#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PRDM2	7799	broad.mit.edu	37	1	14105106	14105106	+	Silent	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:14105106G>A	ENST00000235372.7	+	8	1672	c.816G>A	c.(814-816)gaG>gaA	p.E272E	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Silent_p.E71E|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000311066.5_Silent_p.E272E|PRDM2_ENST00000413440.1_Silent_p.E71E	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	272	Asp/Glu-rich (acidic).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aggaggaggaggaagaggagg	0.517																																					p.E272E													.	PRDM2	147		0			c.G816A												47.0	49.0	48.0					1																	14105106		2203	4300	6503	SO:0001819	synonymous_variant	7799	exon8			GGAGGAGGAAGAG	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.816G>A	1.37:g.14105106G>A			148	0	0		193	0.03	5	NM_015866	7	0.00	0	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Silent	SNP	ENST00000235372.7	37	CCDS150.1																																																																																					0.517	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000021792.2		NM_012231	
C1orf94	84970	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34643423	34643423	+	Silent	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:34643423G>A	ENST00000488417.1	+	1	153	c.33G>A	c.(31-33)ctG>ctA	p.L11L	AC115286.1_ENST00000408126.1_RNA|C1orf94_ENST00000373374.3_Intron	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	11										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				TTCTAGCCCTGGGTGGACAGA	0.617																																					p.L11L													.	.			0			c.G33A												8.0	10.0	9.0					1																	34643423		691	1588	2279	SO:0001819	synonymous_variant	84970	exon1			AGCCCTGGGTGGA	AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.33G>A	1.37:g.34643423G>A			75	0	0		99	0.20	20	NM_001134734	0		0	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	ENST00000488417.1	37	CCDS44108.1																																																																																					0.617	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036845.2		NM_032884	
ELAVL4	1996	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	50642764	50642765	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:50642764_50642765delAG	ENST00000371823.4	+	3	478_479	c.254_255delAG	c.(253-255)cagfs	p.Q85fs	ELAVL4_ENST00000371819.1_Frame_Shift_Del_p.Q90fs|ELAVL4_ENST00000371824.1_Frame_Shift_Del_p.Q85fs|ELAVL4_ENST00000448907.2_Frame_Shift_Del_p.Q88fs|ELAVL4_ENST00000492299.1_3'UTR|ELAVL4_ENST00000371821.1_Frame_Shift_Del_p.Q90fs|ELAVL4_ENST00000371827.1_Frame_Shift_Del_p.Q85fs|ELAVL4_ENST00000357083.4_Frame_Shift_Del_p.Q102fs|RP11-567C20.2_ENST00000442477.1_RNA	NM_001144774.1|NM_021952.3	NP_001138246.1|NP_068771.2	P26378	ELAV4_HUMAN	ELAV like neuron-specific RNA binding protein 4	85	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA processing (GO:0006396)		AU-rich element binding (GO:0017091)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	32						TCCACAGGACAGAGTTTAGGGT	0.401																																					p.102_102del													ELAVL4_ENST00000357083,NS,carcinoma,0,2	ELAVL4	124		0			c.304_305del																																									SO:0001589	frameshift_variant	1996	exon3			CAGGACAGAGTTT	AY033998	CCDS553.1, CCDS44138.1, CCDS44139.1, CCDS44140.1, CCDS53315.1, CCDS72788.1	1p34	2013-10-03	2013-10-03		ENSG00000162374	ENSG00000162374		"""RNA binding motif (RRM) containing"""	3315	protein-coding gene	gene with protein product	"""Hu antigen D"""	168360	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4"""	HUD		8222755	Standard	XM_005270581		Approved	PNEM	uc001csb.2	P26378	OTTHUMG00000007877	ENST00000371823.4:c.254_255delAG	1.37:g.50642766_50642767delAG	ENSP00000360888:p.Gln85fs		72	0	0		73	0.18	13	NM_001144775	0		0	B1APY6|B1APY7|B7Z4G7|Q8IYD4|Q96J74|Q96J75|Q9UD24	Frame_Shift_Del	DEL	ENST00000371823.4	37	CCDS553.1																																																																																					0.401	ELAVL4-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000021712.1		NM_021952	
MIR137HG	400765	hgsc.bcm.edu	37	1	98511786	98511786	+	lincRNA	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:98511786C>T	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		ctactgccgccgccgccgcCA	0.632																																					.													.	.			0			.												3.0	7.0	6.0					1																	98511786		293	1060	1353			400765	.			TGCCGCCGCCGCC	AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511786C>T			98	0	0		88	0.19	17	.	0		0		RNA	SNP	ENST00000580305.1	37																																																																																						0.632	MIR137HG-203	KNOWN	basic	miRNA	lincRNA				NR_046105	
PRPF38B	55119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	109241987	109241989	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	GCA	GCA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:109241987_109241989delGCA	ENST00000370025.4	+	6	1255_1257	c.986_988delGCA	c.(985-990)cgcagc>cgc	p.S330del	PRPF38B_ENST00000370021.1_In_Frame_Del_p.S219del	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	330	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)	p.R329H(1)		NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		GAACGCAGGCGCAGCAGAAGTAG	0.507																																					p.329_329del													.	PRPF38B	55		1	Substitution - Missense(1)	large_intestine(1)	c.985_987del																																									SO:0001651	inframe_deletion	55119	exon6			GCAGGCGCAGCAG	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.986_988delGCA	1.37:g.109241990_109241992delGCA	ENSP00000359042:p.Ser330del		156	0	0		184	0.23	43	NM_018061	212	0.00	0	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	In_Frame_Del	DEL	ENST00000370025.4	37	CCDS788.1																																																																																					0.507	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030231.1		NM_018061	
FLG2	388698	bcgsc.ca	37	1	152327658	152327658	+	Silent	SNP	T	T	A	rs12724005	byFrequency	TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:152327658T>A	ENST00000388718.5	-	3	2676	c.2604A>T	c.(2602-2604)acA>acT	p.T868T	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	868	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAAAGCCAGATGTCTGTCCCG	0.498													T|||	225	0.0449281	0.0008	0.0749	5008	,	,		23493	0.1071		0.007	False		,,,				2504	0.0583				p.T868T													.	FLG2	431		0			c.A2604T												380.0	327.0	345.0					1																	152327658		2201	4283	6484	SO:0001819	synonymous_variant	388698	exon3			GCCAGATGTCTGT	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2604A>T	1.37:g.152327658T>A			86	0.011627907	1		47	0.19	9	NM_001014342	0		0	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																					0.498	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034018.5		NM_001014342	
PLEKHA6	22874	mdanderson.org	37	1	204210552	204210552	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:204210552G>T	ENST00000272203.3	-	17	2676	c.2360C>A	c.(2359-2361)gCa>gAa	p.A787E	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.A807E	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	787										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			TCTTACCACTGCTGATGGGGT	0.597																																					p.A787E													.	.			0			c.C2360A												47.0	39.0	42.0					1																	204210552		2203	4300	6503	SO:0001583	missense	22874	exon17			ACCACTGCTGATG	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2360C>A	1.37:g.204210552G>T	ENSP00000272203:p.Ala787Glu		39	0	0		54	0.06	3	NM_014935	1	0.00	0	A7MD51|Q5VTI6	Missense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	G	6.927	0.540807	0.13250	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.10005	2.92;3.38	5.7	1.74	0.24563	.	1.477610	0.03950	N	0.288325	T	0.11965	0.0291	L	0.40543	1.245	0.09310	N	1	B	0.18741	0.03	B	0.18561	0.022	T	0.37244	-0.9714	10	0.66056	D	0.02	1.8226	7.5591	0.27841	0.0733:0.4828:0.3457:0.0982	.	787	Q9Y2H5	PKHA6_HUMAN	E	787;807	ENSP00000272203:A787E;ENSP00000402046:A807E	ENSP00000272203:A787E	A	-	2	0	PLEKHA6	202477175	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.792000	0.26929	0.068000	0.16574	-0.140000	0.14226	GCA			0.597	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087889.3		NM_014935	
Unknown	0	bcgsc.ca	37	1	249066288	249066288	+	IGR	SNP	A	A	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr1:249066288A>C								LYPD8 (163138 upstream) : SH3BP5L (38361 downstream)																							CTTTTTATCCATGTCATAAGT	0.448																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTATCCATGTCAT																													1.37:g.249066288A>C			30	0	0		32	0.34	11	.	0		0		RNA	SNP		37																																																																																					0	0.448										
PRKCQ	5588	bcgsc.ca;mdanderson.org	37	10	6470241	6470241	+	Silent	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr10:6470241G>T	ENST00000263125.5	-	18	2148	c.2049C>A	c.(2047-2049)atC>atA	p.I683I	PRKCQ_ENST00000539722.1_Silent_p.I558I|PRKCQ_ENST00000397176.2_Silent_p.I620I	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	683	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CCATGCTGTTGATCAGTGCTC	0.463																																					p.I683I	Ovarian(50;572 1126 10530 25349 30594)												.	PRKCQ	113		0			c.C2049A												207.0	213.0	211.0					10																	6470241		2203	4300	6503	SO:0001819	synonymous_variant	5588	exon18			GCTGTTGATCAGT	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.2049C>A	10.37:g.6470241G>T			76	0	0		72	0.07	5	NM_006257	7	0.00	0	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Silent	SNP	ENST00000263125.5	37	CCDS7079.1	.	.	.	.	.	.	.	.	.	.	G	8.379	0.837174	0.16891	.	.	ENSG00000065675	ENST00000397178	.	.	.	5.56	3.53	0.40419	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2853	0.31924	0.0798:0.0:0.5288:0.3914	.	.	.	.	X	456	.	.	S	-	2	0	PRKCQ	6510247	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	2.545000	0.45769	1.336000	0.45506	0.561000	0.74099	TCA			0.463	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046665.1		NM_006257	
ALDH18A1	5832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	97370021	97370021	+	Silent	SNP	G	G	A	rs147842812		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr10:97370021G>A	ENST00000371224.2	-	17	2276	c.2139C>T	c.(2137-2139)caC>caT	p.H713H	ALDH18A1_ENST00000371221.3_Silent_p.H711H	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	713	Gamma-glutamyl phosphate reductase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		CACTGTCTACGTGCTGCAGGA	0.488																																					p.H713H													.	.			0			c.C2139T							G	,	1,4405	2.1+/-5.4	0,1,2202	110.0	92.0	98.0		2133,2139	-5.3	0.4	10	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ALDH18A1	NM_001017423.1,NM_002860.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	711/794,713/796	97370021	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5832	exon17			GTCTACGTGCTGC	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.2139C>T	10.37:g.97370021G>A			86	0	0		99	0.35	35	NM_002860	303	0.66	200	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Silent	SNP	ENST00000371224.2	37	CCDS7443.1																																																																																			0		0.488	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049552.1		NM_002860	
MUC2	4583	mdanderson.org	37	11	1092969	1092969	+	Silent	SNP	A	A	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:1092969A>T	ENST00000441003.2	+	30	4815	c.4788A>T	c.(4786-4788)ccA>ccT	p.P1596P	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccaacacccaccg	0.632																																					p.P1596P													.	.			0			c.A4788T												47.0	82.0	69.0					11																	1092969		1778	3232	5010	SO:0001819	synonymous_variant	4583	exon30			AACCCCAACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4788A>T	11.37:g.1092969A>T			36	0	0		38	0.08	3	NM_002457	0		0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																						0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MUC5B	727897	broad.mit.edu	37	11	1268816	1268816	+	Missense_Mutation	SNP	C	C	T	rs71469871		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:1268816C>T	ENST00000529681.1	+	31	10764	c.10706C>T	c.(10705-10707)aCg>aTg	p.T3569M	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T3572M	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3569	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCACGGGCTGTGAG	0.657																																					p.T3569M													.	MUC5B	473		0			c.C10706T												29.0	40.0	37.0					11																	1268816		1891	4068	5959	SO:0001583	missense	727897	exon31			TGACCACGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10706C>T	11.37:g.1268816C>T	ENSP00000436812:p.Thr3569Met		245	0.0040816327	1		224	0.02	4	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	c	5.804	0.332711	0.11013	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.19394	2.15;2.37	3.55	2.61	0.31194	.	.	.	.	.	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	D;P	0.57899	0.981;0.907	D;B	0.65323	0.934;0.153	T	0.08207	-1.0733	9	0.87932	D	0	.	5.2614	0.15576	0.0:0.6657:0.2138:0.1205	.	4097;3572	A7Y9J9;E9PBJ0	.;.	M	3569;3572;3541;3474	ENSP00000436812:T3569M;ENSP00000415793:T3572M	ENSP00000343037:T3541M	T	+	2	0	MUC5B	1225392	0.000000	0.05858	0.006000	0.13384	0.020000	0.10135	0.326000	0.19646	0.590000	0.29694	0.485000	0.47835	ACG			0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
TRIM3	10612	mdanderson.org	37	11	6477339	6477339	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:6477339C>T	ENST00000525074.1	-	7	1890	c.1496G>A	c.(1495-1497)cGc>cAc	p.R499H	TRIM3_ENST00000345851.3_Missense_Mutation_p.R499H|TRIM3_ENST00000529058.1_5'Flank|TRIM3_ENST00000537602.1_Missense_Mutation_p.R421H|TRIM3_ENST00000536344.1_Missense_Mutation_p.R380H|TRIM3_ENST00000359518.3_Missense_Mutation_p.R499H	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	499					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TACCACGATGCGGCCGCTGCT	0.498																																					p.R499H	Melanoma(6;5 510 1540 25169 29084)												.	.			0			c.G1496A												113.0	104.0	107.0					11																	6477339		2201	4296	6497	SO:0001583	missense	10612	exon8			ACGATGCGGCCGC	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.1496G>A	11.37:g.6477339C>T	ENSP00000433102:p.Arg499His		57	0	0		52	0.06	3	NM_006458	33	0.00	0	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	ENST00000525074.1	37	CCDS7764.1	.	.	.	.	.	.	.	.	.	.	C	31	5.083308	0.94050	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000536344	T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6	5.66	5.66	0.87406	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	L	0.42245	1.32	0.53688	D	0.999978	D;D	0.89917	1.0;0.999	D;D	0.70487	0.961;0.969	T	0.72469	-0.4284	10	0.29301	T	0.29	-20.3884	11.7541	0.51866	0.0:0.919:0.0:0.081	.	380;499	F5H2Q8;O75382	.;TRIM3_HUMAN	H	499;499;499;499;488;421;499;380	ENSP00000433102:R499H;ENSP00000340797:R499H;ENSP00000441091:R421H;ENSP00000352508:R499H;ENSP00000445460:R380H	ENSP00000337094:R488H	R	-	2	0	TRIM3	6433915	0.437000	0.25593	1.000000	0.80357	0.994000	0.84299	2.669000	0.46825	2.667000	0.90743	0.563000	0.77884	CGC			0.498	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384224.2		NM_006458	
CCDC73	493860	hgsc.bcm.edu	37	11	32635415	32635415	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:32635415G>T	ENST00000335185.5	-	16	2492	c.2449C>A	c.(2449-2451)Cag>Aag	p.Q817K	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	817										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TCAGTTACCTGATTCTCATCA	0.333																																					p.K817K													.	.			0			c.A2449A												123.0	106.0	111.0					11																	32635415		1821	4085	5906	SO:0001583	missense	493860	exon16			TTACCTGATTCTC	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.2449C>A	11.37:g.32635415G>T	ENSP00000335325:p.Gln817Lys		89	0	0		97	0.04	4	NM_001008391	0		0	Q6P5Q7|Q6ZMW0|Q86WE7	Silent	SNP	ENST00000335185.5	37	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453648	0.63290	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.64	4.72	0.59763	.	0.469312	0.19820	N	0.105330	T	0.68458	0.3003	M	0.61703	1.905	0.80722	D	1	D	0.65815	0.995	P	0.58721	0.844	T	0.70644	-0.4815	9	0.66056	D	0.02	.	13.2994	0.60315	0.0748:0.0:0.9252:0.0	.	817	Q6ZRK6	CCD73_HUMAN	K	817	.	ENSP00000335325:Q817K	Q	-	1	0	CCDC73	32591991	0.998000	0.40836	1.000000	0.80357	0.909000	0.53808	2.584000	0.46102	2.645000	0.89757	0.650000	0.86243	CAG			0.333	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388874.2		NM_001008391	
PELI3	246330	broad.mit.edu	37	11	66241455	66241455	+	Intron	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:66241455T>C	ENST00000320740.7	+	7	1000				CTD-3074O7.5_ENST00000533502.1_RNA|PELI3_ENST00000524466.1_Missense_Mutation_p.I300T|PELI3_ENST00000531856.1_Intron|PELI3_ENST00000349459.6_Intron|CTD-3074O7.5_ENST00000602951.1_RNA|CTD-3074O7.5_ENST00000527092.1_RNA	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3						defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						AAGCTGCCCATCCCCCTGCCC	0.642																																					.													.	PELI3	36		0			.																																									SO:0001627	intron_variant	246330	.			TGCCCATCCCCCT	AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.840+59T>C	11.37:g.66241455T>C			25	0	0		40	0.08	3	.	3	0.00	0	Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Missense_Mutation	SNP	ENST00000320740.7	37	CCDS31615.1	.	.	.	.	.	.	.	.	.	.	T	11.06	1.527084	0.27299	.	.	ENSG00000174516	ENST00000524466	.	.	.	3.77	-7.54	0.01332	.	.	.	.	.	T	0.21145	0.0509	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.24261	-1.0165	6	.	.	.	.	8.6171	0.33838	0.0:0.2659:0.5416:0.1925	.	300	Q8N2H9-4	.	T	300	.	.	I	+	2	0	PELI3	65998031	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.026000	0.12392	-1.687000	0.01437	-0.290000	0.09829	ATC			0.642	PELI3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000393226.1		NM_145065	
GPR152	390212	mdanderson.org	37	11	67219445	67219445	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:67219445G>T	ENST00000312457.2	-	1	755	c.751C>A	c.(751-753)Ctg>Atg	p.L251M	CABP4_ENST00000438189.2_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			TGGTAGGGCAGCCTCAGGACC	0.652																																					p.L251M	Pancreas(102;800 1581 2723 7382 33622)												.	.			0			c.C751A												49.0	45.0	47.0					11																	67219445		2200	4295	6495	SO:0001583	missense	390212	exon1			AGGGCAGCCTCAG	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.751C>A	11.37:g.67219445G>T	ENSP00000310255:p.Leu251Met		28	0	0		30	0.10	3	NM_206997	0		0	Q0VD88|Q86SM0	Missense_Mutation	SNP	ENST00000312457.2	37	CCDS8165.1	.	.	.	.	.	.	.	.	.	.	G	7.995	0.754201	0.15778	.	.	ENSG00000175514	ENST00000312457	T	0.76060	-0.99	4.72	2.83	0.33086	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31976	N	0.006780	T	0.78117	0.4233	L	0.47190	1.495	0.24066	N	0.995997	D	0.71674	0.998	D	0.74348	0.983	T	0.66135	-0.5999	10	0.44086	T	0.13	.	7.7414	0.28843	0.0922:0.1662:0.7416:0.0	.	251	Q8TDT2	GP152_HUMAN	M	251	ENSP00000310255:L251M	ENSP00000310255:L251M	L	-	1	2	GPR152	66976021	0.973000	0.33851	0.921000	0.36526	0.010000	0.07245	2.670000	0.46833	0.580000	0.29522	-0.305000	0.09177	CTG			0.652	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397623.1			
ARHGEF17	9828	broad.mit.edu	37	11	73066656	73066656	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:73066656G>T	ENST00000263674.3	+	4	3882	c.3532G>T	c.(3532-3534)Gcc>Tcc	p.A1178S	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1178	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						TGTGCGTGTGGCCAAGGAGGC	0.552																																					p.A1178S													.	ARHGEF17	117		0			c.G3532T												114.0	103.0	107.0					11																	73066656		2200	4293	6493	SO:0001583	missense	9828	exon4			CGTGTGGCCAAGG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.3532G>T	11.37:g.73066656G>T	ENSP00000263674:p.Ala1178Ser		100	0	0		97	0.04	4	NM_014786	2	0.00	0	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768444	0.90020	.	.	ENSG00000110237	ENST00000263674	T	0.68765	-0.35	6.17	6.17	0.99709	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.79540	0.4463	L	0.52011	1.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77991	-0.2379	10	0.56958	D	0.05	-13.5856	19.4575	0.94900	0.0:0.0:1.0:0.0	.	1178	Q96PE2	ARHGH_HUMAN	S	1178	ENSP00000263674:A1178S	ENSP00000263674:A1178S	A	+	1	0	ARHGEF17	72744304	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	9.459000	0.97638	2.941000	0.99782	0.655000	0.94253	GCC			0.552	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397365.1		NM_014786	
WNT11	7481	mdanderson.org	37	11	75905775	75905775	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:75905775C>A	ENST00000322563.3	-	3	557	c.433G>T	c.(433-435)Ggt>Tgt	p.G145C	RP11-619A14.2_ENST00000527314.1_RNA	NM_004626.2	NP_004617.2	O96014	WNT11_HUMAN	wingless-type MMTV integration site family, member 11	145					adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|bone mineralization (GO:0030282)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cloacal septation (GO:0060197)|embryonic skeletal system development (GO:0048706)|lung-associated mesenchyme development (GO:0060484)|mesonephric duct development (GO:0072177)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of fibroblast growth factor production (GO:0090272)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroendocrine cell differentiation (GO:0061101)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway (GO:0035567)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta2 production (GO:0032915)|protein localization to cell surface (GO:0034394)|protein phosphorylation (GO:0006468)|response to nutrient levels (GO:0031667)|tight junction assembly (GO:0070830)|ureteric bud morphogenesis (GO:0060675)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|protein kinase activator activity (GO:0030295)|Ras GTPase activator activity (GO:0005099)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20						GGTGGCTCACCTGGGACGGGG	0.701																																					p.G145C													.	.			0			c.G433T												15.0	14.0	14.0					11																	75905775		1944	3844	5788	SO:0001583	missense	7481	exon3			GCTCACCTGGGAC	Y12692	CCDS8242.1	11q13.5	2008-02-05			ENSG00000085741	ENSG00000085741		"""Wingless-type MMTV integration sites"""	12776	protein-coding gene	gene with protein product		603699				9757009	Standard	NM_004626		Approved		uc001oxe.3	O96014	OTTHUMG00000165264	ENST00000322563.3:c.433G>T	11.37:g.75905775C>A	ENSP00000325526:p.Gly145Cys		55	0	0		44	0.07	3	NM_004626	4	0.00	0	B2R8Z6|Q14DE8|Q8WZ98	Missense_Mutation	SNP	ENST00000322563.3	37	CCDS8242.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644188	0.67244	.	.	ENSG00000085741	ENST00000322563;ENST00000531317;ENST00000447195	T	0.76316	-1.01	4.95	4.95	0.65309	.	0.290180	0.36932	N	0.002327	D	0.84334	0.5449	L	0.59436	1.845	0.54753	D	0.99998	D	0.62365	0.991	P	0.60345	0.873	D	0.85511	0.1197	10	0.54805	T	0.06	.	17.1651	0.86814	0.0:1.0:0.0:0.0	.	145	O96014	WNT11_HUMAN	C	145	ENSP00000325526:G145C	ENSP00000325526:G145C	G	-	1	0	WNT11	75583423	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.559000	0.45888	2.287000	0.76781	0.555000	0.69702	GGT			0.701	WNT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383083.1		NM_004626	
DDIAS	220042	mdanderson.org	37	11	82639964	82639964	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:82639964G>T	ENST00000533655.1	+	4	471	c.259G>T	c.(259-261)Gcc>Tcc	p.A87S	C11orf82_ENST00000533750.1_3'UTR|C11orf82_ENST00000524921.1_Missense_Mutation_p.A87S|C11orf82_ENST00000525361.1_Missense_Mutation_p.A87S|C11orf82_ENST00000329143.3_Intron|C11orf82_ENST00000430323.2_Missense_Mutation_p.A87S|C11orf82_ENST00000525388.1_Missense_Mutation_p.A87S|C11orf82_ENST00000528759.1_Intron	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		87					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						TGGTCTTACTGCCACTGGTTT	0.318																																					p.A87S													.	.			0			c.G259T												121.0	119.0	120.0					11																	82639964		2203	4300	6503	SO:0001583	missense	220042	exon4			CTTACTGCCACTG																												ENST00000533655.1:c.259G>T	11.37:g.82639964G>T	ENSP00000435421:p.Ala87Ser		63	0	0		55	0.05	3	NM_145018	28	0.00	0	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	37	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293577	0.80914	.	.	ENSG00000165490	ENST00000524921;ENST00000525361;ENST00000430323;ENST00000533655;ENST00000532764;ENST00000525388;ENST00000528262	T;T	0.53206	0.63;0.63	5.75	4.84	0.62591	Nucleic acid-binding, OB-fold-like (1);Replication factor A, C-terminal (1);Nucleic acid-binding, OB-fold (1);	0.111999	0.64402	D	0.000011	T	0.68650	0.3024	M	0.81239	2.535	0.80722	D	1	P;D	0.76494	0.944;0.999	P;D	0.68192	0.719;0.956	T	0.72462	-0.4286	9	.	.	.	.	14.6217	0.68592	0.0697:0.0:0.9303:0.0	.	87;87	Q8IXT1-2;Q8IXT1	.;NOXIN_HUMAN	S	87;87;87;87;148;87;87	ENSP00000414687:A87S;ENSP00000435421:A87S	.	A	+	1	0	C11orf82	82317612	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.119000	0.77145	1.427000	0.47276	0.557000	0.71058	GCC			0.318	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391936.1			
SLC37A2	219855	mdanderson.org	37	11	124955359	124955359	+	Silent	SNP	C	C	T	rs144643816		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr11:124955359C>T	ENST00000403796.2	+	15	1618	c.1317C>T	c.(1315-1317)acC>acT	p.T439T	SLC37A2_ENST00000407458.1_Silent_p.T439T|SLC37A2_ENST00000525837.1_3'UTR|SLC37A2_ENST00000298280.5_3'UTR|SLC37A2_ENST00000308074.4_Silent_p.T439T	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	439					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		TTGACGGCACCGGCTCCATAG	0.642																																					p.T439T	Melanoma(11;373 620 21213 26083 47768)												.	.			0			c.C1317T							C	,	3,4399	6.2+/-15.9	0,3,2198	57.0	49.0	52.0		1317,1317	-9.8	0.0	11	dbSNP_134	52	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	SLC37A2	NM_001145290.1,NM_198277.2	,	0,4,6496	TT,TC,CC		0.0116,0.0682,0.0308	,	439/502,439/506	124955359	4,12996	2201	4299	6500	SO:0001819	synonymous_variant	219855	exon15			CGGCACCGGCTCC	AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.1317C>T	11.37:g.124955359C>T			75	0	0		38	0.08	3	NM_198277	26	0.04	1	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Silent	SNP	ENST00000403796.2	37	CCDS44757.1																																																																																			0		0.642	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000386837.1		XM_166184	
RHNO1	83695	broad.mit.edu	37	12	2997087	2997087	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr12:2997087A>T	ENST00000489288.2	+	3	331	c.179A>T	c.(178-180)gAt>gTt	p.D60V	TULP3_ENST00000397132.2_5'Flank|RHNO1_ENST00000461997.2_Missense_Mutation_p.D46V|RHNO1_ENST00000464682.2_3'UTR|TULP3_ENST00000448120.2_5'Flank	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	60					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											GTATCACCTGATTTTGATACA	0.433																																					p.D60V													.	.			0			c.A179T												45.0	42.0	43.0					12																	2997087		2203	4300	6503	SO:0001583	missense	83695	exon3			CACCTGATTTTGA	AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.179A>T	12.37:g.2997087A>T	ENSP00000438590:p.Asp60Val		97	0.0515463918	5		164	0.10	17	NM_001257098	218	0.00	0	B7Z989	Missense_Mutation	SNP	ENST00000489288.2	37	CCDS8518.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149132	0.37923	.	.	ENSG00000171792	ENST00000538636;ENST00000461997;ENST00000489288;ENST00000366285;ENST00000538700	.	.	.	5.42	5.42	0.78866	.	0.340042	0.28420	N	0.015408	T	0.56262	0.1973	.	.	.	0.80722	D	1	B;B	0.25169	0.119;0.119	B;B	0.26416	0.069;0.069	T	0.58053	-0.7704	8	0.72032	D	0.01	0.0038	11.8673	0.52501	1.0:0.0:0.0:0.0	.	46;60	B7Z989;Q9BSD3	.;RHINO_HUMAN	V	60;46;60;60;60	.	ENSP00000444654:D60V	D	+	2	0	C12orf32	2867348	1.000000	0.71417	1.000000	0.80357	0.489000	0.33432	4.549000	0.60726	2.050000	0.60909	0.482000	0.46254	GAT			0.433	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351286.2		NM_031465	
DYRK4	8798	broad.mit.edu	37	12	4722809	4722809	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr12:4722809G>A	ENST00000540757.2	+	13	1613	c.1453G>A	c.(1453-1455)Gct>Act	p.A485T	DYRK4_ENST00000010132.5_Missense_Mutation_p.A485T|DYRK4_ENST00000545342.1_Missense_Mutation_p.A122T|DYRK4_ENST00000543431.1_Missense_Mutation_p.A484T|RP11-500M8.7_ENST00000536588.1_Intron	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	485						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			ACTGGTAGACGCTCCCAAGAA	0.542																																					p.A485T													DYRK4,NS,carcinoma,0,1	DYRK4	75	1	0			c.G1453A												58.0	57.0	58.0					12																	4722809		2203	4300	6503	SO:0001583	missense	8798	exon13			GTAGACGCTCCCA	Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.1453G>A	12.37:g.4722809G>A	ENSP00000441755:p.Ala485Thr		132	0	0		267	0.02	5	NM_003845	235	0.00	0	A8K8F7|Q8NEF2|Q92631	Missense_Mutation	SNP	ENST00000540757.2	37	CCDS8530.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649728	0.29336	.	.	ENSG00000010219	ENST00000540757;ENST00000010132;ENST00000543431;ENST00000545342	T;T;T;T	0.64803	-0.12;-0.12;-0.08;0.6	5.88	4.07	0.47477	.	0.371075	0.24031	N	0.042195	T	0.44705	0.1306	L	0.40543	1.245	0.58432	D	0.999998	P;B;B	0.36438	0.553;0.055;0.033	B;B;B	0.23574	0.047;0.013;0.006	T	0.29518	-1.0009	10	0.29301	T	0.29	.	8.7475	0.34596	0.1715:0.0:0.8285:0.0	.	198;484;485	B4E1A4;Q9NR20-2;Q9NR20	.;.;DYRK4_HUMAN	T	485;485;484;122	ENSP00000441755:A485T;ENSP00000010132:A485T;ENSP00000439697:A484T;ENSP00000446005:A122T	ENSP00000010132:A485T	A	+	1	0	DYRK4	4593070	0.550000	0.26489	0.812000	0.32479	0.008000	0.06430	0.461000	0.21940	0.829000	0.34733	0.650000	0.86243	GCT			0.542	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398780.2			
CELA1	1990	mdanderson.org	37	12	51723604	51723604	+	Missense_Mutation	SNP	C	C	G	rs201129231		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr12:51723604C>G	ENST00000293636.1	-	7	663	c.623G>C	c.(622-624)gGc>gCc	p.G208A		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	208	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ATGGAGGGGGCCCCCAGAGTC	0.552																																					p.G208A													.	.			0			c.G623C												59.0	61.0	60.0					12																	51723604		2203	4300	6503	SO:0001583	missense	1990	exon7			AGGGGGCCCCCAG		CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.623G>C	12.37:g.51723604C>G	ENSP00000293636:p.Gly208Ala		40	0	0		37	0.11	4	NM_001971	1	0.00	0	Q5MLF0|Q6DJT0|Q6ISM6	Missense_Mutation	SNP	ENST00000293636.1	37	CCDS8812.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699931	0.48307	.	.	ENSG00000139610	ENST00000293636	D	0.96300	-3.97	5.37	4.46	0.54185	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.97949	0.9325	M	0.83483	2.645	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.98693	1.0697	10	0.87932	D	0	-20.8256	14.5125	0.67797	0.1481:0.8519:0.0:0.0	rs60311818	208	Q9UNI1	CELA1_HUMAN	A	208	ENSP00000293636:G208A	ENSP00000293636:G208A	G	-	2	0	CELA1	50009871	1.000000	0.71417	0.033000	0.17914	0.084000	0.17831	7.543000	0.82106	1.357000	0.45904	0.484000	0.47621	GGC	0.001		0.552	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394901.1		NM_001971	
E2F7	144455	broad.mit.edu	37	12	77449827	77449827	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr12:77449827delT	ENST00000322886.7	-	3	412	c.177delA	c.(175-177)aaafs	p.K59fs	E2F7_ENST00000416496.2_Frame_Shift_Del_p.K59fs	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	59					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.K59fs*29(2)		central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CTGGAGTAAATTTTTTTTGCT	0.363																																					p.K59fs													.	E2F7	201		2	Deletion - Frameshift(2)	large_intestine(2)	c.177delA												82.0	84.0	83.0					12																	77449827		2203	4300	6503	SO:0001589	frameshift_variant	144455	exon3			AGTAAATTTTTTT	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.177delA	12.37:g.77449827delT	ENSP00000323246:p.Lys59fs		174	0	0		228	0.03	7	NM_203394	0		0	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Frame_Shift_Del	DEL	ENST00000322886.7	37	CCDS9016.1																																																																																					0.363	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406716.1		XM_084871	
RFX4	5992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	106995124	106995124	+	Intron	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr12:106995124G>A	ENST00000392842.1	+	2	457				RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Splice_Site_p.E24K	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)						cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						CCGTTCCACTGGTAATGACCA	0.647																																					p.E24K													.	.			0			c.G70A												31.0	25.0	27.0					12																	106995124		2198	4290	6488	SO:0001627	intron_variant	5992	exon1			TCCACTGGTAATG	AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.44-7451G>A	12.37:g.106995124G>A			159	0	0		170	0.21	36	NM_001206691	0		0	A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	ENST00000392842.1	37	CCDS9106.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444205	0.63067	.	.	ENSG00000111783	ENST00000357881;ENST00000266774	T	0.66280	-0.2	3.97	3.97	0.46021	.	0.053701	0.64402	D	0.000001	T	0.58609	0.2134	L	0.27053	0.805	0.80722	D	1	P;P	0.49696	0.593;0.927	P;P	0.56563	0.486;0.801	T	0.49570	-0.8926	10	0.16420	T	0.52	-17.849	11.8453	0.52381	0.0:0.0:1.0:0.0	.	24;24	Q33E94-2;Q33E94-4	.;.	K	24	ENSP00000350552:E24K	ENSP00000266774:E24K	E	+	1	0	RFX4	105519254	0.983000	0.35010	0.982000	0.44146	0.817000	0.46193	2.261000	0.43276	2.497000	0.84241	0.609000	0.83330	GAG			0.647	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402707.1		NM_032491	
FZD10	11211	broad.mit.edu	37	12	130647553	130647553	+	Missense_Mutation	SNP	C	C	A	rs200800452		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr12:130647553C>A	ENST00000229030.4	+	1	550	c.66C>A	c.(64-66)agC>agA	p.S22R	FZD10_ENST00000539839.1_5'UTR|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	22					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.S22R(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CCGCCATCAGCTCCATGGACA	0.667																																					p.S22R													FZD10,NS,carcinoma,0,2	FZD10	95	2	2	Substitution - Missense(2)	prostate(1)|lung(1)	c.C66A												11.0	11.0	11.0					12																	130647553		2191	4283	6474	SO:0001583	missense	11211	exon1			CATCAGCTCCATG	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.66C>A	12.37:g.130647553C>A	ENSP00000229030:p.Ser22Arg		97	0.0206185567	2		107	0.11	12	NM_007197	14	0.07	1		Missense_Mutation	SNP	ENST00000229030.4	37	CCDS9267.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386995	0.25031	.	.	ENSG00000111432	ENST00000229030	T	0.76968	-1.06	3.43	-0.743	0.11105	.	1.117550	0.07024	U	0.827300	T	0.63698	0.2533	L	0.27053	0.805	0.50813	D	0.999897	B	0.10296	0.003	B	0.04013	0.001	T	0.44711	-0.9310	10	0.25106	T	0.35	.	8.7037	0.34340	0.0:0.6722:0.0:0.3278	.	22	Q9ULW2	FZD10_HUMAN	R	22	ENSP00000229030:S22R	ENSP00000229030:S22R	S	+	3	2	FZD10	129213506	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	2.073000	0.41519	-0.099000	0.12263	0.561000	0.74099	AGC			0.667	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding					
LINC00621	100996930	hgsc.bcm.edu	37	13	23471388	23471389	+	lincRNA	DNP	AG	AG	GA	rs140160855		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr13:23471388_23471389AG>GA	ENST00000577004.1	-	0	652									long intergenic non-protein coding RNA 621																		agagagagagaggagagagaga	0.441																																					.													.	.			0			.																																											646201	.			AGAGAGAGGAGAG	AK091626		13q12.12	2012-10-12			ENSG00000262619	ENSG00000262619		"""Long non-coding RNAs"""	44227	non-coding RNA	RNA, long non-coding							Standard			Approved				OTTHUMG00000177835	Exception_encountered	13.37:g.23471388_23471389delinsGA			50	0	0		57	0.07	4	.	0		0		RNA	DNP	ENST00000577004.1	37																																																																																						0.441	LINC00621-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000439167.1			
UNC79	57578	broad.mit.edu	37	14	94088894	94088894	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr14:94088894A>G	ENST00000393151.2	+	30	5315	c.5315A>G	c.(5314-5316)gAg>gGg	p.E1772G	UNC79_ENST00000553484.1_Missense_Mutation_p.E1794G|UNC79_ENST00000555664.1_Missense_Mutation_p.E1772G|UNC79_ENST00000256339.4_Missense_Mutation_p.E1595G			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1772					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACTGAGGGGGAGAAGCCTGGG	0.562																																					p.E1595G													.	UNC79	366		0			c.A4784G												63.0	62.0	63.0					14																	94088894		2203	4300	6503	SO:0001583	missense	57578	exon30			AGGGGGAGAAGCC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5315A>G	14.37:g.94088894A>G	ENSP00000376858:p.Glu1772Gly		100	0.02	2		124	0.03	4	NM_020818	7	0.00	0	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	A	0.571	-0.841303	0.02692	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.18810	2.2;2.19;2.2;2.2	5.57	0.856	0.19019	.	0.935115	0.09117	N	0.846242	T	0.11324	0.0276	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32745	-0.9895	10	0.39692	T	0.17	-4.0088	2.2069	0.03938	0.5804:0.1108:0.0985:0.2103	.	1794	C9JQL1	.	G	1595;1772;1794;1772;1794	ENSP00000256339:E1595G;ENSP00000450868:E1772G;ENSP00000451360:E1794G;ENSP00000376858:E1772G	ENSP00000256339:E1595G	E	+	2	0	KIAA1409	93158647	0.569000	0.26643	0.036000	0.18154	0.034000	0.12701	1.112000	0.31172	0.381000	0.24851	0.397000	0.26171	GAG			0.562	UNC79-006	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000412766.1		XM_028395	
GOLGA8DP	100132979	broad.mit.edu	37	15	22709277	22709278	+	RNA	INS	-	-	A	rs377506667	byFrequency	TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr15:22709277_22709278insA	ENST00000314246.8	-	0	1157				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											CTCTGGATTCCAaaaaaaaaag	0.515													|||unknown(HR)	672	0.134185	0.3185	0.1326	5008	,	,		21907	0.0179		0.0616	False		,,,				2504	0.0808				.													.	.			0			.																																											0	.			GGATTCCAAAAAA			15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709287_22709287dupA			6	0	0		8	0.25	2	.	0		0		RNA	INS	ENST00000314246.8	37																																																																																						0.515	GOLGA8DP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000415613.1		NR_027407	
FAM98B	283742	broad.mit.edu	37	15	38776833	38776833	+	IGR	SNP	T	T	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr15:38776833T>A	ENST00000491535.1	+	0	3111				FAM98B_ENST00000397609.2_Silent_p.G425G	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B							cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)	p.G425G(2)		endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		gtggtggtggtggaggaggtg	0.428																																					p.G425G													FAM98B_ENST00000397609,NS,carcinoma,0,2	FAM98B	53	2	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.T1275A												17.0	17.0	17.0					15																	38776833		1500	3373	4873	SO:0001628	intergenic_variant	283742	exon8			TGGTGGTGGAGGA		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831		15.37:g.38776833T>A			78	0.0256410256	2		148	0.04	6	NM_173611	1	0.00	0	A8MUW5|Q8N935	Silent	SNP	ENST00000491535.1	37	CCDS42015.1																																																																																					0.428	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000252071.2		NM_173611	
DISP2	85455	broad.mit.edu	37	15	40650534	40650536	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr15:40650534_40650536delCAG	ENST00000267889.3	+	1	99_101	c.12_14delCAG	c.(10-15)gacagc>gac	p.S9del		NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	9					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TGGACGGTGAcagcagcagcagc	0.818																																					p.4_5del													.	DISP2	86		0			c.12_14del									9,1127		3,3,562						-2.5	0.0			1	32,2792		9,14,1389	no	coding	DISP2	NM_033510.1		12,17,1951	A1A1,A1R,RR		1.1331,0.7923,1.0354				41,3919				SO:0001651	inframe_deletion	85455	exon1			CGGTGACAGCAGC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.12_14delCAG	15.37:g.40650543_40650545delCAG	ENSP00000267889:p.Ser9del		4	0	0		6	0.33	2	NM_033510	1	0.00	0	Q6AHW3|Q9C0C1	In_Frame_Del	DEL	ENST00000267889.3	37	CCDS10056.1																																																																																					0.818	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252249.1		NM_033510	
SPTBN5	51332	mdanderson.org	37	15	42185137	42185137	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr15:42185137G>T	ENST00000320955.6	-	3	566	c.339C>A	c.(337-339)caC>caA	p.H113Q	RP11-23P13.6_ENST00000309874.2_RNA|RP11-23P13.7_ENST00000605942.1_lincRNA|RP11-23P13.6_ENST00000562920.1_RNA|RP11-23P13.6_ENST00000568861.1_RNA|RP11-23P13.6_ENST00000564432.2_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	113	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCTCCAGGAAGTGCACACGCA	0.687																																					p.H78Q													.	.			0			c.C234A												28.0	35.0	33.0					15																	42185137		1934	4130	6064	SO:0001583	missense	51332	exon3			CAGGAAGTGCACA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.339C>A	15.37:g.42185137G>T	ENSP00000317790:p.His113Gln		34	0	0		42	0.07	3	NM_016642	0		0		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	G	18.36	3.606940	0.66558	.	.	ENSG00000137877	ENST00000320955	D	0.94793	-3.52	5.15	2.91	0.33838	Calponin homology domain (5);	0.000000	0.64402	D	0.000001	D	0.93916	0.8053	L	0.33753	1.03	0.24821	N	0.992585	D	0.89917	1.0	D	0.91635	0.999	D	0.86284	0.1669	10	0.87932	D	0	.	6.3767	0.21511	0.3844:0.0:0.6156:0.0	.	113	Q9NRC6	SPTN5_HUMAN	Q	113	ENSP00000317790:H113Q	ENSP00000317790:H113Q	H	-	3	2	SPTBN5	39972429	1.000000	0.71417	0.999000	0.59377	0.561000	0.35649	1.513000	0.35823	1.184000	0.42957	0.655000	0.94253	CAC			0.687	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000420237.1		NM_016642	
ARIH1	25820	mdanderson.org	37	15	72767235	72767235	+	Silent	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr15:72767235C>T	ENST00000379887.4	+	1	569	c.255C>T	c.(253-255)ggC>ggT	p.G85G	RP11-1007O24.3_ENST00000565181.1_lincRNA	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	85	Gly-rich.				cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						gcggcggcggcggtggtggtg	0.736																																					p.G85G													.	.			0			c.C255T												4.0	3.0	3.0					15																	72767235		1491	2998	4489	SO:0001819	synonymous_variant	25820	exon1			CGGCGGCGGTGGT	AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.255C>T	15.37:g.72767235C>T			62	0.0322580645	2		75	0.08	6	NM_005744	0		0	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Silent	SNP	ENST00000379887.4	37	CCDS10244.1																																																																																					0.736	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257350.1		NM_005744	
VPS33B	26276	broad.mit.edu	37	15	91545330	91545330	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr15:91545330A>G	ENST00000333371.3	-	18	1708	c.1355T>C	c.(1354-1356)cTc>cCc	p.L452P	VPS33B_ENST00000535843.1_Missense_Mutation_p.L361P|VPS33B_ENST00000535906.1_Missense_Mutation_p.L425P	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	452					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CACGGCTGTGAGGGTGTCCCC	0.572																																					p.L452P													.	VPS33B	42		0			c.T1355C												96.0	77.0	84.0					15																	91545330		2198	4298	6496	SO:0001583	missense	26276	exon18			GCTGTGAGGGTGT	AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.1355T>C	15.37:g.91545330A>G	ENSP00000327650:p.Leu452Pro		92	0	0		140	0.03	4	NM_018668	64	0.00	0	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	ENST00000333371.3	37	CCDS10369.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614501	0.87359	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.60548	0.19;0.18;0.79	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.64068	0.2565	L	0.38531	1.155	0.80722	D	1	D;B	0.61697	0.99;0.122	P;B	0.61201	0.885;0.092	T	0.60895	-0.7172	10	0.31617	T	0.26	-28.5376	15.5052	0.75731	1.0:0.0:0.0:0.0	.	425;452	F5H008;Q9H267	.;VP33B_HUMAN	P	452;425;361;407	ENSP00000327650:L452P;ENSP00000444053:L425P;ENSP00000446267:L361P	ENSP00000327650:L452P	L	-	2	0	VPS33B	89346334	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.930000	0.87610	2.326000	0.78906	0.533000	0.62120	CTC			0.572	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313496.1		NM_018668	
HBA2	3040	broad.mit.edu	37	16	223511	223511	+	Missense_Mutation	SNP	T	T	C	rs281860618|rs63751471		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:223511T>C	ENST00000251595.6	+	3	407	c.341T>C	c.(340-342)cTc>cCc	p.L114P	HBA2_ENST00000397806.1_Missense_Mutation_p.L82P	NM_000517.4	NP_000508.1	P69905	HBA_HUMAN	hemoglobin, alpha 2	114			L -> H (in Twin Peaks).		bicarbonate transport (GO:0015701)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|positive regulation of cell death (GO:0010942)|protein heterooligomerization (GO:0051291)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)						all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)			Iron Dextran(DB00893)|Mefloquine(DB00358)	GCCGCCCACCTCCCCGCCGAG	0.667											OREG0003686	type=REGULATORY REGION|Gene=SERPINB9|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.L114P	GBM(107;1340 2104 14383 27419)												.	HBA2	3		0			c.T341C	GRCh37	CM024476	HBA2	M								23.0	31.0	29.0					16																	223511		2146	4295	6441	SO:0001583	missense	3040	exon3			CCCACCTCCCCGC	BC008572	CCDS10398.1	16p13.3	2014-05-19			ENSG00000188536	ENSG00000188536			4824	protein-coding gene	gene with protein product		141850				6452630, 2649166	Standard	NM_000517		Approved	HBA-T2	uc002cfv.4	P69905	OTTHUMG00000059924	ENST00000251595.6:c.341T>C	16.37:g.223511T>C	ENSP00000251595:p.Leu114Pro		223	0.0179372197	4	586	270	0.04	10	NM_000517	7	0.00	0	P01922|Q1HDT5|Q3MIF5|Q53F97|Q96KF1|Q9NYR7|Q9UCM0	Missense_Mutation	SNP	ENST00000251595.6	37	CCDS10398.1	.	.	.	.	.	.	.	.	.	.	t	9.214	1.031657	0.19590	.	.	ENSG00000188536	ENST00000251595;ENST00000534957;ENST00000397806	D;D	0.94966	-3.46;-3.57	4.07	-8.14	0.01069	Globin-like (1);Globin, structural domain (1);	0.782790	0.12569	N	0.457465	D	0.94833	0.8331	M	0.69823	2.125	0.09310	N	0.999999	D	0.54047	0.964	D	0.63381	0.914	D	0.92479	0.5991	10	0.42905	T	0.14	-2.9157	10.9087	0.47094	0.2045:0.0:0.0703:0.7253	.	114	P69905	HBA_HUMAN	P	114;82;82	ENSP00000251595:L114P;ENSP00000380908:L82P	ENSP00000251595:L114P	L	+	2	0	HBA2	163511	0.000000	0.05858	0.001000	0.08648	0.127000	0.20565	-2.126000	0.01316	-2.770000	0.00365	-0.471000	0.05019	CTC			0.667	HBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000133194.1		NM_000517	
WDR24	84219	mdanderson.org	37	16	736808	736808	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:736808C>T	ENST00000248142.6	-	7	1657	c.1658G>A	c.(1657-1659)gGc>gAc	p.G553D	WDR24_ENST00000293883.4_Missense_Mutation_p.G423D|JMJD8_ENST00000293882.4_5'Flank|JMJD8_ENST00000562111.1_5'Flank|JMJD8_ENST00000454700.1_5'Flank|LA16c-313D11.12_ENST00000566927.1_RNA|JMJD8_ENST00000609261.1_5'Flank|JMJD8_ENST00000562824.1_5'Flank|JMJD8_ENST00000412368.2_5'Flank			Q96S15	WDR24_HUMAN	WD repeat domain 24	553										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				CAGTGGCCGGCCAGCCAGCGC	0.662																																					p.G423D													.	.			0			c.G1268A												36.0	33.0	34.0					16																	736808		2198	4298	6496	SO:0001583	missense	84219	exon3			GGCCGGCCAGCCA	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.1658G>A	16.37:g.736808C>T	ENSP00000248142:p.Gly553Asp		54	0	0		44	0.07	3	NM_032259	25	0.00	0	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	ENST00000248142.6	37		.	.	.	.	.	.	.	.	.	.	C	17.52	3.410287	0.62399	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	D;T	0.86432	-2.12;-0.47	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	D	0.83727	0.5317	L	0.34521	1.04	0.80722	D	1	B	0.32101	0.356	B	0.37780	0.258	D	0.84553	0.0645	10	0.56958	D	0.05	-14.9087	16.4659	0.84079	0.0:1.0:0.0:0.0	.	423	Q96S15-2	.	D	553;423	ENSP00000248142:G553D;ENSP00000293883:G423D	ENSP00000248142:G553D	G	-	2	0	WDR24	676809	1.000000	0.71417	0.998000	0.56505	0.180000	0.23129	7.309000	0.78937	2.430000	0.82344	0.655000	0.94253	GGC			0.662	WDR24-201	KNOWN	basic	protein_coding	protein_coding				NM_032259	
BAIAP3	8938	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	1391420	1391420	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:1391420G>A	ENST00000324385.5	+	8	924	c.766G>A	c.(766-768)Gcc>Acc	p.A256T	BAIAP3_ENST00000397489.1_Missense_Mutation_p.A238T|BAIAP3_ENST00000421665.2_Missense_Mutation_p.A221T|BAIAP3_ENST00000397488.2_Missense_Mutation_p.A238T|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A221T|BAIAP3_ENST00000562208.1_Missense_Mutation_p.A198T|BAIAP3_ENST00000568887.1_Missense_Mutation_p.A193T	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	256	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				ACCCCTGCCTGCCAAGTGCAT	0.682																																					p.A256T													.	BAIAP3	88		0			c.G766A												61.0	56.0	58.0					16																	1391420		2197	4297	6494	SO:0001583	missense	8938	exon8			CTGCCTGCCAAGT	AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.766G>A	16.37:g.1391420G>A	ENSP00000324510:p.Ala256Thr		160	0	0		167	0.04	7	NM_003933	38	0.00	0	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	ENST00000324385.5	37	CCDS10434.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.732979	0.69189	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-0.77	4.72	3.6	0.41247	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.062562	0.64402	N	0.000007	T	0.81064	0.4745	L	0.28192	0.835	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.993;0.993;0.991;0.992;0.989	T	0.80555	-0.1330	10	0.62326	D	0.03	-28.0482	8.6093	0.33793	0.1444:0.0:0.8556:0.0	.	221;273;198;256;238	E7EUB9;B4DGA2;B4DIK3;O94812;A2A2B2	.;.;.;BAIP3_HUMAN;.	T	221;238;256;238;221	ENSP00000407242:A221T;ENSP00000380625:A238T;ENSP00000324510:A256T;ENSP00000380626:A238T;ENSP00000409533:A221T	ENSP00000324510:A256T	A	+	1	0	BAIAP3	1331421	1.000000	0.71417	0.777000	0.31699	0.460000	0.32559	6.223000	0.72257	0.948000	0.37687	0.313000	0.20887	GCC			0.682	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000109056.3			
DNASE1L2	1775	mdanderson.org	37	16	2287219	2287219	+	Splice_Site	SNP	C	C	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:2287219C>A	ENST00000564065.1	+	3	1235	c.234C>A	c.(232-234)agC>agA	p.S78R	DNASE1L2_ENST00000567494.1_Splice_Site_p.S78R|RP11-304L19.12_ENST00000564055.1_lincRNA|DNASE1L2_ENST00000382437.4_Splice_Site_p.S78R|DNASE1L2_ENST00000320700.5_Splice_Site_p.S78R			Q92874	DNSL2_HUMAN	deoxyribonuclease I-like 2	78					corneocyte development (GO:0003335)|DNA metabolic process (GO:0006259)|hair follicle development (GO:0001942)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			endometrium(1)|prostate(1)|skin(2)	4						GTCTCCGCAGCGTGTCCGAGC	0.706																																					p.S78R													.	.			0			c.C234A												11.0	14.0	13.0					16																	2287219		1820	4048	5868	SO:0001630	splice_region_variant	1775	exon4			CCGCAGCGTGTCC	U62647	CCDS42105.1	16p13.3	2008-02-05				ENSG00000167968			2958	protein-coding gene	gene with protein product		602622				9205125, 1577479	Standard	NM_001374		Approved	DNAS1L2	uc002cpp.3	Q92874		ENST00000564065.1:c.234-1C>A	16.37:g.2287219C>A			44	0	0		48	0.06	3	NM_001374	0		0	E9PBY4|Q6JVM2|Q6JVM3	Missense_Mutation	SNP	ENST00000564065.1	37	CCDS42105.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.986961	0.00443	.	.	ENSG00000167968	ENST00000541838;ENST00000320700;ENST00000382437	T;T	0.32023	1.47;1.47	4.04	-7.57	0.01318	Endonuclease/exonuclease/phosphatase (2);	0.324438	0.33040	N	0.005351	T	0.07863	0.0197	N	0.04724	-0.175	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.004	T	0.16778	-1.0391	9	.	.	.	.	2.1072	0.03694	0.2635:0.389:0.0878:0.2597	.	78;78	Q92874;Q6JVM2	DNSL2_HUMAN;.	R	78	ENSP00000316938:S78R;ENSP00000371874:S78R	.	S	+	3	2	DNASE1L2	2227220	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	-5.048000	0.00156	-1.482000	0.01860	-1.489000	0.00976	AGC			0.706	DNASE1L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000435236.1		NM_001374	Missense_Mutation
UBN1	29855	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4924423	4924423	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:4924423C>T	ENST00000396658.4	+	14	2715	c.2012C>T	c.(2011-2013)tCc>tTc	p.S671F	UBN1_ENST00000545171.1_Missense_Mutation_p.S671F|UBN1_ENST00000262376.6_Missense_Mutation_p.S671F|UBN1_ENST00000590769.1_Missense_Mutation_p.S671F	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	671					chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AATCCAGCCTCCTCGGTGGAA	0.562																																					p.S671F													.	UBN1	88		0			c.C2012T												107.0	106.0	106.0					16																	4924423		2197	4300	6497	SO:0001583	missense	29855	exon15			CAGCCTCCTCGGT	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2012C>T	16.37:g.4924423C>T	ENSP00000379894:p.Ser671Phe		64	0.015625	1		100	0.16	16	NM_001079514	141	0.27	38	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293109	0.60086	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.52754	1.26;0.65;1.26	4.64	4.64	0.57946	.	0.084911	0.51477	D	0.000094	T	0.65954	0.2741	M	0.63428	1.95	0.41253	D	0.986722	P;D	0.65815	0.852;0.995	P;D	0.75484	0.702;0.986	T	0.68735	-0.5330	10	0.62326	D	0.03	-10.3364	16.2314	0.82344	0.0:1.0:0.0:0.0	.	671;671	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	F	671	ENSP00000262376:S671F;ENSP00000442379:S671F;ENSP00000379894:S671F	ENSP00000262376:S671F	S	+	2	0	UBN1	4864424	1.000000	0.71417	0.997000	0.53966	0.645000	0.38454	3.557000	0.53741	2.575000	0.86900	0.561000	0.74099	TCC			0.562	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251719.1		NM_016936	
CRYM	1428	mdanderson.org	37	16	21289540	21289540	+	Silent	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:21289540G>T	ENST00000219599.3	-	3	298	c.33C>A	c.(31-33)gcC>gcA	p.A11A	CRYM_ENST00000396023.2_Silent_p.A11A|CRYM_ENST00000574787.1_5'Flank|CRYM_ENST00000415987.2_5'UTR|CRYM_ENST00000543948.1_Silent_p.A11A	NM_001888.3	NP_001879.1	Q14894	CRYM_HUMAN	crystallin, mu	11					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|sensory perception of sound (GO:0007605)|thyroid hormone metabolic process (GO:0042403)|thyroid hormone transport (GO:0070327)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|thiomorpholine-carboxylate dehydrogenase activity (GO:0047127)|thyroid hormone binding (GO:0070324)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(3)	4				GBM - Glioblastoma multiforme(48;0.0573)		CCTCCACCTCGGCCGCGCTCA	0.652											OREG0023670	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A11A													.	.			0			c.C33A												30.0	26.0	27.0					16																	21289540		2192	4291	6483	SO:0001819	synonymous_variant	1428	exon3			CACCTCGGCCGCG		CCDS10597.1	16p12.2	2013-02-14			ENSG00000103316	ENSG00000103316	1.5.1.25		2418	protein-coding gene	gene with protein product	"""thiomorpholine-carboxylate dehydrogenase"""	123740				1478656, 21332720	Standard	NM_001014444		Approved	DFNA40	uc002dim.3	Q14894	OTTHUMG00000090707	ENST00000219599.3:c.33C>A	16.37:g.21289540G>T			26	0	0	747	26	0.12	3	NM_001888	10	0.00	0	D5MNX0|Q5HYB7	Silent	SNP	ENST00000219599.3	37	CCDS10597.1																																																																																					0.652	CRYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207398.1			
CDH16	1014	mdanderson.org	37	16	66942309	66942309	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:66942309T>C	ENST00000299752.4	-	18	2669	c.2476A>G	c.(2476-2478)Aag>Gag	p.K826E	CDH16_ENST00000570262.1_Missense_Mutation_p.K746E|CDH16_ENST00000394055.3_Missense_Mutation_p.K804E|CDH16_ENST00000565796.1_Missense_Mutation_p.K787E|CDH16_ENST00000568632.1_Missense_Mutation_p.K729E	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	826					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		ACAGTCGCCTTCAGGGGCACG	0.597																																					p.K826E													.	.			0			c.A2476G												87.0	84.0	85.0					16																	66942309		2200	4300	6500	SO:0001583	missense	1014	exon18			TCGCCTTCAGGGG	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.2476A>G	16.37:g.66942309T>C	ENSP00000299752:p.Lys826Glu		44	0	0		37	0.08	3	NM_004062	0		0	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.809613	0.50421	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.58210	0.35;0.37	5.89	4.74	0.60224	.	0.142673	0.45606	D	0.000343	T	0.64450	0.2599	L	0.54323	1.7	0.40373	D	0.979363	D;D;D	0.71674	0.998;0.997;0.996	D;D;P	0.80764	0.994;0.985;0.836	T	0.66885	-0.5810	10	0.59425	D	0.04	-20.2598	9.4557	0.38753	0.0:0.0:0.1784:0.8216	.	804;826;826	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	E	804;826;790	ENSP00000377619:K804E;ENSP00000299752:K826E	ENSP00000299752:K826E	K	-	1	0	CDH16	65499810	1.000000	0.71417	0.996000	0.52242	0.020000	0.10135	2.172000	0.42463	2.254000	0.74563	0.533000	0.62120	AAG			0.597	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268839.2		NM_004062	
MTSS1L	92154	broad.mit.edu	37	16	70698201	70698201	+	Silent	SNP	C	C	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:70698201C>A	ENST00000338779.6	-	15	1897	c.1623G>T	c.(1621-1623)ggG>ggT	p.G541G	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	541					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						CGGTGGGCAGCCCAGCAGTGG	0.711																																					p.G541G													.	MTSS1L	22		0			c.G1623T												22.0	24.0	24.0					16																	70698201		2188	4278	6466	SO:0001819	synonymous_variant	92154	exon15			GGGCAGCCCAGCA		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1623G>T	16.37:g.70698201C>A			23	0	0		35	0.14	5	NM_138383	22	0.09	2	A6NJI7|Q9BUA8	Silent	SNP	ENST00000338779.6	37	CCDS32476.1																																																																																					0.711	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434927.3		NM_138383	
PSMD7	5713	broad.mit.edu	37	16	74335489	74335489	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:74335489C>A	ENST00000219313.4	+	4	436	c.296C>A	c.(295-297)cCt>cAt	p.P99H	PSMD7_ENST00000568615.2_Missense_Mutation_p.P99H|PSMD7_ENST00000540379.1_Missense_Mutation_p.P22H|PSMD7_ENST00000567958.1_Missense_Mutation_p.P99H	NM_002811.4	NP_002802.2	P51665	PSMD7_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	99	MPN.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	15						CACACAGGCCCTAAACTACAC	0.368																																					p.P99H													.	PSMD7	29		0			c.C296A												120.0	116.0	117.0					16																	74335489		2198	4300	6498	SO:0001583	missense	5713	exon4			CAGGCCCTAAACT	D50063	CCDS10910.1	16q22.3	2010-10-15	2007-07-06		ENSG00000103035	ENSG00000103035		"""Proteasome (prosome, macropain) subunits"""	9565	protein-coding gene	gene with protein product	"""Mov34 homolog"""	157970	"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)"""			7755639	Standard	NM_002811		Approved	S12, P40, MOV34, Rpn8	uc002fcq.3	P51665	OTTHUMG00000137601	ENST00000219313.4:c.296C>A	16.37:g.74335489C>A	ENSP00000219313:p.Pro99His		67	0	0		70	0.06	4	NM_002811	193	0.00	0	D3DWS9|Q6PKI2|Q96E97	Missense_Mutation	SNP	ENST00000219313.4	37	CCDS10910.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016876	0.93404	.	.	ENSG00000103035	ENST00000219313;ENST00000540379	T;T	0.60797	0.16;0.16	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.80722	0.4677	M	0.86864	2.845	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.83304	-0.0026	10	0.87932	D	0	-0.9975	19.8577	0.96767	0.0:1.0:0.0:0.0	.	99	P51665	PSD7_HUMAN	H	99;22	ENSP00000219313:P99H;ENSP00000443925:P22H	ENSP00000219313:P99H	P	+	2	0	PSMD7	72892990	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.747000	0.85070	2.700000	0.92200	0.467000	0.42956	CCT			0.368	PSMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269010.2		NM_002811	
PKD1L2	114780	broad.mit.edu;mdanderson.org	37	16	81253925	81253925	+	RNA	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:81253925G>T	ENST00000525539.1	-	0	50				PKD1L2_ENST00000337114.4_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)	p.A17A(2)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TAACAGTGGTGGCCCTAAGCC	0.562																																					p.A17A													PKD1L2_ENST00000525539,rectum,carcinoma,0,2	PKD1L2	361	2	2	Substitution - coding silent(2)	large_intestine(2)	c.C51A												66.0	66.0	66.0					16																	81253925		2035	4194	6229			114780	exon1			AGTGGTGGCCCTA	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81253925G>T			146	0	0		140	0.04	5	NM_001076780	0		0	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000525539.1	37																																																																																						0.562	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000387972.2			
ADAD2	161931	broad.mit.edu	37	16	84228102	84228102	+	Missense_Mutation	SNP	C	C	T	rs537250511		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr16:84228102C>T	ENST00000315906.5	+	2	525	c.473C>T	c.(472-474)gCg>gTg	p.A158V	RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.A230V	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	158	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						GTCTGCCCTGCGGGCACTGCG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		18441	0.0		0.0	False		,,,				2504	0.001				p.A230V													.	ADAD2	46		0			c.C689T												33.0	33.0	33.0					16																	84228102		2200	4300	6500	SO:0001583	missense	161931	exon3			GCCCTGCGGGCAC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.473C>T	16.37:g.84228102C>T	ENSP00000325153:p.Ala158Val		57	0	0		45	0.07	3	NM_139174	3	0.00	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	.	.	.	.	.	.	.	.	.	.	C	3.912	-0.019799	0.07634	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.77098	-1.07;-1.07	4.15	-0.544	0.11847	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	1.239420	0.05654	N	0.585685	T	0.61060	0.2317	N	0.24115	0.695	0.09310	N	1	B;B	0.20261	0.007;0.043	B;B	0.15484	0.013;0.008	T	0.46442	-0.9191	10	0.40728	T	0.16	-1.5702	2.7852	0.05372	0.2033:0.4271:0.0:0.3697	.	158;230	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	V	158;230	ENSP00000325153:A158V;ENSP00000268624:A230V	ENSP00000268624:A230V	A	+	2	0	ADAD2	82785603	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.719000	0.04974	0.121000	0.18284	0.511000	0.50034	GCG			0.647	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433385.1		NM_139174	
SMG6	23293	mdanderson.org	37	17	1968954	1968954	+	Silent	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr17:1968954G>T	ENST00000263073.6	-	17	3905	c.3855C>A	c.(3853-3855)ggC>ggA	p.G1285G	SMG6_ENST00000544865.1_Silent_p.G1254G|SMG6_ENST00000536871.2_Silent_p.G377G|SMG6_ENST00000354901.4_Silent_p.G377G|SMG6_ENST00000573166.1_5'UTR	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	1285	PINc.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCTTGGCCAGGCCGTCCAGCT	0.587																																					p.G1285G	Melanoma(59;28 1088 11621 25887 46638 50814)												.	.			0			c.C3855A												37.0	33.0	35.0					17																	1968954		2203	4300	6503	SO:0001819	synonymous_variant	23293	exon17			GGCCAGGCCGTCC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.3855C>A	17.37:g.1968954G>T			32	0	0		41	0.07	3	NM_017575	34	0.00	0	B7Z874|O94837|Q86VH6|Q9UF60	Silent	SNP	ENST00000263073.6	37	CCDS11016.1																																																																																					0.587	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437826.3			
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		227	0.0220264317	5		193	0.08	16	NM_145301	22	0.77	17	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
CDC27	996	broad.mit.edu	37	17	45234323	45234323	+	Silent	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr17:45234323T>C	ENST00000066544.3	-	7	891	c.798A>G	c.(796-798)cgA>cgG	p.R266R	CDC27_ENST00000446365.2_Silent_p.R205R|CDC27_ENST00000531206.1_Silent_p.R266R|CDC27_ENST00000528748.1_5'Flank|CDC27_ENST00000527547.1_Silent_p.R266R	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	266					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CTAATAAACTTCGACCAGTTT	0.358																																					p.R266R													.	CDC27	337		0			c.A798G												60.0	65.0	63.0					17																	45234323		2200	4293	6493	SO:0001819	synonymous_variant	996	exon7			TAAACTTCGACCA	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.798A>G	17.37:g.45234323T>C			47	0.0212765957	1		60	0.07	4	NM_001114091	181	0.00	0	G3V1C4|Q16349|Q96F35	Silent	SNP	ENST00000066544.3	37	CCDS11509.1																																																																																					0.358	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
STRADA	92335	broad.mit.edu	37	17	61790804	61790804	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr17:61790804G>T	ENST00000336174.6	-	6	422	c.310C>A	c.(310-312)Cta>Ata	p.L104I	STRADA_ENST00000245865.5_Missense_Mutation_p.L46I|STRADA_ENST00000447001.3_Missense_Mutation_p.L60I|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000375840.4_Missense_Mutation_p.L46I|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000582137.1_Missense_Mutation_p.L75I|STRADA_ENST00000392950.4_Missense_Mutation_p.L67I|STRADA_ENST00000579340.1_Missense_Mutation_p.L46I	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	104	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						CAAGCTTCTAGGTTAATCCTC	0.443																																					p.L104I													.	STRADA	27		0			c.C310A												265.0	232.0	243.0					17																	61790804		2203	4300	6503	SO:0001583	missense	92335	exon6			CTTCTAGGTTAAT	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.310C>A	17.37:g.61790804G>T	ENSP00000336655:p.Leu104Ile		105	0	0		234	0.03	6	NM_001003787	81	0.00	0	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	37	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109918	0.37242	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T;T	0.66099	-0.17;-0.17;-0.17;-0.17;-0.19	4.99	4.99	0.66335	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067006	0.64402	D	0.000011	T	0.70193	0.3196	L	0.48642	1.525	0.58432	D	0.999998	D;D;D;P;D;D;D	0.89917	0.987;0.998;0.999;0.935;1.0;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.978;0.999;0.998;0.912;0.997;0.997;0.999	T	0.71839	-0.4471	10	0.87932	D	0	.	8.4473	0.32849	0.2111:0.0:0.7889:0.0	.	75;60;46;46;67;67;104	B4DW17;B4DDE3;Q5JPI2;Q86YC8;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;.;STRAA_HUMAN	I	104;46;60;67;66	ENSP00000336655:L104I;ENSP00000365000:L46I;ENSP00000398841:L60I;ENSP00000376677:L67I;ENSP00000245865:L66I	ENSP00000245865:L66I	L	-	1	2	STRADA	59144536	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.833000	0.27504	2.599000	0.87857	0.491000	0.48974	CTA			0.443	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443894.1			
FASN	2194	broad.mit.edu	37	17	80043188	80043188	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr17:80043188G>A	ENST00000306749.2	-	24	4431	c.4213C>T	c.(4213-4215)Cgg>Tgg	p.R1405W	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1405					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGGGTGGGCCGGCGGCACAGG	0.682																																					p.R1405W	Colon(59;314 1043 11189 28578 32273)												.	FASN	154		0			c.C4213T												16.0	22.0	20.0					17																	80043188		2182	4276	6458	SO:0001583	missense	2194	exon24			TGGGCCGGCGGCA	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4213C>T	17.37:g.80043188G>A	ENSP00000304592:p.Arg1405Trp		156	0	0		222	0.02	5	NM_004104	225	0.00	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240092	0.58995	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.28255	1.62	4.49	4.49	0.54785	.	0.131469	0.51477	D	0.000093	T	0.47040	0.1424	M	0.78456	2.415	0.58432	D	0.999994	D	0.71674	0.998	P	0.50192	0.634	T	0.58561	-0.7615	10	0.72032	D	0.01	-44.4255	17.5028	0.87736	0.0:0.0:1.0:0.0	.	1405	P49327	FAS_HUMAN	W	1405;370	ENSP00000304592:R1405W	ENSP00000304592:R1405W	R	-	1	2	FASN	77636477	1.000000	0.71417	0.990000	0.47175	0.173000	0.22820	5.210000	0.65214	2.187000	0.69744	0.462000	0.41574	CGG			0.682	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442369.1		NM_004104	
ZNF491	126069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11917208	11917208	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:11917208T>C	ENST00000323169.5	+	3	771	c.440T>C	c.(439-441)cTt>cCt	p.L147P	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						AGTTTATACCTTACCCATGAA	0.408																																					p.L147P													.	.			0			c.T440C												91.0	91.0	91.0					19																	11917208		2203	4300	6503	SO:0001583	missense	126069	exon3			TATACCTTACCCA	AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.440T>C	19.37:g.11917208T>C	ENSP00000313443:p.Leu147Pro		77	0	0		99	0.13	13	NM_152356	2	0.00	0	Q3MJ35|Q8NAT8	Missense_Mutation	SNP	ENST00000323169.5	37	CCDS12267.1	.	.	.	.	.	.	.	.	.	.	t	8.980	0.975143	0.18736	.	.	ENSG00000177599	ENST00000323169;ENST00000455048	T	0.19250	2.16	1.34	-2.68	0.06041	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15955	0.0384	L	0.54323	1.7	0.09310	N	1	P	0.35456	0.502	B	0.36766	0.232	T	0.16571	-1.0398	9	0.31617	T	0.26	.	2.7375	0.05244	0.4058:0.0:0.2504:0.3439	.	147	Q8N8L2	ZN491_HUMAN	P	147	ENSP00000313443:L147P	ENSP00000313443:L147P	L	+	2	0	ZNF491	11778208	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	1.688000	0.37690	-1.138000	0.02884	-0.651000	0.03910	CTT			0.408	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344518.1		NM_152356	
ZNF799	90576	ucsc.edu	37	19	12501830	12501830	+	Missense_Mutation	SNP	T	T	C	rs537596404		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:12501830T>C	ENST00000430385.3	-	4	1582	c.1382A>G	c.(1381-1383)tAt>tGt	p.Y461C	ZNF799_ENST00000419318.1_Missense_Mutation_p.Y429C|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TTGAAAGGAATAGAAATCAAT	0.383													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22287	0.0		0.0	False		,,,				2504	0.0				p.Y461C													.	ZNF799	111		0			c.A1382G												69.0	75.0	73.0					19																	12501830		2201	4299	6500	SO:0001583	missense	90576	exon4			AAGGAATAGAAAT	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1382A>G	19.37:g.12501830T>C	ENSP00000411084:p.Tyr461Cys		130	0.0076923077	1		184	0.03	5	NM_001080821	41	0.34	14		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	T	2.384	-0.341449	0.05243	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.15372	2.43;2.43	1.31	-2.61	0.06171	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07638	0.0192	N	0.16130	0.375	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	9	0.62326	D	0.03	.	0.7224	0.00943	0.1532:0.2423:0.267:0.3376	.	461	Q96GE5	ZN799_HUMAN	C	429;461	ENSP00000415278:Y429C;ENSP00000411084:Y461C	ENSP00000415278:Y429C	Y	-	2	0	ZNF799	12362830	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.527000	0.00441	-2.535000	0.00489	0.352000	0.21897	TAT			0.383	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344099.2	rescued with RNA-seq	NM_001080821	
ZNF799	90576	ucsc.edu	37	19	12501855	12501855	+	Missense_Mutation	SNP	A	A	G	rs201077492|rs79480756		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:12501855A>G	ENST00000430385.3	-	4	1557	c.1357T>C	c.(1357-1359)Tgt>Cgt	p.C453R	ZNF799_ENST00000419318.1_Missense_Mutation_p.C421R|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	453					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GCTTTCCCACATTTGCATTTA	0.388																																					p.C453R													.	ZNF799	111		0			c.T1357C												76.0	81.0	79.0					19																	12501855		2202	4299	6501	SO:0001583	missense	90576	exon4			TCCCACATTTGCA	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1357T>C	19.37:g.12501855A>G	ENSP00000411084:p.Cys453Arg		134	0.0149253731	2		184	0.06	11	NM_001080821	49	0.37	18		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.790257	0.50102	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	D;D	0.85955	-2.05;-2.05	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.87791	0.6266	H	0.95950	3.745	0.58432	D	0.999998	B	0.02656	0.0	B	0.10450	0.005	D	0.85733	0.1332	9	0.72032	D	0.01	.	6.6913	0.23174	1.0:0.0:0.0:0.0	.	453	Q96GE5	ZN799_HUMAN	R	421;453	ENSP00000415278:C421R;ENSP00000411084:C453R	ENSP00000415278:C421R	C	-	1	0	ZNF799	12362855	0.997000	0.39634	0.001000	0.08648	0.965000	0.64279	5.185000	0.65076	0.846000	0.35142	0.352000	0.21897	TGT			0.388	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344099.2		NM_001080821	
ZSWIM4	65249	mdanderson.org	37	19	13915877	13915877	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:13915877C>A	ENST00000254323.2	+	3	816	c.627C>A	c.(625-627)agC>agA	p.S209R	ZSWIM4_ENST00000440752.2_5'UTR	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	209							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			ACCTCATCAGCGCCCATCACA	0.622											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S209R													.	.			0			c.C627A												49.0	43.0	45.0					19																	13915877		2203	4300	6503	SO:0001583	missense	65249	exon3			CATCAGCGCCCAT	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.627C>A	19.37:g.13915877C>A	ENSP00000254323:p.Ser209Arg		45	0	0	691	44	0.07	3	NM_023072	19	0.00	0		Missense_Mutation	SNP	ENST00000254323.2	37	CCDS32924.1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487528	0.44249	.	.	ENSG00000132003	ENST00000254323	T	0.21543	2.0	4.81	-1.52	0.08637	.	0.000000	0.64402	D	0.000001	T	0.33352	0.0860	M	0.80746	2.51	0.80722	D	1	D	0.64830	0.994	P	0.53450	0.726	T	0.22208	-1.0223	10	0.87932	D	0	-24.9991	9.2682	0.37654	0.0:0.6025:0.0:0.3975	.	209	Q9H7M6	ZSWM4_HUMAN	R	209	ENSP00000254323:S209R	ENSP00000254323:S209R	S	+	3	2	ZSWIM4	13776877	0.000000	0.05858	0.990000	0.47175	0.237000	0.25408	-2.181000	0.01257	-0.419000	0.07439	-0.258000	0.10820	AGC			0.622	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457457.1		XM_031342	
ZNF429	353088	mdanderson.org	37	19	21720482	21720482	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:21720482G>T	ENST00000358491.4	+	4	1835	c.1627G>T	c.(1627-1629)Ggc>Tgc	p.G543C	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						TGAAGAATGTGGCAAAGCTTT	0.363																																					p.G543C													.	.			0			c.G1627T												42.0	47.0	45.0					19																	21720482		2135	4270	6405	SO:0001583	missense	353088	exon4			GAATGTGGCAAAG	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1627G>T	19.37:g.21720482G>T	ENSP00000351280:p.Gly543Cys		49	0	0		51	0.06	3	NM_001001415	23	0.00	0	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	37	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	9.220	1.033212	0.19590	.	.	ENSG00000197013	ENST00000358491	T	0.07908	3.15	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37019	0.0988	H	0.96916	3.905	0.26742	N	0.970369	D	0.89917	1.0	D	0.97110	1.0	T	0.12400	-1.0549	9	0.87932	D	0	.	6.65	0.22957	0.0:0.0:1.0:0.0	.	543	Q86V71	ZN429_HUMAN	C	543	ENSP00000351280:G543C	ENSP00000351280:G543C	G	+	1	0	ZNF429	21512322	1.000000	0.71417	0.275000	0.24674	0.274000	0.26718	3.744000	0.55112	0.293000	0.22520	0.298000	0.19748	GGC			0.363	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463981.1		NM_001001415	
IRF2BP1	26145	mdanderson.org	37	19	46388367	46388367	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:46388367C>T	ENST00000302165.3	-	1	1009	c.666G>A	c.(664-666)tgG>tgA	p.W222*		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		GGCGCCCGTGCCATTCCTCTG	0.632																																					p.W222X													.	.			0			c.G666A												85.0	87.0	86.0					19																	46388367		2203	4300	6503	SO:0001587	stop_gained	26145	exon1			CCCGTGCCATTCC	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.666G>A	19.37:g.46388367C>T	ENSP00000307265:p.Trp222*		34	0	0		29	0.10	3	NM_015649	58	0.00	0	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Nonsense_Mutation	SNP	ENST00000302165.3	37	CCDS12678.1	.	.	.	.	.	.	.	.	.	.	C	39	7.590939	0.98378	.	.	ENSG00000170604	ENST00000302165	.	.	.	4.3	4.3	0.51218	.	0.094270	0.47093	U	0.000249	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2851	0.66240	0.0:1.0:0.0:0.0	.	.	.	.	X	222	.	ENSP00000307265:W222X	W	-	3	0	IRF2BP1	51080207	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.219000	0.78000	2.202000	0.70862	0.462000	0.41574	TGG			0.632	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461683.1		NM_015649	
MZF1	7593	mdanderson.org	37	19	59073497	59073497	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr19:59073497C>T	ENST00000215057.2	-	6	2707	c.2147G>A	c.(2146-2148)cGc>cAc	p.R716H	MZF1_ENST00000599369.1_Missense_Mutation_p.R716H|MZF1_ENST00000594234.1_3'UTR|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	716					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		GTGGAAGCGGCGGCCACAGTC	0.667																																					p.R716H													.	.			0			c.G2147A												32.0	30.0	31.0					19																	59073497		2199	4300	6499	SO:0001583	missense	7593	exon6			AAGCGGCGGCCAC	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.2147G>A	19.37:g.59073497C>T	ENSP00000215057:p.Arg716His		33	0	0		47	0.06	3	NM_003422	41	0.00	0	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	37	CCDS12988.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926158	0.73327	.	.	ENSG00000099326	ENST00000215057	T	0.19669	2.13	3.42	3.42	0.39159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.216583	0.23635	N	0.046096	T	0.33673	0.0871	L	0.55017	1.72	0.33011	D	0.527589	D	0.71674	0.998	D	0.64687	0.928	T	0.43972	-0.9358	10	0.87932	D	0	-25.6473	6.792	0.23705	0.0:0.8739:0.0:0.1261	.	716	P28698	MZF1_HUMAN	H	716	ENSP00000215057:R716H	ENSP00000215057:R716H	R	-	2	0	MZF1	63765309	0.000000	0.05858	0.998000	0.56505	0.984000	0.73092	0.263000	0.18478	2.199000	0.70637	0.462000	0.41574	CGC			0.667	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467112.1		NM_198055	
CEBPZ	10153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37450403	37450403	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr2:37450403C>G	ENST00000234170.5	-	3	1936	c.1791G>C	c.(1789-1791)caG>caC	p.Q597H		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	597					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				ATGGTGGCATCTGTTGACAAG	0.388																																					p.Q597H													.	.			0			c.G1791C												130.0	128.0	129.0					2																	37450403		2203	4300	6503	SO:0001583	missense	10153	exon3			TGGCATCTGTTGA	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1791G>C	2.37:g.37450403C>G	ENSP00000234170:p.Gln597His		116	0	0		146	0.16	23	NM_005760	265	0.23	61	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604616	0.28623	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.12879	2.64	5.46	2.65	0.31530	Armadillo-type fold (1);CCAAT-binding factor (1);	0.000000	0.85682	D	0.000000	T	0.19366	0.0465	L	0.31578	0.945	0.47009	D	0.999281	D	0.61697	0.99	P	0.62885	0.908	T	0.01165	-1.1431	10	0.87932	D	0	.	7.4302	0.27124	0.1101:0.5909:0.0:0.299	.	597	Q03701	CEBPZ_HUMAN	H	597	ENSP00000234170:Q597H	ENSP00000234170:Q597H	Q	-	3	2	CEBPZ	37303907	0.999000	0.42202	0.995000	0.50966	0.682000	0.39822	0.710000	0.25748	0.089000	0.17243	-1.598000	0.00824	CAG			0.388	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218569.2		NM_005760	
RASSF2	9770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	4768332	4768332	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr20:4768332T>A	ENST00000379400.3	-	10	955	c.760A>T	c.(760-762)Atc>Ttc	p.I254F	RASSF2_ENST00000478553.1_5'UTR|RASSF2_ENST00000379376.2_Missense_Mutation_p.I254F	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	254	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						ACTTTGGAGATCTGCTCACAT	0.567																																					p.I254F	Melanoma(158;1891 3343 50738)												.	.			0			c.A760T												133.0	109.0	117.0					20																	4768332		2203	4300	6503	SO:0001583	missense	9770	exon10			TGGAGATCTGCTC	D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.760A>T	20.37:g.4768332T>A	ENSP00000368710:p.Ile254Phe		112	0	0		142	0.22	31	NM_014737	56	0.41	23	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	37	CCDS13083.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531683	0.64972	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.16897	2.31;2.31	5.41	4.46	0.54185	Ras-association (3);	0.055638	0.64402	D	0.000001	T	0.23330	0.0564	M	0.75264	2.295	0.26539	N	0.974115	B	0.21381	0.055	B	0.29598	0.104	T	0.15321	-1.0441	10	0.48119	T	0.1	.	10.3241	0.43783	0.0:0.8386:0.0:0.1614	.	254	P50749	RASF2_HUMAN	F	254	ENSP00000368710:I254F;ENSP00000368684:I254F	ENSP00000368684:I254F	I	-	1	0	RASSF2	4716332	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	2.882000	0.48546	0.844000	0.35094	-0.215000	0.12644	ATC			0.567	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077828.1		NM_014737	
FRG1B	284802	bcgsc.ca	37	20	29628229	29628229	+	Silent	SNP	G	G	T	rs373737774		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr20:29628229G>T	ENST00000278882.3	+	6	611	c.231G>T	c.(229-231)ggG>ggT	p.G77G	FRG1B_ENST00000358464.4_Silent_p.G77G|FRG1B_ENST00000439954.2_Silent_p.G82G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	77										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCACTTAGGGGAAAATGGCTT	0.353																																					.													.	FRG1B	181		0			.																																									SO:0001819	synonymous_variant	284802	.			TTAGGGGAAAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.231G>T	20.37:g.29628229G>T			394	0.0228426396	9		493	0.04	20	.	94	0.00	0	C4AME5	Silent	SNP	ENST00000278882.3	37																																																																																						0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
POFUT1	23509	mdanderson.org	37	20	30795757	30795757	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr20:30795757G>T	ENST00000375749.3	+	1	75	c.13G>T	c.(13-15)Gcg>Tcg	p.A5S	POFUT1_ENST00000375730.3_Missense_Mutation_p.A5S|POFUT1_ENST00000486717.1_3'UTR|POFUT1_ENST00000539210.1_5'UTR|PLAGL2_ENST00000246229.4_5'Flank	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	5					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GGGCGCCGCCGCGTGGGCACG	0.751																																					p.A5S													POFUT1,NS,carcinoma,-2,1	POFUT1	-2	1	0			c.G13T												5.0	7.0	7.0					20																	30795757		2108	4187	6295	SO:0001583	missense	23509	exon1			GCCGCCGCGTGGG	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.13G>T	20.37:g.30795757G>T	ENSP00000364902:p.Ala5Ser		9	0	0		17	0.12	2	NM_172236	28	0.00	0	A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	ENST00000375749.3	37	CCDS13198.1	.	.	.	.	.	.	.	.	.	.	G	33	5.220941	0.95139	.	.	ENSG00000101346	ENST00000375749;ENST00000375730	T	0.31247	1.5	4.25	4.25	0.50352	.	0.166877	0.36482	N	0.002563	T	0.39655	0.1086	N	0.19112	0.55	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.79108	0.982;0.992	T	0.36696	-0.9737	10	0.54805	T	0.06	-16.3394	14.6072	0.68489	0.0:0.0:1.0:0.0	.	5;5	Q9H488;Q9H488-2	OFUT1_HUMAN;.	S	5	ENSP00000364902:A5S	ENSP00000364882:A5S	A	+	1	0	POFUT1	30259418	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.903000	0.69877	2.182000	0.69389	0.563000	0.77884	GCG			0.751	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078613.1		NM_015352	
CDH26	60437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	58560110	58560110	+	Silent	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr20:58560110C>T	ENST00000244047.5	+	7	1074	c.763C>T	c.(763-765)Ctg>Ttg	p.L255L	CDH26_ENST00000348616.4_Silent_p.L255L			Q8IXH8	CAD26_HUMAN	cadherin 26	255	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			AGAACCGTCACTGTCATCCAC	0.542																																					p.L255L													.	.			0			c.C763T												66.0	56.0	59.0					20																	58560110		2203	4300	6503	SO:0001819	synonymous_variant	60437	exon7			CCGTCACTGTCAT	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.763C>T	20.37:g.58560110C>T			106	0	0		143	0.14	20	NM_177980	0		0	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	ENST00000244047.5	37																																																																																						0.542	CDH26-201	KNOWN	basic	protein_coding	protein_coding				NM_177980	
KRTAP10-10	353333	mdanderson.org	37	21	46057778	46057778	+	Silent	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr21:46057778G>T	ENST00000380095.1	+	1	506	c.444G>T	c.(442-444)gtG>gtT	p.V148V	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	148	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CCTGCTGTGTGCCTGTCTGCT	0.612																																					p.V148V													.	.			0			c.G444T												304.0	273.0	283.0					21																	46057778		2203	4300	6503	SO:0001819	synonymous_variant	353333	exon1			CTGTGTGCCTGTC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.444G>T	21.37:g.46057778G>T			59	0	0		75	0.05	4	NM_181688	0		0		Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																					0.612	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128034.1		NM_181688	
MCM3AP	8888	broad.mit.edu	37	21	47704596	47704596	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr21:47704596G>T	ENST00000397708.1	-	2	859	c.605C>A	c.(604-606)gCt>gAt	p.A202D	YBEY_ENST00000329319.3_5'Flank|YBEY_ENST00000397691.1_5'Flank|YBEY_ENST00000397694.1_5'Flank|YBEY_ENST00000397692.1_5'Flank|YBEY_ENST00000397701.4_5'Flank|MCM3AP_ENST00000291688.1_Missense_Mutation_p.A202D|YBEY_ENST00000339195.6_5'Flank			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	202	FG-repeats.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					TGAAGTGGTAGCTGAACTACT	0.398																																					p.A202D													.	MCM3AP	146		0			c.C605A												67.0	73.0	71.0					21																	47704596		2203	4300	6503	SO:0001583	missense	8888	exon1			GTGGTAGCTGAAC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.605C>A	21.37:g.47704596G>T	ENSP00000380820:p.Ala202Asp		101	0	0		134	0.04	5	NM_003906	46	0.00	0	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	G	6.993	0.553401	0.13374	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.18016	2.24;2.24	5.21	2.07	0.26955	.	1.325240	0.04634	N	0.404066	T	0.13970	0.0338	N	0.24115	0.695	0.09310	N	1	B	0.27498	0.18	B	0.27076	0.076	T	0.36212	-0.9757	10	0.27082	T	0.32	-1.2279	10.5566	0.45121	0.0814:0.2649:0.6537:0.0	.	202	O60318	MCM3A_HUMAN	D	202	ENSP00000380820:A202D;ENSP00000291688:A202D	ENSP00000291688:A202D	A	-	2	0	MCM3AP	46529024	0.037000	0.19845	0.051000	0.19133	0.442000	0.32017	0.679000	0.25291	0.548000	0.28955	0.561000	0.74099	GCT			0.398	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207254.1		NM_003906	
OR11H1	81061	bcgsc.ca;mdanderson.org	37	22	16449645	16449645	+	Missense_Mutation	SNP	T	T	C	rs145243620		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr22:16449645T>C	ENST00000252835.4	-	1	160	c.160A>G	c.(160-162)Ata>Gta	p.I54V		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TTCCCTGTTATAGTCAGTGCA	0.408																																					p.I54V													.	OR11H1	44		0			c.A160G							T	VAL/ILE	6,2996		0,6,1495	102.0	101.0	102.0		160	-4.1	1.0	22	dbSNP_134	102	0,6322		0,0,3161	no	missense	OR11H1	NM_001005239.1	29	0,6,4656	CC,CT,TT		0.0,0.1999,0.0644	benign	54/327	16449645	6,9318	1501	3161	4662	SO:0001583	missense	81061	exon1			CTGTTATAGTCAG	AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.160A>G	22.37:g.16449645T>C	ENSP00000252835:p.Ile54Val		540	0	0		554	0.08	43	NM_001005239	0		0	Q6IEX0|Q96R32	Missense_Mutation	SNP	ENST00000252835.4	37	CCDS33594.1	.	.	.	.	.	.	.	.	.	.	t	0.366	-0.936708	0.02340	0.001999	0.0	ENSG00000130538	ENST00000252835	T	0.00531	6.76	2.19	-4.09	0.03951	.	1.066260	0.07434	N	0.896197	T	0.00241	0.0007	N	0.04373	-0.215	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.31223	-0.9951	10	0.33141	T	0.24	.	3.9849	0.09511	0.0:0.3122:0.4163:0.2715	.	54	Q8NG94	O11H1_HUMAN	V	54	ENSP00000252835:I54V	ENSP00000252835:I54V	I	-	1	0	OR11H1	14829645	0.000000	0.05858	0.978000	0.43139	0.082000	0.17680	-4.465000	0.00229	-0.424000	0.07382	-0.623000	0.04022	ATA			0.408	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000074923.2		NM_001005239	
DGCR6	8214	mdanderson.org	37	22	18897765	18897765	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr22:18897765G>A	ENST00000331444.6	+	3	504	c.352G>A	c.(352-354)Gct>Act	p.A118T	DGCR6_ENST00000413981.1_5'UTR|DGCR6_ENST00000436645.1_3'UTR	NM_005675.4	NP_005666.2	Q14129	DGCR6_HUMAN	DiGeorge syndrome critical region gene 6	118					cell adhesion (GO:0007155)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|upper_aerodigestive_tract(1)	3						GCTTCAGGCGGCTCAGCAGCG	0.677																																					p.A118T													.	.			0			c.G352A												21.0	24.0	23.0					22																	18897765		2200	4299	6499	SO:0001583	missense	8214	exon3			CAGGCGGCTCAGC	X96484	CCDS13753.1	22q11.21	2008-06-12			ENSG00000183628	ENSG00000183628			2846	protein-coding gene	gene with protein product		601279				8733130	Standard	NM_005675		Approved		uc002zoh.4	Q14129	OTTHUMG00000150162	ENST00000331444.6:c.352G>A	22.37:g.18897765G>A	ENSP00000331681:p.Ala118Thr		37	0	0		50	0.06	3	NM_005675	24	0.00	0	B2RCH5|D3DX15|G5E9J8|Q9BY28	Missense_Mutation	SNP	ENST00000331444.6	37	CCDS13753.1	.	.	.	.	.	.	.	.	.	.	g	5.459	0.269757	0.10349	.	.	ENSG00000183628	ENST00000331444;ENST00000436645	T	0.29142	1.58	3.61	3.61	0.41365	.	0.131192	0.52532	D	0.000070	T	0.14442	0.0349	N	0.12569	0.235	0.30957	N	0.724121	B	0.18310	0.027	B	0.22152	0.038	T	0.14282	-1.0478	10	0.14656	T	0.56	-8.8077	7.0871	0.25264	0.125:0.0:0.875:0.0	.	118	Q14129	DGCR6_HUMAN	T	118;38	ENSP00000331681:A118T	ENSP00000331681:A118T	A	+	1	0	DGCR6	17277765	0.060000	0.20803	0.994000	0.49952	0.079000	0.17450	1.767000	0.38501	2.035000	0.60131	0.400000	0.26472	GCT			0.677	DGCR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316631.2		NM_005675	
RTN4R	65078	mdanderson.org	37	22	20229344	20229344	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr22:20229344C>T	ENST00000043402.7	-	2	1750	c.1312G>A	c.(1312-1314)Ggt>Agt	p.G438S	RTN4R_ENST00000469601.1_5'Flank	NM_023004.5	NP_075380.1	Q9BZR6	RTN4R_HUMAN	reticulon 4 receptor	438	Poly-Gly.				axonogenesis (GO:0007409)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			lung(1)|ovary(1)|prostate(1)	3	Colorectal(54;0.0993)					GTCCCGCCACCCCCGCTGCCT	0.711																																					p.G438S													.	.			0			c.G1312A												9.0	8.0	8.0					22																	20229344		2136	4208	6344	SO:0001583	missense	65078	exon2			CGCCACCCCCGCT	AF283463	CCDS13777.1	22q11	2008-05-02			ENSG00000040608	ENSG00000040608			18601	protein-coding gene	gene with protein product		605566				11201742	Standard	NM_023004		Approved	NOGOR	uc002zrv.3	Q9BZR6	OTTHUMG00000150572	ENST00000043402.7:c.1312G>A	22.37:g.20229344C>T	ENSP00000043402:p.Gly438Ser		51	0	0		59	0.05	3	NM_023004	18	0.00	0	D3DX28	Missense_Mutation	SNP	ENST00000043402.7	37	CCDS13777.1	.	.	.	.	.	.	.	.	.	.	C	7.470	0.646568	0.14451	.	.	ENSG00000040608	ENST00000043402	T	0.60299	0.2	3.02	1.95	0.26073	.	.	.	.	.	T	0.34774	0.0909	N	0.22421	0.69	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.24657	-1.0154	9	0.06494	T	0.89	.	6.4138	0.21705	0.0:0.8542:0.0:0.1458	.	438	Q9BZR6	RTN4R_HUMAN	S	438	ENSP00000043402:G438S	ENSP00000043402:G438S	G	-	1	0	RTN4R	18609344	0.000000	0.05858	0.073000	0.20177	0.443000	0.32047	0.598000	0.24074	0.577000	0.29470	0.305000	0.20034	GGT			0.711	RTN4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318950.2			
CELSR1	9620	broad.mit.edu	37	22	46832175	46832175	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr22:46832175T>C	ENST00000262738.3	-	4	4417	c.4418A>G	c.(4417-4419)cAg>cGg	p.Q1473R		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1473	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GTTCCTTTCCTGAGTGGCAAA	0.577																																					p.Q1473R													.	CELSR1	242		0			c.A4418G												77.0	60.0	66.0					22																	46832175		2203	4300	6503	SO:0001583	missense	9620	exon4			CTTTCCTGAGTGG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4418A>G	22.37:g.46832175T>C	ENSP00000262738:p.Gln1473Arg		53	0	0		81	0.04	3	NM_014246	17	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.486005	0.01018	.	.	ENSG00000075275	ENST00000262738	T	0.76060	-0.99	4.73	-0.632	0.11523	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.405610	0.21432	N	0.074628	T	0.34803	0.0910	N	0.00595	-1.35	0.24844	N	0.992446	B	0.06786	0.001	B	0.11329	0.006	T	0.42378	-0.9455	10	0.11182	T	0.66	.	9.2835	0.37742	0.0:0.5706:0.0:0.4294	.	1473	Q9NYQ6	CELR1_HUMAN	R	1473	ENSP00000262738:Q1473R	ENSP00000262738:Q1473R	Q	-	2	0	CELSR1	45210839	0.004000	0.15560	0.387000	0.26183	0.169000	0.22640	0.199000	0.17237	-0.010000	0.14271	-0.388000	0.06559	CAG			0.577	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
EPM2AIP1	9852	mdanderson.org	37	3	37034271	37034271	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr3:37034271C>A	ENST00000322716.5	-	1	524	c.298G>T	c.(298-300)Gca>Tca	p.A100S	MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000536378.1_5'Flank|MLH1_ENST00000435176.1_5'Flank|MLH1_ENST00000455445.2_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	100					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						CCGAGGCCTGCACGAGCAGCT	0.657																																					p.A100S													.	.			0			c.G298T												60.0	67.0	65.0					3																	37034271		1949	4153	6102	SO:0001583	missense	9852	exon1			GGCCTGCACGAGC	AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.298G>T	3.37:g.37034271C>A	ENSP00000406027:p.Ala100Ser		30	0	0		53	0.06	3	NM_014805	1	0.00	0	O94866|Q9H3L3	Missense_Mutation	SNP	ENST00000322716.5	37	CCDS46790.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099338	0.76983	.	.	ENSG00000178567	ENST00000322716	T	0.17691	2.26	5.26	5.26	0.73747	.	.	.	.	.	T	0.32585	0.0834	L	0.40543	1.245	0.35862	D	0.827583	D	0.76494	0.999	D	0.83275	0.996	T	0.14117	-1.0484	9	0.46703	T	0.11	-15.268	14.2504	0.66016	0.0:1.0:0.0:0.0	.	100	Q7L775	EPMIP_HUMAN	S	100	ENSP00000406027:A100S	ENSP00000406027:A100S	A	-	1	0	EPM2AIP1	37009275	0.991000	0.36638	0.954000	0.39281	0.973000	0.67179	3.165000	0.50778	2.735000	0.93741	0.563000	0.77884	GCA			0.657	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000470593.1		NM_014805	
WWP1P1	339843	bcgsc.ca	37	3	98378117	98378117	+	IGR	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr3:98378117G>T								AC021660.1 (35229 upstream) : ST3GAL6-AS1 (55056 downstream)																							AGAACTCAAGGCTTACAGAAT	0.418																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CTCAAGGCTTACA																													3.37:g.98378117G>T			108	0	0		141	0.31	44	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.418										
LOC220729	220729	broad.mit.edu	37	3	197348646	197348646	+	RNA	SNP	T	T	C	rs377377382		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr3:197348646T>C	ENST00000418868.1	-	0	613					NR_003266.2																						TGGGCCTGCCTGCCCTTTCCA	0.532																																					.													.	.			0			.																																											0	.			CCTGCCTGCCCTT																													3.37:g.197348646T>C			60	0.0166666667	1		82	0.06	5	.	15	0.00	0		RNA	SNP	ENST00000418868.1	37																																																																																						0.532	AC024560.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000340283.1			
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55593605	55593605	+	Missense_Mutation	SNP	G	G	T	rs121913511|rs121913234|rs121913510		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr4:55593605G>T	ENST00000288135.5	+	11	1768	c.1671G>T	c.(1669-1671)tgG>tgT	p.W557C		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	557			Missing (in GIST; somatic mutation). {ECO:0000269|PubMed:15824741, ECO:0000269|PubMed:9438854}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W557_K558del(120)|p.W557_V559>F(18)|p.W557_E561del(17)|p.W557_V559>C(9)|p.Y553_K558>(8)|p.E554_K558del(8)|p.K550_K558del(7)|p.W557_V559del(7)|p.Q556_V560del(6)|p.M552_W557del(6)|p.Y553_K558del(4)|p.W557del(4)|p.V555_K558del(3)|p.W557_V560>C(3)|p.Y553_T574>S(3)|p.V555_I571del(3)|p.V555_V560del(3)|p.V555_P573del(3)|p.Q556_V560>H(3)|p.V555_V559del(3)|p.W557_K558>CP(3)|p.W557_K558>E(2)|p.Q556_L576del(2)|p.K550_V559del(2)|p.W557_Q575del(2)|p.K550fs*6(2)|p.Q556_K558del(2)|p.V555_E562del(2)|p.W557_V560del(2)|p.Q556_V559del(2)|p.W557_P573>S(2)|p.W557_K558>FP(1)|p.V555_G565del(1)|p.Q556_N566>SNNLQLY(1)|p.W557_K558>C(1)|p.Q556_W557del(1)|p.P551_K558del(1)|p.Q556_V559>H(1)|p.M552_E561>K(1)|p.V555_I563del(1)|p.W557_K558>S(1)|p.Q556_K558>HPCR(1)|p.E554_I571del(1)|p.Q556_V560>F(1)|p.V555_Y570del(1)|p.M552_T574>TESA(1)|p.W557_K558>SS(1)|p.Q556_D572>PS(1)|p.Y553_W557del(1)|p.Q556_D572del(1)|p.W557_E562del(1)|p.V555_N566>D(1)|p.V555_V560>V(1)|p.W557*(1)|p.Q556_V560>HNLQLY(1)|p.W557_K558>CT(1)|p.M552_K558del(1)|p.Q556_E561del(1)|p.W557C(1)|p.Q556_K558>H(1)|p.Q556_E561>HH(1)|p.W557_V560>F(1)|p.W557_I571del(1)|p.Q556_K558>R(1)|p.E554_N564del(1)|p.Q556_V560>TTF(1)|p.K550_W557del(1)|p.Q556_D572>H(1)|p.W557_V559>I(1)|p.M552_D572del(1)|p.Y553_V559>E(1)|p.Q556_T574del(1)|p.P551_V559del>L(1)|p.Q556_P573del(1)|p.E554_D572del(1)|p.Q556_V559>HT(1)|p.E554_E562del(1)|p.Y553_V559del(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAGTACAGTGGAAGGTTGTTG	0.388		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.W557C			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,germ_cell_tumour,+2,59	KIT	2	59	308	Deletion - In frame(229)|Complex - deletion inframe(66)|Complex - compound substitution(6)|Complex - insertion inframe(3)|Deletion - Frameshift(2)|Substitution - Nonsense(1)|Substitution - Missense(1)	soft_tissue(303)|haematopoietic_and_lymphoid_tissue(2)|genital_tract(1)|testis(1)|skin(1)	c.G1671T												80.0	82.0	81.0					4																	55593605		2203	4300	6503	SO:0001583	missense	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	ACAGTGGAAGGTT	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1671G>T	4.37:g.55593605G>T	ENSP00000288135:p.Trp557Cys		122	0	0		266	0.11	28	NM_000222	622	0.16	100	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.432207	0.83776	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.95724	-3.79;-3.79	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000016	D	0.98157	0.9391	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.991	D	0.98281	1.0508	10	0.87932	D	0	.	20.613	0.99472	0.0:0.0:1.0:0.0	.	64;553;557	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	C	557;553	ENSP00000288135:W557C;ENSP00000390987:W553C	ENSP00000288135:W557C	W	+	3	0	KIT	55288362	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.667000	0.98616	2.876000	0.98609	0.655000	0.94253	TGG			0.388	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
MTHFD2L	441024	broad.mit.edu	37	4	75067012	75067012	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr4:75067012G>T	ENST00000395759.2	+	5	664	c.637G>T	c.(637-639)Gct>Tct	p.A213S	MTHFD2L_ENST00000331145.6_Missense_Mutation_p.A155S|MTHFD2L_ENST00000325278.6_Missense_Mutation_p.A155S|MTHFD2L_ENST00000433372.1_Missense_Mutation_p.A78S	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	213					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			TGTGGTTGTGGCTGGAAGATC	0.403																																					p.A213S													.	MTHFD2L	41		0			c.G637T												98.0	95.0	96.0					4																	75067012		2203	4300	6503	SO:0001583	missense	441024	exon5			GTTGTGGCTGGAA	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.637G>T	4.37:g.75067012G>T	ENSP00000379108:p.Ala213Ser		143	0	0		138	0.03	4	NM_001144978	1	0.00	0	Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	37	CCDS47075.1	.	.	.	.	.	.	.	.	.	.	G	31	5.103542	0.94245	.	.	ENSG00000163738	ENST00000433372;ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38	5.97	5.97	0.96955	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.093875	0.64402	D	0.000001	T	0.70527	0.3234	M	0.80847	2.515	0.43930	D	0.996581	P;P	0.44429	0.835;0.735	P;P	0.53518	0.728;0.624	T	0.72969	-0.4130	10	0.87932	D	0	-26.6548	17.9263	0.88985	0.0:0.0:1.0:0.0	.	213;155	Q9H903;Q9H903-3	MTD2L_HUMAN;.	S	78;213;155;155;155	ENSP00000405692:A78S;ENSP00000379108:A213S;ENSP00000330982:A155S;ENSP00000352012:A155S;ENSP00000321984:A155S	ENSP00000321984:A155S	A	+	1	0	MTHFD2L	75285876	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.314000	0.96306	2.833000	0.97629	0.585000	0.79938	GCT			0.403	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001004346	
DSPP	1834	bcgsc.ca	37	4	88537114	88537114	+	Silent	SNP	C	C	T	rs369973717	byFrequency	TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr4:88537114C>T	ENST00000282478.7	+	4	3333	c.3300C>T	c.(3298-3300)agC>agT	p.S1100S	DSPP_ENST00000399271.1_Silent_p.S1100S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1100	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgatagcagcgacagcagcg	0.547													T|||	2077	0.414736	0.5416	0.487	5008	,	,		13280	0.3323		0.3996	False		,,,				2504	0.2924				p.S1100S													.	DSPP	174		0			c.C3300T												13.0	21.0	18.0					4																	88537114		1002	1944	2946	SO:0001819	synonymous_variant	1834	exon5			TAGCAGCGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3300C>T	4.37:g.88537114C>T			32	0	0		28	0.29	8	NM_014208	0		0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																					0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
PCDH10	57575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	134072091	134072091	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr4:134072091G>C	ENST00000264360.5	+	1	1622	c.796G>C	c.(796-798)Ggc>Cgc	p.G266R	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	266	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CTCTCCCCCAGGCACTCTCGT	0.622																																					p.G266R													.	.			0			c.G796C												88.0	87.0	87.0					4																	134072091		2203	4300	6503	SO:0001583	missense	57575	exon1			CCCCCAGGCACTC	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.796G>C	4.37:g.134072091G>C	ENSP00000264360:p.Gly266Arg		73	0	0		50	0.18	9	NM_032961	0		0	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735616	0.30774	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.55413	0.52	4.29	2.52	0.30459	Cadherin (4);Cadherin-like (1);	0.000000	0.44902	D	0.000420	T	0.78660	0.4318	H	0.97077	3.935	0.58432	D	0.999992	D;D	0.89917	0.993;1.0	D;D	0.79784	0.955;0.993	T	0.80756	-0.1240	10	0.87932	D	0	.	9.5853	0.39512	0.0805:0.1416:0.7779:0.0	.	266;266	Q9P2E7;Q96SF0	PCD10_HUMAN;.	R	266	ENSP00000264360:G266R	ENSP00000264360:G266R	G	+	1	0	PCDH10	134291541	1.000000	0.71417	0.151000	0.22473	0.203000	0.24098	9.584000	0.98220	0.416000	0.25844	0.505000	0.49811	GGC			0.622	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000364457.2		NM_032961	
PCDH10	57575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	134073757	134073757	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr4:134073757A>T	ENST00000264360.5	+	1	3288	c.2462A>T	c.(2461-2463)tAt>tTt	p.Y821F		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	821					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		AATTACTGCTATCAGGTATGC	0.597																																					p.Y821F													.	.			0			c.A2462T												84.0	74.0	78.0					4																	134073757		2203	4300	6503	SO:0001583	missense	57575	exon1			ACTGCTATCAGGT	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2462A>T	4.37:g.134073757A>T	ENSP00000264360:p.Tyr821Phe		109	0	0		77	0.16	12	NM_032961	1	1.00	1	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.158810	0.78226	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.61510	0.1	5.01	5.01	0.66863	.	0.000000	0.41001	D	0.000974	T	0.71500	0.3347	L	0.58101	1.795	0.58432	D	0.999998	D;D	0.69078	0.997;0.985	D;P	0.70716	0.97;0.728	T	0.75065	-0.3449	10	0.87932	D	0	.	14.3979	0.67022	1.0:0.0:0.0:0.0	.	821;821	Q9P2E7;Q96SF0	PCD10_HUMAN;.	F	821	ENSP00000264360:Y821F	ENSP00000264360:Y821F	Y	+	2	0	PCDH10	134293207	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.923000	0.92808	1.883000	0.54544	0.459000	0.35465	TAT			0.597	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000364457.2		NM_032961	
MAN2A1	4124	mdanderson.org	37	5	109103372	109103372	+	Silent	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr5:109103372G>A	ENST00000261483.4	+	6	2024	c.972G>A	c.(970-972)ctG>ctA	p.L324L		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	324					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		ACTTTGCACTGCATAAAACAT	0.388																																					p.L324L													.	.			0			c.G972A												111.0	111.0	111.0					5																	109103372		2202	4299	6501	SO:0001819	synonymous_variant	4124	exon6			TGCACTGCATAAA		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.972G>A	5.37:g.109103372G>A			53	0	0		55	0.07	4	NM_002372	4	0.00	0	Q16767	Silent	SNP	ENST00000261483.4	37	CCDS34209.1																																																																																					0.388	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370680.1			
FBN2	2201	mdanderson.org	37	5	127873220	127873220	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr5:127873220G>A	ENST00000508053.1	-	7	1051	c.77C>T	c.(76-78)aCg>aTg	p.T26M	FBN2_ENST00000508989.1_Missense_Mutation_p.T26M|FBN2_ENST00000262464.4_Missense_Mutation_p.T26M			P35556	FBN2_HUMAN	fibrillin 2	26					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTGGCCGGCCGTGCCCTGCGC	0.711																																					p.T26M													.	.			0			c.C77T												14.0	15.0	15.0					5																	127873220		2164	4240	6404	SO:0001583	missense	2201	exon1			CCGGCCGTGCCCT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.77C>T	5.37:g.127873220G>A	ENSP00000424571:p.Thr26Met		50	0	0		24	0.13	3	NM_001999	0		0	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672391	0.67928	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989;ENST00000502468	D;D;D;T	0.86694	-1.88;-1.88;-2.16;-0.69	4.77	4.77	0.60923	.	0.354847	0.23916	N	0.043287	T	0.80869	0.4706	N	0.08118	0	0.33145	D	0.544896	D;D;D;P	0.61080	0.988;0.989;0.957;0.88	P;P;B;B	0.51016	0.656;0.551;0.321;0.321	T	0.82961	-0.0197	10	0.25106	T	0.35	.	15.9565	0.79891	0.0:0.0:1.0:0.0	.	26;26;26;26	P35556-2;E9PHW4;D6RJI3;P35556	.;.;.;FBN2_HUMAN	M	26	ENSP00000262464:T26M;ENSP00000424571:T26M;ENSP00000425596:T26M;ENSP00000424753:T26M	ENSP00000262464:T26M	T	-	2	0	FBN2	127901119	0.999000	0.42202	0.936000	0.37596	0.998000	0.95712	4.032000	0.57274	2.350000	0.79820	0.591000	0.81541	ACG			0.711	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371618.2		NM_001999	
BTN2A3P	54718	broad.mit.edu;mdanderson.org	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	.		9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											0	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			113	0	0		130	0.05	6	.	0		0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
ZNF322	79692	broad.mit.edu	37	6	26637624	26637624	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr6:26637624delT	ENST00000415922.2	-	4	1803	c.1158delA	c.(1156-1158)aaafs	p.K386fs	ZNF322_ENST00000461899.1_5'Flank|RP11-457M11.2_ENST00000456172.1_RNA|ZNF322_ENST00000471278.1_Frame_Shift_Del_p.K386fs	NM_024639.4	NP_078915.2	Q6U7Q0	ZN322_HUMAN	zinc finger protein 322	386					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCTCAAGACCTTTTTCACTCA	0.413																																					p.K386fs													.	.			0			c.1158delA												175.0	133.0	147.0					6																	26637624		2201	4298	6499	SO:0001589	frameshift_variant	79692	exon5			AAGACCTTTTTCA	AY376736	CCDS4617.1	6p22.1	2013-01-08	2011-07-29	2011-07-29	ENSG00000181315	ENSG00000181315		"""Zinc fingers, C2H2-type"""	23640	protein-coding gene	gene with protein product		610847	"""zinc finger protein 489"", ""HLA complex group 12"", ""zinc finger protein 322A"""	ZNF489, ZNF388, HCG12, ZNF322A		15555580	Standard	NM_024639		Approved	bA457M11.3, bA457M11.2	uc021yny.1	Q6U7Q0	OTTHUMG00000014460	ENST00000415922.2:c.1158delA	6.37:g.26637624delT	ENSP00000418897:p.Lys386fs		727	0	0		833	0.01	8	NM_001242797	31	0.00	0	A8K1X3|Q0VDH6|Q6B0G2|Q86W72|Q9H5I9	Frame_Shift_Del	DEL	ENST00000415922.2	37	CCDS4617.1																																																																																					0.413	ZNF322-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040126.2		NM_024639	
VWA7	80737	broad.mit.edu	37	6	31733784	31733784	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr6:31733784A>C	ENST00000375688.4	-	16	2575	c.2375T>G	c.(2374-2376)gTc>gGc	p.V792G	VWA7_ENST00000467576.1_5'Flank|VWA7_ENST00000375686.3_Missense_Mutation_p.V792G|SAPCD1-AS1_ENST00000419679.1_RNA			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	792						extracellular region (GO:0005576)											TGAATCTGGGACCTCCAGCCA	0.627																																					p.V792G													.	.			0			c.T2375G												89.0	113.0	104.0					6																	31733784		1508	2707	4215	SO:0001583	missense	80737	exon16			TCTGGGACCTCCA		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2375T>G	6.37:g.31733784A>C	ENSP00000364840:p.Val792Gly		69	0.2898550725	20		108	0.34	37	NM_025258	1	0.00	0	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	A	22.8	4.333629	0.81801	.	.	ENSG00000204396	ENST00000375688;ENST00000375686	T;T	0.18016	2.46;2.24	4.75	4.75	0.60458	.	0.415822	0.21513	N	0.073344	T	0.13372	0.0324	L	0.32530	0.975	0.80722	D	1	P	0.51791	0.948	P	0.55577	0.779	T	0.02378	-1.1168	10	0.38643	T	0.18	-19.5948	10.8128	0.46557	1.0:0.0:0.0:0.0	.	792	Q9Y334	G7C_HUMAN	G	792	ENSP00000364840:V792G;ENSP00000364838:V792G	ENSP00000364838:V792G	V	-	2	0	C6orf27	31841763	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.046000	0.57376	2.125000	0.65367	0.460000	0.39030	GTC			0.627	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076233.2		NM_025258	
HLA-DOA	3111	broad.mit.edu	37	6	32975873	32975873	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr6:32975873T>C	ENST00000229829.5	-	2	323	c.248A>G	c.(247-249)cAg>cGg	p.Q83R	HLA-DOA_ENST00000495532.1_5'UTR|HLA-DOA_ENST00000450833.2_Missense_Mutation_p.Q53R	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	83	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						CAGCCCGCCCTGCGGGTCAAA	0.602																																					p.Q83R													.	HLA-DOA	22		0			c.A248G												50.0	50.0	50.0					6																	32975873		1511	2709	4220	SO:0001583	missense	3111	exon2			CCGCCCTGCGGGT	M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.248A>G	6.37:g.32975873T>C	ENSP00000229829:p.Gln83Arg		69	0.0144927536	1		107	0.04	4	NM_002119	31	0.00	0	Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Missense_Mutation	SNP	ENST00000229829.5	37	CCDS4763.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.062|9.062	0.994682|0.994682	0.19043|0.19043	.|.	.|.	ENSG00000204252|ENSG00000204252	ENST00000374813|ENST00000229829;ENST00000450833	.|T;T	.|0.01015	.|5.44;5.44	4.5|4.5	4.5|4.5	0.54988|0.54988	.|MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);MHC class II, alpha chain, N-terminal (2);	.|0.301841	.|0.31697	.|N	.|0.007209	.|T	.|0.03011	.|0.0089	M|M	0.90082|0.90082	3.085|3.085	0.23661|0.23661	N|N	0.997171|0.997171	.|D;D	.|0.57899	.|0.965;0.981	.|D;D	.|0.75020	.|0.985;0.943	.|T	.|0.17899	.|-1.0354	.|10	.|0.87932	.|D	.|0	.|.	10.4184|10.4184	0.44335|0.44335	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|53;83	.|B4DW77;P06340	.|.;DOA_HUMAN	.|R	-1|83;53	.|ENSP00000229829:Q83R;ENSP00000403896:Q53R	.|ENSP00000229829:Q83R	.|Q	-|-	.|2	.|0	HLA-DOA|HLA-DOA	33083851|33083851	0.171000|0.171000	0.23029|0.23029	0.300000|0.300000	0.25030|0.25030	0.253000|0.253000	0.25986|0.25986	1.315000|1.315000	0.33608|0.33608	2.021000|2.021000	0.59480|0.59480	0.459000|0.459000	0.35465|0.35465	.|CAG			0.602	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076426.2		NM_002119	
KLHL31	401265	mdanderson.org	37	6	53516646	53516646	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr6:53516646T>C	ENST00000407079.1	-	2	1654	c.1655A>G	c.(1654-1656)cAg>cGg	p.Q552R	KLHL31_ENST00000370905.3_Missense_Mutation_p.Q552R			Q9H511	KLH31_HUMAN	kelch-like family member 31	552					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					CACTCCCACCTGCAGCGGCGC	0.716																																					p.Q552R													.	.			0			c.A1655G												13.0	15.0	14.0					6																	53516646		2195	4292	6487	SO:0001583	missense	401265	exon3			CCCACCTGCAGCG		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.1655A>G	6.37:g.53516646T>C	ENSP00000384644:p.Gln552Arg		25	0	0		32	0.09	3	NM_001003760	0		0	A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	37	CCDS34478.1	.	.	.	.	.	.	.	.	.	.	T	3.740	-0.053862	0.07362	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.65549	-0.16;-0.16	5.67	-11.3	0.00108	Galactose oxidase, beta-propeller (1);	0.722104	0.14382	N	0.323097	T	0.14442	0.0349	N	0.25426	0.745	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.16571	-1.0398	10	0.11182	T	0.66	.	10.1395	0.42728	0.2971:0.0:0.5707:0.1322	.	552	Q9H511	KLH31_HUMAN	R	552	ENSP00000359942:Q552R;ENSP00000384644:Q552R	ENSP00000359942:Q552R	Q	-	2	0	KLHL31	53624605	0.000000	0.05858	0.001000	0.08648	0.866000	0.49608	-0.943000	0.03917	-2.269000	0.00684	-1.096000	0.02151	CAG			0.716	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040965.1		NM_001003760	
IGF2R	3482	broad.mit.edu	37	6	160509121	160509121	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr6:160509121G>A	ENST00000356956.1	+	42	6410	c.6262G>A	c.(6262-6264)Gca>Aca	p.A2088T		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	2088					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.A2088T(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AAATAAGACCGCATCCTCCGT	0.478											OREG0017769	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A2088T													IGF2R,NS,carcinoma,0,3	IGF2R	251	3	1	Substitution - Missense(1)	large_intestine(1)	c.G6262A												128.0	113.0	118.0					6																	160509121		2203	4300	6503	SO:0001583	missense	3482	exon42			AAGACCGCATCCT	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.6262G>A	6.37:g.160509121G>A	ENSP00000349437:p.Ala2088Thr		94	0	0	1809	116	0.03	4	NM_000876	118	0.01	1	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022273	0.35701	.	.	ENSG00000197081	ENST00000356956	T	0.29397	1.57	5.0	3.22	0.36961	Mannose-6-phosphate receptor, binding (1);	0.182681	0.47852	N	0.000208	T	0.12646	0.0307	M	0.79805	2.47	0.09310	N	1	B	0.19935	0.04	B	0.21708	0.036	T	0.34428	-0.9829	10	0.16420	T	0.52	-12.0389	5.0076	0.14295	0.2386:0.0:0.614:0.1474	.	2088	P11717	MPRI_HUMAN	T	2088	ENSP00000349437:A2088T	ENSP00000349437:A2088T	A	+	1	0	IGF2R	160429111	0.024000	0.19004	0.009000	0.14445	0.835000	0.47333	1.236000	0.32683	0.521000	0.28445	0.655000	0.94253	GCA			0.478	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042931.1		NM_000876	
RAC1	5879	broad.mit.edu	37	7	6441622	6441622	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr7:6441622A>G	ENST00000348035.4	+	5	625	c.412A>G	c.(412-414)Acc>Gcc	p.T138A	RAC1_ENST00000488373.1_3'UTR|RAC1_ENST00000356142.4_Missense_Mutation_p.T157A	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	138					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	GACTCCCATCACCTATCCGCA	0.463																																					p.T157A													.	RAC1	101		0			c.A469G												186.0	152.0	164.0					7																	6441622		2203	4300	6503	SO:0001583	missense	5879	exon6			CCCATCACCTATC	AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.412A>G	7.37:g.6441622A>G	ENSP00000258737:p.Thr138Ala		74	0	0		116	0.03	3	NM_018890	798	0.00	2	O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Missense_Mutation	SNP	ENST00000348035.4	37	CCDS5348.1	.	.	.	.	.	.	.	.	.	.	.	19.64	3.864565	0.71949	.	.	ENSG00000136238	ENST00000348035;ENST00000356142	T;T	0.76839	-1.05;-1.05	5.89	5.89	0.94794	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.79015	0.4375	M	0.74467	2.265	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.14578	0.011;0.01	T	0.75969	-0.3130	10	0.66056	D	0.02	.	16.2979	0.82784	1.0:0.0:0.0:0.0	.	138;157	P63000;A4D2P0	RAC1_HUMAN;.	A	138;157	ENSP00000258737:T138A;ENSP00000348461:T157A	ENSP00000258737:T138A	T	+	1	0	RAC1	6408147	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.145000	0.94634	2.241000	0.73720	0.533000	0.62120	ACC			0.463	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000242868.2		NM_018890	
GTF2IRD2P1	401375	broad.mit.edu;bcgsc.ca	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			105	0.0095238095	1		177	0.04	7	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
GTF2I	2969	broad.mit.edu	37	7	74148279	74148279	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr7:74148279A>G	ENST00000324896.4	+	16	1708	c.1319A>G	c.(1318-1320)aAt>aGt	p.N440S	GTF2I_ENST00000416070.1_Missense_Mutation_p.N399S|GTF2I_ENST00000353920.4_Missense_Mutation_p.N420S|GTF2I_ENST00000346152.4_Missense_Mutation_p.N419S	NM_032999.2	NP_127492.1	P78347	GTF2I_HUMAN	general transcription factor IIi	440					negative regulation of angiogenesis (GO:0016525)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N440S(7)		NS(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19						GAGCTTCTGAATTCAACACGT	0.358																																					p.N440S													GTF2I,NS,carcinoma,0,7	GTF2I	40	7	7	Substitution - Missense(7)	endometrium(7)	c.A1319G												111.0	102.0	105.0					7																	74148279		2201	4300	6501	SO:0001583	missense	2969	exon16			TTCTGAATTCAAC	U77948	CCDS5573.1, CCDS5574.1, CCDS5575.1, CCDS47614.1, CCDS64680.1	7q11.23	2011-05-25	2009-07-23			ENSG00000263001		"""General transcription factors"""	4659	protein-coding gene	gene with protein product		601679	"""general transcription factor II, i"""	WBSCR6		9334314, 9012831	Standard	NM_032999		Approved	TFII-I, BAP-135, SPIN, BTKAP1, DIWS, IB291	uc003uau.3	P78347		ENST00000324896.4:c.1319A>G	7.37:g.74148279A>G	ENSP00000322542:p.Asn440Ser		415	0.0024096386	1		638	0.01	6	NM_032999	485	0.00	0	O14743|O15359|O43546|O43588|O43589|Q75M85|Q75M86|Q75M87|Q75M88|Q86U51|Q9BSZ4	Missense_Mutation	SNP	ENST00000324896.4	37	CCDS5573.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085752	0.55861	.	.	ENSG00000077809	ENST00000324896;ENST00000539339;ENST00000353920;ENST00000346152;ENST00000416070	T;T;T;T	0.35236	1.34;1.32;1.32;1.32	4.07	4.07	0.47477	.	0.000000	0.64402	D	0.000002	T	0.40670	0.1126	N	0.16368	0.405	0.80722	D	1	D;D;D;D;D	0.71674	0.997;0.971;0.99;0.998;0.982	D;P;D;D;D	0.76071	0.97;0.717;0.979;0.987;0.952	T	0.31052	-0.9957	10	0.45353	T	0.12	-19.2887	11.2081	0.48782	1.0:0.0:0.0:0.0	.	418;399;420;419;440	Q499G6;P78347-2;P78347-3;P78347-4;P78347	.;.;.;.;GTF2I_HUMAN	S	440;435;420;419;399	ENSP00000322542:N440S;ENSP00000322671:N420S;ENSP00000322599:N419S;ENSP00000387651:N399S	ENSP00000322542:N440S	N	+	2	0	GTF2I	73786215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.703000	0.54808	1.839000	0.53478	0.477000	0.44152	AAT			0.358	GTF2I-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252708.1		NM_032999	
SSPO	23145	mdanderson.org	37	7	149523792	149523792	+	RNA	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr7:149523792C>T	ENST00000378016.2	+	0	14605							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CACGTGTGTGCCTCCCACTGC	0.677																																					p.P4868S													.	.			0			c.C14602T												20.0	25.0	23.0					7																	149523792		2184	4269	6453			23145	exon103			TGTGTGCCTCCCA	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149523792C>T			18	0	0		21	0.10	2	NM_198455	0		0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.677	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
UBE3C	9690	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	157023941	157023941	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr7:157023941T>C	ENST00000348165.5	+	18	2761	c.2401T>C	c.(2401-2403)Tac>Cac	p.Y801H		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	801	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGGGCTTCTGTACCCCAACCC	0.423																																					p.Y801H													.	UBE3C	124		0			c.T2401C												64.0	68.0	67.0					7																	157023941		2203	4300	6503	SO:0001583	missense	9690	exon18			CTTCTGTACCCCA	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2401T>C	7.37:g.157023941T>C	ENSP00000309198:p.Tyr801His		145	0.0068965517	1		221	0.21	46	NM_014671	176	0.23	40	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	37	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.885870	0.91814	.	.	ENSG00000009335	ENST00000348165	T	0.58797	0.31	5.46	5.46	0.80206	HECT (4);	0.057534	0.64402	D	0.000001	T	0.75019	0.3793	M	0.71036	2.16	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.988	T	0.78357	-0.2235	10	0.87932	D	0	.	15.5773	0.76400	0.0:0.0:0.0:1.0	.	801;654	Q15386;B4DHJ9	UBE3C_HUMAN;.	H	801	ENSP00000309198:Y801H	ENSP00000309198:Y801H	Y	+	1	0	UBE3C	156716702	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.751000	0.85126	2.094000	0.63399	0.454000	0.30748	TAC			0.423	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348108.1		NM_014671	
DUSP4	1846	mdanderson.org	37	8	29207399	29207399	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr8:29207399G>A	ENST00000240100.2	-	1	786	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	RP4-676L2.1_ENST00000567818.1_RNA|DUSP4_ENST00000240101.2_5'Flank	NM_001394.6	NP_001385.1	Q13115	DUS4_HUMAN	dual specificity phosphatase 4	133	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein dephosphorylation (GO:0006470)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			endometrium(1)|large_intestine(1)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		TCGGCGTTGCGGCGCAGCGCC	0.706																																					p.R133C													.	.			0			c.C397T												14.0	13.0	13.0					8																	29207399		2073	4086	6159	SO:0001583	missense	1846	exon1			CGTTGCGGCGCAG	U21108	CCDS6072.1, CCDS6073.1	8p12-p11	2011-06-09			ENSG00000120875	ENSG00000120875		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3070	protein-coding gene	gene with protein product	"""VH1 homologous phosphatase 2"", ""MAP kinase phosphatase 2"""	602747				7535768, 9205128	Standard	NM_001394		Approved	HVH2, MKP-2, TYP	uc003xhm.3	Q13115	OTTHUMG00000133395	ENST00000240100.2:c.397C>T	8.37:g.29207399G>A	ENSP00000240100:p.Arg133Cys		10	0	0		10	0.20	2	NM_001394	3	0.00	0	B2RBU5|D3DSU4|G5E930|Q13524	Missense_Mutation	SNP	ENST00000240100.2	37	CCDS6072.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042957	0.55003	.	.	ENSG00000120875	ENST00000240100	T	0.27720	1.65	3.89	3.01	0.34805	Rhodanese-like (5);	0.052530	0.64402	D	0.000001	T	0.52661	0.1748	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.55438	-0.8141	10	0.51188	T	0.08	.	11.1306	0.48345	0.0:0.0:0.8139:0.1861	.	133	Q13115	DUS4_HUMAN	C	133	ENSP00000240100:R133C	ENSP00000240100:R133C	R	-	1	0	DUSP4	29263318	0.998000	0.40836	0.995000	0.50966	0.405000	0.30901	1.262000	0.32992	1.208000	0.43306	0.491000	0.48974	CGC			0.706	DUSP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257249.1		NM_001394	
AK3	50808	mdanderson.org	37	9	4741004	4741004	+	Silent	SNP	A	A	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr9:4741004A>G	ENST00000381809.3	-	1	314	c.84T>C	c.(82-84)acT>acC	p.T28T	AK3_ENST00000447596.4_Silent_p.T28T|AK3_ENST00000359883.2_Intron	NM_016282.3	NP_057366.2	P27144	KAD4_HUMAN	adenylate kinase 3	26					ADP biosynthetic process (GO:0006172)|AMP metabolic process (GO:0046033)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|GTP metabolic process (GO:0046039)|liver development (GO:0001889)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|response to drug (GO:0042493)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside triphosphate adenylate kinase activity (GO:0046899)			large_intestine(2)|lung(1)|ovary(2)	5	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)	Adefovir Dipivoxil(DB00718)|Tenofovir(DB00300)	CGAAGTGTGTAGTGATGCGCG	0.721																																					p.T28T													.	.			0			c.T84C												35.0	31.0	32.0					9																	4741004		2202	4300	6502	SO:0001819	synonymous_variant	50808	exon1			GTGTGTAGTGATG	BC013771	CCDS6455.1, CCDS56561.1, CCDS56562.1	9p24.1	2010-09-29	2004-06-11	2005-04-07	ENSG00000147853	ENSG00000147853			17376	protein-coding gene	gene with protein product		609290	"""adenylate kinase 6"", ""adenylate kinase 3 like 1"""	AK6, AK3L1		8288, 182062	Standard	NM_001199852		Approved	AKL3L1	uc003ziq.2	Q9UIJ7	OTTHUMG00000019472	ENST00000381809.3:c.84T>C	9.37:g.4741004A>G			93	0	0		60	0.05	3	NM_001199852	16	0.00	0	B2R927|D3DQ62|Q6IBH4|Q6NXQ5|Q8IUU9	Silent	SNP	ENST00000381809.3	37	CCDS6455.1																																																																																					0.721	AK3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051585.1		NM_016282	
SIGMAR1	10280	mdanderson.org	37	9	34637553	34637553	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr9:34637553G>A	ENST00000277010.4	-	1	215	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	SIGMAR1_ENST00000378892.1_5'UTR|SIGMAR1_ENST00000477726.1_Nonsense_Mutation_p.Q48*|SIGMAR1_ENST00000461426.1_5'UTR	NM_001282208.1|NM_005866.2	NP_001269137.1|NP_005857.1	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1	48					cell death (GO:0008219)|lipid transport (GO:0006869)|nervous system development (GO:0007399)|regulation of neuron apoptotic process (GO:0043523)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|nuclear envelope (GO:0005635)	drug binding (GO:0008144)|opioid receptor activity (GO:0004985)			large_intestine(1)|lung(1)	2					Amitriptyline(DB00321)|Dextromethorphan(DB00514)|Nortriptyline(DB00540)|Pentazocine(DB00652)|Remoxipride(DB00409)	CCAGCGTACTGCCGCGCCAAC	0.697																																					p.Q48X													.	.			0			c.C142T												14.0	17.0	16.0					9																	34637553		2199	4294	6493	SO:0001587	stop_gained	10280	exon1			CGTACTGCCGCGC	BC004899	CCDS6562.1, CCDS6563.1	9p13.3	2008-12-18	2008-12-18	2008-12-18	ENSG00000147955	ENSG00000147955			8157	protein-coding gene	gene with protein product		601978	"""opioid receptor, sigma 1"""	OPRS1		8954936, 9453537	Standard	NM_005866		Approved	SR-BP1	uc003zvb.3	Q99720	OTTHUMG00000019829	ENST00000277010.4:c.142C>T	9.37:g.34637553G>A	ENSP00000277010:p.Gln48*		14	0	0		48	0.06	3	NM_147157	75	0.00	0	D3DRM7|O00673|O00725|Q0Z9W6|Q153Z1|Q2TSD1|Q53GN2|Q7Z653|Q8N7H3|Q9NYX0	Nonsense_Mutation	SNP	ENST00000277010.4	37	CCDS6562.1	.	.	.	.	.	.	.	.	.	.	G	34	5.389942	0.95988	.	.	ENSG00000147955	ENST00000277010;ENST00000477726	.	.	.	4.7	3.79	0.43588	.	0.064498	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.3087	5.6611	0.17670	0.0982:0.0:0.7055:0.1964	.	.	.	.	X	48	.	ENSP00000277010:Q48X	Q	-	1	0	SIGMAR1	34627553	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.621000	0.54210	1.163000	0.42636	0.561000	0.74099	CAG			0.697	SIGMAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052204.1		NM_005866	
RC3H2	54542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125643061	125643061	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr9:125643061C>G	ENST00000373670.1	-	5	1372	c.772G>C	c.(772-774)Gat>Cat	p.D258H	SNORD90_ENST00000391145.1_RNA|RC3H2_ENST00000357244.2_Missense_Mutation_p.D258H|RC3H2_ENST00000335387.5_Missense_Mutation_p.D258H|RC3H2_ENST00000373665.2_Missense_Mutation_p.D258H|RC3H2_ENST00000423239.2_Missense_Mutation_p.D258H			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	258					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						GAGTCTTCATCTCTTTTGGTA	0.408																																					p.D258H													.	.			0			c.G772C												83.0	77.0	79.0					9																	125643061		1882	4114	5996	SO:0001583	missense	54542	exon6			CTTCATCTCTTTT	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.772G>C	9.37:g.125643061C>G	ENSP00000362774:p.Asp258His		88	0	0		86	0.17	15	NM_018835	48	0.42	20	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	ENST00000373670.1	37	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301860	0.81136	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239;ENST00000373665;ENST00000335387	D;D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43;-3.43	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.96670	0.8913	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.957;0.99;0.996	D	0.97213	0.9872	10	0.87932	D	0	-16.3659	17.6585	0.88184	0.0:1.0:0.0:0.0	.	258;258;258	A6NHN2;Q9HBD1;Q9HBD1-4	.;RC3H2_HUMAN;.	H	258;258;129;258;258;258	ENSP00000362774:D258H;ENSP00000349783:D258H;ENSP00000411767:D258H;ENSP00000362769:D258H;ENSP00000335150:D258H	ENSP00000335150:D258H	D	-	1	0	RC3H2	124682882	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.776000	0.85560	2.503000	0.84419	0.561000	0.74099	GAT			0.408	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053966.1		NM_018835	
TTF1	7270	mdanderson.org	37	9	135277780	135277780	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr9:135277780G>T	ENST00000334270.2	-	2	468	c.429C>A	c.(427-429)gaC>gaA	p.D143E		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	143	N-terminal region (NRD). {ECO:0000250}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CCTGAAATTTGTCTGTTTTAG	0.353																																					p.D143E													.	.			0			c.C429A												80.0	78.0	78.0					9																	135277780		2203	4300	6503	SO:0001583	missense	7270	exon2			AAATTTGTCTGTT	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.429C>A	9.37:g.135277780G>T	ENSP00000333920:p.Asp143Glu		75	0	0		92	0.04	4	NM_007344	42	0.00	0	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423696	0.25639	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.06528	3.29	4.9	-9.8	0.00490	.	1.463330	0.04079	N	0.309237	T	0.03053	0.0090	L	0.27053	0.805	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.40289	-0.9571	10	0.13853	T	0.58	.	1.0312	0.01538	0.1586:0.1761:0.3011:0.3642	.	143	Q15361	TTF1_HUMAN	E	143	ENSP00000333920:D143E	ENSP00000245588:D143E	D	-	3	2	TTF1	134267601	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-4.371000	0.00244	-3.124000	0.00238	0.655000	0.94253	GAC			0.353	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054784.2		NM_007344	
RABL6	55684	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	139702690	139702690	+	Silent	SNP	C	C	T			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chr9:139702690C>T	ENST00000311502.7	+	1	278	c.42C>T	c.(40-42)gcC>gcT	p.A14A	RABL6_ENST00000357466.2_Silent_p.A14A|RP11-216L13.19_ENST00000415992.1_RNA|RABL6_ENST00000371671.4_Silent_p.A14A|RABL6_ENST00000371663.4_Silent_p.A14A|KIAA1984-AS1_ENST00000414656.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	14					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CGGACCAGGCCCCGGGCCGGG	0.701																																					p.A14A													.	.			0			c.C42T												13.0	20.0	18.0					9																	139702690		691	1590	2281	SO:0001819	synonymous_variant	55684	exon1			CCAGGCCCCGGGC	AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.42C>T	9.37:g.139702690C>T			103	0	0		81	0.36	29	NM_024718	38	0.24	9	A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Silent	SNP	ENST00000311502.7	37	CCDS48058.1																																																																																					0.701	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000055141.4		NM_024718	
MT-ND4	4538	hgsc.bcm.edu;broad.mit.edu	37	M	11796	11796	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chrM:11796A>G	ENST00000361381.2	+	1	1037	c.1037A>G	c.(1036-1038)cAa>cGa	p.Q346R	MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	346					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						AATCCTCTCTCAAGGACTTCA	0.458																																					p.Q346R													.	.			0			c.A1037G																																									SO:0001583	missense	0	exon1			TCTCTCAAGGACT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1037A>G	M.37:g.11796A>G	ENSP00000354961:p.Gln346Arg		13	0	0		29	0.17	5	ENST00000361381	0		0	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	37																																																																																						0.458	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024035	
MID2	11043	mdanderson.org	37	X	107084386	107084386	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chrX:107084386G>A	ENST00000262843.6	+	2	1039	c.491G>A	c.(490-492)cGt>cAt	p.R164H	MID2_ENST00000443968.2_Missense_Mutation_p.R164H	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	164					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						TACTGTGACCGTTGCCTGCGG	0.572																																					p.R164H													.	.			0			c.G491A												58.0	49.0	52.0					X																	107084386		2203	4300	6503	SO:0001583	missense	11043	exon2			GTGACCGTTGCCT		CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.491G>A	X.37:g.107084386G>A	ENSP00000262843:p.Arg164His		64	0	0		54	0.06	3	NM_052817	4	0.00	0	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	ENST00000262843.6	37	CCDS14532.2	.	.	.	.	.	.	.	.	.	.	G	14.98	2.695938	0.48202	.	.	ENSG00000080561	ENST00000451923;ENST00000262843;ENST00000443968	D;D;D	0.87571	-2.27;-2.27;-2.27	5.94	5.94	0.96194	Zinc finger, B-box (1);	0.000000	0.85682	D	0.000000	D	0.88833	0.6544	L	0.47190	1.495	0.41263	D	0.986791	D;D	0.63046	0.992;0.982	P;P	0.53185	0.72;0.615	D	0.89943	0.4074	10	0.72032	D	0.01	.	16.5117	0.84287	0.0:0.0:1.0:0.0	.	164;164	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	H	144;164;164	ENSP00000410730:R144H;ENSP00000262843:R164H;ENSP00000413976:R164H	ENSP00000262843:R164H	R	+	2	0	MID2	106971042	0.939000	0.31865	1.000000	0.80357	0.995000	0.86356	2.621000	0.46418	2.506000	0.84524	0.600000	0.82982	CGT			0.572	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057852.2		NM_012216	
GABRE	2564	broad.mit.edu	37	X	151123181	151123181	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chrX:151123181T>A	ENST00000370328.3	-	9	1566	c.1513A>T	c.(1513-1515)Aac>Tac	p.N505Y	GABRE_ENST00000483564.1_5'UTR|GABRE_ENST00000370325.1_3'UTR|AF274855.1_ENST00000582865.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	505					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACCTACAAGTTAAGGCAAACA	0.542																																					p.N505Y													.	GABRE	141		0			c.A1513T												20.0	20.0	20.0					X																	151123181		2202	4293	6495	SO:0001583	missense	2564	exon9			ACAAGTTAAGGCA	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.1513A>T	X.37:g.151123181T>A	ENSP00000359353:p.Asn505Tyr		114	0.0614035088	7		110	0.13	14	NM_004961	0		0	E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	.	.	.	.	.	.	.	.	.	.	T	9.256	1.041959	0.19748	.	.	ENSG00000102287	ENST00000370328	T	0.79749	-1.3	5.48	3.06	0.35304	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.350050	0.20965	N	0.082496	T	0.75496	0.3857	N	0.17082	0.46	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68663	-0.5349	10	0.17369	T	0.5	.	3.3368	0.07103	0.3839:0.125:0.0:0.4911	.	505	P78334	GBRE_HUMAN	Y	505	ENSP00000359353:N505Y	ENSP00000359353:N505Y	N	-	1	0	GABRE	150873837	1.000000	0.71417	0.805000	0.32314	0.494000	0.33585	4.991000	0.63883	0.206000	0.20587	0.486000	0.48141	AAC			0.542	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060903.1		NM_004961, NM_021990, NM_021984	
ABCD1	215	mdanderson.org	37	X	153008731	153008731	+	Missense_Mutation	SNP	G	G	T	rs200460000		TCGA-2G-AAHT-01A-11D-A42Y-10	TCGA-2G-AAHT-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	17178935-8114-4de7-abd2-9f4df326a495	9dd4b0d8-774d-4b6c-b2d1-f75b413982d5	g.chrX:153008731G>T	ENST00000218104.3	+	9	2321	c.1922G>T	c.(1921-1923)gGc>gTc	p.G641V	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	641	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GACGTGGAAGGCAAGATCTTC	0.677																																					p.G641V													.	.			0			c.G1922T												25.0	22.0	23.0					X																	153008731		2200	4296	6496	SO:0001583	missense	215	exon9			TGGAAGGCAAGAT	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1922G>T	X.37:g.153008731G>T	ENSP00000218104:p.Gly641Val		59	0.0169491525	1		62	0.15	9	NM_000033	22	0.00	0	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615756	0.87359	.	.	ENSG00000101986	ENST00000218104	D	0.99839	-7.07	5.02	5.02	0.67125	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.074917	0.51477	D	0.000084	D	0.99725	0.9893	M	0.66939	2.045	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	D	0.97118	0.9809	10	0.72032	D	0.01	-32.1863	16.4303	0.83840	0.0:0.0:1.0:0.0	.	641	P33897	ABCD1_HUMAN	V	641	ENSP00000218104:G641V	ENSP00000218104:G641V	G	+	2	0	ABCD1	152661925	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	9.349000	0.97066	2.221000	0.72209	0.523000	0.50628	GGC			0.677	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061041.1		NM_000033	
