.	.	.	.	.	.	.	.	.	C	1.101	-0.661169	0.03454	.	.	ENSG00000188095	ENST00000341735	T	0.81078	-1.45	0.798	-0.239	0.13050	.	.	.	.	.	T	0.57844	0.2081	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.39272	-0.9622	9	0.09338	T	0.73	.	5.309	0.15819	0.0:0.7609:0.0:0.2391	.	182	Q0VG99	MESP2_HUMAN	E	182	ENSP00000342392:Q182E	ENSP00000342392:Q182E	Q	+	1	0	MESP2	88121136	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.199000	0.09491	-0.121000	0.11787	-0.657000	0.03884	CAA			0.786	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416421.1		XM_085261	
MESP2	145873	broad.mit.edu;mdanderson.org	37	15	90320173	90320173	+	Silent	SNP	A	A	G	rs113636330		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr15:90320173A>G	ENST00000341735.3	+	1	585	c.585A>G	c.(583-585)ggA>ggG	p.G195G	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	195	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			aggggcaaggacaggggcaag	0.781																																					p.G195G													.	MESP2	20		0			c.A585G												3.0	5.0	4.0					15																	90320173		1538	3548	5086	SO:0001819	synonymous_variant	145873	exon1			GCAAGGACAGGGG		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.585A>G	15.37:g.90320173A>G			21	0	0		38	0.05	2	NM_001039958	1	0.00	0	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																					0.781	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416421.1		XM_085261	
PRSS41	360226	mdanderson.org	37	16	2849000	2849000	+	RNA	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:2849000C>T	ENST00000399677.1	+	0	171				SNORA3_ENST00000408792.1_RNA			Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										TGGTGGCGGGCGGAGTGGAGT	0.751																																					p.G57G													.	.			0			c.C171T												2.0	5.0	4.0					16																	2849000		545	1345	1890			360226	exon2			GGCGGGCGGAGTG			16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		16.37:g.2849000C>T			13	0	0		16	0.19	3	NM_001135086	1	0.00	0		Silent	SNP	ENST00000399677.1	37																																																																																						0.751	PRSS41-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000436450.1		NM_183379	
NLRC3	197358	broad.mit.edu	37	16	3601981	3601982	+	RNA	INS	-	-	CACC	rs113120190|rs56287077	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:3601981_3601982insCACC	ENST00000301749.7	-	0	2757				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						atcccttcattcatccatccat	0.49														4566	0.911741	0.9667	0.8588	5008	,	,		23246	0.9256		0.8459	False		,,,				2504	0.9284				.													.	NLRC3	103		0			.																																											197358	.			CTTCATTCATCCA	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3601981_3601982insCACC			11	0	0		17	0.47	8	.	0		0	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	RNA	INS	ENST00000301749.7	37																																																																																						0.490	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene				NM_178844	
SEC14L5	9717	mdanderson.org	37	16	5041986	5041986	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:5041986C>T	ENST00000251170.7	+	6	802	c.622C>T	c.(622-624)Ccc>Tcc	p.P208S		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	208						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						GGCCCACGGGCCCCGTAGCAC	0.692																																					p.P208S													.	.			0			c.C622T												13.0	14.0	14.0					16																	5041986		1923	4100	6023	SO:0001583	missense	9717	exon6			CACGGGCCCCGTA	AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.622C>T	16.37:g.5041986C>T	ENSP00000251170:p.Pro208Ser		16	0	0		31	0.10	3	NM_014692	3	0.00	0		Missense_Mutation	SNP	ENST00000251170.7	37	CCDS45403.1	.	.	.	.	.	.	.	.	.	.	C	8.852	0.944834	0.18356	.	.	ENSG00000103184	ENST00000251170	T	0.69561	-0.41	3.11	0.715	0.18186	.	0.430091	0.18569	N	0.137400	T	0.61135	0.2323	L	0.56769	1.78	0.09310	N	1	B	0.31790	0.34	B	0.37047	0.24	T	0.50215	-0.8854	10	0.13853	T	0.58	-20.1169	13.1925	0.59719	0.1887:0.8113:0.0:0.0	.	208	O43304	S14L5_HUMAN	S	208	ENSP00000251170:P208S	ENSP00000251170:P208S	P	+	1	0	SEC14L5	4981987	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.623000	0.24447	0.167000	0.19631	0.555000	0.69702	CCC			0.692	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434379.1			
UBFD1	56061	broad.mit.edu	37	16	23568933	23568933	+	5'UTR	SNP	T	T	G			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:23568933T>G	ENST00000395878.3	+	0	251				EARS2_ENST00000449606.1_5'Flank|EARS2_ENST00000563232.1_5'Flank|UBFD1_ENST00000219638.4_Missense_Mutation_p.V181G|EARS2_ENST00000563459.1_5'Flank|UBFD1_ENST00000567264.1_5'Flank|UBFD1_ENST00000567212.1_5'Flank|EARS2_ENST00000564501.1_5'UTR	NM_019116.2	NP_061989.2	O14562	UBFD1_HUMAN	ubiquitin family domain containing 1								poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7				GBM - Glioblastoma multiforme(48;0.0331)		AGGAGGCGGGTCTCCATAGAA	0.662																																					.	Melanoma(22;290 1069 22358 48158)												.	UBFD1	16		0			.																																									SO:0001623	5_prime_UTR_variant	56061	.			GGCGGGTCTCCAT	AK124139	CCDS10613.2	16p12.1	2008-11-05			ENSG00000103353	ENSG00000103353			30565	protein-coding gene	gene with protein product	"""ubiquitin-binding protein homolog"""					10493829	Standard	XM_006721064		Approved	FLJ42145, FLJ38870, UBPH	uc002dlv.3	O14562	OTTHUMG00000128855	ENST00000395878.3:c.-131T>G	16.37:g.23568933T>G			21	0.3333333333	7		42	0.36	15	.	2	0.00	0	A8MW58|D3DWF2	Missense_Mutation	SNP	ENST00000395878.3	37	CCDS10613.2	.	.	.	.	.	.	.	.	.	.	T	18.93	3.727214	0.69074	.	.	ENSG00000103353	ENST00000219638	.	.	.	4.76	4.76	0.60689	.	0.219942	0.23213	N	0.050643	T	0.57770	0.2076	.	.	.	0.53688	D	0.999972	.	.	.	.	.	.	T	0.53143	-0.8480	6	0.26408	T	0.33	-10.6615	10.8342	0.46677	0.0:0.0:0.0:1.0	.	.	.	.	G	181	.	ENSP00000219638:V181G	V	+	2	0	UBFD1	23476434	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.473000	0.35387	2.127000	0.65507	0.455000	0.32223	GTC			0.662	UBFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250795.2		NM_019116	
ARHGAP17	55114	ucsc.edu	37	16	24965936	24965936	+	Silent	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:24965936G>A	ENST00000289968.6	-	10	909	c.840C>T	c.(838-840)ggC>ggT	p.G280G	ARHGAP17_ENST00000303665.5_Silent_p.G280G|ARHGAP17_ENST00000441763.2_3'UTR|ARHGAP17_ENST00000575975.1_5'Flank	NM_001006634.1	NP_001006635.1	Q68EM7	RHG17_HUMAN	Rho GTPase activating protein 17	280	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|urinary_tract(2)	30				GBM - Glioblastoma multiforme(48;0.0407)		CCTCCTTCATGCCTGTCTCCA	0.597																																					p.G280G													.	ARHGAP17	138		0			c.C840T												117.0	109.0	112.0					16																	24965936		2197	4300	6497	SO:0001819	synonymous_variant	55114	exon10			CTTCATGCCTGTC	AJ306731	CCDS32408.1, CCDS32409.1	16p12.2-p12.1	2011-06-29				ENSG00000140750		"""Rho GTPase activating proteins"""	18239	protein-coding gene	gene with protein product		608293				10967100, 11431473	Standard	XM_005255413		Approved	RICH1, FLJ10308, NADRIN, FLJ13219, WBP15	uc002dnb.3	Q68EM7		ENST00000289968.6:c.840C>T	16.37:g.24965936G>A			43	0	0		41	0.10	4	NM_001006634	68	0.00	0	A8K6M6|Q6ZUS4|Q7Z2F2|Q8NDG2|Q96KS2|Q96KS3|Q96SS8|Q9BVF6|Q9H8U5|Q9NW54	Silent	SNP	ENST00000289968.6	37	CCDS32409.1																																																																																					0.597	ARHGAP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436548.3		NM_018054	
TAOK2	9344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29998788	29998788	+	Silent	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:29998788G>A	ENST00000308893.4	+	16	4238	c.3195G>A	c.(3193-3195)gcG>gcA	p.A1065A	TAOK2_ENST00000543033.1_Silent_p.A952A|TAOK2_ENST00000416441.2_Silent_p.A892A|TAOK2_ENST00000279394.3_Intron	NM_001252043.1|NM_016151.3	NP_001238972.1|NP_057235.2	Q9UL54	TAOK2_HUMAN	TAO kinase 2	1065					actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|focal adhesion assembly (GO:0048041)|G2 DNA damage checkpoint (GO:0031572)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein targeting to membrane (GO:0006612)|regulation of cell growth (GO:0001558)|regulation of cell shape (GO:0008360)|response to stress (GO:0006950)|stress-activated MAPK cascade (GO:0051403)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase binding (GO:0031434)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(3)|skin(1)	22						CTATGGCAGCGGGGGGCAGAT	0.687																																					p.A1065A													TAOK2_ENST00000308893,colon,carcinoma,+1,1	TAOK2_ENST00000308893	1	1	0			c.G3195A												18.0	24.0	22.0					16																	29998788		2182	4288	6470	SO:0001819	synonymous_variant	9344	exon16			GGCAGCGGGGGGC	AB020688	CCDS10662.1, CCDS10663.1, CCDS58448.1	16p11.2	2008-02-05			ENSG00000149930	ENSG00000149930			16835	protein-coding gene	gene with protein product		613199				10048485, 9786855	Standard	NM_016151		Approved	TAO1, KIAA0881, PSK, PSK1, TAO2, MAP3K17	uc002dva.2	Q9UL54	OTTHUMG00000132111	ENST00000308893.4:c.3195G>A	16.37:g.29998788G>A			82	0	0		89	0.26	23	NM_016151	80	0.34	27	A5PKY1|A7MCZ2|B2RN35|B7ZM88|O94957|Q6UW73|Q7LC09|Q9NSW2	Silent	SNP	ENST00000308893.4	37	CCDS10663.1																																																																																					0.687	TAOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000255152.2		NM_016151	
PHKB	5257	mdanderson.org	37	16	47622988	47622988	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:47622988G>T	ENST00000323584.5	+	10	1067	c.1043G>T	c.(1042-1044)tGc>tTc	p.C348F	PHKB_ENST00000566044.1_Missense_Mutation_p.C341F|PHKB_ENST00000299167.8_Missense_Mutation_p.C348F|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000455779.1_Missense_Mutation_p.C341F	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	348					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CCCAACAGATGCTACTACAAG	0.358																																					p.C348F													.	.			0			c.G1043T												61.0	65.0	64.0					16																	47622988		2201	4300	6501	SO:0001583	missense	5257	exon10			ACAGATGCTACTA		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1043G>T	16.37:g.47622988G>T	ENSP00000313504:p.Cys348Phe		62	0	0		64	0.06	4	NM_000293	60	0.00	0	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	8.194	0.796603	0.16327	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.92595	-3.07;-3.07	5.83	4.88	0.63580	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.051696	0.85682	D	0.000000	T	0.81522	0.4840	N	0.08118	0	0.32911	D	0.514495	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.77824	-0.2444	10	0.17369	T	0.5	-1.3009	11.3284	0.49463	0.0678:0.1281:0.8041:0.0	.	348;341	Q93100;Q93100-4	KPBB_HUMAN;.	F	341;341;348	ENSP00000414345:C341F;ENSP00000313504:C348F	ENSP00000299167:C341F	C	+	2	0	PHKB	46180489	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	6.647000	0.74354	1.482000	0.48325	-0.234000	0.12200	TGC			0.358	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000430413.1			
AC009120.6	0	broad.mit.edu	37	16	74366343	74366343	+	RNA	SNP	T	T	C	rs112075144	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr16:74366343T>C	ENST00000565313.1	-	0	47				AC009120.6_ENST00000561921.1_RNA																							CCTACCTCAGTTCCCAAGGCC	0.483																																					.													.	.			0			.																																											0	.			CCTCAGTTCCCAA																													16.37:g.74366343T>C			24	0.0416666667	1		36	0.25	9	.	5	0.00	0		RNA	SNP	ENST00000565313.1	37																																																																																						0.483	AC009120.6-003	KNOWN	basic	antisense	antisense		OTTHUMT00000434677.1			
POLR2A	5430	broad.mit.edu	37	17	7407047	7407047	+	Silent	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr17:7407047G>T	ENST00000322644.6	+	19	3576	c.3177G>T	c.(3175-3177)cgG>cgT	p.R1059R		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1059					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				AGGAGTTTCGGCTCAGTGGGG	0.552																																					p.R1059R													.	POLR2A	157		0			c.G3177T												74.0	61.0	66.0					17																	7407047		2203	4300	6503	SO:0001819	synonymous_variant	5430	exon19			GTTTCGGCTCAGT			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.3177G>T	17.37:g.7407047G>T			209	0	0		257	0.02	4	NM_000937	196	0.00	0	A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	37	CCDS32548.1																																																																																					0.552	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437967.1		NM_000937	
GUCY2D	3000	mdanderson.org	37	17	7909965	7909965	+	Silent	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr17:7909965G>T	ENST00000254854.4	+	4	1461	c.1311G>T	c.(1309-1311)ccG>ccT	p.P437P		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	437					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				TGCACTTCCCGCGTGGGGGAT	0.647																																					p.P437P													.	.			0			c.G1311T												23.0	22.0	22.0					17																	7909965		2203	4300	6503	SO:0001819	synonymous_variant	3000	exon4			CTTCCCGCGTGGG	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1311G>T	17.37:g.7909965G>T			56	0	0		51	0.06	3	NM_000180	0		0	Q6LEA7	Silent	SNP	ENST00000254854.4	37	CCDS11127.1																																																																																					0.647	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226973.2			
ACACA	31	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	35445916	35445916	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr17:35445916T>G	ENST00000394406.2	-	55	7064	c.6874A>C	c.(6874-6876)Atc>Ctc	p.I2292L	ACACA_ENST00000360679.3_Missense_Mutation_p.I2234L|ACACA_ENST00000353139.5_Missense_Mutation_p.I2329L|ACACA_ENST00000335166.5_Missense_Mutation_p.I2214L|ACACA_ENST00000361253.5_Missense_Mutation_p.I418L	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	2292					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ATGCATTTGATGTTTTCCTCT	0.463																																					p.I2329L	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												ACACA_ENST00000353139,bladder,carcinoma,+2,2	ACACA_ENST00000353139	2	2	0			c.A6985C												293.0	246.0	262.0					17																	35445916		2203	4300	6503	SO:0001583	missense	31	exon55			ATTTGATGTTTTC	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.6874A>C	17.37:g.35445916T>G	ENSP00000377928:p.Ile2292Leu		273	0	0		302	0.27	83	NM_198834	232	0.38	87	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.481388	0.63849	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330;ENST00000361253	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.45357	0.1338	L	0.60845	1.875	0.80722	D	1	B;B;B;B;B	0.15719	0.001;0.014;0.002;0.0;0.0	B;B;B;B;B	0.21708	0.009;0.036;0.025;0.004;0.01	T	0.39035	-0.9633	10	0.12103	T	0.63	-13.7742	16.089	0.81080	0.0:0.0:0.0:1.0	.	330;991;2329;2292;2234	B4DIG6;F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;.;ACACA_HUMAN;.	L	2329;2234;2292;2316;2214;991;418	ENSP00000344789:I2329L;ENSP00000353898:I2234L;ENSP00000377928:I2292L;ENSP00000335323:I2214L;ENSP00000354565:I418L	ENSP00000335323:I2214L	I	-	1	0	ACACA	32520029	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.021000	0.88750	2.205000	0.71048	0.533000	0.62120	ATC			0.463	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256696.1		NM_198836	
CDH19	28513	bcgsc.ca;mdanderson.org	37	18	64172301	64172301	+	Silent	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr18:64172301G>A	ENST00000262150.2	-	12	2359	c.2067C>T	c.(2065-2067)ggC>ggT	p.G689G	CDH19_ENST00000540086.1_3'UTR	NM_021153.3	NP_066976.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CACTGTCGGGGCCAACTTGCA	0.498																																					p.G689G													.	CDH19	141		0			c.C2067T												155.0	149.0	151.0					18																	64172301		2203	4300	6503	SO:0001819	synonymous_variant	28513	exon12			GTCGGGGCCAACT	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000262150.2:c.2067C>T	18.37:g.64172301G>A			99	0	0		89	0.06	5	NM_021153	1	0.00	0	O15098	Silent	SNP	ENST00000262150.2	37	CCDS11994.1																																																																																					0.498	CDH19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256219.1		NM_021153	
ACTL9	284382	mdanderson.org	37	19	8808404	8808404	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr19:8808404G>T	ENST00000324436.3	-	1	768	c.648C>A	c.(646-648)caC>caA	p.H216Q		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	216						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						GCTCCGTGGCGTGGAGCAGGT	0.682																																					p.H216Q													ACTL9,NS,carcinoma,0,2	ACTL9	0	2	0			c.C648A												47.0	45.0	45.0					19																	8808404		2203	4299	6502	SO:0001583	missense	284382	exon1			CGTGGCGTGGAGC		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.648C>A	19.37:g.8808404G>T	ENSP00000316674:p.His216Gln		13	0	0		15	0.13	2	NM_178525	0		0	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	37	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464217	0.63513	.	.	ENSG00000181786	ENST00000324436	T	0.08282	3.11	4.55	-2.58	0.06228	.	0.789151	0.11006	N	0.610029	T	0.21841	0.0526	M	0.67397	2.05	0.35675	D	0.813654	D	0.69078	0.997	D	0.70016	0.967	T	0.42292	-0.9460	10	0.87932	D	0	.	10.4052	0.44252	0.6295:0.0:0.3705:0.0	.	216	Q8TC94	ACTL9_HUMAN	Q	216	ENSP00000316674:H216Q	ENSP00000316674:H216Q	H	-	3	2	ACTL9	8669404	0.161000	0.22892	0.835000	0.33067	0.906000	0.53458	-0.664000	0.05292	-0.196000	0.10366	0.462000	0.41574	CAC			0.682	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459953.1		NM_178525	
ZNF433	163059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12126012	12126012	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr19:12126012G>A	ENST00000344980.6	-	4	1840	c.1670C>T	c.(1669-1671)aCt>aTt	p.T557I	CTD-2006C1.2_ENST00000406892.2_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|ZNF433_ENST00000419886.2_Missense_Mutation_p.T522I|CTD-2006C1.2_ENST00000495324.1_RNA	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	557					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						TTTCTCTCCAGTGTGAGTCCT	0.463																																					p.T557I													.	.			0			c.C1670T												100.0	104.0	103.0					19																	12126012		2203	4300	6503	SO:0001583	missense	163059	exon4			TCTCCAGTGTGAG	AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.1670C>T	19.37:g.12126012G>A	ENSP00000339767:p.Thr557Ile		137	0	0		171	0.32	55	NM_001080411	21	0.43	9	Q86VX3	Missense_Mutation	SNP	ENST00000344980.6	37	CCDS45983.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520663	0.64747	.	.	ENSG00000197647	ENST00000419886;ENST00000344980	T;T	0.25749	1.78;1.78	1.37	0.121	0.14695	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44074	0.1276	M	0.73372	2.23	0.23298	N	0.997959	D	0.69078	0.997	D	0.69142	0.962	T	0.22906	-1.0203	9	0.66056	D	0.02	.	8.3351	0.32211	0.0:0.2487:0.7512:0.0	.	557	Q8N7K0	ZN433_HUMAN	I	522;557	ENSP00000393416:T522I;ENSP00000339767:T557I	ENSP00000339767:T557I	T	-	2	0	ZNF433	11987012	0.991000	0.36638	0.349000	0.25694	0.880000	0.50808	1.607000	0.36836	0.093000	0.17368	0.298000	0.19748	ACT			0.463	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403716.1		NM_152602	
ZNF99	7652	hgsc.bcm.edu	37	19	22941279	22941279	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr19:22941279C>G	ENST00000596209.1	-	4	1522	c.1432G>C	c.(1432-1434)Gag>Cag	p.E478Q	ZNF99_ENST00000397104.3_Missense_Mutation_p.E387Q	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E387Q(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAGGGTTTCTCTCCAGTATGA	0.353																																					p.E478Q													ZNF99,NS,carcinoma,0,1	ZNF99	0	1	1	Substitution - Missense(1)	prostate(1)	c.G1432C																																									SO:0001583	missense	7652	exon4			GTTTCTCTCCAGT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1432G>C	19.37:g.22941279C>G	ENSP00000472969:p.Glu478Gln		50	0.02	1		62	0.05	3	NM_001080409	13	0.00	0	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	15.37	2.812264	0.50527	.	.	ENSG00000213973	ENST00000397104	T	0.25912	1.77	1.28	1.28	0.21552	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38188	0.1031	L	0.55834	1.745	0.37534	D	0.918031	D	0.65815	0.995	P	0.61328	0.887	T	0.41980	-0.9478	9	0.72032	D	0.01	.	9.4929	0.38971	0.0:1.0:0.0:0.0	.	387	A8MXY4	ZNF99_HUMAN	Q	387	ENSP00000380293:E387Q	ENSP00000380293:E387Q	E	-	1	0	ZNF99	22733119	0.013000	0.17824	0.386000	0.26170	0.619000	0.37552	0.270000	0.18607	0.675000	0.31264	0.395000	0.25975	GAG			0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000464591.1		XM_065124	
RHPN2	85415	mdanderson.org	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M													RHPN2,face,carcinoma,0,2	RHPN2	0	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A												84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met		19	0	0		25	0.12	3	NM_033103	26	0.00	0	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG			0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450828.2		NM_033103	
WBP1	23559	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	74685732	74685732	+	Start_Codon_SNP	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr2:74685732G>A	ENST00000233615.2	+	1	277	c.3G>A	c.(1-3)atG>atA	p.M1I	WBP1_ENST00000393972.3_Start_Codon_SNP_p.M1I|WBP1_ENST00000409737.1_Start_Codon_SNP_p.M1I|WBP1_ENST00000494741.1_3'UTR	NM_012477.3	NP_036609.1	Q96G27	WBP1_HUMAN	WW domain binding protein 1	1							WW domain binding (GO:0050699)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	8						GTGGAGGTATGGCTCGGGCCA	0.692																																					p.M1I													.	.			0			c.G3A												9.0	11.0	10.0					2																	74685732		2132	4167	6299	SO:0001582	initiator_codon_variant	23559	exon1			AGGTATGGCTCGG	U79457	CCDS1943.1	2p12	2012-04-20			ENSG00000239779	ENSG00000239779			12737	protein-coding gene	gene with protein product		606961				7644498	Standard	NM_012477		Approved	WBP-1	uc002slj.2	Q96G27	OTTHUMG00000129958	ENST00000233615.2:c.3G>A	2.37:g.74685732G>A	ENSP00000233615:p.Met1Ile		111	0	0		152	0.29	44	NM_012477	134	0.22	29	B2RE02|O95637	Missense_Mutation	SNP	ENST00000233615.2	37	CCDS1943.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082910	0.55861	.	.	ENSG00000239779	ENST00000233615;ENST00000393972;ENST00000409737	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	T	0.54663	0.1872	.	.	.	0.80722	D	1	B;B	0.24483	0.049;0.104	B;B	0.15870	0.014;0.014	T	0.56202	-0.8018	7	0.87932	D	0	-0.7827	13.9567	0.64152	0.0:0.0:1.0:0.0	.	1;1	B8ZZ95;Q96G27	.;WBP1_HUMAN	I	1	.	ENSP00000233615:M1I	M	+	3	0	WBP1	74539240	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.511000	0.60462	2.671000	0.90904	0.555000	0.69702	ATG			0.692	WBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252221.2		NM_012477	Missense_Mutation
DBI	1622	mdanderson.org	37	2	120129839	120129839	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr2:120129839C>T	ENST00000355857.3	+	4	340	c.209C>T	c.(208-210)gCc>gTc	p.A70V	DBI_ENST00000460901.1_3'UTR|DBI_ENST00000535757.1_Missense_Mutation_p.A87V|DBI_ENST00000393103.2_Missense_Mutation_p.A71V|DBI_ENST00000542275.1_Missense_Mutation_p.A131V|DBI_ENST00000409094.1_Missense_Mutation_p.A87V|DBI_ENST00000535617.1_Missense_Mutation_p.A112V|DBI_ENST00000311521.4_Missense_Mutation_p.A87V	NM_001079862.1|NM_001178043.1	NP_001073331.1|NP_001171514.1	P07108	ACBP_HUMAN	diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)	70	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				hair follicle development (GO:0001942)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|transport (GO:0006810)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear endoplasmic reticulum (GO:0097038)	benzodiazepine receptor binding (GO:0030156)|lipid binding (GO:0008289)|long-chain fatty acyl-CoA binding (GO:0036042)|protein dimerization activity (GO:0046983)			kidney(1)|lung(4)|skin(1)	6						AAGGAAGATGCCATGAAAGCT	0.458																																					p.A131V													.	.			0			c.C392T												146.0	137.0	140.0					2																	120129839		2203	4300	6503	SO:0001583	missense	1622	exon4			AAGATGCCATGAA	L76366	CCDS2126.1, CCDS42740.1, CCDS42741.1, CCDS74568.1	2q12-q21	2010-10-20	2010-04-30		ENSG00000155368	ENSG00000155368			2690	protein-coding gene	gene with protein product	"""endozepine"""	125950	"""diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)"""			1440058	Standard	NM_001079863		Approved	ACBP, ACBD1	uc021vnj.1	P07108	OTTHUMG00000131403	ENST00000355857.3:c.209C>T	2.37:g.120129839C>T	ENSP00000348116:p.Ala70Val		38	0	0		42	0.07	3	NM_001178017	911	0.00	0	B8ZWD2|B8ZWD6|B8ZWD7|P08869|Q4VWZ6|Q53SQ7|Q6IB48|Q9UCI8	Missense_Mutation	SNP	ENST00000355857.3	37	CCDS42740.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030342	0.93575	.	.	ENSG00000155368	ENST00000355857;ENST00000535617;ENST00000535757;ENST00000409094;ENST00000311521;ENST00000542275;ENST00000393103	T;T;T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02;0.02;0.02	5.54	5.54	0.83059	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	0.052168	0.85682	D	0.000000	D	0.86623	0.5977	H	0.98155	4.16	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;0.998;0.999;0.996	D;D;D;D;D	0.83275	0.964;0.996;0.939;0.989;0.982	D	0.90623	0.4561	10	0.87932	D	0	-3.2193	14.8575	0.70351	0.0:1.0:0.0:0.0	.	80;112;71;87;70	B8ZWD1;B8ZWD7;P07108-3;B8ZWD2;P07108	.;.;.;.;ACBP_HUMAN	V	70;112;87;87;87;131;71	ENSP00000348116:A70V;ENSP00000442917:A112V;ENSP00000439012:A87V;ENSP00000386486:A87V;ENSP00000311117:A87V;ENSP00000440698:A131V;ENSP00000376815:A71V	ENSP00000311117:A87V	A	+	2	0	DBI	119846309	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.905000	0.69893	2.884000	0.98904	0.655000	0.94253	GCC			0.458	DBI-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330590.1		NM_020548	
NR4A2	4929	mdanderson.org	37	2	157183293	157183293	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr2:157183293G>T	ENST00000339562.4	-	6	1660	c.1298C>A	c.(1297-1299)gCc>gAc	p.A433D	NR4A2_ENST00000539077.1_Missense_Mutation_p.A444D|NR4A2_ENST00000409108.2_Missense_Mutation_p.A433D|NR4A2_ENST00000409572.1_Missense_Mutation_p.A433D|NR4A2_ENST00000429376.1_Missense_Mutation_p.A370D|NR4A2_ENST00000426264.1_Missense_Mutation_p.A370D	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	433	Ligand-binding. {ECO:0000255}.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						GTCTTGGTCGGCTTTGGGCAG	0.517																																					p.A433D													.	.			0			c.C1298A												145.0	156.0	152.0					2																	157183293		2203	4300	6503	SO:0001583	missense	4929	exon6			TGGTCGGCTTTGG	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1298C>A	2.37:g.157183293G>T	ENSP00000344479:p.Ala433Asp		58	0	0		47	0.06	3	NM_006186	9	0.00	0	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	37	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	G	8.122	0.781217	0.16120	.	.	ENSG00000153234	ENST00000339562;ENST00000426264;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000429376	T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92	5.62	4.74	0.60224	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.302328	0.37261	N	0.002176	T	0.20414	0.0491	N	0.04959	-0.14	0.34696	D	0.726296	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.0	T	0.22208	-1.0223	10	0.17832	T	0.49	.	9.6179	0.39704	0.0713:0.0:0.7877:0.1411	.	86;433	C0KWD2;P43354	.;NR4A2_HUMAN	D	433;370;433;444;433;370	ENSP00000344479:A433D;ENSP00000389986:A370D;ENSP00000386747:A433D;ENSP00000444925:A444D;ENSP00000386993:A433D;ENSP00000410952:A370D	ENSP00000344479:A433D	A	-	2	0	NR4A2	156891539	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	3.386000	0.52492	1.502000	0.48669	0.557000	0.71058	GCC			0.517	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254909.2			
DGKD	8527	mdanderson.org	37	2	234370999	234370999	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr2:234370999G>T	ENST00000264057.2	+	25	2999	c.2987G>T	c.(2986-2988)cGa>cTa	p.R996L	DGKD_ENST00000409813.3_Missense_Mutation_p.R952L	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	996					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCTAGTATCCGAGAAATAGCT	0.567																																					p.R996L													.	.			0			c.G2987T												75.0	69.0	71.0					2																	234370999		2203	4300	6503	SO:0001583	missense	8527	exon25			GTATCCGAGAAAT	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2987G>T	2.37:g.234370999G>T	ENSP00000264057:p.Arg996Leu		37	0	0		47	0.06	3	NM_152879	140	0.00	0	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784642	0.49997	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.80480	-1.21;-1.38	4.33	4.33	0.51752	.	0.000000	0.64402	D	0.000004	T	0.80270	0.4592	M	0.71581	2.175	0.39286	D	0.964648	D;P	0.53151	0.958;0.628	P;B	0.47299	0.543;0.326	T	0.79455	-0.1796	10	0.27082	T	0.32	.	10.9838	0.47510	0.0866:0.0:0.9134:0.0	.	952;996	Q16760-2;Q16760	.;DGKD_HUMAN	L	996;952	ENSP00000264057:R996L;ENSP00000386455:R952L	ENSP00000264057:R996L	R	+	2	0	DGKD	234035738	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.476000	0.81055	2.411000	0.81874	0.561000	0.74099	CGA			0.567	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257072.2		NM_003648	
ACTL10	170487	mdanderson.org	37	20	32255441	32255441	+	Silent	SNP	C	C	T	rs147746551	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr20:32255441C>T	ENST00000330271.4	+	1	1138	c.138C>T	c.(136-138)aaC>aaT	p.N46N	NECAB3_ENST00000246190.6_Intron|NECAB3_ENST00000375238.4_Intron	NM_001024675.1	NP_001019846.1	Q5JWF8	ACL10_HUMAN	actin-like 10	46																	TCCGACTGAACGTGGCAGGCA	0.706																																					p.N46N													.	.			0			c.C138T												21.0	16.0	18.0					20																	32255441		2196	4286	6482	SO:0001819	synonymous_variant	170487	exon1			ACTGAACGTGGCA	AL121906	CCDS33463.1	20q11.22	2011-11-24	2011-11-24	2011-11-24	ENSG00000182584	ENSG00000182584			16127	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 134"""	C20orf134			Standard	NM_001024675		Approved		uc002wzt.3	Q5JWF8	OTTHUMG00000032262	ENST00000330271.4:c.138C>T	20.37:g.32255441C>T			56	0	0		46	0.07	3	NM_001024675	0		0	B9EH76	Silent	SNP	ENST00000330271.4	37	CCDS33463.1																																																																																					0.706	ACTL10-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078713.1			
IFNAR2	3455	broad.mit.edu	37	21	34635615	34635615	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr21:34635615T>C	ENST00000342136.4	+	9	1684	c.1358T>C	c.(1357-1359)cTg>cCg	p.L453P	IFNAR2_ENST00000404220.3_3'UTR|AP000295.9_ENST00000433395.2_Intron|IL10RB-AS1_ENST00000411998.1_RNA|IFNAR2_ENST00000342101.3_3'UTR|IFNAR2_ENST00000382241.3_Missense_Mutation_p.L453P			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2	453					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	TCGTCTCATCTGGAAGAGATG	0.483																																					p.L453P													.	IFNAR2	44		0			c.T1358C												245.0	246.0	246.0					21																	34635615		2203	4300	6503	SO:0001583	missense	3455	exon9			CTCATCTGGAAGA		CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.1358T>C	21.37:g.34635615T>C	ENSP00000343957:p.Leu453Pro		79	0	0		146	0.03	4	NM_207585	35	0.00	0	A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Missense_Mutation	SNP	ENST00000342136.4	37	CCDS13621.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.609339	0.00842	.	.	ENSG00000159110	ENST00000382241;ENST00000342136	T;T	0.20738	2.05;2.05	4.74	-0.747	0.11091	.	2.533200	0.01165	N	0.006725	T	0.04861	0.0131	N	0.00554	-1.385	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.40040	-0.9584	10	0.02654	T	1	.	3.0751	0.06243	0.3189:0.4048:0.0:0.2764	.	453	P48551	INAR2_HUMAN	P	453	ENSP00000371676:L453P;ENSP00000343957:L453P	ENSP00000343957:L453P	L	+	2	0	IFNAR2	33557485	0.009000	0.17119	0.005000	0.12908	0.001000	0.01503	0.126000	0.15769	0.023000	0.15187	-0.837000	0.03062	CTG			0.483	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000139825.1			
CARD10	29775	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37903924	37903924	+	Missense_Mutation	SNP	C	C	T	rs150236189	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr22:37903924C>T	ENST00000403299.1	-	7	1319	c.1103G>A	c.(1102-1104)cGc>cAc	p.R368H	CARD10_ENST00000251973.5_Missense_Mutation_p.R368H|CARD10_ENST00000494166.1_5'Flank|CARD10_ENST00000406271.3_Missense_Mutation_p.R82H			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	368					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CTGCAGCGTGCGGTGCTTGAG	0.622																																					p.R368H													.	CARD10	55		0			c.G1103A							C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	174.0	140.0	151.0		1103	5.3	1.0	22	dbSNP_134	151	0,8600		0,0,4300	no	missense	CARD10	NM_014550.3	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	368/1033	37903924	2,13004	2203	4300	6503	SO:0001583	missense	29775	exon6			AGCGTGCGGTGCT	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.1103G>A	22.37:g.37903924C>T	ENSP00000384570:p.Arg368His		115	0.0086956522	1		132	0.48	63	NM_014550	77	0.65	50	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Missense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228715	0.79576	4.54E-4	0.0	ENSG00000100065	ENST00000403299;ENST00000406271;ENST00000251973;ENST00000437756	T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.14	5.35	5.35	0.76521	.	0.059305	0.64402	D	0.000003	T	0.76673	0.4020	L	0.59436	1.845	0.22762	N	0.998764	D;D	0.57571	0.98;0.957	P;P	0.46796	0.513;0.527	T	0.72424	-0.4298	10	0.48119	T	0.1	-16.8812	11.7297	0.51730	0.0:0.9185:0.0:0.0815	.	368;82	Q9BWT7;Q8NC81	CAR10_HUMAN;.	H	368;82;368;9	ENSP00000384570:R368H;ENSP00000385799:R82H;ENSP00000251973:R368H;ENSP00000416239:R9H	ENSP00000251973:R368H	R	-	2	0	CARD10	36233870	1.000000	0.71417	0.999000	0.59377	0.784000	0.44337	3.559000	0.53756	2.517000	0.84864	0.555000	0.69702	CGC			0.622	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318997.1		NM_014550	
ADSL	158	broad.mit.edu	37	22	40757555	40757555	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr22:40757555G>A	ENST00000216194.7	+	9	982	c.926G>A	c.(925-927)cGc>cAc	p.R309H	ADSL_ENST00000342312.6_Missense_Mutation_p.R309H|ADSL_ENST00000454266.2_Missense_Mutation_p.R323H|ADSL_ENST00000480775.1_3'UTR	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	309					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						AGTCTTGCCCGCCACCTGATG	0.532																																					p.R309H	Colon(4;65 130 1097 1516)												.	ADSL	98		0			c.G926A												146.0	117.0	127.0					22																	40757555		2203	4300	6503	SO:0001583	missense	158	exon9			TTGCCCGCCACCT	X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.926G>A	22.37:g.40757555G>A	ENSP00000216194:p.Arg309His		64	0	0		93	0.04	4	NM_001123378	974	0.00	0	B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	ENST00000216194.7	37	CCDS14001.1	.	.	.	.	.	.	.	.	.	.	G	36	5.731123	0.96856	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	T;T;T	0.73897	-0.79;-0.79;-0.79	5.91	5.91	0.95273	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	H	0.97758	4.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93979	0.7256	10	0.87932	D	0	-17.1946	20.2985	0.98592	0.0:0.0:1.0:0.0	.	323;309;309;309	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	H	309;323;129;309	ENSP00000216194:R309H;ENSP00000390107:R323H;ENSP00000341429:R309H	ENSP00000216194:R309H	R	+	2	0	ADSL	39087501	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.026000	0.93700	2.793000	0.96121	0.655000	0.94253	CGC			0.532	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321386.1		NM_000026	
RHOA	387	ucsc.edu	37	3	49399927	49399927	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr3:49399927G>T	ENST00000418115.1	-	4	793		c.e4+1		RHOA_ENST00000422781.1_Splice_Site|RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000454011.2_Splice_Site	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCCAGATCATGCCTGCTTCAT	0.517																																					.													.	RHOA	46		0			c.408+2C>A												150.0	136.0	141.0					3																	49399927		2203	4300	6503	SO:0001630	splice_region_variant	387	exon5			GATCATGCCTGCT	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.408+1C>A	3.37:g.49399927G>T			88	0	0		88	0.01	1	NM_001664	43	0.09	4	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Splice_Site	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134376	0.56828	.	.	ENSG00000067560	ENST00000418115;ENST00000422781	.	.	.	5.31	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1548	0.20332	0.3254:0.0:0.6746:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RHOA	49374931	1.000000	0.71417	0.976000	0.42696	0.992000	0.81027	2.374000	0.44274	0.356000	0.24157	0.655000	0.94253	.			0.517	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346157.3		NM_001664	Intron
CTD-2185K10.1	0	broad.mit.edu	37	3	59087570	59087570	+	lincRNA	DEL	A	A	-			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr3:59087570delA	ENST00000487624.1	+	0	117																											gattaatgcgaaaaagaattc	0.348																																					.													.	.			0			.																																											0	.			AATGCGAAAAAGA																													3.37:g.59087570delA			7	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000487624.1	37																																																																																						0.348	CTD-2185K10.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000353799.1			
ANAPC10	10393	broad.mit.edu	37	4	145916698	145916698	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr4:145916698T>C	ENST00000507656.1	-	5	478	c.385A>G	c.(385-387)Aag>Gag	p.K129E	ANAPC10_ENST00000510270.1_5'UTR|ANAPC10_ENST00000451299.2_Missense_Mutation_p.K129E|ANAPC10_ENST00000309439.5_Missense_Mutation_p.K129E	NM_001256706.1	NP_001243635.1	Q9UM13	APC10_HUMAN	anaphase promoting complex subunit 10	129	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(180;0.151)					GTTGGCTTCTTATGATTGTCA	0.383																																					p.K140E													.	ANAPC10	12		0			c.A418G												124.0	122.0	123.0					4																	145916698		1861	4101	5962	SO:0001583	missense	10393	exon7			GCTTCTTATGATT	AF132794	CCDS43273.1	4q31	2011-06-15			ENSG00000164162	ENSG00000164162		"""Anaphase promoting complex subunits"""	24077	protein-coding gene	gene with protein product		613745				10318877, 11230166	Standard	NM_001256706		Approved	APC10, DOC1, DKFZP564L0562	uc031shk.1	Q9UM13	OTTHUMG00000161477	ENST00000507656.1:c.385A>G	4.37:g.145916698T>C	ENSP00000423995:p.Lys129Glu		171	0	0		112	0.03	3	NM_001256709	123	0.00	0	D3DNZ7|Q2V500|Q9UG51|Q9Y5R0	Missense_Mutation	SNP	ENST00000507656.1	37	CCDS43273.1	.	.	.	.	.	.	.	.	.	.	T	0.040	-1.289615	0.01387	.	.	ENSG00000164162	ENST00000507656;ENST00000309439;ENST00000451299;ENST00000514390;ENST00000513054	T;T;T;T;T	0.70986	-0.53;-0.53;-0.53;-0.53;-0.53	5.69	4.49	0.54785	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	0.044787	0.85682	D	0.000000	T	0.39279	0.1072	N	0.02169	-0.655	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40776	-0.9545	10	0.02654	T	1	-9.1896	12.1032	0.53796	0.1289:0.0:0.0:0.8711	.	129	Q9UM13	APC10_HUMAN	E	129	ENSP00000423995:K129E;ENSP00000310071:K129E;ENSP00000403891:K129E;ENSP00000423043:K129E;ENSP00000421609:K129E	ENSP00000310071:K129E	K	-	1	0	ANAPC10	146136148	1.000000	0.71417	0.999000	0.59377	0.045000	0.14185	5.861000	0.69553	0.962000	0.38057	-0.481000	0.04817	AAG			0.383	ANAPC10-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365090.1		NM_014885	
C5orf56	441108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	131811504	131811504	+	Silent	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr5:131811504C>T	ENST00000378953.4	+	4	710	c.234C>T	c.(232-234)acC>acT	p.T78T	AC116366.6_ENST00000443093.2_RNA|C5orf56_ENST00000464024.1_3'UTR			Q8N8D9	CE056_HUMAN	chromosome 5 open reading frame 56	0										breast(1)|endometrium(1)|large_intestine(1)|lung(3)	6						CTGTGGACACCGCGTCTGTGT	0.537																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	441108	.			GGACACCGCGTCT	BC130299		5q31.1	2009-04-20			ENSG00000197536	ENSG00000197536			33838	protein-coding gene	gene with protein product							Standard	NR_045116		Approved		uc010jds.2	Q8N8D9	OTTHUMG00000059493	ENST00000378953.4:c.234C>T	5.37:g.131811504C>T			51	0	0		51	0.37	19	.	4	0.00	0	A1L3V9|A6NKA0	RNA	SNP	ENST00000378953.4	37																																																																																						0.537	C5orf56-002	NOVEL	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000132330.3		NM_001013717	
HK3	3101	mdanderson.org	37	5	176308126	176308126	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr5:176308126G>A	ENST00000292432.5	-	19	2811	c.2720C>T	c.(2719-2721)gCg>gTg	p.A907V		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	907	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACCAGGGCCGCACCTTTGCC	0.662																																					p.A907V													HK3,NS,carcinoma,+1,1	HK3	1	1	0			c.C2720T												51.0	50.0	50.0					5																	176308126		2203	4300	6503	SO:0001583	missense	3101	exon19			AGGGCCGCACCTT		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2720C>T	5.37:g.176308126G>A	ENSP00000292432:p.Ala907Val		66	0	0		38	0.08	3	NM_002115	1	0.00	0	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560395	0.65538	.	.	ENSG00000160883	ENST00000292432	D	0.99405	-5.84	5.22	5.22	0.72569	Hexokinase, C-terminal (1);	0.000000	0.49305	D	0.000149	D	0.99722	0.9892	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97363	0.9971	10	0.87932	D	0	-12.1194	17.5321	0.87817	0.0:0.0:1.0:0.0	.	907	P52790	HXK3_HUMAN	V	907	ENSP00000292432:A907V	ENSP00000292432:A907V	A	-	2	0	HK3	176240732	1.000000	0.71417	0.878000	0.34440	0.130000	0.20726	7.415000	0.80131	2.714000	0.92807	0.561000	0.74099	GCG			0.662	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253428.1			
OR2Y1	134083	bcgsc.ca	37	5	180166235	180166235	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr5:180166235A>G	ENST00000307832.2	-	1	864	c.824T>C	c.(823-825)cTt>cCt	p.L275P		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTATAAAAAAGGGCAACAAA	0.423																																					p.L275P													.	OR2Y1	49		0			c.T824C												85.0	98.0	94.0					5																	180166235		2203	4300	6503	SO:0001583	missense	134083	exon1			TAAAAAAGGGCAA	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.824T>C	5.37:g.180166235A>G	ENSP00000312403:p.Leu275Pro		71	0	0		48	0.08	4	NM_001001657	0		0	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	37	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	a	13.90	2.373892	0.42105	.	.	ENSG00000174339	ENST00000307832	T	0.00188	8.59	4.41	1.81	0.25067	GPCR, rhodopsin-like superfamily (1);	0.187185	0.26153	N	0.026031	T	0.00637	0.0021	H	0.95611	3.695	0.09310	N	0.999995	D	0.89917	1.0	D	0.76575	0.988	T	0.37407	-0.9707	10	0.87932	D	0	.	5.0293	0.14402	0.7411:0.0:0.0965:0.1624	.	275	Q8NGV0	OR2Y1_HUMAN	P	275	ENSP00000312403:L275P	ENSP00000312403:L275P	L	-	2	0	OR2Y1	180098841	0.566000	0.26618	0.271000	0.24616	0.008000	0.06430	5.938000	0.70170	0.821000	0.34540	0.418000	0.28097	CTT			0.423	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368059.2		XM_068682	
UFL1	23376	broad.mit.edu	37	6	96997435	96997435	+	Silent	SNP	A	A	G			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr6:96997435A>G	ENST00000369278.4	+	14	1734	c.1668A>G	c.(1666-1668)aaA>aaG	p.K556K		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	556					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										TATTTGAAAAAGGGATGAAGT	0.323																																					p.K556K													.	.			0			c.A1668G												56.0	56.0	56.0					6																	96997435		2203	4298	6501	SO:0001819	synonymous_variant	23376	exon14			TGAAAAAGGGATG	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1668A>G	6.37:g.96997435A>G			112	0	0		109	0.03	3	NM_015323	30	0.00	0	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Silent	SNP	ENST00000369278.4	37	CCDS5034.1																																																																																					0.323	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041557.1		NM_015323	
QKI	9444	mdanderson.org	37	6	163983060	163983060	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr6:163983060C>T	ENST00000361752.3	+	5	1144	c.593C>T	c.(592-594)gCg>gTg	p.A198V	QKI_ENST00000453779.2_Missense_Mutation_p.A198V|QKI_ENST00000424802.3_Missense_Mutation_p.A198V|QKI_ENST00000275262.7_Missense_Mutation_p.A198V|QKI_ENST00000392127.2_Missense_Mutation_p.A198V|QKI_ENST00000361195.2_Missense_Mutation_p.A198V	NM_006775.2|NM_206853.2|NM_206854.2|NM_206855.2	NP_006766.1|NP_996735.1|NP_996736.1|NP_996737.1	Q96PU8	QKI_HUMAN	QKI, KH domain containing, RNA binding	198					long-chain fatty acid biosynthetic process (GO:0042759)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|muscle cell differentiation (GO:0042692)|myelination (GO:0042552)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|spermatid development (GO:0007286)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(5)|ovary(1)|prostate(3)|urinary_tract(2)	27		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		ATGGAGCTTGCGATTCTGAAT	0.443																																					p.A198V													.	.			0			c.C593T												114.0	107.0	110.0					6																	163983060		2203	4300	6503	SO:0001583	missense	9444	exon5			AGCTTGCGATTCT	AB067798	CCDS5285.1, CCDS5286.1, CCDS5287.1, CCDS43525.1, CCDS75546.1	6q26	2011-09-12	2011-09-12		ENSG00000112531	ENSG00000112531			21100	protein-coding gene	gene with protein product		609590	"""quaking homolog, KH domain RNA binding (mouse)"""			10535969	Standard	NM_006775		Approved	QK3	uc003qui.3	Q96PU8	OTTHUMG00000015977	ENST00000361752.3:c.593C>T	6.37:g.163983060C>T	ENSP00000355094:p.Ala198Val		54	0	0		46	0.07	3	NM_206855	180	0.00	0	Q2I375|Q5MJQ1|Q969L9|Q96EJ3|Q96KA3|Q96PU6|Q96PU7|Q9P0X6|Q9P0X7|Q9P0X8|Q9P0X9|Q9P0Y0|Q9P0Y1	Missense_Mutation	SNP	ENST00000361752.3	37	CCDS5285.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339594	0.81911	.	.	ENSG00000112531	ENST00000453779;ENST00000275262;ENST00000392127;ENST00000361752;ENST00000361195;ENST00000424802;ENST00000537041;ENST00000544823	T;T;T;T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23;2.23;2.23;2.23	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.37919	0.1021	M	0.79475	2.455	0.58432	D	0.999999	P;P;D;D;P;P	0.89917	0.915;0.779;1.0;1.0;0.915;0.715	B;B;D;D;B;B	0.68039	0.092;0.063;0.955;0.955;0.069;0.069	T	0.18429	-1.0337	10	0.87932	D	0	.	19.6035	0.95573	0.0:1.0:0.0:0.0	.	198;198;198;198;198;198	Q96PU8-3;Q96PU8;Q96PU8-5;Q96PU8-9;Q96PU8-6;Q96PU8-8	.;QKI_HUMAN;.;.;.;.	V	198;198;198;198;198;198;143;143	ENSP00000408775:A198V;ENSP00000275262:A198V;ENSP00000375973:A198V;ENSP00000355094:A198V;ENSP00000354867:A198V;ENSP00000408382:A198V;ENSP00000440991:A143V;ENSP00000440599:A143V	ENSP00000275262:A198V	A	+	2	0	QKI	163903050	1.000000	0.71417	0.698000	0.30274	0.987000	0.75469	5.724000	0.68500	2.814000	0.96858	0.650000	0.86243	GCG			0.443	QKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043016.2		NM_006775	
INTS1	26173	ucsc.edu	37	7	1519274	1519274	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr7:1519274C>T	ENST00000404767.3	-	31	4206	c.4121G>A	c.(4120-4122)cGc>cAc	p.R1374H	INTS1_ENST00000389470.4_Missense_Mutation_p.R1573H	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1374					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GGCCACGGGGCGGGGACTGGA	0.716																																					p.R1374H													.	INTS1	145		0			c.G4121A												4.0	6.0	5.0					7																	1519274		1695	3501	5196	SO:0001583	missense	26173	exon31			ACGGGGCGGGGAC	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.4121G>A	7.37:g.1519274C>T	ENSP00000385722:p.Arg1374His		20	0	0		25	0.16	4	NM_001080453	53	0.00	0	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	37	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.726940	0.69074	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.54279	0.71;0.58	5.14	4.26	0.50523	.	0.047916	0.85682	D	0.000000	T	0.60483	0.2272	M	0.67953	2.075	0.46185	D	0.99891	D	0.69078	0.997	P	0.51453	0.67	T	0.65030	-0.6267	10	0.59425	D	0.04	.	13.3749	0.60732	0.0:0.924:0.0:0.076	.	1374	Q8N201	INT1_HUMAN	H	1374;1573	ENSP00000385722:R1374H;ENSP00000374121:R1573H	ENSP00000374121:R1573H	R	-	2	0	INTS1	1485800	1.000000	0.71417	0.950000	0.38849	0.073000	0.16967	4.866000	0.63005	1.170000	0.42753	0.655000	0.94253	CGC			0.716	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323683.1			
SNX8	29886	mdanderson.org	37	7	2304059	2304059	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr7:2304059G>A	ENST00000222990.3	-	6	698	c.656C>T	c.(655-657)gCc>gTc	p.A219V		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	219					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CCGGCTGATGGCAAACTGAGC	0.587																																					p.A219V													SNX8,NS,carcinoma,+1,1	SNX8	1	1	0			c.C656T												61.0	58.0	59.0					7																	2304059		2203	4300	6503	SO:0001583	missense	29886	exon6			CTGATGGCAAACT	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.656C>T	7.37:g.2304059G>A	ENSP00000222990:p.Ala219Val		28	0	0		31	0.10	3	NM_013321	336	0.00	0	A4D207|Q96I67	Missense_Mutation	SNP	ENST00000222990.3	37	CCDS5331.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555613	0.65425	.	.	ENSG00000106266	ENST00000222990;ENST00000435060;ENST00000457286	.	.	.	5.04	5.04	0.67666	.	0.160205	0.43579	D	0.000553	T	0.60011	0.2236	L	0.48642	1.525	0.44061	D	0.996807	B	0.28439	0.212	B	0.32465	0.146	T	0.57940	-0.7724	9	0.35671	T	0.21	.	18.3921	0.90486	0.0:0.0:1.0:0.0	.	219	Q9Y5X2	SNX8_HUMAN	V	219;205;166	.	ENSP00000222990:A219V	A	-	2	0	SNX8	2270585	1.000000	0.71417	0.929000	0.37066	0.904000	0.53231	7.146000	0.77373	2.340000	0.79590	0.655000	0.94253	GCC			0.587	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322949.2			
TNRC18	84629	mdanderson.org	37	7	5364801	5364801	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr7:5364801C>T	ENST00000430969.1	-	20	6574	c.6226G>A	c.(6226-6228)Gct>Act	p.A2076T	TNRC18_ENST00000399537.4_Missense_Mutation_p.A2076T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2076							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCGTGAGGAGCCCTGGCCTCA	0.642																																					p.A2076T													.	.			0			c.G6226A												18.0	18.0	18.0					7																	5364801		1537	3503	5040	SO:0001583	missense	84629	exon20			GAGGAGCCCTGGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.6226G>A	7.37:g.5364801C>T	ENSP00000395538:p.Ala2076Thr		28	0	0		39	0.08	3	NM_001080495	49	0.00	0	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	.	12.25	1.881984	0.33255	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544	T;T	0.13420	2.59;2.6	4.26	3.36	0.38483	.	1.911950	0.03391	N	0.201900	T	0.13200	0.0320	L	0.40543	1.245	0.09310	N	1	B	0.18310	0.027	B	0.14023	0.01	T	0.27606	-1.0069	10	0.17832	T	0.49	.	7.8166	0.29263	0.0:0.7324:0.0:0.2676	.	2076	O15417	TNC18_HUMAN	T	2076;2076;1131	ENSP00000382452:A2076T;ENSP00000395538:A2076T	ENSP00000382452:A2076T	A	-	1	0	TNRC18	5331327	0.996000	0.38824	0.993000	0.49108	0.551000	0.35334	1.593000	0.36686	1.933000	0.56026	0.290000	0.19541	GCT			0.642	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding					
CCT6P1	643253	broad.mit.edu	37	7	65226641	65226641	+	RNA	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr7:65226641G>T	ENST00000442266.1	+	0	1167				SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		AGGTTCTTGCGCAGAATTCTG	0.383																																					.													.	.			0			.																																											0	.			TCTTGCGCAGAAT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65226641G>T			111	0.027027027	3		129	0.02	3	.	25	0.00	0		RNA	SNP	ENST00000442266.1	37																																																																																						0.383	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345507.1		NR_003110	
KLRG2	346689	mdanderson.org	37	7	139168282	139168282	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr7:139168282G>T	ENST00000340940.4	-	1	176	c.107C>A	c.(106-108)gCg>gAg	p.A36E	KLRG2_ENST00000393039.2_Missense_Mutation_p.A36E	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	36	Pro-rich.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					TCGCACCTTCGCGGGCACCTG	0.701																																					p.A36E													.	.			0			c.C107A												12.0	15.0	14.0					7																	139168282		1932	3970	5902	SO:0001583	missense	346689	exon1			ACCTTCGCGGGCA	AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.107C>A	7.37:g.139168282G>T	ENSP00000339356:p.Ala36Glu		22	0	0		30	0.10	3	NM_198508	288	0.00	0	Q2NL79|Q6ZTV6	Missense_Mutation	SNP	ENST00000340940.4	37	CCDS5854.1	.	.	.	.	.	.	.	.	.	.	G	6.061	0.379666	0.11466	.	.	ENSG00000188883	ENST00000340940;ENST00000393039	T;T	0.56776	3.36;0.44	3.16	1.16	0.20824	.	0.867806	0.09336	N	0.816224	T	0.33933	0.0880	N	0.17082	0.46	0.09310	N	1	B;B	0.17852	0.024;0.004	B;B	0.21151	0.033;0.014	T	0.25117	-1.0141	10	0.26408	T	0.33	-6.5321	7.2762	0.26286	0.0:0.1786:0.6356:0.1858	.	36;36	A4D1S0-2;A4D1S0	.;KLRG2_HUMAN	E	36	ENSP00000339356:A36E;ENSP00000376759:A36E	ENSP00000339356:A36E	A	-	2	0	KLRG2	138818822	0.000000	0.05858	0.005000	0.12908	0.009000	0.06853	-0.089000	0.11180	-0.263000	0.09378	-2.386000	0.00229	GCG			0.701	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349433.1		NM_198508	
KMT2C	58508	mdanderson.org	37	7	151945313	151945313	+	Silent	SNP	A	A	G	rs372718879		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr7:151945313A>G	ENST00000262189.6	-	14	2424	c.2206T>C	c.(2206-2208)Ttg>Ctg	p.L736L	KMT2C_ENST00000355193.2_Silent_p.L736L	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	736					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GAGTCCATCAATCCAGTAGAA	0.373																																					p.L736L													.	.			0			c.T2206C												75.0	74.0	74.0					7																	151945313		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon14			CCATCAATCCAGT	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2206T>C	7.37:g.151945313A>G			111	0.009009009	1		166	0.08	14	NM_170606	29	0.00	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1																																																																																					0.373	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318887.3			
FGF20	26281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	16853180	16853180	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr8:16853180C>T	ENST00000180166.5	-	2	522	c.374G>A	c.(373-375)gGa>gAa	p.G125E		NM_019851.2	NP_062825.1	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	125					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of cardiac muscle cell proliferation (GO:0060043)|signal transduction (GO:0007165)	extracellular region (GO:0005576)		p.G125E(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	11				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		ATAGAGTTCTCCTTTGTCATT	0.318																																					p.G125E													FGF20,leg,malignant_melanoma,0,1	FGF20	0	1	1	Substitution - Missense(1)	skin(1)	c.G374A												105.0	98.0	100.0					8																	16853180		2203	4300	6503	SO:0001583	missense	26281	exon2			AGTTCTCCTTTGT	AB030648	CCDS5998.1	8p22	2008-05-15			ENSG00000078579	ENSG00000078579			3677	protein-coding gene	gene with protein product		605558				10913340	Standard	NM_019851		Approved		uc003wxc.1	Q9NP95	OTTHUMG00000096964	ENST00000180166.5:c.374G>A	8.37:g.16853180C>T	ENSP00000180166:p.Gly125Glu		82	0	0		143	0.24	35	NM_019851	0		0	B2RPH5	Missense_Mutation	SNP	ENST00000180166.5	37	CCDS5998.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937811	0.92458	.	.	ENSG00000078579	ENST00000180166	D	0.92545	-3.06	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.97754	0.9263	H	0.96916	3.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98278	1.0507	10	0.87932	D	0	.	20.2886	0.98538	0.0:1.0:0.0:0.0	.	125	Q9NP95	FGF20_HUMAN	E	125	ENSP00000180166:G125E	ENSP00000180166:G125E	G	-	2	0	FGF20	16897551	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	GGA			0.318	FGF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214030.1			
DUSP4	1846	mdanderson.org	37	8	29207485	29207485	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr8:29207485G>A	ENST00000240100.2	-	1	700	c.311C>T	c.(310-312)gCg>gTg	p.A104V	DUSP4_ENST00000240101.2_5'Flank|RP4-676L2.1_ENST00000567818.1_RNA	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	104	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		GACGATGACCGCCGAGTAGAG	0.731																																					p.A104V													.	.			0			c.C311T												7.0	8.0	8.0					8																	29207485		2131	4188	6319	SO:0001583	missense	1846	exon1			ATGACCGCCGAGT	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.311C>T	8.37:g.29207485G>A	ENSP00000240100:p.Ala104Val		22	0	0		39	0.08	3	NM_001394	0		0	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	ENST00000240100.2	37	CCDS6072.1	.	.	.	.	.	.	.	.	.	.	G	35	5.538945	0.96474	.	.	ENSG00000120875	ENST00000240100	T	0.25579	1.79	3.89	3.89	0.44902	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.38799	0.1054	M	0.61703	1.905	0.80722	D	1	D	0.64830	0.994	P	0.54499	0.754	T	0.16958	-1.0385	10	0.42905	T	0.14	.	14.1674	0.65486	0.0:0.0:1.0:0.0	.	104	Q13115	DUS4_HUMAN	V	104	ENSP00000240100:A104V	ENSP00000240100:A104V	A	-	2	0	DUSP4	29263404	1.000000	0.71417	0.993000	0.49108	0.987000	0.75469	5.851000	0.69481	2.467000	0.83353	0.491000	0.48974	GCG			0.731	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257249.1		NM_001394	
DOCK8	81704	mdanderson.org	37	9	396818	396818	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr9:396818G>T	ENST00000453981.1	+	25	3116	c.3004G>T	c.(3004-3006)Gac>Tac	p.D1002Y	DOCK8_ENST00000432829.2_Missense_Mutation_p.D934Y|DOCK8_ENST00000382329.1_Missense_Mutation_p.D469Y|DOCK8_ENST00000469391.1_Missense_Mutation_p.D902Y|DOCK8_ENST00000382331.1_Missense_Mutation_p.D304Y			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1002					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ACATAACATGGACAAACGGGA	0.468																																					p.D1002Y													.	.			0			c.G3004T												200.0	186.0	191.0					9																	396818		2203	4300	6503	SO:0001583	missense	81704	exon25			AACATGGACAAAC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3004G>T	9.37:g.396818G>T	ENSP00000408464:p.Asp1002Tyr		114	0	0		74	0.05	4	NM_203447	14	0.00	0	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	37	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048042	0.93740	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382331;ENST00000382329	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	5.7	5.7	0.88788	.	0.095697	0.64402	D	0.000001	T	0.52025	0.1709	M	0.68593	2.085	0.80722	D	1	D;P;P;P	0.89917	1.0;0.881;0.881;0.881	D;P;P;P	0.74023	0.982;0.615;0.615;0.615	T	0.48468	-0.9033	10	0.56958	D	0.05	.	19.8411	0.96685	0.0:0.0:1.0:0.0	.	304;902;469;1002	A2A370;E9PH09;A2A369;Q8NF50	.;.;.;DOCK8_HUMAN	Y	1002;970;934;902;304;469	ENSP00000408464:D1002Y;ENSP00000394888:D934Y;ENSP00000419438:D902Y;ENSP00000371768:D304Y;ENSP00000371766:D469Y	ENSP00000287364:D970Y	D	+	1	0	DOCK8	386818	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.796000	0.85898	2.683000	0.91414	0.655000	0.94253	GAC			0.468	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171792.5		XM_036307	
Unknown	0	bcgsc.ca	37	9	45376206	45376206	+	IGR	SNP	A	A	C	rs372171742		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr9:45376206A>C								RP11-449H15.2 (163705 upstream) : RP11-187C18.5 (17638 downstream)																							TCGCGGACCAAACCAACGATG	0.527																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	441420	.			GGACCAAACCAAC																													9.37:g.45376206A>C			40	0.05	2		46	0.17	8	.	2	0.00	0		RNA	SNP		37																																																																																					0	0.527										
LINC00475	158314	broad.mit.edu	37	9	94907350	94907351	+	RNA	INS	-	-	T	rs112532694	byFrequency	TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr9:94907350_94907351insT	ENST00000416438.2	+	0	184				snoU13_ENST00000459125.1_RNA	NR_027341.1				long intergenic non-protein coding RNA 475																		TTTGTTTCTTCTTTTTTTTTAA	0.431													?|TTTTTTTTT|TTTTTTTTTT|unsure	40	0.00798722	0.0197	0.0058	5008	,	,		21834	0.006		0.002	False		,,,				2504	0.002				.													.	.			0			.																																											0	.			TTTCTTCTTTTTT	AK023662		9q22.31	2012-10-12	2011-08-31	2011-08-31	ENSG00000225511	ENSG00000225511		"""Long non-coding RNAs"""	23569	non-coding RNA	RNA, long non-coding			"""chromosome 9 open reading frame 44"""	C9orf44			Standard	NR_027341		Approved		uc004arp.1		OTTHUMG00000020216		9.37:g.94907359_94907359dupT			5	0	0		8	0.75	6	.	0		0		RNA	INS	ENST00000416438.2	37																																																																																						0.431	LINC00475-003	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000053051.2			
WNK2	65268	bcgsc.ca	37	9	95947703	95947703	+	Missense_Mutation	SNP	G	G	T	rs369083880		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr9:95947703G>T	ENST00000297954.4	+	1	492	c.492G>T	c.(490-492)gaG>gaT	p.E164D	WNK2_ENST00000395475.2_Missense_Mutation_p.E150D|WNK2_ENST00000349097.3_5'UTR|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000427277.2_5'UTR|WNK2_ENST00000395477.2_Missense_Mutation_p.E164D	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	164					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CGAAGCCTGAGCCCGGGCGCA	0.731																																					p.E164D													.	WNK2	277		0			c.G492T												14.0	17.0	16.0					9																	95947703		2193	4290	6483	SO:0001583	missense	65268	exon1			GCCTGAGCCCGGG	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.492G>T	9.37:g.95947703G>T	ENSP00000297954:p.Glu164Asp		38	0	0		44	0.09	4	NM_006648	23	0.00	0	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.895|9.895	1.205284|1.205284	0.22205|0.22205	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000448039;ENST00000297954;ENST00000395477;ENST00000395475|ENST00000432730	T;T;T;T|.	0.71817|.	-0.6;-0.5;-0.5;-0.59|.	4.24|4.24	1.03|1.03	0.20045|0.20045	.|.	0.734363|.	0.11667|.	N|.	0.541269|.	T|T	0.21227|0.21227	0.0511|0.0511	N|N	0.08118|0.08118	0|0	0.54753|0.54753	D|D	0.999986|0.999986	B;B;B;B|.	0.13594|.	0.002;0.008;0.002;0.001|.	B;B;B;B|.	0.11329|.	0.004;0.006;0.004;0.002|.	T|T	0.07966|0.07966	-1.0745|-1.0745	10|5	0.33940|.	T|.	0.23|.	.|.	0.7654|0.7654	0.01014|0.01014	0.1799:0.2285:0.3583:0.2333|0.1799:0.2285:0.3583:0.2333	.|.	164;164;164;164|.	Q9Y3S1-2;Q9Y3S1-4;F8W9F9;Q9Y3S1|.	.;.;.;WNK2_HUMAN|.	D|I	164;164;164;150|160	ENSP00000412465:E164D;ENSP00000297954:E164D;ENSP00000378860:E164D;ENSP00000378858:E150D|.	ENSP00000297954:E164D|.	E|S	+|+	3|2	2|0	WNK2|WNK2	94987524|94987524	.|.	.|.	0.240000|0.240000	0.24138|0.24138	0.073000|0.073000	0.16967|0.16967	.|.	.|.	0.876000|0.876000	0.35872|0.35872	0.561000|0.561000	0.74099|0.74099	GAG|AGC			0.731	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000317359.1		NM_006648	
VCX3B	425054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	8434340	8434340	+	Silent	SNP	G	G	A			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chrX:8434340G>A	ENST00000381032.1	+	3	964	c.657G>A	c.(655-657)caG>caA	p.Q219Q	VCX3B_ENST00000453306.1_Intron|VCX3B_ENST00000381029.4_Silent_p.Q187Q|VCX3B_ENST00000444481.1_Silent_p.Q189Q|VCX3B_ENST00000440654.2_Silent_p.Q169Q	NM_001001888.3	NP_001001888.3	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B	219	14 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.					nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|urinary_tract(3)	11						AGGAGAGCCAGGTGGAGGAAC	0.562																																					p.Q219Q													.	.			0			c.G657A												87.0	166.0	139.0					X																	8434340		2182	4246	6428	SO:0001819	synonymous_variant	425054	exon3			GAGCCAGGTGGAG		CCDS48077.1, CCDS48077.2	Xp22.31	2009-01-14			ENSG00000205642	ENSG00000205642			31838	protein-coding gene	gene with protein product							Standard	NM_001001888		Approved	VCX-C	uc011mht.2	Q9H321	OTTHUMG00000021106	ENST00000381032.1:c.657G>A	X.37:g.8434340G>A			289	0.0034602076	1		434	0.41	179	NM_001001888	62	0.11	7	C9JS46|Q4KN12	Silent	SNP	ENST00000381032.1	37	CCDS48077.2																																																																																					0.562	VCX3B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000055691.1			
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28		8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A												52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A			203	0.0049261084	1		341	0.02	8	NM_153183	109	0.00	0	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																					0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056578.1		NM_153183	
SPIN2B	474343	broad.mit.edu	37	X	57146615	57146615	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chrX:57146615T>C	ENST00000333933.3	-	2	758	c.448A>G	c.(448-450)Atg>Gtg	p.M150V	SPIN2B_ENST00000275988.5_Missense_Mutation_p.M150V|RP3-323P24.3_ENST00000439622.1_RNA|SPIN2B_ENST00000460948.1_Intron|SPIN2B_ENST00000374912.5_Missense_Mutation_p.M150V|SPIN2B_ENST00000374910.3_Intron	NM_001006681.1	NP_001006682.1	Q9BPZ2	SPI2B_HUMAN	spindlin family, member 2B	150					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				endometrium(3)|large_intestine(1)|skin(1)	5						GCTAAGACCATCCCCCTCCAT	0.408																																					p.M150V													.	SPIN2B	11		0			c.A448G												89.0	80.0	83.0					X																	57146615		2200	4294	6494	SO:0001583	missense	474343	exon2			AGACCATCCCCCT	AF356353	CCDS35311.1, CCDS65274.1	Xp11.1	2014-02-12	2006-12-05		ENSG00000186787	ENSG00000186787			33147	protein-coding gene	gene with protein product		300517				12145692	Standard	XM_005262010		Approved	SPIN-2	uc004dva.3	Q9BPZ2	OTTHUMG00000021680	ENST00000333933.3:c.448A>G	X.37:g.57146615T>C	ENSP00000335008:p.Met150Val		349	0.0028653295	1		541	0.01	7	NM_001006683	13	0.00	0	Q7Z2M0	Missense_Mutation	SNP	ENST00000333933.3	37	CCDS35311.1	.	.	.	.	.	.	.	.	.	.	t	8.506	0.865304	0.17250	.	.	ENSG00000186787	ENST00000275988;ENST00000374912;ENST00000333933;ENST00000434397	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	2.37	2.37	0.29283	.	0.000000	0.85682	D	0.000000	T	0.29684	0.0741	L	0.33753	1.03	0.40170	D	0.97716	B	0.33694	0.421	B	0.37304	0.246	T	0.05852	-1.0860	10	0.23302	T	0.38	-23.7792	7.9777	0.30164	0.0:0.0:0.0:1.0	.	150	Q9BPZ2	SPI2B_HUMAN	V	150	ENSP00000275988:M150V;ENSP00000364047:M150V;ENSP00000335008:M150V;ENSP00000404314:M150V	ENSP00000275988:M150V	M	-	1	0	SPIN2B	57163340	1.000000	0.71417	0.997000	0.53966	0.667000	0.39255	6.542000	0.73869	1.215000	0.43411	0.143000	0.16000	ATG			0.408	SPIN2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056912.1		NM_001006681	
HS6ST2	90161	mdanderson.org	37	X	132092425	132092425	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chrX:132092425T>C	ENST00000370836.2	-	2	621	c.206A>G	c.(205-207)gAc>gGc	p.D69G	HS6ST2_ENST00000521489.1_Missense_Mutation_p.D69G|HS6ST2_ENST00000370833.2_5'Flank	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	69					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					TCGGGGCTTGTCCAGGAGCGG	0.726																																					p.D69G													.	.			0			c.A206G												7.0	10.0	10.0					X																	132092425		1757	3901	5658	SO:0001583	missense	90161	exon2			GGCTTGTCCAGGA	AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.206A>G	X.37:g.132092425T>C	ENSP00000359873:p.Asp69Gly		13	0	0		16	0.19	3	NM_001077188	0		0	B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	ENST00000370836.2	37	CCDS48169.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.330471	0.24167	.	.	ENSG00000171004	ENST00000370836;ENST00000521489	T;T	0.74526	-0.84;-0.85	3.65	3.65	0.41850	.	0.374424	0.19509	N	0.112557	T	0.53417	0.1795	N	0.08118	0	0.80722	D	1	B;B	0.29531	0.071;0.247	B;B	0.28139	0.019;0.086	T	0.58393	-0.7644	10	0.87932	D	0	-28.4584	9.4942	0.38978	0.0:0.0:0.0:1.0	.	69;69	Q96MM7;E9PDY5	H6ST2_HUMAN;.	G	69	ENSP00000359873:D69G;ENSP00000429473:D69G	ENSP00000359873:D69G	D	-	2	0	HS6ST2	131920097	0.986000	0.35501	0.991000	0.47740	0.412000	0.31113	1.999000	0.40806	1.669000	0.50854	0.486000	0.48141	GAC			0.726	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000058332.3		NM_147174	
CYP21A2	1589	mdanderson.org	37	6	32008888	32008888	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHG-01A-11D-A42Y-10	TCGA-2G-AAHG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	10eaeb31-4b4d-4a4e-b429-25eaf4d45fa9	6a857e34-f9b6-4512-980b-8bc82ecddee7	g.chr6:32008888C>T	ENST00000418967.2	+	10	1623	c.1465C>T	c.(1465-1467)Cac>Tac	p.H489Y	CYP21A2_ENST00000435122.2_Missense_Mutation_p.H459Y	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	488					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	GATGGGGGCCCACAGCCCGGG	0.682																																					.	Melanoma(174;1669 1998 3915 34700 46447)												.	.			0			.												15.0	17.0	16.0					6																	32008888		1431	2616	4047	SO:0001583	missense	1589	.			GGGGCCCACAGCC	X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.1465C>T	6.37:g.32008888C>T	ENSP00000408860:p.His489Tyr		11	0	0		21	0.10	2	.	0		0	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Missense_Mutation	SNP	ENST00000418967.2	37	CCDS4735.1	.	.	.	.	.	.	.	.	.	.	c	3.832	-0.035567	0.07497	.	.	ENSG00000231852	ENST00000418967;ENST00000435122	T;T	0.71461	-0.46;-0.57	5.13	2.13	0.27403	.	3.007070	0.01180	N	0.007076	T	0.32436	0.0829	N	0.08118	0	0.09310	N	1	B;B	0.17465	0.009;0.022	B;B	0.19666	0.018;0.026	T	0.32025	-0.9922	10	0.56958	D	0.05	.	6.4994	0.22160	0.0:0.5455:0.3569:0.0975	.	459;489	Q5ST44;Q16874	.;.	Y	489;459	ENSP00000408860:H489Y;ENSP00000415043:H459Y	ENSP00000408860:H489Y	H	+	1	0	CYP21A2	32116867	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.261000	0.18442	1.265000	0.44215	0.604000	0.83254	CAC			0.682	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268768.2		NM_000500	
