#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
ESPNP	284729	broad.mit.edu	37	1	17030903	17030905	+	RNA	DEL	GAG	GAG	-	rs67156338|rs376609585	byFrequency	TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:17030903_17030905delGAG	ENST00000492551.1	-	0	696					NR_026567.1				espin pseudogene																		AGAGATCGACGAGGAGGGGGCCT	0.64														1867	0.372804	0.3245	0.3343	5008	,	,		43669	0.4474		0.3936	False		,,,				2504	0.3671				.													.	.			0			.																																											0	.			ATCGACGAGGAGG	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17030906_17030908delGAG			7	0	0		9	0.56	5	.	0		0		RNA	DEL	ENST00000492551.1	37																																																																																						0.640	ESPNP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000326311.1			
ALDH4A1	8659	mdanderson.org	37	1	19216533	19216533	+	Silent	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:19216533G>T	ENST00000375341.3	-	2	386	c.129C>A	c.(127-129)ggC>ggA	p.G43G	ALDH4A1_ENST00000538309.1_5'UTR|RP13-279N23.2_ENST00000494072.3_3'UTR|ALDH4A1_ENST00000290597.5_Silent_p.G43G|ALDH4A1_ENST00000538839.1_Silent_p.G43G	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	43					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCAGGGCTGCCCTGCGTGA	0.637																																					p.G43G													.	.			0			c.C129A												46.0	37.0	40.0					1																	19216533		2203	4300	6503	SO:0001819	synonymous_variant	8659	exon2			AGGGCTGCCCTGC	U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.129C>A	1.37:g.19216533G>T			34	0	0		31	0.10	3	NM_003748	1	0.00	0	A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Silent	SNP	ENST00000375341.3	37	CCDS188.1																																																																																					0.637	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006954.1			
HMGCL	3155	broad.mit.edu	37	1	24151935	24151935	+	De_novo_Start_InFrame	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:24151935G>T	ENST00000374490.3	-	0	14				HMGCL_ENST00000436439.2_5'Flank|HMGCL_ENST00000374483.4_Intron|HMGCL_ENST00000509389.1_5'Flank	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase						acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		CGGCAGTCCAGCTGGGCCCCG	0.726																																					.													.	HMGCL	22		0			.												11.0	11.0	11.0					1																	24151935		2071	4001	6072			3155	.			AGTCCAGCTGGGC	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963		1.37:g.24151935G>T			84	0	0		51	0.06	3	.	0		0	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Translation_Start_Site	SNP	ENST00000374490.3	37	CCDS243.1																																																																																					0.726	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008253.2		NM_000191	
MACF1	23499	broad.mit.edu	37	1	39783026	39783026	+	Silent	SNP	A	A	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:39783026A>G	ENST00000372915.3	+	28	3831	c.3744A>G	c.(3742-3744)aaA>aaG	p.K1248K	MACF1_ENST00000539005.1_Silent_p.K1248K|MACF1_ENST00000564288.1_Silent_p.K1243K|MACF1_ENST00000361689.2_Silent_p.K1248K|MACF1_ENST00000317713.7_Silent_p.K1248K|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000567887.1_Silent_p.K1280K|MACF1_ENST00000545844.1_Silent_p.K1248K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1248					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATCAGGAAAAAGGCTCCCAGC	0.542																																					p.K1248K													.	MACF1	909		0			c.A3744G												84.0	80.0	81.0					1																	39783026		2203	4300	6503	SO:0001819	synonymous_variant	23499	exon30			GGAAAAAGGCTCC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.3744A>G	1.37:g.39783026A>G			120	0	0		114	0.03	3	NM_012090	0		0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	A	10.93	1.490827	0.26774	.	.	ENSG00000127603	ENST00000372925	.	.	.	5.74	2.11	0.27256	.	.	.	.	.	T	0.55242	0.1908	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46624	-0.9178	4	.	.	.	.	7.326	0.26555	0.5627:0.0:0.4373:0.0	.	.	.	.	G	382	.	.	R	+	1	2	MACF1	39555613	0.998000	0.40836	0.994000	0.49952	0.977000	0.68977	0.531000	0.23052	0.458000	0.26988	0.451000	0.29950	AGG			0.542	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000392096.1		NM_033044	
OVGP1	5016	bcgsc.ca	37	1	111957533	111957533	+	Silent	SNP	C	C	T	rs112145355		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:111957533C>T	ENST00000369732.3	-	11	1645	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	530					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGGTCACAGACTGATGACCCA	0.542																																					p.Q530Q													.	OVGP1	177		0			c.G1590A												59.0	57.0	58.0					1																	111957533		2197	4207	6404	SO:0001819	synonymous_variant	5016	exon11			CACAGACTGATGA	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1590G>A	1.37:g.111957533C>T			120	0.0083333333	1		147	0.20	29	NM_002557	3	0.00	0	A0AV19|B9EGE1|Q15841	Silent	SNP	ENST00000369732.3	37	CCDS834.1																																																																																					0.542	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032461.1		NM_002557	
OVGP1	5016	bcgsc.ca	37	1	111957556	111957556	+	Missense_Mutation	SNP	T	T	C	rs140282461|rs376377993		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:111957556T>C	ENST00000369732.3	-	11	1622	c.1567A>G	c.(1567-1569)Acc>Gcc	p.T523A		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	523					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGGGTCAGGGTCTTTTCCCCA	0.557																																					p.T523A													.	OVGP1	177		0			c.A1567G												55.0	51.0	52.0					1																	111957556		2199	4217	6416	SO:0001583	missense	5016	exon11			TCAGGGTCTTTTC	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1567A>G	1.37:g.111957556T>C	ENSP00000358747:p.Thr523Ala		126	0	0		131	0.08	10	NM_002557	6	0.00	0	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	37	CCDS834.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.243335	0.58995	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.03831	3.79	3.05	-4.06	0.03986	.	.	.	.	.	T	0.00906	0.0030	N	0.22421	0.69	0.09310	N	1	B;B	0.25486	0.127;0.127	B;B	0.13407	0.009;0.009	T	0.48246	-0.9052	9	0.66056	D	0.02	.	3.9881	0.09525	0.5528:0.0:0.186:0.2613	.	523;587	Q12889;Q59HH5	OVGP1_HUMAN;.	A	523;587;331	ENSP00000358747:T523A	ENSP00000358743:T587A	T	-	1	0	OVGP1	111759079	0.000000	0.05858	0.000000	0.03702	0.569000	0.35902	-1.387000	0.02535	-0.462000	0.06984	0.473000	0.43528	ACC			0.557	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032461.1		NM_002557	
NBPF8	728841	broad.mit.edu	37	1	144220807	144220807	+	Missense_Mutation	SNP	A	A	C	rs375759831		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:144220807A>C	ENST00000369373.5	+	2	74	c.74A>C	c.(73-75)gAt>gCt	p.D25A				Q3BBV2	NBPF8_HUMAN	neuroblastoma breakpoint family, member 8	665						cytoplasm (GO:0005737)											GAGCTGCTGGATGAGAAAGAG	0.483																																					.													ENSG00000162825_ENST00000369365,NS,carcinoma,0,4	.		4	0			.																																									SO:0001583	missense	728841	.			TGCTGGATGAGAA	AY894572		1q21.1	2014-04-01	2013-04-24	2013-04-24	ENSG00000162825	ENSG00000162825		"""neuroblastoma breakpoint family"""	31990	protein-coding gene	gene with protein product		613998	"""neuroblastoma breakpoint family, member 8, pseudogene"""	NBPF8P		16079250	Standard	NM_001037501		Approved			Q3BBV2	OTTHUMG00000074805	ENST00000369373.5:c.74A>C	1.37:g.144220807A>C	ENSP00000358380:p.Asp25Ala		80	0.0125	1		102	0.10	10	.	2	0.50	1		Missense_Mutation	SNP	ENST00000369373.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	7.405|7.405	0.633647|0.633647	0.14322|0.14322	.|.	.|.	ENSG00000162825|ENSG00000162825	ENST00000369373|ENST00000369365	T|.	0.07021|.	3.23|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.39835|.	0.1093|.	.|.	.|.	.|.	0.80722|.	D|.	1.000000|.	P;.;B;B|.	0.52842|.	0.956;.;0.04;0.002|.	P;.;B;B|.	0.57502|.	0.822;.;0.074;0.015|.	T|.	0.29610|.	-1.0006|.	4|.	0.33940|.	T|.	0.23|.	.|.	.|.	.|.	.|.	.|.	431;598;373;440|.	Q5VTG8;B4DG53;Q8IX72;Q5TB04|.	.;.;.;.|.	A|L	25|3576	ENSP00000358380:D25A|.	ENSP00000358380:D25A|.	D|M	+|+	2|1	0|0	RP3-377D14.1|RP3-377D14.1	142932164|142932164	0.533000|0.533000	0.26354|0.26354	.|.	.|.	.|.	.|.	0.868000|0.868000	0.27982|0.27982	.|.	.|.	.|.	.|.	GAT|ATG			0.483	NBPF8-204	KNOWN	basic|appris_candidate	protein_coding	protein_coding					
DENND4B	9909	broad.mit.edu	37	1	153914771	153914771	+	Silent	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:153914771G>T	ENST00000361217.4	-	5	1120	c.702C>A	c.(700-702)ccC>ccA	p.P234P		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	234	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCAGAAGACGGGCACTGACT	0.647																																					p.P234P													.	DENND4B	210		0			c.C702A												57.0	71.0	67.0					1																	153914771		2109	4209	6318	SO:0001819	synonymous_variant	9909	exon5			GAAGACGGGCACT	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.702C>A	1.37:g.153914771G>T			62	0	0		61	0.05	3	NM_014856	2	0.00	0	Q5T4K0	Silent	SNP	ENST00000361217.4	37	CCDS44228.1																																																																																					0.647	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090278.2		XM_375806	
RGL1	23179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183816714	183816714	+	Silent	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr1:183816714G>A	ENST00000360851.3	+	3	331	c.153G>A	c.(151-153)caG>caA	p.Q51Q	RGL1_ENST00000536277.1_Silent_p.Q49Q|RGL1_ENST00000304685.4_Silent_p.Q86Q|RGL1_ENST00000539189.1_Silent_p.Q51Q			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	51					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						AAGGGGACCAGCTGCCTCCAG	0.428																																					p.Q86Q													.	.			0			c.G258A												154.0	167.0	162.0					1																	183816714		2203	4300	6503	SO:0001819	synonymous_variant	23179	exon4			GGACCAGCTGCCT	AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.153G>A	1.37:g.183816714G>A			88	0	0		95	0.22	21	NM_015149	0		0	Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Silent	SNP	ENST00000360851.3	37																																																																																						0.428	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000085742.1		NM_015149	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F													CSGALNACT2,NS,carcinoma,0,5	CSGALNACT2	67	5	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T												223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe		151	0.0066225166	1		135	0.04	5	NM_018590	7	0.00	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG			0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047693.1		NM_018590	
PGBD3	267004	broad.mit.edu	37	10	50724864	50724864	+	Silent	SNP	A	A	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr10:50724864A>G	ENST00000374127.3	-	2	498	c.297T>C	c.(295-297)ccT>ccC	p.P99P	PGBD3_ENST00000508005.2_Silent_p.P99P|ERCC6-PGBD3_ENST00000447839.2_Silent_p.P567P|ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000515869.1_Silent_p.P567P|PGBD3_ENST00000603152.1_Silent_p.P567P	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	99										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						TTGATGGTGGAGGTTGCTGCA	0.453																																					p.M99I													.	PGBD3	58		0			c.G297C												119.0	112.0	114.0					10																	50724864		2203	4300	6503	SO:0001819	synonymous_variant	0	exon2			TGGTGGAGGTTGC	AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.297T>C	10.37:g.50724864A>G			150	0	0		137	0.03	4	NM_170753	1	0.00	0	B3KQC4|Q5W0M0|Q6PIH0	Silent	SNP	ENST00000374127.3	37	CCDS7230.1																																																																																					0.453	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000047988.1			
RRP12	23223	mdanderson.org	37	10	99133414	99133414	+	Silent	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr10:99133414G>T	ENST00000370992.4	-	17	2055	c.1944C>A	c.(1942-1944)ggC>ggA	p.G648G	RRP12_ENST00000479481.1_5'Flank|RRP12_ENST00000536831.1_Silent_p.G366G|RRP12_ENST00000315563.6_Silent_p.G548G|RRP12_ENST00000414986.1_Silent_p.G587G	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	648						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TGATGGCCATGCCCAGCGTCC	0.632																																					p.G648G													.	.			0			c.C1944A												64.0	60.0	61.0					10																	99133414		2203	4300	6503	SO:0001819	synonymous_variant	23223	exon17			GGCCATGCCCAGC		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.1944C>A	10.37:g.99133414G>T			66	0.0151515152	1		50	0.06	3	NM_015179	10	0.00	0	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	37	CCDS7457.1																																																																																					0.632	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049699.4		NM_015179	
MUC2	4583	hgsc.bcm.edu	37	11	1093462	1093462	+	Missense_Mutation	SNP	G	G	A	rs564585015	byFrequency	TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr11:1093462G>A	ENST00000441003.2	+	30	5308	c.5281G>A	c.(5281-5283)Ggc>Agc	p.G1761S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.G49S|MUC2_ENST00000359061.5_Missense_Mutation_p.G1728S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	gacacccaccggcacacagac	0.617													g|||	2	0.000399361	0.0008	0.0014	5008	,	,		26017	0.0		0.0	False		,,,				2504	0.0				p.G1761S													MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5281A												96.0	121.0	112.0					11																	1093462		2051	4069	6120	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5281G>A	11.37:g.1093462G>A	ENSP00000415183:p.Gly1761Ser		36	0	0		44	0.05	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	g	0.206	-1.040219	0.02013	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.17370	3.17;3.2;2.28	1.62	-3.24	0.05094	.	1741.130000	0.00447	U	0.000080	T	0.10766	0.0263	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.31024	-0.9958	9	0.17369	T	0.5	.	8.5102	0.33213	0.7364:0.0:0.2636:0.0	.	1761	E7EUV1	.	S	1761;1728;49	ENSP00000415183:G1761S;ENSP00000351956:G1728S;ENSP00000331373:G49S	ENSP00000331373:G49S	G	+	1	0	MUC2	1083462	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.472000	0.00228	-2.335000	0.00629	-2.974000	0.00080	GGC			0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
PRMT3	10196	mdanderson.org	37	11	20409297	20409297	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr11:20409297G>T	ENST00000331079.6	+	1	222	c.5G>T	c.(4-6)tGc>tTc	p.C2F	PRMT3_ENST00000437750.2_Missense_Mutation_p.C2F	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	2					histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						ACAGCCATGTGCTCGTTAGCG	0.746																																					p.C2F													.	.			0			c.G5T												13.0	14.0	14.0					11																	20409297		1779	3318	5097	SO:0001583	missense	10196	exon1			CCATGTGCTCGTT	AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.5G>T	11.37:g.20409297G>T	ENSP00000331879:p.Cys2Phe		31	0	0		37	0.08	3	NM_001145166	2	0.00	0	B4DUC7	Missense_Mutation	SNP	ENST00000331079.6	37	CCDS7853.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360982	0.61403	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.26373	1.74;1.75	4.55	4.55	0.56014	.	.	.	.	.	T	0.34077	0.0885	N	0.22421	0.69	0.28695	N	0.904366	D;D	0.65815	0.994;0.995	P;P	0.60682	0.878;0.854	T	0.14924	-1.0455	9	0.87932	D	0	5.5154	14.1365	0.65291	0.0:0.0:1.0:0.0	.	2;2	O60678-2;O60678	.;ANM3_HUMAN	F	2	ENSP00000331879:C2F;ENSP00000397766:C2F	ENSP00000329586:C2F	C	+	2	0	PRMT3	20365873	0.998000	0.40836	1.000000	0.80357	0.644000	0.38419	4.031000	0.57267	2.346000	0.79739	0.563000	0.77884	TGC			0.746	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387489.1		NM_005788	
ATN1	1822	broad.mit.edu	37	12	7045069	7045069	+	Silent	SNP	T	T	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr12:7045069T>C	ENST00000356654.4	+	5	876	c.639T>C	c.(637-639)ccT>ccC	p.P213P	ATN1_ENST00000396684.2_Silent_p.P213P	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	213					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CTGGGGCCCCTCCCCCTCACC	0.627																																					p.P213P													.	ATN1	95		0			c.T639C												36.0	38.0	37.0					12																	7045069		2203	4300	6503	SO:0001819	synonymous_variant	1822	exon5			GGCCCCTCCCCCT	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.639T>C	12.37:g.7045069T>C			125	0.032	4		260	0.06	15	NM_001007026	85	0.01	1	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																					0.627	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401948.2		NM_001940	
NANOG	79923	broad.mit.edu	37	12	7947381	7947382	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr12:7947381_7947382delAT	ENST00000229307.4	+	4	827_828	c.608_609delAT	c.(607-609)aatfs	p.N203fs	NANOG_ENST00000526286.1_Frame_Shift_Del_p.N187fs	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	203	8 X repeats starting with a Trp in each unit.|Sufficient for transactivation activity. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		ACCTGGAACAATTCAACCTGGA	0.554																																					p.203_203del													.	NANOG	30		0			c.608_609del																																									SO:0001589	frameshift_variant	79923	exon4			GGAACAATTCAAC	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.608_609delAT	12.37:g.7947381_7947382delAT	ENSP00000229307:p.Asn203fs		279	0	0		732	0.02	17	NM_024865	0		0	D3DUU4|Q2TTG0|Q6JZS5	Frame_Shift_Del	DEL	ENST00000229307.4	37	CCDS31736.1																																																																																					0.554	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387480.2		NM_024865	
NANOG	79923	broad.mit.edu	37	12	7947386	7947387	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr12:7947386_7947387insGT	ENST00000229307.4	+	4	832_833	c.613_614insGT	c.(613-615)accfs	p.T205fs	NANOG_ENST00000526286.1_Frame_Shift_Ins_p.T189fs	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	205	8 X repeats starting with a Trp in each unit.|Sufficient for transactivation activity. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		GAACAATTCAACCTGGAGCAAC	0.55																																					p.T205fs													.	NANOG	30		0			c.613_614insGT																																									SO:0001589	frameshift_variant	79923	exon4			AATTCAACCTGGA	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		Exception_encountered	12.37:g.7947386_7947387insGT	ENSP00000229307:p.Thr205fs		265	0	0		674	0.03	17	NM_024865	0		0	D3DUU4|Q2TTG0|Q6JZS5	Frame_Shift_Ins	INS	ENST00000229307.4	37	CCDS31736.1																																																																																					0.550	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387480.2		NM_024865	
RNF6	6049	mdanderson.org	37	13	26793723	26793723	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr13:26793723G>T	ENST00000381588.4	-	3	816	c.64C>A	c.(64-66)Cat>Aat	p.H22N	RNF6_ENST00000468480.1_5'UTR|RNF6_ENST00000346166.3_Missense_Mutation_p.H22N|RNF6_ENST00000381570.3_Missense_Mutation_p.H22N|RNF6_ENST00000399762.2_5'UTR	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	22					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		TTTTCATGATGATTATGGTCT	0.393																																					p.H22N													.	.			0			c.C64A												217.0	207.0	210.0					13																	26793723		2203	4300	6503	SO:0001583	missense	6049	exon3			CATGATGATTATG	AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.64C>A	13.37:g.26793723G>T	ENSP00000371000:p.His22Asn		113	0	0		124	0.04	5	NM_183043	0		0	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Missense_Mutation	SNP	ENST00000381588.4	37	CCDS9316.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788861	0.31685	.	.	ENSG00000127870	ENST00000346166;ENST00000381588;ENST00000381570	T;T;T	0.09255	3.0;3.0;3.0	4.71	4.71	0.59529	.	0.476775	0.19451	N	0.113923	T	0.09024	0.0223	L	0.40543	1.245	0.27340	N	0.956539	B;B	0.30973	0.18;0.302	B;B	0.30572	0.056;0.117	T	0.19063	-1.0317	10	0.22109	T	0.4	-8.1641	8.746	0.34587	0.1012:0.0:0.8988:0.0	.	22;22	Q9Y252;Q9BZP5	RNF6_HUMAN;.	N	22	ENSP00000342121:H22N;ENSP00000371000:H22N;ENSP00000370982:H22N	ENSP00000342121:H22N	H	-	1	0	RNF6	25691723	0.826000	0.29277	0.100000	0.21137	0.942000	0.58702	1.848000	0.39309	2.442000	0.82660	0.655000	0.94253	CAT			0.393	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044246.2		NM_005977	
C14orf183	196913	broad.mit.edu	37	14	50550133	50550134	+	IGR	INS	-	-	TCTG	rs397822999|rs75774505|rs145296357|rs33970295	byFrequency	TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr14:50550133_50550134insTCTG	ENST00000305273.1	-	0	975				RP11-58E21.7_ENST00000556019.2_lincRNA|RP11-58E21.5_ENST00000603228.1_lincRNA	NM_001014830.1	NP_001014830.1	Q8WXQ3	CN183_HUMAN	chromosome 14 open reading frame 183											endometrium(2)|large_intestine(2)|lung(3)	7						GCCAATCTCTCTCTGTCTTTCT	0.366														2916	0.582268	0.5598	0.6282	5008	,	,		22966	0.5942		0.6163	False		,,,				2504	0.5327				.													.	C14orf183	9		0			.																																									SO:0001628	intergenic_variant	0	.			ATCTCTCTCTGTC	AF390030	CCDS45101.1	14q21.3	2012-09-26			ENSG00000168260	ENSG00000168260			27285	protein-coding gene	gene with protein product							Standard	NM_001014830		Approved		uc010tqk.2	Q8WXQ3	OTTHUMG00000170858		14.37:g.50550134_50550137dupTCTG			5	0	0		9	0.44	4	.	0		0		RNA	INS	ENST00000305273.1	37	CCDS45101.1																																																																																					0.366	C14orf183-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000410705.1		NM_001014830	
SERPINA1	5265	broad.mit.edu	37	14	94849140	94849140	+	Missense_Mutation	SNP	G	G	T	rs11558263		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr14:94849140G>T	ENST00000448921.1	-	4	1007	c.435C>A	c.(433-435)agC>agA	p.S145R	SERPINA1_ENST00000402629.1_Missense_Mutation_p.S145R|SERPINA1_ENST00000355814.4_Missense_Mutation_p.S145R|SERPINA1_ENST00000440909.1_Missense_Mutation_p.S145R|SERPINA1_ENST00000449399.3_Missense_Mutation_p.S145R|SERPINA1_ENST00000404814.4_Missense_Mutation_p.S145R|SERPINA1_ENST00000393088.4_Missense_Mutation_p.S145R|SERPINA1_ENST00000393087.4_Missense_Mutation_p.S145R|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000437397.1_Missense_Mutation_p.S145R	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	145					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TCAGGCCCTCGCTGAGGAACA	0.547																																					p.S145R													.	SERPINA1	51		0			c.C435A												69.0	67.0	67.0					14																	94849140		2203	4300	6503	SO:0001583	missense	5265	exon4			GCCCTCGCTGAGG	X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.435C>A	14.37:g.94849140G>T	ENSP00000416066:p.Ser145Arg		128	0.0078125	1		140	0.04	5	NM_001127701	1314	0.00	0	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Missense_Mutation	SNP	ENST00000448921.1	37	CCDS9925.1	.	.	.	.	.	.	.	.	.	.	G	7.121	0.577919	0.13686	.	.	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629;ENST00000554720;ENST00000556091	D;D;D;D;D;D;D;D;D;T;D	0.87729	-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-0.83;-1.63	5.8	-1.93	0.07594	Serpin domain (3);	1.424990	0.04236	N	0.336153	T	0.77075	0.4077	N	0.11341	0.13	0.09310	N	1	B;B	0.28605	0.217;0.011	B;B	0.37989	0.262;0.028	T	0.65442	-0.6167	10	0.52906	T	0.07	.	3.5456	0.07827	0.4189:0.1115:0.3771:0.0925	rs11558263;rs11558263	145;145	P01009-2;P01009	.;A1AT_HUMAN	R	145;145;145;145;145;145;145;145;145;59;145	ENSP00000390299:S145R;ENSP00000416066:S145R;ENSP00000408474:S145R;ENSP00000348068:S145R;ENSP00000376802:S145R;ENSP00000376803:S145R;ENSP00000385960:S145R;ENSP00000416354:S145R;ENSP00000386094:S145R;ENSP00000450561:S59R;ENSP00000452169:S145R	ENSP00000348068:S145R	S	-	3	2	SERPINA1	93918893	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.501000	0.00450	-0.770000	0.04614	-0.254000	0.11334	AGC			0.547	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317768.2		NM_001002235	
SLC25A29	123096	mdanderson.org	37	14	100758776	100758776	+	Silent	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr14:100758776C>T	ENST00000359232.3	-	4	1056	c.756G>A	c.(754-756)gcG>gcA	p.A252A	SLC25A29_ENST00000539621.1_Silent_p.A186A|RP11-638I2.6_ENST00000556458.1_lincRNA|AL157871.2_ENST00000553954.1_RNA|SLC25A29_ENST00000555927.1_Silent_p.A186A|SLC25A29_ENST00000554912.1_Silent_p.A186A|SLC25A29_ENST00000392908.3_3'UTR|SLC25A29_ENST00000556505.1_Silent_p.A186A	NM_001039355.1	NP_001034444.1	Q8N8R3	MCATL_HUMAN	solute carrier family 25 (mitochondrial carnitine/acylcarnitine carrier), member 29	252						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	acyl carnitine transmembrane transporter activity (GO:0015227)			NS(1)|endometrium(1)|ovary(1)	3		Melanoma(154;0.152)			L-Carnitine(DB00583)	GCAGCGTGGACGCCAGCCCCC	0.756																																					p.A252A													.	.			0			c.G756A												9.0	12.0	11.0					14																	100758776		2129	4187	6316	SO:0001819	synonymous_variant	123096	exon4			CGTGGACGCCAGC	AK095532	CCDS32156.1	14q32.2	2013-05-22	2012-03-29	2004-01-21	ENSG00000197119	ENSG00000197119		"""Solute carriers"""	20116	protein-coding gene	gene with protein product		615064	"""chromosome 14 open reading frame 69"", ""solute carrier family 25, member 29"""	C14orf69			Standard	XM_005267343		Approved	FLJ38975	uc010twx.2	Q8N8R3	OTTHUMG00000171569	ENST00000359232.3:c.756G>A	14.37:g.100758776C>T			25	0	0		24	0.13	3	NM_001039355	9	0.00	0	A3KMR5|Q541V0	Silent	SNP	ENST00000359232.3	37	CCDS32156.1																																																																																					0.756	SLC25A29-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000072449.3			
HERC2P2	400322	broad.mit.edu	37	15	23312380	23312380	+	RNA	DEL	T	T	-			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr15:23312380delT	ENST00000560464.1	-	0	3118									hect domain and RLD 2 pseudogene 2																		TGTTAttttcttttttttttt	0.398																																					.													.	.			0			.																																											0	.			ATTTTCTTTTTTT	AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23312380delT			11	0	0		10	0.20	2	.	0		0		RNA	DEL	ENST00000560464.1	37																																																																																						0.398	HERC2P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000415936.1			
TICRR	90381	broad.mit.edu	37	15	90168410	90168410	+	Silent	SNP	A	A	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr15:90168410A>C	ENST00000268138.7	+	20	4974	c.4869A>C	c.(4867-4869)tcA>tcC	p.S1623S	TICRR_ENST00000560985.1_Silent_p.S1622S|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1623					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.S1623S(1)									CCTATGTGTCACCCCCCTGCC	0.627																																					p.S1623S													C15orf42,NS,carcinoma,0,1	.		1	1	Substitution - coding silent(1)	lung(1)	c.A4869C												40.0	38.0	39.0					15																	90168410		2200	4299	6499	SO:0001819	synonymous_variant	90381	exon20			TGTGTCACCCCCC	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4869A>C	15.37:g.90168410A>C			44	0.1363636364	6		43	0.23	10	NM_152259	8	0.00	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	37	CCDS10352.2																																																																																					0.627	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000312856.1		NM_152259	
MESP2	145873	hgsc.bcm.edu	37	15	90320132	90320132	+	Missense_Mutation	SNP	C	C	G	rs200021459	byFrequency	TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr15:90320132C>G	ENST00000341735.3	+	1	544	c.544C>G	c.(544-546)Caa>Gaa	p.Q182E	MESP2_ENST00000558723.1_Intron|MESP2_ENST00000560219.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	182	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			ggggcaggggcaagggcaggg	0.786																																					p.Q182E													MESP2,NS,carcinoma,-2,1	MESP2	-2	1	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.C544G												3.0	3.0	3.0					15																	90320132		1229	2996	4225	SO:0001583	missense	145873	exon1			CAGGGGCAAGGGC		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.544C>G	15.37:g.90320132C>G	ENSP00000342392:p.Gln182Glu		23	0	0		16	0.13	2	NM_001039958	0		0	Q7RTU2	Missense_Mutation	SNP	ENST00000341735.3	37	CCDS42078.1	.	.	.	.	.	.	.	.	.	.	C	1.101	-0.661169	0.03454	.	.	ENSG00000188095	ENST00000341735	T	0.81078	-1.45	0.798	-0.239	0.13050	.	.	.	.	.	T	0.57844	0.2081	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.39272	-0.9622	9	0.09338	T	0.73	.	5.309	0.15819	0.0:0.7609:0.0:0.2391	.	182	Q0VG99	MESP2_HUMAN	E	182	ENSP00000342392:Q182E	ENSP00000342392:Q182E	Q	+	1	0	MESP2	88121136	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.199000	0.09491	-0.121000	0.11787	-0.657000	0.03884	CAA			0.786	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416421.1		XM_085261	
RHBDF1	64285	mdanderson.org	37	16	113155	113155	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:113155C>T	ENST00000262316.6	-	5	630	c.488G>A	c.(487-489)cGt>cAt	p.R163H	RHBDF1_ENST00000454039.2_Missense_Mutation_p.R163H	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	163					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				ACGGAAGGCACGGCCACGGGC	0.662																																					p.R163H													.	.			0			c.G488A												28.0	31.0	30.0					16																	113155		2164	4251	6415	SO:0001583	missense	64285	exon5			AAGGCACGGCCAC	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.488G>A	16.37:g.113155C>T	ENSP00000262316:p.Arg163His		67	0	0		51	0.06	3	NM_022450	7	0.00	0	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	37	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	21.2	4.115241	0.77210	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	T;T	0.70986	-0.53;-0.53	5.54	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.82518	0.5054	M	0.76328	2.33	0.58432	D	0.999997	P;D;D	0.67145	0.94;0.977;0.996	B;P;D	0.66847	0.34;0.58;0.947	D	0.84849	0.0812	10	0.72032	D	0.01	-33.9089	14.7068	0.69198	0.1462:0.8538:0.0:0.0	.	163;186;163	F5GWL4;B4E3Q0;Q96CC6	.;.;RHDF1_HUMAN	H	163	ENSP00000262316:R163H;ENSP00000392133:R163H	ENSP00000262316:R163H	R	-	2	0	RHBDF1	53155	1.000000	0.71417	0.987000	0.45799	0.122000	0.20287	7.729000	0.84864	1.305000	0.44909	0.462000	0.41574	CGT			0.662	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000134178.2		NM_022450	
TRAF7	84231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2221328	2221328	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:2221328T>C	ENST00000326181.6	+	6	544	c.412T>C	c.(412-414)Ttc>Ctc	p.F138L		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	138					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						CTGCAGCGTCTTCAAAGACCC	0.687																																					p.F138L													.	.			0			c.T412C												26.0	21.0	23.0					16																	2221328		2160	4254	6414	SO:0001583	missense	84231	exon6			AGCGTCTTCAAAG	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.412T>C	16.37:g.2221328T>C	ENSP00000318944:p.Phe138Leu		52	0	0		67	0.22	15	NM_032271	49	0.18	9	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	37	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711652	0.68730	.	.	ENSG00000131653	ENST00000326181	D	0.83755	-1.76	5.58	4.47	0.54385	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.77039	0.4072	L	0.35542	1.07	0.58432	D	0.999995	P	0.34462	0.454	B	0.38156	0.266	T	0.76348	-0.2992	10	0.87932	D	0	-42.0853	11.3135	0.49377	0.1362:0.0:0.0:0.8638	.	138	Q6Q0C0	TRAF7_HUMAN	L	138	ENSP00000318944:F138L	ENSP00000318944:F138L	F	+	1	0	TRAF7	2161329	1.000000	0.71417	0.852000	0.33557	0.275000	0.26752	5.028000	0.64115	0.933000	0.37291	0.459000	0.35465	TTC			0.687	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250762.1		NM_032271	
NPIPB5	100132247	broad.mit.edu	37	16	22545906	22545906	+	Silent	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:22545906C>T	ENST00000517539.1	+	8	1677	c.1602C>T	c.(1600-1602)gcC>gcT	p.A534A	NPIPB5_ENST00000424340.1_Silent_p.A534A|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	534	Pro-rich.					integral component of membrane (GO:0016021)											AGACACCTGCCGAGCGTCTGC	0.592																																					p.A534A													RP11-368J21.2_ENST00000424340,NS,carcinoma,0,2	.		2	0			c.C1602T												4.0	4.0	4.0					16																	22545906		650	1439	2089	SO:0001819	synonymous_variant	100132247	exon7			ACCTGCCGAGCGT		CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1602C>T	16.37:g.22545906C>T			51	0.0196078431	1		59	0.10	6	NM_001135865	70	0.00	0	B4DK13	Silent	SNP	ENST00000517539.1	37	CCDS45443.1																																																																																					0.592	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374343.2		NM_001135865	
PRSS36	146547	mdanderson.org	37	16	31154162	31154162	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:31154162G>T	ENST00000268281.4	-	9	1311	c.1253C>A	c.(1252-1254)aCg>aAg	p.T418K	PRSS36_ENST00000418068.2_Missense_Mutation_p.T418K|PRSS36_ENST00000569305.1_Missense_Mutation_p.T418K	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	418	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						GTTCACGGGCGTGCGCAGCTG	0.756																																					p.T418K													.	.			0			c.C1253A												7.0	10.0	9.0					16																	31154162		2127	4197	6324	SO:0001583	missense	146547	exon9			ACGGGCGTGCGCA	AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.1253C>A	16.37:g.31154162G>T	ENSP00000268281:p.Thr418Lys		31	0	0		36	0.08	3	NM_001258290	0		0	A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Missense_Mutation	SNP	ENST00000268281.4	37	CCDS32436.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980248	0.34942	.	.	ENSG00000178226	ENST00000268281;ENST00000418068	D;D	0.88046	-2.33;-2.33	4.67	1.44	0.22558	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.73210	0.3558	L	0.31926	0.97	0.22601	N	0.998943	B;P;P	0.36354	0.042;0.549;0.549	B;B;B	0.32211	0.031;0.142;0.142	T	0.61481	-0.7054	9	0.05620	T	0.96	.	6.759	0.23530	0.1814:0.151:0.6676:0.0	.	418;418;418	E7EX56;B7ZMK8;Q5K4E3	.;.;POLS2_HUMAN	K	418	ENSP00000268281:T418K;ENSP00000407160:T418K	ENSP00000268281:T418K	T	-	2	0	PRSS36	31061663	0.000000	0.05858	0.943000	0.38184	0.956000	0.61745	0.009000	0.13219	0.461000	0.27071	0.585000	0.79938	ACG			0.756	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000433542.1		NM_173502	
COG4	25839	hgsc.bcm.edu;mdanderson.org	37	16	70530257	70530257	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:70530257G>A	ENST00000323786.5	-	12	1580	c.1559C>T	c.(1558-1560)gCc>gTc	p.A520V		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	516					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				GATGTTCACGGCACTTGTCAC	0.552																																					p.A520V													.	.			0			c.C1559T												143.0	108.0	120.0					16																	70530257		2198	4300	6498	SO:0001583	missense	25839	exon12			TTCACGGCACTTG	AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1559C>T	16.37:g.70530257G>A	ENSP00000315775:p.Ala520Val		102	0	0		140	0.04	6	NM_015386	113	0.00	0	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	ENST00000323786.5	37	CCDS10892.2	.	.	.	.	.	.	.	.	.	.	G	35	5.592037	0.96590	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000539961	T	0.47869	0.83	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.70404	0.3220	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	0.989;1.0;0.999	P;D;D	0.74348	0.851;0.983;0.972	T	0.70676	-0.4806	10	0.87932	D	0	-17.6636	20.5792	0.99380	0.0:0.0:1.0:0.0	.	426;515;516	Q8N8L9;Q6PIW8;Q9H9E3	.;.;COG4_HUMAN	V	520;516;178	ENSP00000315775:A520V	ENSP00000315775:A520V	A	-	2	0	COG4	69087758	1.000000	0.71417	0.996000	0.52242	0.959000	0.62525	9.623000	0.98386	2.873000	0.98535	0.561000	0.74099	GCC			0.552	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250326.3			
SYCE1L	100130958	broad.mit.edu	37	16	77233353	77233354	+	Frame_Shift_Ins	INS	-	-	G	rs369924114		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:77233353_77233354insG	ENST00000378644.4	+	1	60_61	c.5_6insG	c.(4-9)gcggggfs	p.AG2fs	RP11-538I12.2_ENST00000569032.1_RNA|MON1B_ENST00000248248.3_3'UTR	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	2					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						TGGAAAATGGCGGGGAAGCTGA	0.569																																					p.A2fs													.	SYCE1L	10		0			c.5_6insG																																									SO:0001589	frameshift_variant	100130958	exon1			AAATGGCGGGGAA		CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.9dupG	16.37:g.77233357_77233357dupG	ENSP00000367911:p.Ala2fs		193	0	0		199	0.04	7	NM_001129979	30	0.00	0	A6NF23	Frame_Shift_Ins	INS	ENST00000378644.4	37	CCDS45533.1																																																																																					0.569	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433889.1		NM_001129979	
TAF1C	9013	mdanderson.org	37	16	84213858	84213858	+	Silent	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr16:84213858C>T	ENST00000567759.1	-	12	1661	c.1479G>A	c.(1477-1479)ctG>ctA	p.L493L	TAF1C_ENST00000378541.4_Silent_p.L493L|TAF1C_ENST00000541676.1_Silent_p.L400L|TAF1C_ENST00000566732.1_Silent_p.L467L|TAF1C_ENST00000341690.6_Silent_p.L400L|TAF1C_ENST00000570117.1_Silent_p.L161L	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	493					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						GCGGAGGCAGCAGTCGGGCCA	0.706																																					p.L493L													.	.			0			c.G1479A												15.0	16.0	15.0					16																	84213858		2108	4154	6262	SO:0001819	synonymous_variant	9013	exon12			AGGCAGCAGTCGG	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.1479G>A	16.37:g.84213858C>T			17	0	0		15	0.20	3	NM_005679	52	0.00	0	B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Silent	SNP	ENST00000567759.1	37	CCDS32496.1																																																																																					0.706	TAF1C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000433045.2		NM_139353	
PRPF8	10594	mdanderson.org	37	17	1576479	1576479	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:1576479G>A	ENST00000572621.1	-	23	3935	c.3670C>T	c.(3670-3672)Cgc>Tgc	p.R1224C	PRPF8_ENST00000304992.6_Missense_Mutation_p.R1224C			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1224	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGAGCTGTGCGCTCCTTAGTA	0.537																																					p.R1224C													.	.			0			c.C3670T												125.0	100.0	108.0					17																	1576479		2203	4300	6503	SO:0001583	missense	10594	exon24			CTGTGCGCTCCTT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3670C>T	17.37:g.1576479G>A	ENSP00000460348:p.Arg1224Cys		97	0	0		85	0.05	4	NM_006445	9	0.00	0	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825815	0.71143	.	.	ENSG00000174231	ENST00000304992	T	0.46451	0.87	6.06	5.04	0.67666	Pre-mRNA-processing-splicing factor 8, U5-snRNA-binding (1);	0.047131	0.85682	D	0.000000	T	0.66752	0.2821	M	0.85462	2.755	0.80722	D	1	D	0.76494	0.999	D	0.65140	0.932	T	0.68435	-0.5409	10	0.45353	T	0.12	-6.6737	17.345	0.87308	0.0:0.0:0.8504:0.1496	.	1224	Q6P2Q9	PRP8_HUMAN	C	1224	ENSP00000304350:R1224C	ENSP00000304350:R1224C	R	-	1	0	PRPF8	1523229	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	2.954000	0.49113	2.879000	0.98667	0.650000	0.86243	CGC			0.537	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438412.2			
ITGAE	3682	broad.mit.edu	37	17	3660286	3660286	+	Missense_Mutation	SNP	C	C	T	rs545813409		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:3660286C>T	ENST00000263087.4	-	10	1261	c.1163G>A	c.(1162-1164)aGc>aAc	p.S388N		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	388	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ACCTTCCATGCTGATGATGTT	0.592																																					p.S388N	NSCLC(182;635 2928 8995 38788)												.	ITGAE	96		0			c.G1163A												151.0	138.0	142.0					17																	3660286		2203	4300	6503	SO:0001583	missense	3682	exon10			TCCATGCTGATGA	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1163G>A	17.37:g.3660286C>T	ENSP00000263087:p.Ser388Asn		85	0	0		104	0.04	4	NM_002208	0		0	Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	37	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	C	9.309	1.055086	0.19907	.	.	ENSG00000083457	ENST00000263087	T	0.78003	-1.14	4.59	-8.37	0.00976	.	.	.	.	.	T	0.47563	0.1452	N	0.10916	0.065	0.09310	N	1	B	0.27068	0.167	B	0.16722	0.016	T	0.34153	-0.9840	9	0.46703	T	0.11	.	1.563	0.02599	0.1251:0.197:0.2484:0.4295	.	388	P38570	ITAE_HUMAN	N	388	ENSP00000263087:S388N	ENSP00000263087:S388N	S	-	2	0	ITGAE	3607035	0.000000	0.05858	0.000000	0.03702	0.735000	0.41995	-0.704000	0.05058	-1.194000	0.02684	0.407000	0.27541	AGC			0.592	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438169.1		NM_002208	
CAMTA2	23125	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	4883462	4883462	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:4883462C>G	ENST00000348066.3	-	9	1278	c.1155G>C	c.(1153-1155)caG>caC	p.Q385H	CAMTA2_ENST00000358183.4_Missense_Mutation_p.Q385H|CAMTA2_ENST00000414043.3_Missense_Mutation_p.Q408H|CAMTA2_ENST00000381311.5_Missense_Mutation_p.Q387H|CAMTA2_ENST00000572543.1_Missense_Mutation_p.Q390H|CAMTA2_ENST00000361571.5_Missense_Mutation_p.Q384H|CAMTA2_ENST00000571831.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	385					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TCTGGCCCCTCTGGGGGCTGT	0.617																																					p.Q408H													.	CAMTA2	93		0			c.G1224C												28.0	33.0	32.0					17																	4883462		2187	4290	6477	SO:0001583	missense	23125	exon9			GCCCCTCTGGGGG	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1155G>C	17.37:g.4883462C>G	ENSP00000321813:p.Gln385His		213	0.0046948357	1		175	0.03	6	NM_001171167	4	0.00	0	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.281848	0.40394	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	4.59	2.34	0.29019	.	0.354182	0.23187	N	0.050954	T	0.44644	0.1303	N	0.19112	0.55	0.26837	N	0.968468	D;D;D;D;D	0.64830	0.976;0.976;0.986;0.976;0.994	P;P;P;P;D	0.72075	0.459;0.556;0.66;0.459;0.976	T	0.21827	-1.0234	10	0.72032	D	0.01	-13.149	2.2616	0.04068	0.2648:0.4062:0.0:0.329	.	361;408;387;385;384	B7ZM30;E7EWU5;O94983-3;O94983;O94983-4	.;.;.;CMTA2_HUMAN;.	H	408;387;384;385;385	ENSP00000412886:Q408H;ENSP00000370712:Q387H;ENSP00000354828:Q384H;ENSP00000350910:Q385H;ENSP00000321813:Q385H	ENSP00000321813:Q385H	Q	-	3	2	CAMTA2	4824186	0.551000	0.26497	1.000000	0.80357	0.999000	0.98932	-0.211000	0.09332	1.027000	0.39758	0.655000	0.94253	CAG			0.617	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000216876.1		NM_015099	
TMEM256	254863	hgsc.bcm.edu	37	17	7307176	7307176	+	Intron	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:7307176C>T	ENST00000302422.3	-	1	138				C17orf61-PLSCR3_ENST00000573331.1_Intron|TMEM256-PLSCR3_ENST00000535512.1_Intron|NLGN2_ENST00000575301.1_5'Flank	NM_152766.3	NP_689979.1	Q8N2U0	TM256_HUMAN	transmembrane protein 256							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CAATTGGACCCAGCTGGGGGA	0.622																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			TGGACCCAGCTGG	BC030270	CCDS11102.1	17p13.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000205544	ENSG00000205544			28618	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 61"""	C17orf61		12477932	Standard	NM_152766		Approved	MGC40107	uc002ggs.3	Q8N2U0	OTTHUMG00000132900	ENST00000302422.3:c.85+142G>A	17.37:g.7307176C>T			86	0	0		83	0.20	17	.	0		0		RNA	SNP	ENST00000302422.3	37	CCDS11102.1																																																																																					0.622	TMEM256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256404.1		NM_152766	
CPD	1362	broad.mit.edu	37	17	28758789	28758789	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:28758789G>T	ENST00000225719.4	+	8	2093		c.e8-1		CPD_ENST00000543464.2_Splice_Site	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						TTCCCTTATAGGTTCTTTGGT	0.348																																					.													.	CPD	89		0			c.2018-1G>T												146.0	127.0	133.0					17																	28758789		2203	4300	6503	SO:0001630	splice_region_variant	1362	exon8			CTTATAGGTTCTT	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2018-1G>T	17.37:g.28758789G>T			96	0	0		129	0.04	5	NM_001304	0		0	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Splice_Site	SNP	ENST00000225719.4	37	CCDS11257.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.251009	0.80135	.	.	ENSG00000108582	ENST00000225719;ENST00000543464	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0987	0.89499	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPD	25782915	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	8.243000	0.89821	2.576000	0.86940	0.563000	0.77884	.			0.348	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256214.3		NM_001304	Intron
CBX1	10951	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	46154242	46154242	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:46154242C>T	ENST00000393408.3	-	2	605	c.125G>A	c.(124-126)tGg>tAg	p.W42*	CBX1_ENST00000225603.4_Nonsense_Mutation_p.W42*|CBX1_ENST00000495350.1_Nonsense_Mutation_p.W42*	NM_006807.4	NP_006798.1	P83916	CBX1_HUMAN	chromobox homolog 1	42	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				negative regulation of transcription, DNA-templated (GO:0045892)	chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|pericentric heterochromatin (GO:0005721)|spindle (GO:0005819)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)			breast(1)|central_nervous_system(1)|kidney(1)|prostate(1)	4						GAATCCCTTCCACTTTAGGAG	0.468																																					p.W42X	NSCLC(136;694 2497 38792 39034)												.	.			0			c.G125A												280.0	231.0	247.0					17																	46154242		2203	4300	6503	SO:0001587	stop_gained	10951	exon2			CCCTTCCACTTTA	U35451	CCDS11525.1	17q21.32	2010-07-06	2010-06-24		ENSG00000108468	ENSG00000108468			1551	protein-coding gene	gene with protein product	"""HP1 beta homolog (Drosophila )"""	604511	"""chromobox homolog 1 (Drosophila HP1 beta)"""			9169582	Standard	NM_001127228		Approved	HP1Hs-beta, M31, MOD1, CBX, HP1-BETA	uc002ind.4	P83916	OTTHUMG00000150417	ENST00000393408.3:c.125G>A	17.37:g.46154242C>T	ENSP00000377060:p.Trp42*		183	0	0		206	0.09	18	NM_006807	25	0.00	0	P23197	Nonsense_Mutation	SNP	ENST00000393408.3	37	CCDS11525.1	.	.	.	.	.	.	.	.	.	.	C	36	5.814792	0.96982	.	.	ENSG00000108468	ENST00000225603;ENST00000393408;ENST00000402583;ENST00000444685	.	.	.	5.85	5.85	0.93711	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6704	18.9246	0.92540	0.0:1.0:0.0:0.0	.	.	.	.	X	42	.	ENSP00000225603:W42X	W	-	2	0	CBX1	43509241	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.792000	0.85828	2.767000	0.95098	0.655000	0.94253	TGG			0.468	CBX1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318016.1		NM_006807	
PHOSPHO1	162466	mdanderson.org	37	17	47301803	47301803	+	Silent	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:47301803G>A	ENST00000310544.4	-	3	736	c.609C>T	c.(607-609)gaC>gaT	p.D203D	PHOSPHO1_ENST00000514112.1_Silent_p.D228D|PHOSPHO1_ENST00000413580.1_Silent_p.D228D			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1	203					bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	CGTTGGCGCCGTCGCCCACGT	0.701																																					p.D228D													.	.			0			c.C684T												5.0	6.0	5.0					17																	47301803		2112	4127	6239	SO:0001819	synonymous_variant	162466	exon3			GGCGCCGTCGCCC	AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.609C>T	17.37:g.47301803G>A			31	0	0		43	0.07	3	NM_001143804	0		0	E9PAM0|Q17RU6	Silent	SNP	ENST00000310544.4	37	CCDS11547.1																																																																																					0.701	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364467.2			
BZRAP1	9256	hgsc.bcm.edu	37	17	56386622	56386622	+	Silent	SNP	T	T	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:56386622T>C	ENST00000343736.4	-	22	4174	c.4011A>G	c.(4009-4011)gaA>gaG	p.E1337E	BZRAP1_ENST00000268893.6_Silent_p.E1277E|BZRAP1_ENST00000355701.3_Silent_p.E1337E			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1337	Poly-Glu.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					cctcttcctcttcctcctcct	0.597																																					p.E1337E													.	.			0			c.A4011G												58.0	62.0	61.0					17																	56386622		2203	4300	6503	SO:0001819	synonymous_variant	9256	exon22			TTCCTCTTCCTCC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4011A>G	17.37:g.56386622T>C			80	0	0		79	0.10	8	NM_004758	8	0.13	1	O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	CCDS11605.1																																																																																					0.597	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000443980.1		NM_004758	
EVPL	2125	broad.mit.edu;mdanderson.org	37	17	74008164	74008164	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr17:74008164T>G	ENST00000301607.3	-	19	2633	c.2380A>C	c.(2380-2382)Acg>Ccg	p.T794P	EVPL_ENST00000586740.1_Missense_Mutation_p.T816P	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	794	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						ATCTCCTGCGTCAGCCTCTGC	0.632																																					p.T794P													.	EVPL	155		0			c.A2380C												39.0	37.0	38.0					17																	74008164		2203	4300	6503	SO:0001583	missense	2125	exon19			CCTGCGTCAGCCT	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.2380A>C	17.37:g.74008164T>G	ENSP00000301607:p.Thr794Pro		52	0	0		56	0.05	3	NM_001988	8	0.13	1	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	T	8.425	0.847190	0.17034	.	.	ENSG00000167880	ENST00000301607	T	0.63580	-0.05	5.16	1.77	0.24775	.	1.070280	0.07176	N	0.853188	T	0.42131	0.1189	N	0.08118	0	0.09310	N	0.999998	B;B	0.25609	0.13;0.031	B;B	0.21708	0.036;0.024	T	0.36065	-0.9763	10	0.72032	D	0.01	-6.3195	8.0582	0.30617	0.0:0.4869:0.3792:0.1338	.	816;794	B7ZLH8;Q92817	.;EVPL_HUMAN	P	794	ENSP00000301607:T794P	ENSP00000301607:T794P	T	-	1	0	EVPL	71519759	0.930000	0.31532	0.576000	0.28549	0.091000	0.18340	0.116000	0.15561	0.076000	0.16826	0.448000	0.29417	ACG			0.632	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449483.1		NM_001988	
KISS1R	84634	mdanderson.org	37	19	920547	920547	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:920547G>T	ENST00000234371.5	+	5	1149	c.996G>T	c.(994-996)caG>caT	p.Q332H	KISS1R_ENST00000606939.1_3'UTR	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	332					activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTTCCGACAGGCCTTccgcc	0.746																																					p.Q332H													.	.			0			c.G996T												26.0	23.0	24.0					19																	920547		2201	4300	6501	SO:0001583	missense	84634	exon5			CCGACAGGCCTTC	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.996G>T	19.37:g.920547G>T	ENSP00000234371:p.Gln332His		22	0	0		13	0.23	3	NM_032551	1	0.00	0	A5D8U2|B2RTV1|Q96QG0	Missense_Mutation	SNP	ENST00000234371.5	37	CCDS12049.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.304433	0.60305	.	.	ENSG00000116014	ENST00000234371	T	0.38240	1.15	4.66	3.59	0.41128	.	0.220296	0.35970	N	0.002871	T	0.30823	0.0777	N	0.24115	0.695	0.34862	D	0.742726	P	0.44986	0.847	P	0.45913	0.497	T	0.48246	-0.9052	10	0.72032	D	0.01	.	12.4977	0.55937	0.0:0.17:0.8299:0.0	.	332	Q969F8	KISSR_HUMAN	H	332	ENSP00000234371:Q332H	ENSP00000234371:Q332H	Q	+	3	2	KISS1R	871547	1.000000	0.71417	0.933000	0.37362	0.329000	0.28539	2.550000	0.45811	0.942000	0.37525	0.549000	0.68633	CAG			0.746	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458217.3		NM_032551	
MATK	4145	mdanderson.org	37	19	3784375	3784375	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:3784375G>T	ENST00000310132.6	-	4	605	c.207C>A	c.(205-207)ttC>ttA	p.F69L	MATK_ENST00000395045.2_Missense_Mutation_p.F70L|MATK_ENST00000585778.1_Missense_Mutation_p.F69L|MATK_ENST00000395040.2_Missense_Mutation_p.F28L	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	69	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCCTTGCGGAAGGCCAGCT	0.716																																					p.F70L													.	.			0			c.C210A												21.0	23.0	22.0					19																	3784375		2200	4298	6498	SO:0001583	missense	4145	exon4			CTTGCGGAAGGCC	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.207C>A	19.37:g.3784375G>T	ENSP00000308734:p.Phe69Leu		31	0	0		36	0.08	3	NM_002378	3	0.00	0	B3KNZ9|Q9NST8	Missense_Mutation	SNP	ENST00000310132.6	37	CCDS12114.1	.	.	.	.	.	.	.	.	.	.	g	24.8	4.573554	0.86542	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.24151	1.87;1.87;1.87	4.81	2.66	0.31614	Src homology-3 domain (4);	0.279023	0.36409	N	0.002606	T	0.31734	0.0806	L	0.53249	1.67	0.36163	D	0.84821	D;D;D	0.60160	0.987;0.987;0.987	P;P;P	0.52909	0.713;0.713;0.713	T	0.31641	-0.9936	10	0.56958	D	0.05	-22.7345	7.4783	0.27390	0.2729:0.0:0.7271:0.0	.	69;70;69	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	L	70;69;28	ENSP00000378485:F70L;ENSP00000308734:F69L;ENSP00000378481:F28L	ENSP00000308734:F69L	F	-	3	2	MATK	3735375	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.020000	0.49643	0.431000	0.26258	0.457000	0.33378	TTC			0.716	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000453639.1		NM_139355	
ICAM3	3385	mdanderson.org	37	19	10445899	10445899	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:10445899G>T	ENST00000160262.5	-	4	988	c.780C>A	c.(778-780)gaC>gaA	p.D260E	RAVER1_ENST00000293677.6_5'Flank|ICAM3_ENST00000589261.1_Missense_Mutation_p.D183E	NM_002162.3	NP_002153.2	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3	260	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	13			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)			TCAGCATCTGGTCCCCCAGCG	0.657																																					p.D260E													.	.			0			c.C780A												104.0	113.0	110.0					19																	10445899		2203	4300	6503	SO:0001583	missense	3385	exon4			CATCTGGTCCCCC		CCDS12235.1	19p13.3-p13.2	2013-01-11				ENSG00000076662		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5346	protein-coding gene	gene with protein product		146631				1448174	Standard	NM_002162		Approved	CDW50, ICAM-R, CD50	uc002mob.2	P32942		ENST00000160262.5:c.780C>A	19.37:g.10445899G>T	ENSP00000160262:p.Asp260Glu		70	0	0		49	0.06	3	NM_002162	36	0.00	0	Q6PD68	Missense_Mutation	SNP	ENST00000160262.5	37	CCDS12235.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121525	0.56613	.	.	ENSG00000076662	ENST00000160262	T	0.03413	3.94	5.15	2.88	0.33553	Immunoglobulin-like fold (1);	1.024290	0.07794	N	0.955388	T	0.04815	0.0130	L	0.42632	1.34	0.09310	N	1	B	0.14438	0.01	B	0.16289	0.015	T	0.34378	-0.9831	10	0.48119	T	0.1	-12.1809	7.6719	0.28463	0.0945:0.1658:0.7398:0.0	.	260	P32942	ICAM3_HUMAN	E	260	ENSP00000160262:D260E	ENSP00000160262:D260E	D	-	3	2	ICAM3	10306899	0.226000	0.23696	0.558000	0.28319	0.416000	0.31233	1.433000	0.34947	1.295000	0.44724	0.462000	0.41574	GAC			0.657	ICAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451234.1			
SMARCA4	6597	mdanderson.org	37	19	11129657	11129657	+	Missense_Mutation	SNP	G	G	T	rs375459615		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:11129657G>T	ENST00000429416.3	+	18	2744	c.2463G>T	c.(2461-2463)gaG>gaT	p.E821D	SMARCA4_ENST00000444061.3_Missense_Mutation_p.E821D|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000541122.2_Missense_Mutation_p.E821D|SMARCA4_ENST00000589677.1_Missense_Mutation_p.E821D|SMARCA4_ENST00000590574.1_Missense_Mutation_p.E821D|SMARCA4_ENST00000344626.4_Missense_Mutation_p.E821D|SMARCA4_ENST00000450717.3_Missense_Mutation_p.E821D|SMARCA4_ENST00000358026.2_Missense_Mutation_p.E821D|SMARCA4_ENST00000413806.3_Missense_Mutation_p.E821D	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	821	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GGGCGTACGAGTTTGACAAGT	0.562			"""F, N, Mis"""		NSCLC																																p.E821D				Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4,NS,lymphoid_neoplasm,+2,3	SMARCA4	2	3	1	Unknown(1)	lung(1)	c.G2463T												175.0	149.0	158.0					19																	11129657		2203	4300	6503	SO:0001583	missense	6597	exon17			GTACGAGTTTGAC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2463G>T	19.37:g.11129657G>T	ENSP00000395654:p.Glu821Asp		159	0	0		126	0.04	5	NM_003072	32	0.00	0	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786396	0.49997	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	4.95	0.604	0.17547	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98601	0.9532	H	0.99789	4.78	0.47819	D	0.999521	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.998;1.0;1.0	D	0.96391	0.9289	10	0.87932	D	0	-27.2359	8.8713	0.35318	0.5561:0.0:0.4438:0.0	.	821;821;821;821;821;821;821	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	D	821;821;885;821;821;821;821;821	ENSP00000395654:E821D;ENSP00000350720:E821D;ENSP00000343896:E821D;ENSP00000445036:E821D;ENSP00000392837:E821D;ENSP00000397783:E821D;ENSP00000414727:E821D	ENSP00000343896:E821D	E	+	3	2	SMARCA4	10990657	0.358000	0.24947	0.957000	0.39632	0.288000	0.27193	-0.180000	0.09754	-0.128000	0.11641	-0.469000	0.05056	GAG			0.562	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000452638.2		NM_003072	
MAN2B1	4125	mdanderson.org	37	19	12776540	12776540	+	Missense_Mutation	SNP	G	G	T	rs566259319		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:12776540G>T	ENST00000456935.2	-	2	279	c.239C>A	c.(238-240)aCc>aAc	p.T80N	WDR83_ENST00000418543.3_5'Flank|CTD-2192J16.24_ENST00000597961.1_Missense_Mutation_p.T77N|MAN2B1_ENST00000221363.4_Missense_Mutation_p.T80N	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	80					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTGGTCCACGGTTTTGAGCCA	0.572																																					p.T80N													.	.			0			c.C239A												133.0	102.0	113.0					19																	12776540		2203	4300	6503	SO:0001583	missense	4125	exon2			TCCACGGTTTTGA		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.239C>A	19.37:g.12776540G>T	ENSP00000395473:p.Thr80Asn		58	0	0		52	0.06	3	NM_000528	32	0.00	0	G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	ENST00000456935.2	37	CCDS32919.1	.	.	.	.	.	.	.	.	.	.	G	35	5.433920	0.96150	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.82255	-1.59;-1.59	5.76	5.76	0.90799	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.000000	0.51477	D	0.000098	D	0.92459	0.7606	M	0.89414	3.03	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.978;0.981	D	0.93370	0.6734	10	0.87932	D	0	-29.5684	17.4644	0.87628	0.0:0.0:1.0:0.0	.	80;80	G5E928;O00754	.;MA2B1_HUMAN	N	80;19;80	ENSP00000395473:T80N;ENSP00000221363:T80N	ENSP00000221363:T80N	T	-	2	0	MAN2B1	12637540	1.000000	0.71417	0.948000	0.38648	0.944000	0.59088	9.363000	0.97131	2.728000	0.93425	0.655000	0.94253	ACC			0.572	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000344062.1			
ZNF676	163223	ucsc.edu	37	19	22363307	22363307	+	Silent	SNP	T	T	C	rs112075209		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:22363307T>C	ENST00000397121.2	-	3	1529	c.1212A>G	c.(1210-1212)tcA>tcG	p.S404S		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GCTTTGAGGATGAGTTGGAAG	0.433																																					p.S404S													.	ZNF676	146		0			c.A1212G												80.0	82.0	81.0					19																	22363307		2141	4267	6408	SO:0001819	synonymous_variant	163223	exon3			TGAGGATGAGTTG	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1212A>G	19.37:g.22363307T>C			61	0.0327868852	2		48	0.19	9	NM_001001411	0		0	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																					0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464392.1		NM_001001411	
CIC	23152	mdanderson.org	37	19	42791528	42791528	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:42791528G>T	ENST00000575354.2	+	4	549	c.509G>T	c.(508-510)cGg>cTg	p.R170L	CIC_ENST00000572681.2_Missense_Mutation_p.R1079L|CIC_ENST00000160740.3_Missense_Mutation_p.R170L	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GGAAAACGTCGGACCCAGTCC	0.597			"""Mis, F, S"""		oligodendroglioma																																p.R170L				Rec	yes		19	19q13.2	23152	capicua homolog		O	.	.			0			c.G509T												118.0	116.0	117.0					19																	42791528		2203	4300	6503	SO:0001583	missense	23152	exon4			AACGTCGGACCCA	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.509G>T	19.37:g.42791528G>T	ENSP00000458663:p.Arg170Leu		49	0	0		51	0.06	3	NM_015125	8	0.00	0	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570196	0.65765	.	.	ENSG00000079432	ENST00000160740	.	.	.	4.36	4.36	0.52297	.	.	.	.	.	T	0.64103	0.2568	L	0.27053	0.805	0.54753	D	0.999987	D	0.76494	0.999	D	0.79784	0.993	T	0.68777	-0.5319	8	0.87932	D	0	-13.7371	14.5137	0.67804	0.0:0.0:1.0:0.0	.	170	Q96RK0	CIC_HUMAN	L	170	.	ENSP00000160740:R170L	R	+	2	0	CIC	47483368	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.335000	0.72949	2.284000	0.76573	0.555000	0.69702	CGG			0.597	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000438532.2			
TMC4	147798	mdanderson.org	37	19	54675697	54675697	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:54675697G>T	ENST00000376591.4	-	2	384	c.253C>A	c.(253-255)Cag>Aag	p.Q85K	TMC4_ENST00000476013.2_5'UTR|TMC4_ENST00000301187.4_Missense_Mutation_p.Q79K	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	85					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGAGGGTCCTGCAGCTCTGTC	0.682																																					p.Q85K													.	.			0			c.C253A												124.0	120.0	122.0					19																	54675697		2203	4300	6503	SO:0001583	missense	147798	exon2			GGTCCTGCAGCTC	AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.253C>A	19.37:g.54675697G>T	ENSP00000365776:p.Gln85Lys		76	0	0		47	0.09	4	NM_001145303	62	0.02	1	Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	ENST00000376591.4	37	CCDS46174.1	.	.	.	.	.	.	.	.	.	.	g	10.57	1.388311	0.25118	.	.	ENSG00000167608	ENST00000301187;ENST00000376591	T;T	0.72051	-0.61;-0.62	3.55	2.47	0.30058	.	2.023590	0.02500	N	0.090405	T	0.64659	0.2618	L	0.52573	1.65	0.33391	D	0.576129	B;B	0.20887	0.049;0.009	B;B	0.25614	0.016;0.062	T	0.51593	-0.8686	10	0.05959	T	0.93	-0.5042	9.1447	0.36925	0.0:0.2253:0.7747:0.0	.	85;79	Q7Z404;Q7Z404-1	TMC4_HUMAN;.	K	79;85	ENSP00000301187:Q79K;ENSP00000365776:Q85K	ENSP00000301187:Q79K	Q	-	1	0	TMC4	59367509	0.086000	0.21541	0.481000	0.27354	0.379000	0.30106	2.282000	0.43461	0.634000	0.30469	0.430000	0.28490	CAG			0.682	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000156164.2			
ZNF628	89887	ucsc.edu	37	19	55994302	55994302	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:55994302T>C	ENST00000598519.1	+	3	2295	c.1742T>C	c.(1741-1743)cTg>cCg	p.L581P	NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000591590.1_5'Flank|ZNF628_ENST00000391718.2_Missense_Mutation_p.L577P|NAT14_ENST00000205194.4_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	581					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		ACCTCCAACCTGCGGCAGCAC	0.706																																					p.L581P													.	ZNF628	75		0			c.T1742C												22.0	24.0	24.0					19																	55994302		2202	4293	6495	SO:0001583	missense	89887	exon3			CCAACCTGCGGCA	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1742T>C	19.37:g.55994302T>C	ENSP00000469591:p.Leu581Pro		27	0	0		34	0.12	4	NM_033113	8	0.00	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	16.38	3.107901	0.56291	.	.	ENSG00000197483	ENST00000391718	T	0.53857	0.6	3.9	3.9	0.45041	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.207576	0.22422	N	0.060280	T	0.77294	0.4109	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82263	-0.0544	10	0.87932	D	0	-5.1587	11.0086	0.47649	0.0:0.0:0.0:1.0	.	577	Q5EBL2	ZN628_HUMAN	P	577	ENSP00000375598:L577P	ENSP00000375598:L577P	L	+	2	0	ZNF628	60686114	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.569000	0.82380	1.779000	0.52309	0.454000	0.30748	CTG			0.706	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317934.2		XM_058964	
ZNF814	730051	bcgsc.ca	37	19	58385788	58385788	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr19:58385788A>G	ENST00000435989.2	-	3	1204	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	324					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CCACATTCATAAGGTCTTTTC	0.358																																					p.Y324H													.	ZNF814	93		0			c.T970C												15.0	12.0	13.0					19																	58385788		688	1564	2252	SO:0001583	missense	730051	exon3			ATTCATAAGGTCT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.970T>C	19.37:g.58385788A>G	ENSP00000410545:p.Tyr324His		109	0	0		113	0.06	7	NM_001144989	0		0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.644	0.896732	0.17686	.	.	ENSG00000204514	ENST00000435989	T	0.21734	1.99	2.27	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.22386	0.039	T	0.24368	-1.0162	9	0.72032	D	0.01	.	7.1587	0.25652	0.6135:0.0:0.3865:0.0	.	324	B7Z6K7	ZN814_HUMAN	H	324	ENSP00000410545:Y324H	ENSP00000410545:Y324H	Y	-	1	0	ZNF814	63077600	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.130000	0.15850	-0.181000	0.10619	0.113000	0.15668	TAT			0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466976.1		XM_001725708	
ADCY3	109	mdanderson.org	37	2	25050963	25050963	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr2:25050963C>T	ENST00000260600.5	-	13	3091	c.2240G>A	c.(2239-2241)tGc>tAc	p.C747Y	ADCY3_ENST00000450524.1_5'UTR|RP11-443B20.1_ENST00000606114.1_RNA|ADCY3_ENST00000405392.1_Intron	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	747					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GTTCTCCAGGCAGCTGCCCTC	0.602											OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C747Y													.	.			0			c.G2240A												94.0	73.0	80.0					2																	25050963		2203	4300	6503	SO:0001583	missense	109	exon13			TCCAGGCAGCTGC	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2240G>A	2.37:g.25050963C>T	ENSP00000260600:p.Cys747Tyr		80	0	0	776	101	0.05	5	NM_004036	17	0.00	0	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.154872	0.38021	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000455323;ENST00000450524	T;T;T	0.70045	-0.45;-0.45;-0.45	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.61664	0.2365	L	0.59436	1.845	0.80722	D	1	B;B	0.33266	0.067;0.404	B;B	0.35550	0.04;0.205	T	0.59994	-0.7349	10	0.02654	T	1	.	18.1003	0.89504	0.0:1.0:0.0:0.0	.	747;747	B7ZLX9;O60266	.;ADCY3_HUMAN	Y	747;722;86;90	ENSP00000260600:C747Y;ENSP00000402008:C86Y;ENSP00000410972:C90Y	ENSP00000260600:C747Y	C	-	2	0	ADCY3	24904467	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	7.539000	0.82063	2.608000	0.88229	0.561000	0.74099	TGC			0.602	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211574.2			
RNF103	7844	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	86849821	86849821	+	Silent	SNP	G	G	C	rs139047742		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr2:86849821G>C	ENST00000237455.4	-	1	1157	c.189C>G	c.(187-189)ccC>ccG	p.P63P	CHMP3_ENST00000439940.2_Intron|RNF103_ENST00000477307.1_5'UTR|RNF103-CHMP3_ENST00000604011.1_Intron	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	63					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						CCTTCTTCTCGGGCAACCCTG	0.612																																					p.P63P													.	.			0			c.C189G							G	,,,	0,4406		0,0,2203	73.0	81.0	78.0		177,189,,189	-5.6	0.9	2	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,intron,coding-synonymous	RNF103,RNF103-VPS24	NM_001198951.1,NM_001198952.1,NM_001198954.1,NM_005667.3	,,,	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	,,,	59/682,63/123,,63/686	86849821	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7844	exon1			CTTCTCGGGCAAC	D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.189C>G	2.37:g.86849821G>C			217	0	0		287	0.08	24	NM_005667	4	0.00	0	A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Silent	SNP	ENST00000237455.4	37	CCDS33237.1																																																																																			0		0.612	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330041.2		NM_005667	
RGPD8	727851	broad.mit.edu	37	2	113147636	113147636	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr2:113147636delA	ENST00000302558.3	-	20	3077	c.2886delT	c.(2884-2886)tttfs	p.F962fs	RGPD8_ENST00000409750.1_Frame_Shift_Del_p.F822fs	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	962					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						TTGTTTGGCCAAAAATCACAC	0.408																																					p.F962fs													.	RGPD8	81		0			c.2886delT												80.0	72.0	74.0					2																	113147636		686	1568	2254	SO:0001589	frameshift_variant	727851	exon20			TTGGCCAAAAATC	AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.2886delT	2.37:g.113147636delA	ENSP00000306637:p.Phe962fs		1573	0	0		1798	0.01	10	NM_001164463	1	0.00	0	Q5CZA8	Frame_Shift_Del	DEL	ENST00000302558.3	37	CCDS46394.1																																																																																					0.408	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375951.1		XM_001722279	
XRN2	22803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	21319698	21319698	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr20:21319698G>A	ENST00000377191.3	+	14	1345	c.1250G>A	c.(1249-1251)cGa>cAa	p.R417Q	XRN2_ENST00000430571.2_Missense_Mutation_p.R341Q|XRN2_ENST00000539513.1_Missense_Mutation_p.R363Q	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	417					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TTTAGAAGACGACAGAAAGAA	0.303																																					p.R417Q													.	.			0			c.G1250A												97.0	110.0	105.0					20																	21319698		2202	4298	6500	SO:0001583	missense	22803	exon14			GAAGACGACAGAA	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1250G>A	20.37:g.21319698G>A	ENSP00000366396:p.Arg417Gln		54	0	0		60	0.27	16	NM_012255	24	0.21	5	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	37	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689435	0.88735	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.33438	1.43;1.41;1.41	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	P	0.57057	0.812	T	0.55811	-0.8082	10	0.41790	T	0.15	-9.9748	16.89	0.86084	0.0:0.0:1.0:0.0	.	417	Q9H0D6	XRN2_HUMAN	Q	417;341;363	ENSP00000366396:R417Q;ENSP00000413548:R341Q;ENSP00000441113:R363Q	ENSP00000366396:R417Q	R	+	2	0	XRN2	21267698	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.427000	0.73378	2.416000	0.81992	0.655000	0.94253	CGA			0.303	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078273.2		NM_012255	
NCOR1P1	149934	broad.mit.edu	37	20	26094406	26094407	+	RNA	INS	-	-	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr20:26094406_26094407insC	ENST00000478176.1	-	0	150					NR_003678.1		Q9H4R4	CT191_HUMAN	nuclear receptor corepressor 1 pseudogene 1																		AGCTCTTGCCATTTAAAAAAAA	0.322																																					.													.	.			0			.																																											0	.			CTTGCCATTTAAA	AL391119		20p11.1	2011-09-16	2011-09-16	2011-09-16	ENSG00000240108	ENSG00000240108			16724	pseudogene	pseudogene			"""chromosome 20 open reading frame 191"""	C20orf191			Standard	NR_003678		Approved	bB329D4.2	uc002wvj.5	Q9H4R4	OTTHUMG00000032145		20.37:g.26094406_26094407insC			5	0	0		6	0.33	2	.	0		0	A2RUA0	RNA	INS	ENST00000478176.1	37																																																																																						0.322	NCOR1P1-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000078478.2			
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000358464.4_Splice_Site|FRG1B_ENST00000439954.2_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.													.	FRG1B	181		0			c.529-2A>G																																									SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G			506	0.0217391304	11		429	0.05	20	NR_003579	1	0.00	0	C4AME5	Splice_Site	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.			0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	Intron
TOP3B	8940	mdanderson.org	37	22	22326986	22326986	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr22:22326986G>T	ENST00000398793.2	-	4	741	c.307C>A	c.(307-309)Cag>Aag	p.Q103K	TOP3B_ENST00000357179.5_Missense_Mutation_p.Q103K|TOP3B_ENST00000413067.2_5'UTR	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	103	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CCACGCACCTGCAGGAACTTC	0.577											OREG0026347	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q103K													.	.			0			c.C307A												126.0	91.0	103.0					22																	22326986		2203	4300	6503	SO:0001583	missense	8940	exon4			GCACCTGCAGGAA	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.307C>A	22.37:g.22326986G>T	ENSP00000381773:p.Gln103Lys		92	0	0	755	48	0.06	3	NM_003935	10	0.00	0	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	37	CCDS13797.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684905	0.47991	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000424393;ENST00000437929;ENST00000430142	T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19	5.0	5.0	0.66597	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.000000	0.85682	D	0.000000	T	0.12561	0.0305	N	0.10760	0.04	0.80722	D	1	B	0.14012	0.009	B	0.14023	0.01	T	0.14476	-1.0471	10	0.16896	T	0.51	-1.2404	18.484	0.90821	0.0:0.0:1.0:0.0	.	103	O95985	TOP3B_HUMAN	K	103	ENSP00000349705:Q103K;ENSP00000381773:Q103K;ENSP00000390977:Q103K;ENSP00000402622:Q103K;ENSP00000414538:Q103K	ENSP00000349705:Q103K	Q	-	1	0	TOP3B	20656986	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.361000	0.97122	2.592000	0.87571	0.563000	0.77884	CAG			0.577	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320251.1		NM_003935	
TTC28	23331	mdanderson.org	37	22	28388647	28388647	+	Silent	SNP	C	C	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr22:28388647C>T	ENST00000397906.2	-	19	5622	c.5481G>A	c.(5479-5481)ctG>ctA	p.L1827L	TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000434221.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1827					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CAGGATTGGGCAGACCTAAAC	0.557																																					p.L1827L													.	.			0			c.G5481A												58.0	59.0	59.0					22																	28388647		692	1591	2283	SO:0001819	synonymous_variant	23331	exon19			ATTGGGCAGACCT	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5481G>A	22.37:g.28388647C>T			59	0	0		52	0.06	3	NM_001145418	0		0	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	ENST00000397906.2	37	CCDS46678.1																																																																																					0.557	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000320930.2		XM_929318	
DYNC1LI1	51143	broad.mit.edu	37	3	32582556	32582556	+	Silent	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr3:32582556G>T	ENST00000273130.4	-	5	814	c.711C>A	c.(709-711)ggC>ggA	p.G237G	DYNC1LI1_ENST00000432458.2_Silent_p.G121G	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	237					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						GTACTGGAATGCCCAAGTTAT	0.428																																					p.G237G													.	DYNC1LI1	23		0			c.C711A												208.0	189.0	195.0					3																	32582556		2203	4300	6503	SO:0001819	synonymous_variant	51143	exon5			TGGAATGCCCAAG	AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.711C>A	3.37:g.32582556G>T			136	0	0		134	0.03	4	NM_016141	30	0.03	1	A2RRG7|Q53HC8|Q53HK7	Silent	SNP	ENST00000273130.4	37	CCDS2654.1																																																																																					0.428	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253250.1		NM_016141	
UBA7	7318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49841691	49841691	+	IGR	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr3:49841691G>A	ENST00000333486.3	-	0	3299				MIR5193_ENST00000584510.1_RNA|FAM212A_ENST00000333323.4_Silent_p.Q45Q	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CAGATGTGCAGCCCAGCCACC	0.612																																					p.Q45Q													.	.			0			c.G135A												82.0	83.0	83.0					3																	49841691		2203	4300	6503	SO:0001628	intergenic_variant	389119	exon2			TGTGCAGCCCAGC	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267		3.37:g.49841691G>A			67	0	0		57	0.25	14	NM_203370	53	0.26	14	Q9BRB2	Silent	SNP	ENST00000333486.3	37	CCDS2805.1																																																																																					0.612	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350503.1		NM_003335	
ADAMTS9	56999	broad.mit.edu	37	3	64527581	64527581	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr3:64527581T>G	ENST00000498707.1	-	33	5472	c.5130A>C	c.(5128-5130)caA>caC	p.Q1710H	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.Q1682H	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1710	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		AGTGGCTGGGTTGGTCCTCAT	0.448																																					p.Q1710H													.	ADAMTS9	206		0			c.A5130C												182.0	172.0	176.0					3																	64527581		2203	4300	6503	SO:0001583	missense	56999	exon33			GCTGGGTTGGTCC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5130A>C	3.37:g.64527581T>G	ENSP00000418735:p.Gln1710His		185	0.1243243243	23		169	0.20	33	NM_182920	4	0.00	0	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.04|17.04	3.287559|3.287559	0.59976|0.59976	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000481060|ENST00000295903;ENST00000498707	.|T;T	.|0.55052	.|0.54;0.54	5.7|5.7	-1.59|-1.59	0.08453|0.08453	.|.	.|0.069831	.|0.64402	.|D	.|0.000015	T|T	0.57036|0.57036	0.2026|0.2026	L|L	0.49699|0.49699	1.58|1.58	0.80722|0.80722	D|D	1|1	.|D;D	.|0.58970	.|0.984;0.973	.|P;P	.|0.59115	.|0.852;0.852	T|T	0.56932|0.56932	-0.7897|-0.7897	5|10	.|0.41790	.|T	.|0.15	.|.	12.6626|12.6626	0.56822|0.56822	0.0:0.6324:0.0:0.3676|0.0:0.6324:0.0:0.3676	.|.	.|1682;1710	.|B7ZVX9;Q9P2N4	.|.;ATS9_HUMAN	T|H	766|1682;1710	.|ENSP00000295903:Q1682H;ENSP00000418735:Q1710H	.|ENSP00000295903:Q1682H	N|Q	-|-	2|3	0|2	ADAMTS9|ADAMTS9	64502621|64502621	0.704000|0.704000	0.27836|0.27836	0.997000|0.997000	0.53966|0.53966	0.992000|0.992000	0.81027|0.81027	-0.120000|-0.120000	0.10660|0.10660	-0.095000|-0.095000	0.12351|0.12351	-0.353000|-0.353000	0.07706|0.07706	AAC|CAA			0.448	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351891.1			
JAKMIP1	152789	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	6107587	6107589	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	CTC	CTC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr4:6107587_6107589delCTC	ENST00000282924.5	-	3	720_722	c.235_237delGAG	c.(235-237)gagdel	p.E79del	JAKMIP1_ENST00000457227.2_Intron|JAKMIP1_ENST00000409831.1_In_Frame_Del_p.E79del|JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000409021.3_In_Frame_Del_p.E79del|JAKMIP1_ENST00000409371.3_Intron	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	79	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCTTGGTCTTCTCCTCATGCAGC	0.68																																					p.79_80del													.	JAKMIP1	250		0			c.236_238del																																									SO:0001651	inframe_deletion	152789	exon3			GGTCTTCTCCTCA	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.235_237delGAG	4.37:g.6107590_6107592delCTC	ENSP00000282924:p.Glu79del		72	0	0		54	0.22	12	NM_144720	1	0.00	0	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	In_Frame_Del	DEL	ENST00000282924.5	37	CCDS3385.1																																																																																					0.680	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246816.2		NM_144720	
RXRB	6257	mdanderson.org	37	6	33168217	33168217	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr6:33168217G>A	ENST00000374680.3	-	1	248	c.37C>T	c.(37-39)Cgg>Tgg	p.R13W	RXRB_ENST00000374685.4_Missense_Mutation_p.R13W|RXRB_ENST00000413614.2_5'UTR|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374677.3_5'Flank|RXRB_ENST00000544186.1_Intron|SLC39A7_ENST00000374675.3_5'Flank	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	13	Modulating. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	GCGGCATGCCGCTGAGGGAGG	0.667																																					p.R13W													.	.			0			c.C37T												13.0	12.0	12.0					6																	33168217		1497	2705	4202	SO:0001583	missense	6257	exon1			CATGCCGCTGAGG	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.37C>T	6.37:g.33168217G>A	ENSP00000363812:p.Arg13Trp		18	0	0		38	0.08	3	NM_021976	9	0.00	0	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164524	0.57476	.	.	ENSG00000204231	ENST00000374685;ENST00000374680	D;D	0.93811	-3.29;-3.29	4.51	4.51	0.55191	.	1.821170	0.02948	N	0.141368	D	0.86151	0.5864	N	0.14661	0.345	0.80722	D	1	D;P;P;P	0.63880	0.993;0.938;0.938;0.938	B;B;B;B	0.44315	0.446;0.042;0.026;0.026	T	0.76495	-0.2938	10	0.87932	D	0	.	12.906	0.58152	0.0:0.0:1.0:0.0	.	13;13;53;13	B7Z6J2;B7Z6X3;Q59G65;P28702	.;.;.;RXRB_HUMAN	W	13	ENSP00000363817:R13W;ENSP00000363812:R13W	ENSP00000363812:R13W	R	-	1	2	RXRB	33276195	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.722000	0.54948	2.494000	0.84150	0.549000	0.68633	CGG			0.667	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076642.2		NM_021976	
CRIP3	401262	mdanderson.org	37	6	43274254	43274254	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr6:43274254G>T	ENST00000274990.4	-	5	334	c.330C>A	c.(328-330)agC>agA	p.S110R	CRIP3_ENST00000372569.3_Splice_Site_p.S110R|ZNF318_ENST00000607252.1_5'Flank			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	110					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TATGGGGAGGGCCTTTAAAGG	0.552																																					p.S110R													.	.			0			c.C330A												46.0	45.0	45.0					6																	43274254		2203	4300	6503	SO:0001630	splice_region_variant	401262	exon5			GGGAGGGCCTTTA	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.329-1C>A	6.37:g.43274254G>T			120	0	0		117	0.04	5	NM_206922	0		0	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	37		.	.	.	.	.	.	.	.	.	.	G	11.68	1.711692	0.30322	.	.	ENSG00000146215	ENST00000372569;ENST00000274990	T;T	0.72282	-0.29;-0.64	4.97	4.09	0.47781	.	1.257960	0.05711	N	0.595937	T	0.32704	0.0838	N	0.08118	0	0.28327	N	0.921977	B;B	0.06786	0.001;0.001	B;B	0.09377	0.001;0.004	T	0.15925	-1.0420	10	0.21540	T	0.41	.	13.6395	0.62241	0.0:0.1561:0.8439:0.0	.	110;110	Q6Q6R5;Q6Q6R5-3	CRIP3_HUMAN;.	R	110	ENSP00000361650:S110R;ENSP00000274990:S110R	ENSP00000274990:S110R	S	-	3	2	CRIP3	43382232	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.835000	0.48175	1.194000	0.43101	0.561000	0.74099	AGC			0.552	CRIP3-004	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000313968.1			Missense_Mutation
MMS22L	253714	mdanderson.org	37	6	97729152	97729152	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr6:97729152G>T	ENST00000275053.4	-	3	516	c.251C>A	c.(250-252)gCa>gAa	p.A84E	MMS22L_ENST00000369251.2_Missense_Mutation_p.A84E	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	84					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						ATTCACTAATGCTGTTTCAGT	0.318																																					p.A84E													.	.			0			c.C251A												120.0	123.0	122.0					6																	97729152		2203	4300	6503	SO:0001583	missense	253714	exon3			ACTAATGCTGTTT		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.251C>A	6.37:g.97729152G>T	ENSP00000275053:p.Ala84Glu		43	0	0		42	0.07	3	NM_198468	2	0.00	0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707977	0.89018	.	.	ENSG00000146263	ENST00000275053;ENST00000369251;ENST00000510018	T;T;T	0.36520	1.25;1.25;1.25	5.73	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.53061	0.1773	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.62393	-0.6864	10	0.87932	D	0	-4.9126	16.7007	0.85349	0.0:0.1298:0.8702:0.0	.	84;84	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	E	84;84;10	ENSP00000275053:A84E;ENSP00000358254:A84E;ENSP00000427288:A10E	ENSP00000275053:A84E	A	-	2	0	MMS22L	97835873	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	6.865000	0.75500	1.384000	0.46424	0.591000	0.81541	GCA			0.318	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041573.3		NM_198468	
TFR2	7036	mdanderson.org	37	7	100238346	100238346	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr7:100238346G>T	ENST00000462107.1	-	4	723	c.436C>A	c.(436-438)Cag>Aag	p.Q146K	TFR2_ENST00000223051.3_Missense_Mutation_p.Q146K|TFR2_ENST00000431692.1_Missense_Mutation_p.Q146K			Q9UP52	TFR2_HUMAN	transferrin receptor 2	146					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CCCAGGAACTGCAGGAACATG	0.607																																					p.Q146K													TFR2,NS,carcinoma,+2,1	TFR2	2	1	0			c.C436A												41.0	41.0	41.0					7																	100238346		2203	4300	6503	SO:0001583	missense	7036	exon3			GGAACTGCAGGAA	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.436C>A	7.37:g.100238346G>T	ENSP00000420525:p.Gln146Lys		45	0	0		48	0.06	3	NM_003227	0		0	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	ENST00000462107.1	37	CCDS34707.1	.	.	.	.	.	.	.	.	.	.	G	6.692	0.496233	0.12762	.	.	ENSG00000106327	ENST00000223051;ENST00000431692;ENST00000462107	T;T;T	0.47869	1.19;0.83;1.19	4.47	1.32	0.21799	.	0.317822	0.28914	N	0.013732	T	0.16514	0.0397	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	10	0.06757	T	0.87	-18.6018	9.7745	0.40609	0.0:0.0:0.4523:0.5477	.	146	Q9UP52	TFR2_HUMAN	K	146	ENSP00000223051:Q146K;ENSP00000413905:Q146K;ENSP00000420525:Q146K	ENSP00000223051:Q146K	Q	-	1	0	TFR2	100076282	0.968000	0.33430	0.781000	0.31783	0.694000	0.40290	1.501000	0.35693	0.583000	0.29574	0.313000	0.20887	CAG			0.607	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356392.3		NM_003227	
KCP	375616	broad.mit.edu	37	7	128548304	128548305	+	RNA	INS	-	-	A	rs370991615|rs370653893|rs10565205|rs55898241		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr7:128548304_128548305insA	ENST00000476647.2	-	0	263				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						aagaaagaaagaagaaagaaag	0.371																																					.													.	KCP	16		0			.																																											375616	.			AAGAAAGAAGAAA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128548306_128548306dupA			4	0	0		7	0.57	4	.	0		0	Q8NBE0	RNA	INS	ENST00000476647.2	37																																																																																						0.371	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
OR7E161P	389626	bcgsc.ca	37	8	11786991	11786991	+	IGR	SNP	T	T	C	rs79082977		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr8:11786991T>C								CTSB (61253 upstream) : DEFB136 (44454 downstream)																							TCTGGATCCTTTGAGAGTCCC	0.502																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	389626	.			GATCCTTTGAGAG																													8.37:g.11786991T>C			36	0.0277777778	1		30	0.17	5	.	0		0		RNA	SNP		37																																																																																					0	0.502										
PXDNL	137902	broad.mit.edu	37	8	52232504	52232504	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr8:52232504A>T	ENST00000356297.4	-	23	4439	c.4339T>A	c.(4339-4341)Tgt>Agt	p.C1447S	RP11-401H2.1_ENST00000521294.1_RNA|PXDNL_ENST00000543296.1_3'UTR	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1447	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CAAACTGGACAGCAGGTTCCT	0.512																																					p.C1447S													PXDNL_ENST00000356297,larynx,carcinoma,+1,1	PXDNL	414	1	0			c.T4339A												54.0	54.0	54.0					8																	52232504		1896	4106	6002	SO:0001583	missense	137902	exon23			CTGGACAGCAGGT		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4339T>A	8.37:g.52232504A>T	ENSP00000348645:p.Cys1447Ser		140	0	0		191	0.02	4	NM_144651	3	0.00	0	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	A	15.57	2.873773	0.51695	.	.	ENSG00000147485	ENST00000356297	D	0.92048	-2.96	4.51	3.35	0.38373	von Willebrand factor, type C (4);	.	.	.	.	D	0.96256	0.8779	H	0.94503	3.545	0.09310	N	0.999998	D	0.56521	0.976	D	0.65140	0.932	D	0.89472	0.3744	9	0.87932	D	0	.	6.7242	0.23346	0.8897:0.0:0.1103:0.0	.	1447	A1KZ92	PXDNL_HUMAN	S	1447	ENSP00000348645:C1447S	ENSP00000348645:C1447S	C	-	1	0	PXDNL	52395057	0.019000	0.18553	0.002000	0.10522	0.004000	0.04260	0.966000	0.29331	0.595000	0.29777	0.533000	0.62120	TGT			0.512	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377905.1		NM_144651	
SLC39A4	55630	mdanderson.org	37	8	145641504	145641504	+	Missense_Mutation	SNP	G	G	A	rs201917734	byFrequency	TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr8:145641504G>A	ENST00000276833.5	-	1	392	c.89C>T	c.(88-90)gCg>gTg	p.A30V	SLC39A4_ENST00000301305.3_Intron|SLC39A4_ENST00000531013.1_5'Flank	NM_001280557.1|NM_017767.2	NP_001267486.1|NP_060237	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	333					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GAGCAGGGGCGCTGGGCCCAC	0.692													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15442	0.0		0.0	False		,,,				2504	0.0				p.A30V													.	.			0			c.C89T							G	VAL/ALA,	9,4149		0,9,2070	14.0	21.0	19.0		89,	-7.1	0.0	8		19	0,8412		0,0,4206	yes	missense,intron	SLC39A4	NM_017767.2,NM_130849.2	64,	0,9,6276	AA,AG,GG		0.0,0.2165,0.0716	,	30/623,	145641504	9,12561	2079	4206	6285	SO:0001583	missense	55630	exon1			AGGGGCGCTGGGC	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000276833.5:c.89C>T	8.37:g.145641504G>A	ENSP00000276833:p.Ala30Val		17	0	0		23	0.09	2	NM_017767	6	0.00	0	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000276833.5	37	CCDS43782.1	.	.	.	.	.	.	.	.	.	.	G	7.595	0.671593	0.14776	0.002165	0.0	ENSG00000147804	ENST00000276833	T	0.59772	0.24	3.57	-7.14	0.01527	.	.	.	.	.	T	0.24392	0.0591	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34179	-0.9839	9	0.02654	T	1	.	1.4057	0.02280	0.2928:0.1269:0.3677:0.2126	.	30	A6NDY5	.	V	30	ENSP00000276833:A30V	ENSP00000276833:A30V	A	-	2	0	SLC39A4	145612312	0.000000	0.05858	0.000000	0.03702	0.313000	0.28021	-0.291000	0.08343	-2.366000	0.00606	-1.254000	0.01491	GCG			0.692	SLC39A4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000382687.2			
MLLT3	4300	mdanderson.org	37	9	20414370	20414370	+	Silent	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:20414370G>A	ENST00000380338.4	-	5	760	c.474C>T	c.(472-474)agC>agT	p.S158S	MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000429426.2_Silent_p.S155S	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	158	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctgctactgc	0.532			T	MLL	ALL																																p.S158S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	.			0			c.C474T												8.0	14.0	12.0					9																	20414370		1695	3515	5210	SO:0001819	synonymous_variant	4300	exon5			GCTGCTGCTGCTA	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.474C>T	9.37:g.20414370G>A			30	0	0		33	0.09	3	NM_004529	2	0.00	0	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																					0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000051872.1		NM_004529	
TLN1	7094	mdanderson.org	37	9	35711280	35711280	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:35711280G>T	ENST00000314888.9	-	30	4344	c.3991C>A	c.(3991-3993)Ctc>Atc	p.L1331I	TLN1_ENST00000540444.1_Missense_Mutation_p.L1331I	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1331	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGACTCTTGAGGTTAGGGGCA	0.572																																					p.L1331I													.	.			0			c.C3991A												53.0	50.0	51.0					9																	35711280		2203	4300	6503	SO:0001583	missense	7094	exon30			TCTTGAGGTTAGG	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.3991C>A	9.37:g.35711280G>T	ENSP00000316029:p.Leu1331Ile		71	0	0		53	0.06	3	NM_006289	18	0.00	0	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.603732	0.46423	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.29397	1.57;1.57	5.82	5.82	0.92795	Vinculin-binding site-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.31389	0.0795	L	0.43152	1.355	0.58432	D	0.999994	B	0.28258	0.205	B	0.35114	0.196	T	0.04320	-1.0960	10	0.22706	T	0.39	-11.2198	15.5604	0.76240	0.0:0.1372:0.8628:0.0	.	1331	Q9Y490	TLN1_HUMAN	I	1331	ENSP00000316029:L1331I;ENSP00000442981:L1331I	ENSP00000316029:L1331I	L	-	1	0	TLN1	35701280	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.212000	0.51145	2.756000	0.94617	0.561000	0.74099	CTC			0.572	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052353.2		NM_006289	
PTCH1	5727	broad.mit.edu;bcgsc.ca	37	9	98209504	98209524	+	In_Frame_Del	DEL	CGGGCCCCGCGAGGGCCCCAG	CGGGCCCCGCGAGGGCCCCAG	-	rs556901417|rs200100952|rs576944494|rs575146278		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	CGGGCCCCGCGAGGGCCCCAG	CGGGCCCCGCGAGGGCCCCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:98209504_98209524delCGGGCCCCGCGAGGGCCCCAG	ENST00000331920.6	-	23	4313_4333	c.4014_4034delCTGGGGCCCTCGCGGGGCCCG	c.(4012-4035)cgctggggccctcgcggggcccgt>cgt	p.1338_1345RWGPRGAR>R	PTCH1_ENST00000421141.1_In_Frame_Del_p.1187_1194RWGPRGAR>R|PTCH1_ENST00000418258.1_In_Frame_Del_p.1187_1194RWGPRGAR>R|PTCH1_ENST00000430669.2_In_Frame_Del_p.1272_1279RWGPRGAR>R|PTCH1_ENST00000429896.2_In_Frame_Del_p.1187_1194RWGPRGAR>R|PTCH1_ENST00000437951.1_In_Frame_Del_p.1272_1279RWGPRGAR>R|PTCH1_ENST00000375274.2_In_Frame_Del_p.1337_1344RWGPRGAR>R	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1338					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GTTGTGAGAACGGGCCCCGCGAGGGCCCCAGCGGGCCCTAT	0.643																																					p.1338_1345del													.	PTCH1	1850		0			c.4014_4034del																																									SO:0001651	inframe_deletion	5727	exon23			TGAGAACGGGCCC	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.4014_4034delCTGGGGCCCTCGCGGGGCCCG	9.37:g.98209504_98209524delCGGGCCCCGCGAGGGCCCCAG	ENSP00000332353:p.Arg1338_Ala1344del		72	0	0		58	0.24	14	NM_000264	8	0.00	0	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	In_Frame_Del	DEL	ENST00000331920.6	37	CCDS6714.1																																																																																					0.643	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053229.2		NM_000264	
GOLGA2	2801	hgsc.bcm.edu;bcgsc.ca	37	9	131020818	131020818	+	Missense_Mutation	SNP	A	A	C	rs572632320|rs199744363	byFrequency	TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:131020818A>C	ENST00000421699.2	-	21	2136	c.2124T>G	c.(2122-2124)gaT>gaG	p.D708E	GOLGA2_ENST00000609374.1_Missense_Mutation_p.D696E|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	708	Poly-Glu.				mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						cctcctcctcatcctcctcct	0.652													A|||	1033	0.20627	0.3707	0.1427	5008	,	,		9892	0.2083		0.0845	False		,,,				2504	0.1524				p.D708E													.	.			0			c.T2124G												30.0	11.0	17.0					9																	131020818		2129	4127	6256	SO:0001583	missense	2801	exon21			CTCCTCATCCTCC	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2124T>G	9.37:g.131020818A>C	ENSP00000416097:p.Asp708Glu		41	0	0		22	0.18	4	NM_004486	0		0	Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	ENST00000421699.2	37	CCDS6896.2	.	.	.	.	.	.	.	.	.	.	a	0.001	-4.226747	0.00001	.	.	ENSG00000167110	ENST00000421699	T	0.19250	2.16	0.418	-0.836	0.10770	.	1.458270	0.04855	N	0.443108	T	0.08044	0.0201	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32955	-0.9887	9	0.06099	T	0.92	.	.	.	.	.	708	Q08379	GOGA2_HUMAN	E	708	ENSP00000416097:D708E	ENSP00000416097:D708E	D	-	3	2	GOLGA2	130060639	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.632000	0.02024	-4.078000	0.00075	-4.219000	0.00009	GAT			0.652	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054358.2		NM_004486	
SPTAN1	6709	mdanderson.org	37	9	131344818	131344818	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:131344818G>T	ENST00000372731.4	+	13	1743	c.1633G>T	c.(1633-1635)Gcc>Tcc	p.A545S	SPTAN1_ENST00000358161.5_Missense_Mutation_p.A545S|SPTAN1_ENST00000372739.3_Missense_Mutation_p.A545S	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	545					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GGAAGATGTGGCCACTCGCCG	0.413																																					p.A545S	NSCLC(120;833 1744 2558 35612 37579)												.	.			0			c.G1633T												184.0	177.0	180.0					9																	131344818		2203	4300	6503	SO:0001583	missense	6709	exon13			GATGTGGCCACTC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1633G>T	9.37:g.131344818G>T	ENSP00000361816:p.Ala545Ser		59	0	0		40	0.08	3	NM_003127	4	0.00	0	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	37	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345913	0.82022	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.49139	0.79;0.79;0.79	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	L	0.58669	1.825	0.80722	D	1	B;D;P;B;B	0.63046	0.414;0.992;0.545;0.428;0.213	B;D;B;B;B	0.77004	0.224;0.989;0.36;0.25;0.262	T	0.60712	-0.7209	10	0.35671	T	0.21	.	19.0811	0.93182	0.0:0.0:1.0:0.0	.	545;545;545;545;545	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	S	545	ENSP00000350882:A545S;ENSP00000361816:A545S;ENSP00000361824:A545S	ENSP00000350882:A545S	A	+	1	0	SPTAN1	130384639	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.756000	0.94617	0.561000	0.74099	GCC			0.413	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054472.1		NM_003127	
ENTPD2	954	mdanderson.org	37	9	139943484	139943484	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:139943484T>C	ENST00000355097.2	-	8	1240	c.1193A>G	c.(1192-1194)tAc>tGc	p.Y398C	ENTPD2_ENST00000312665.5_Intron|ENTPD2_ENST00000460614.1_5'UTR|NPDC1_ENST00000488145.1_5'Flank|NPDC1_ENST00000371601.4_5'Flank	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	398					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CCCGGCGCAGTAGTCGGCCAG	0.711																																					p.Y398C													.	.			0			c.A1193G												3.0	3.0	3.0					9																	139943484		1798	3630	5428	SO:0001583	missense	954	exon8			GCGCAGTAGTCGG	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.1193A>G	9.37:g.139943484T>C	ENSP00000347213:p.Tyr398Cys		17	0	0		9	0.11	1	NM_203468	21	0.00	0	O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	ENST00000355097.2	37	CCDS7026.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098622	0.76870	.	.	ENSG00000054179	ENST00000355097	T	0.11930	2.73	3.57	3.57	0.40892	.	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	M	0.93978	3.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.57808	-0.7747	10	0.87932	D	0	-15.2433	11.3668	0.49677	0.0:0.0:0.0:1.0	.	398;398	Q9Y5L3;Q5SPY7	ENTP2_HUMAN;.	C	398	ENSP00000347213:Y398C	ENSP00000347213:Y398C	Y	-	2	0	ENTPD2	139063305	1.000000	0.71417	0.999000	0.59377	0.710000	0.40934	2.660000	0.46749	1.608000	0.50180	0.368000	0.22195	TAC			0.711	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055169.1		NM_203468	
ANAPC2	29882	mdanderson.org	37	9	140069899	140069899	+	Silent	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:140069899G>A	ENST00000323927.2	-	12	2050	c.2046C>T	c.(2044-2046)agC>agT	p.S682S	ANAPC2_ENST00000487917.1_5'UTR	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	682					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		TCACCGCCTTGCTCAGTTCCT	0.701																																					p.S682S													.	.			0			c.C2046T												16.0	14.0	15.0					9																	140069899		2180	4289	6469	SO:0001819	synonymous_variant	29882	exon12			CGCCTTGCTCAGT	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.2046C>T	9.37:g.140069899G>A			37	0	0		36	0.08	3	NM_013366	123	0.00	0	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Silent	SNP	ENST00000323927.2	37	CCDS7033.1																																																																																					0.701	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055315.1		NM_013366	
NELFB	25920	mdanderson.org	37	9	140151299	140151299	+	Silent	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr9:140151299G>T	ENST00000343053.4	+	4	727	c.390G>T	c.(388-390)ctG>ctT	p.L130L		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	130					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AACTGAAGCTGGTTATGGCTG	0.582																																					p.L130L													.	.			0			c.G390T												74.0	66.0	69.0					9																	140151299		2203	4300	6503	SO:0001819	synonymous_variant	25920	exon4			GAAGCTGGTTATG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.390G>T	9.37:g.140151299G>T			65	0	0		48	0.06	3	NM_015456	76	0.00	0	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Silent	SNP	ENST00000343053.4	37	CCDS7040.1																																																																																					0.582	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254710.1		NM_015456	
PPP1R3F	89801	mdanderson.org	37	X	49142704	49142704	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chrX:49142704G>T	ENST00000055335.6	+	4	1568	c.1552G>T	c.(1552-1554)Gga>Tga	p.G518*	PPP1R3F_ENST00000376188.1_Nonsense_Mutation_p.G172*|PPP1R3F_ENST00000495799.1_Nonsense_Mutation_p.G172*|PPP1R3F_ENST00000438316.1_Nonsense_Mutation_p.G189*|PPP1R3F_ENST00000466508.1_Nonsense_Mutation_p.G172*	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	518					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					CTCCACAGATGGAGGGATGTC	0.682																																					p.G518X													.	.			0			c.G1552T												17.0	15.0	16.0					X																	49142704		2199	4286	6485	SO:0001587	stop_gained	89801	exon4			ACAGATGGAGGGA		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1552G>T	X.37:g.49142704G>T	ENSP00000055335:p.Gly518*		35	0	0		50	0.06	3	NM_033215	2	0.00	0	A2VDJ8|B3KPW2|E9PCM3	Nonsense_Mutation	SNP	ENST00000055335.6	37	CCDS35254.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087480	0.76642	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	.	.	.	4.48	3.53	0.40419	.	0.272678	0.26836	N	0.022260	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-9.1056	7.9628	0.30081	0.0:0.0:0.7565:0.2435	.	.	.	.	X	172;189;518;172;172	.	ENSP00000055335:G518X	G	+	1	0	PPP1R3F	49029648	1.000000	0.71417	0.927000	0.36925	0.192000	0.23643	1.474000	0.35398	2.177000	0.69029	0.429000	0.28392	GGA			0.682	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000060819.2		NM_033215	
NXF4	55999	hgsc.bcm.edu	37	X	101819124	101819124	+	RNA	SNP	G	G	C			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chrX:101819124G>C	ENST00000360035.2	+	0	1258					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						tctctctcctgtctctctgtc	0.557													c|||	93	0.0246358	0.0401	0.013	3775	,	,		13457	0.0159		0.005	False		,,,				2504	0.0102				.													.	.			0			.																																											55999	.			TCTCCTGTCTCTC	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101819124G>C			104	0	0		123	0.05	6	.	0		0		RNA	SNP	ENST00000360035.2	37																																																																																						0.557	NXF4-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000095720.1			
FRMPD3	84443	bcgsc.ca	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582																																					.													.	.			0			.												3.0	2.0	2.0					X																	106846480		690	1560	2250	SO:0001819	synonymous_variant	84443	.			ACAACAGCAGCAG	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A			125	0	0		176	0.06	11	.	0		0	Q96JK8	Silent	SNP	ENST00000276185.4	37																																																																																						0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_042978	
SLC6A8	6535	broad.mit.edu	37	X	152960296	152960296	+	Silent	SNP	G	G	A	rs2314070		TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chrX:152960296G>A	ENST00000253122.5	+	12	2195	c.1719G>A	c.(1717-1719)ccG>ccA	p.P573P	SLC6A8_ENST00000430077.2_Silent_p.P458P|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	573					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	TGTGCGTGCCGCTGCACCTCC	0.662													G|||	1	0.000264901	0.0	0.0014	3775	,	,		7384	0.0		0.0	False		,,,				2504	0.0				p.P573P													.	SLC6A8	34		0			c.G1719A												29.0	25.0	26.0					X																	152960296		2202	4298	6500	SO:0001819	synonymous_variant	6535	exon12			CGTGCCGCTGCAC		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1719G>A	X.37:g.152960296G>A			46	0	0		57	0.05	3	NM_005629	43	0.09	4	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Silent	SNP	ENST00000253122.5	37	CCDS14726.1																																																																																					0.662	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061003.1			
TXNRD2	10587	mdanderson.org	37	22	19885586	19885586	+	Silent	SNP	G	G	A			TCGA-2G-AALG-01A-11D-A42Y-10	TCGA-2G-AALG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f29b7c0c-30ed-4d15-9ee2-148852f3e573	6f3fee73-6a59-47ea-891c-e9946680a400	g.chr22:19885586G>A	ENST00000400521.1	-	10	756	c.750C>T	c.(748-750)agC>agT	p.S250S	TXNRD2_ENST00000542719.1_Silent_p.S220S|TXNRD2_ENST00000535882.1_Silent_p.S249S|TXNRD2_ENST00000334363.9_Silent_p.S250S|TXNRD2_ENST00000400518.1_Silent_p.S220S|TXNRD2_ENST00000400519.1_Silent_p.S249S|TXNRD2_ENST00000491939.1_5'UTR	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	250					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					GGAGGGGGATGCTGCGCATCA	0.657																																					.													.	.			0			.												26.0	31.0	29.0					22																	19885586		2071	4168	6239	SO:0001819	synonymous_variant	10587	.			GGGGATGCTGCGC	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.750C>T	22.37:g.19885586G>A			54	0	0		47	0.06	3	.	45	0.00	0	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	ENST00000400521.1	37	CCDS42981.1																																																																																					0.657	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000314903.3		NM_006440	
