#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SLC45A1	50651	mdanderson.org	37	1	8385880	8385880	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr1:8385880G>T	ENST00000471889.1	+	4	878	c.493G>T	c.(493-495)Gca>Tca	p.A165S	SLC45A1_ENST00000377479.2_Missense_Mutation_p.A199S|Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000289877.8_Missense_Mutation_p.A165S			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	165					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GTGTCCAGGGGCACTGCTGGG	0.567																																					p.A165S													.	.			0			c.G493T												67.0	64.0	65.0					1																	8385880		2203	4300	6503	SO:0001583	missense	50651	exon3			CCAGGGGCACTGC	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.493G>T	1.37:g.8385880G>T	ENSP00000418096:p.Ala165Ser		28	0	0		23	0.13	3	NM_001080397	0		0	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744830	0.69418	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.92858	-3.12;-3.12;-3.12	5.52	5.52	0.82312	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.93973	0.8070	L	0.39020	1.185	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.94236	0.7481	10	0.56958	D	0.05	-28.3991	18.4623	0.90743	0.0:0.0:1.0:0.0	.	165	Q9Y2W3	S45A1_HUMAN	S	165;199;165	ENSP00000418096:A165S;ENSP00000366699:A199S;ENSP00000289877:A165S	ENSP00000289877:A165S	A	+	1	0	SLC45A1	8308467	1.000000	0.71417	0.998000	0.56505	0.584000	0.36387	7.756000	0.85195	2.595000	0.87683	0.655000	0.94253	GCA			0.567	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001245.5			
SEC22B	9554	broad.mit.edu	37	1	145109284	145109292	+	RNA	DEL	AAAAAAAAA	AAAAAAAAA	-	rs373765269		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	AAAAAAAAA	AAAAAAAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr1:145109284_145109292delAAAAAAAAA	ENST00000453618.1	+	0	512							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											actccgtctcaaaaaaaaagaaaaaaaaa	0.435																																					.													.	.			0			.																																											9554	.			CGTCTCAAAAAAA	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109284_145109292delAAAAAAAAA			6	0	0		10	0.30	3	.	0		0	A8K1G0	RNA	DEL	ENST00000453618.1	37																																																																																						0.435	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
MUC1	4582	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	155161884	155161884	+	Silent	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr1:155161884G>T	ENST00000368395.1	-	2	320	c.249C>A	c.(247-249)gcC>gcA	p.A83A	MUC1_ENST00000438413.1_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000338684.5_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000368398.3_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000368390.3_Intron|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000457295.2_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	863					cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGGTTCCGTGGCCGGGGCCA	0.647			T	IGH@	B-NHL																																p.A92A				Dom	yes		1	1q21	4582	"""mucin 1, transmembrane"""		L	.	.			0			c.C276A																																									SO:0001819	synonymous_variant	4582	exon2			TTCCGTGGCCGGG	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.249C>A	1.37:g.155161884G>T			68	0	0		121	0.04	5	NM_001204286	6	0.00	0	A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Silent	SNP	ENST00000368395.1	37	CCDS55640.1																																																																																					0.647	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000086735.1		NM_002456	
CALML3	810	mdanderson.org	37	10	5567450	5567450	+	Silent	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr10:5567450C>T	ENST00000315238.1	+	1	527	c.402C>T	c.(400-402)gaC>gaT	p.D134D	CALML3-AS1_ENST00000542093.1_RNA|CALML3-AS1_ENST00000543008.1_RNA|CALML3-AS1_ENST00000545372.1_RNA|RP11-116G8.5_ENST00000442008.2_RNA	NM_005185.2	NP_005176.1	P27482	CALL3_HUMAN	calmodulin-like 3	134	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			endometrium(3)|lung(2)	5						CGGACGGAGACGGACAGGTGA	0.672																																					p.D134D	Colon(173;2070 2647 27580 52203)												.	.			0			c.C402T												63.0	58.0	59.0					10																	5567450		2203	4300	6503	SO:0001819	synonymous_variant	810	exon1			CGGAGACGGACAG	X13461	CCDS7069.1	10p15.1	2013-01-10			ENSG00000178363	ENSG00000178363		"""EF-hand domain containing"""	1452	protein-coding gene	gene with protein product		114184				8476923	Standard	NM_005185		Approved	CLP	uc001iie.1	P27482	OTTHUMG00000017597	ENST00000315238.1:c.402C>T	10.37:g.5567450C>T			39	0	0		47	0.06	3	NM_005185	1	0.00	0	B2R9V6|Q5SQI4	Silent	SNP	ENST00000315238.1	37	CCDS7069.1																																																																																					0.672	CALML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046555.1		NM_005185	
CSGALNACT2	55454	broad.mit.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F													CSGALNACT2,NS,carcinoma,0,5	CSGALNACT2	67	5	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T												223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe		113	0.017699115	2		110	0.04	4	NM_018590	11	0.00	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG			0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047693.1		NM_018590	
GDF10	2662	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	48429456	48429456	+	Missense_Mutation	SNP	G	G	C	rs139712067		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr10:48429456G>C	ENST00000224605.2	-	2	695	c.430C>G	c.(430-432)Cga>Gga	p.R144G		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	144					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						TCGAGCGCTCGAGGCCACCGA	0.627																																					p.R144G													.	.			0			c.C430G																																									SO:0001583	missense	2662	exon2			GCGCTCGAGGCCA	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.430C>G	10.37:g.48429456G>C	ENSP00000224605:p.Arg144Gly		68	0	0		69	0.32	22	NM_004962	2	0.00	0	Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	37	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	G	6.717	0.500965	0.12822	.	.	ENSG00000107623	ENST00000224605	T	0.75260	-0.92	5.59	2.52	0.30459	.	0.519649	0.22337	N	0.061388	T	0.66567	0.2802	L	0.47716	1.5	0.35940	D	0.833168	P	0.38565	0.637	B	0.41946	0.371	T	0.64769	-0.6329	9	.	.	.	.	7.3745	0.26821	0.0786:0.0:0.4688:0.4526	.	144	P55107	BMP3B_HUMAN	G	144	ENSP00000224605:R144G	.	R	-	1	2	GDF10	48049462	0.992000	0.36948	0.291000	0.24904	0.025000	0.11179	2.305000	0.43664	0.226000	0.20979	-0.410000	0.06199	CGA			0.627	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047884.1		NM_004962	
SLC18A3	6572	broad.mit.edu	37	10	50819027	50819027	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr10:50819027A>C	ENST00000374115.3	+	1	681	c.241A>C	c.(241-243)Acc>Ccc	p.T81P	CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000339797.1_Intron	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	81					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)	p.T81P(1)		endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						GTGGGAGCCCACCCTGCCGCT	0.716																																					p.T81P													SLC18A3,NS,carcinoma,0,1	SLC18A3	100	1	1	Substitution - Missense(1)	endometrium(1)	c.A241C																																									SO:0001583	missense	6572	exon1			GAGCCCACCCTGC	BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.241A>C	10.37:g.50819027A>C	ENSP00000363229:p.Thr81Pro		88	0.0340909091	3		94	0.13	12	NM_003055	0		0	B2R7S1	Missense_Mutation	SNP	ENST00000374115.3	37	CCDS7231.1	.	.	.	.	.	.	.	.	.	.	A	9.348	1.064675	0.20067	.	.	ENSG00000187714	ENST00000374115	T	0.05199	3.48	3.99	3.99	0.46301	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.817059	0.10837	U	0.628629	T	0.04588	0.0125	N	0.13198	0.31	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31052	-0.9957	10	0.45353	T	0.12	-10.6943	8.4532	0.32884	0.7277:0.2723:0.0:0.0	.	81	Q16572	VACHT_HUMAN	P	81	ENSP00000363229:T81P	ENSP00000363229:T81P	T	+	1	0	SLC18A3	50489033	0.957000	0.32711	0.706000	0.30403	0.966000	0.64601	3.957000	0.56730	1.809000	0.52856	0.459000	0.35465	ACC			0.716	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047995.1		NM_003055	
DHX32	55760	mdanderson.org	37	10	127526784	127526784	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr10:127526784G>T	ENST00000284690.3	-	10	2544	c.2054C>A	c.(2053-2055)tCt>tAt	p.S685Y	BCCIP_ENST00000429863.2_Intron|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000368721.1_Missense_Mutation_p.S309Y|BCCIP_ENST00000299130.3_Intron|DHX32_ENST00000284688.6_Missense_Mutation_p.S604Y	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	685						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CAGTTCAGGAGAGATTTCTGA	0.358																																					p.S685Y													.	.			0			c.C2054A												94.0	94.0	94.0					10																	127526784		2203	4300	6503	SO:0001583	missense	55760	exon10			TCAGGAGAGATTT		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.2054C>A	10.37:g.127526784G>T	ENSP00000284690:p.Ser685Tyr		45	0	0		37	0.08	3	NM_018180	63	0.00	0	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	ENST00000284690.3	37	CCDS7652.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766095	0.69878	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	T;T;T	0.18657	2.2;3.98;3.69	5.09	5.09	0.68999	Domain of unknown function DUF1605 (1);	0.133662	0.52532	D	0.000070	T	0.44540	0.1298	M	0.71581	2.175	0.58432	D	0.999999	D	0.56287	0.975	P	0.60886	0.88	T	0.44651	-0.9314	10	0.87932	D	0	-15.9037	17.5018	0.87734	0.0:0.0:1.0:0.0	.	685	Q7L7V1	DHX32_HUMAN	Y	309;685;604	ENSP00000357710:S309Y;ENSP00000284690:S685Y;ENSP00000284688:S604Y	ENSP00000284688:S604Y	S	-	2	0	DHX32	127516774	1.000000	0.71417	0.835000	0.33067	0.561000	0.35649	6.155000	0.71833	2.363000	0.80096	0.561000	0.74099	TCT			0.358	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050945.2		NM_018180	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651442	1651442	+	Silent	SNP	G	G	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:1651442G>C	ENST00000399676.2	+	1	410	c.372G>C	c.(370-372)ggG>ggC	p.G124G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	124	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G124G(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCTGTGGGGGGTCCAAGGGGG	0.692																																					p.G124G													KRTAP5-5,bladder,carcinoma,0,4	KRTAP5-5	0	4	2	Substitution - coding silent(2)	prostate(2)	c.G372C																																									SO:0001819	synonymous_variant	439915	exon1			TGGGGGGTCCAAG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.372G>C	11.37:g.1651442G>C			37	0.0540540541	2		47	0.13	6	NM_001001480	0		0	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																					0.692	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127919.1			
RTN4RL2	349667	mdanderson.org	37	11	57243909	57243909	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:57243909G>T	ENST00000335099.3	+	3	1105	c.788G>T	c.(787-789)tGg>tTg	p.W263L	RP11-624G17.3_ENST00000528885.1_RNA	NM_178570.1	NP_848665.1			reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						GCTAACCCCTGGGCGTGCGAC	0.731																																					p.W263L													.	.			0			c.G788T												6.0	7.0	7.0					11																	57243909		2074	4152	6226	SO:0001583	missense	349667	exon3			ACCCCTGGGCGTG	BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000335099.3:c.788G>T	11.37:g.57243909G>T	ENSP00000335397:p.Trp263Leu		12	0	0		10	0.20	2	NM_178570	0		0		Missense_Mutation	SNP	ENST00000335099.3	37	CCDS7957.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.103860	0.76983	.	.	ENSG00000186907	ENST00000335099	T	0.01584	4.75	4.43	4.43	0.53597	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.37095	U	0.002245	T	0.05227	0.0139	M	0.66939	2.045	0.80722	D	1	D	0.61080	0.989	P	0.48524	0.58	T	0.31166	-0.9953	10	0.87932	D	0	.	16.6163	0.84917	0.0:0.0:1.0:0.0	.	263	Q86UN3	R4RL2_HUMAN	L	263	ENSP00000335397:W263L	ENSP00000335397:W263L	W	+	2	0	RTN4RL2	57000485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.411000	0.97342	1.991000	0.58162	0.491000	0.48974	TGG			0.731	RTN4RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392537.1		NM_178570	
MARK2	2011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63662685	63662685	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:63662685G>A	ENST00000509502.2	+	2	473	c.10G>A	c.(10-12)Ggc>Agc	p.G4S	MARK2_ENST00000315032.8_Missense_Mutation_p.G37S|MARK2_ENST00000425897.2_Missense_Mutation_p.G4S|MARK2_ENST00000413835.2_Missense_Mutation_p.G37S|MARK2_ENST00000513765.2_Missense_Mutation_p.G4S|MARK2_ENST00000508192.1_Missense_Mutation_p.G37S|MARK2_ENST00000408948.3_Missense_Mutation_p.G4S|MARK2_ENST00000377810.3_Missense_Mutation_p.G4S|MARK2_ENST00000350490.7_Missense_Mutation_p.G37S|MARK2_ENST00000502399.3_Missense_Mutation_p.G37S|MARK2_ENST00000377809.4_Missense_Mutation_p.G37S|MARK2_ENST00000402010.2_Missense_Mutation_p.G37S|MARK2_ENST00000361128.5_Missense_Mutation_p.G37S	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						CATGATTCGGGGCCGCAACTC	0.547																																					p.G37S													.	.			0			c.G109A												49.0	47.0	48.0					11																	63662685		2201	4298	6499	SO:0001583	missense	2011	exon2			ATTCGGGGCCGCA	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.10G>A	11.37:g.63662685G>A	ENSP00000423974:p.Gly4Ser		79	0	0		93	0.17	16	NM_001163296	4	0.50	2		Missense_Mutation	SNP	ENST00000509502.2	37	CCDS41665.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449191	0.63178	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000508025;ENST00000502399;ENST00000543220;ENST00000543674;ENST00000540169;ENST00000509502;ENST00000512060;ENST00000535394;ENST00000513765;ENST00000408948;ENST00000425897	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70399	-0.47;-0.47;-0.48;-0.47;-0.45;-0.47;-0.46;-0.46;-0.26;0.09;-0.46;-0.44;-0.45;-0.46	6.07	6.07	0.98685	.	0.165435	0.53938	D	0.000053	T	0.55178	0.1904	N	0.01168	-0.975	0.40286	D	0.978458	B;D;B;B;B;B;B	0.61697	0.0;0.99;0.001;0.0;0.288;0.0;0.0	B;P;B;B;B;B;B	0.59546	0.001;0.859;0.002;0.001;0.081;0.002;0.002	T	0.59648	-0.7415	10	0.08599	T	0.76	.	14.2756	0.66177	0.0:0.0:0.8511:0.1489	.	4;57;4;37;37;37;37	E7ETY4;Q5DNC5;Q7KZI7-14;Q7KZI7-15;Q7KZI7-5;Q7KZI7;Q7KZI7-16	.;.;.;.;.;MARK2_HUMAN;.	S	37;37;37;37;4;37;37;37;37;37;4;71;4;4;57;57;4;4;4	ENSP00000385751:G37S;ENSP00000326632:G37S;ENSP00000367040:G37S;ENSP00000389184:G37S;ENSP00000367041:G4S;ENSP00000425765:G37S;ENSP00000355091:G37S;ENSP00000294247:G37S;ENSP00000444956:G4S;ENSP00000437509:G4S;ENSP00000423974:G4S;ENSP00000421075:G4S;ENSP00000386128:G4S;ENSP00000415494:G4S	ENSP00000326632:G37S	G	+	1	0	MARK2	63419261	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.031000	0.49728	2.884000	0.98904	0.655000	0.94253	GGC			0.547	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000360862.2		NM_017490	
ATG2A	23130	mdanderson.org	37	11	64684506	64684506	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:64684506G>T	ENST00000377264.3	-	1	214	c.102C>A	c.(100-102)agC>agA	p.S34R	ATG2A_ENST00000421419.2_Missense_Mutation_p.S34R	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	34					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GCTGGTCCAGGCTGAGGTGCT	0.582																																					p.S34R													.	.			0			c.C102A												91.0	75.0	80.0					11																	64684506		2201	4297	6498	SO:0001583	missense	23130	exon1			GTCCAGGCTGAGG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.102C>A	11.37:g.64684506G>T	ENSP00000366475:p.Ser34Arg		40	0	0		46	0.07	3	NM_015104	0		0	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	ENST00000377264.3	37	CCDS31602.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.124639|4.124639	0.77436|0.77436	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000377262|ENST00000421419;ENST00000377264;ENST00000227459	.|T;T	.|0.72051	.|-0.62;-0.62	4.95|4.95	3.07|3.07	0.35406|0.35406	.|.	.|0.047620	.|0.85682	.|D	.|0.000000	T|T	0.74458|0.74458	0.3719|0.3719	L|L	0.39397|0.39397	1.21|1.21	0.49299|0.49299	D|D	0.999777|0.999777	.|D	.|0.76494	.|0.999	.|D	.|0.75020	.|0.985	T|T	0.71803|0.71803	-0.4482|-0.4482	6|10	0.87932|0.42905	D|T	0|0.14	.|.	9.7138|9.7138	0.40263|0.40263	0.1748:0.0:0.8252:0.0|0.1748:0.0:0.8252:0.0	.|.	.|34	.|Q2TAZ0	.|ATG2A_HUMAN	T|R	32|34	.|ENSP00000410522:S34R;ENSP00000366475:S34R	ENSP00000366473:P32T|ENSP00000227459:S34R	P|S	-|-	1|3	0|2	ATG2A|ATG2A	64441082|64441082	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.055000|2.055000	0.41345|0.41345	0.758000|0.758000	0.33059|0.33059	0.561000|0.561000	0.74099|0.74099	CCT|AGC			0.582	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000143224.1		NM_015104	
SART1	9092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65733919	65733919	+	Silent	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:65733919G>A	ENST00000312397.5	+	9	1172	c.1080G>A	c.(1078-1080)ctG>ctA	p.L360L		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	360					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTGATGGCCTGCGGGAGCGGG	0.647																																					p.L360L													.	.			0			c.G1080A												31.0	31.0	31.0					11																	65733919		2201	4296	6497	SO:0001819	synonymous_variant	9092	exon9			TGGCCTGCGGGAG	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.1080G>A	11.37:g.65733919G>A			50	0	0		82	0.44	36	NM_005146	163	0.39	64	A6NDN1|Q53GB5	Silent	SNP	ENST00000312397.5	37	CCDS31611.1																																																																																					0.647	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391409.1			
PPP6R3	55291	mdanderson.org	37	11	68377455	68377455	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:68377455C>T	ENST00000393800.2	+	23	2788	c.2534C>T	c.(2533-2535)gCg>gTg	p.A845V	PPP6R3_ENST00000265637.4_Missense_Mutation_p.A799V|PPP6R3_ENST00000393799.2_Missense_Mutation_p.A851V|PPP6R3_ENST00000524904.1_Missense_Mutation_p.A839V|PPP6R3_ENST00000534534.1_Missense_Mutation_p.A613V|PPP6R3_ENST00000529710.1_Missense_Mutation_p.A765V|PPP6R3_ENST00000524845.1_Missense_Mutation_p.A816V|PPP6R3_ENST00000265636.5_Missense_Mutation_p.A765V|PPP6R3_ENST00000527403.2_Missense_Mutation_p.A810V|PPP6R3_ENST00000393801.3_Missense_Mutation_p.A851V	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	845					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						GCGAAGTGCGCGGCGCCCAGG	0.607																																					p.A851V													PPP6R3_ENST00000393801,rectum,carcinoma,+1,2	PPP6R3_ENST00000393801	1	2	0			c.C2552T												75.0	69.0	71.0					11																	68377455		2200	4294	6494	SO:0001583	missense	55291	exon24			AGTGCGCGGCGCC	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.2534C>T	11.37:g.68377455C>T	ENSP00000377389:p.Ala845Val		38	0	0		20	0.10	2	NM_001164160	40	0.00	0	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	37	CCDS53672.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.842|9.842	1.191376|1.191376	0.21954|0.21954	.|.	.|.	ENSG00000110075|ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190|ENST00000530734	T;T;T;T;T;T;T;T;T;T;T|.	0.46451|.	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87|.	5.2|5.2	-1.78|-1.78	0.07957|0.07957	.|.	1.693780|.	0.03025|.	N|.	0.151328|.	T|T	0.17874|0.17874	0.0429|0.0429	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B|.	0.06786|.	0.0;0.0;0.001;0.0;0.001;0.0;0.001;0.001|.	B;B;B;B;B;B;B;B|.	0.04013|.	0.0;0.0;0.001;0.001;0.001;0.0;0.001;0.001|.	T|T	0.29119|0.29119	-1.0022|-1.0022	10|5	0.19590|.	T|.	0.45|.	.|.	11.0736|11.0736	0.48019|0.48019	0.0:0.4968:0.0:0.5032|0.0:0.4968:0.0:0.5032	.|.	528;613;765;816;839;845;851;765|.	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4|.	.;.;.;.;.;PP6R3_HUMAN;.;.|.	V|W	851;845;613;816;799;839;851;765;765;810;552|13	ENSP00000377388:A851V;ENSP00000377389:A845V;ENSP00000434429:A613V;ENSP00000431415:A816V;ENSP00000265637:A799V;ENSP00000433058:A839V;ENSP00000377390:A851V;ENSP00000265636:A765V;ENSP00000437329:A765V;ENSP00000433565:A810V;ENSP00000436209:A552V|.	ENSP00000265636:A765V|.	A|R	+|+	2|1	0|2	PPP6R3|PPP6R3	68134031|68134031	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.342000|0.342000	0.19926|0.19926	-0.735000|-0.735000	0.04837|0.04837	-0.367000|-0.367000	0.07326|0.07326	GCG|CGG			0.607	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395275.1		NM_018312	
TRPC6	7225	mdanderson.org	37	11	101454180	101454180	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:101454180C>T	ENST00000344327.3	-	1	479	c.55G>A	c.(55-57)Gcc>Acc	p.A19T	TRPC6_ENST00000348423.4_Missense_Mutation_p.A19T|TRPC6_ENST00000532133.1_Missense_Mutation_p.A19T|TRPC6_ENST00000360497.4_Missense_Mutation_p.A19T|RP11-748H22.1_ENST00000527374.1_RNA|TRPC6_ENST00000526713.1_Intron	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	19					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GCGGCTCCGGCAGCGCCCCGG	0.741																																					p.A19T	Colon(166;1315 1927 11094 12848 34731)												.	.			0			c.G55A												8.0	9.0	8.0					11																	101454180		2113	4104	6217	SO:0001583	missense	7225	exon1			CTCCGGCAGCGCC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.55G>A	11.37:g.101454180C>T	ENSP00000340913:p.Ala19Thr		19	0	0		20	0.10	2	NM_004621	0		0	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.545035	0.00934	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.79749	-1.14;-1.21;-1.03;-1.3	3.65	0.526	0.17078	.	0.935497	0.08871	N	0.881580	T	0.60470	0.2271	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43180	-0.9407	10	0.23302	T	0.38	-10.2795	3.4199	0.07389	0.0:0.5065:0.2334:0.2601	.	19;19;19	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	T	19	ENSP00000340913:A19T;ENSP00000435574:A19T;ENSP00000343672:A19T;ENSP00000353687:A19T	ENSP00000340913:A19T	A	-	1	0	TRPC6	100959390	0.000000	0.05858	0.024000	0.17045	0.001000	0.01503	-0.178000	0.09782	0.271000	0.22005	0.462000	0.41574	GCC			0.741	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394770.1		NM_004621	
COLCA1	399948	mdanderson.org	37	11	111167557	111167557	+	De_novo_Start_InFrame	SNP	A	A	T	rs6589218	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr11:111167557A>T	ENST00000532918.1	-	0	2052				COLCA2_ENST00000526216.1_5'Flank|COLCA2_ENST00000398035.2_5'Flank|COLCA1_ENST00000355430.4_De_novo_Start_InFrame|COLCA1_ENST00000540738.1_5'Flank|COLCA1_ENST00000526150.1_5'Flank			Q6ZS62	COLC1_HUMAN	colorectal cancer associated 1							integral component of membrane (GO:0016021)|membrane (GO:0016020)											AGAGGGGGCAAGGCCTAGGCA	0.557																																					.													.	.			0			.																																											399948	.			GGGGCAAGGCCTA	AK127703		11q23.1	2013-08-22	2013-08-22	2013-08-22	ENSG00000196167	ENSG00000196167			33789	other	unknown	"""cancer susceptibility candidate 12"""	615693	"""chromosome 11 open reading frame 92"""	C11orf92			Standard	NR_034154		Approved	FLJ45803, CASC12	uc001pld.3	Q6ZS62	OTTHUMG00000166658		11.37:g.111167557A>T			126	0	0		104	0.03	3	.	0		0		RNA	SNP	ENST00000532918.1	37																																																																																						0.557	COLCA1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000390999.1			
FOXM1	2305	broad.mit.edu	37	12	2968305	2968305	+	Silent	SNP	A	A	G			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:2968305A>G	ENST00000359843.3	-	9	1859	c.1791T>C	c.(1789-1791)ccT>ccC	p.P597P	FOXM1_ENST00000342628.2_Silent_p.P635P|AC005841.1_ENST00000382678.3_5'Flank|Y_RNA_ENST00000410561.1_RNA|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000361953.3_Silent_p.P582P	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	597					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GTGTCTTAAAAGGTCCTCCCA	0.622																																					p.P635P													.	FOXM1	62		0			c.T1905C												54.0	62.0	59.0					12																	2968305		2194	4292	6486	SO:0001819	synonymous_variant	2305	exon10			CTTAAAAGGTCCT	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1791T>C	12.37:g.2968305A>G			16	0	0		89	0.03	3	NM_202002	281	0.01	3	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	ENST00000359843.3	37	CCDS8515.1																																																																																					0.622	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000398272.1		NM_021953	
KLRC3	3823	broad.mit.edu	37	12	10568291	10568291	+	Intron	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:10568291G>T	ENST00000396439.2	-	6	723				KLRC3_ENST00000381904.2_Intron|KLRC3_ENST00000381903.2_Missense_Mutation_p.S230R|NKG2-E_ENST00000539033.1_Intron	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3						cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						TAATTCTAAAGCTTATGCTCA	0.343																																					p.S230R													.	KLRC3	25		0			c.C690A												103.0	89.0	94.0					12																	10568291		2203	4300	6503	SO:0001627	intron_variant	3823	exon6			TCTAAAGCTTATG	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.678+11C>A	12.37:g.10568291G>T			106	0.0188679245	2		336	0.02	8	NM_007333	0		0	Q8WXA4|Q96RL0|Q9UP04	Missense_Mutation	SNP	ENST00000396439.2	37	CCDS41755.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.706406	0.30232	.	.	ENSG00000205810	ENST00000381903	T	0.01685	4.69	2.48	-0.808	0.10868	.	.	.	.	.	T	0.01353	0.0044	.	.	.	0.09310	N	1	B	0.26041	0.14	B	0.28849	0.095	T	0.48636	-0.9018	8	0.29301	T	0.29	.	3.1664	0.06538	0.1512:0.0:0.429:0.4198	.	230	Q07444-2	.	R	230	ENSP00000371328:S230R	ENSP00000371328:S230R	S	-	3	2	KLRC3	10459558	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.715000	0.04997	-0.198000	0.10333	0.557000	0.71058	AGC			0.343	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000393471.1		NM_002261	
KLRC3	3823	broad.mit.edu	37	12	10569302	10569302	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:10569302G>T	ENST00000396439.2	-	5	595	c.551C>A	c.(550-552)cCa>cAa	p.P184Q	KLRC3_ENST00000381904.2_Missense_Mutation_p.P184Q|KLRC3_ENST00000381903.2_Missense_Mutation_p.P184Q|NKG2-E_ENST00000539033.1_Missense_Mutation_p.P184Q	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3	184	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						TGTCACCCATGGATGATGACT	0.299																																					p.P184Q													.	KLRC3	25		0			c.C551A												65.0	64.0	64.0					12																	10569302		2203	4300	6503	SO:0001583	missense	3823	exon5			ACCCATGGATGAT	L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.551C>A	12.37:g.10569302G>T	ENSP00000379716:p.Pro184Gln		333	0	0		1156	0.01	11	NM_007333	0		0	Q8WXA4|Q96RL0|Q9UP04	Missense_Mutation	SNP	ENST00000396439.2	37	CCDS41755.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045405	0.36085	.	.	ENSG00000255641;ENSG00000205810;ENSG00000205810;ENSG00000205810	ENST00000539033;ENST00000396439;ENST00000381904;ENST00000381903	T;T;T;T	0.06449	3.3;3.3;3.3;3.3	2.96	2.01	0.26516	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.950064	0.08605	N	0.920870	T	0.21718	0.0523	M	0.76574	2.34	0.09310	N	1	D;D;D	0.89917	0.962;0.999;1.0	P;D;D	0.91635	0.739;0.984;0.999	T	0.09100	-1.0690	10	0.44086	T	0.13	.	7.0535	0.25085	0.0:0.0:0.7303:0.2697	.	184;184;184	Q07444-2;F5H6K3;Q07444	.;.;NKG2E_HUMAN	Q	184	ENSP00000437563:P184Q;ENSP00000379716:P184Q;ENSP00000371329:P184Q;ENSP00000371328:P184Q	ENSP00000371328:P184Q	P	-	2	0	KLRC3;RP11-277P12.6	10460569	0.001000	0.12720	0.001000	0.08648	0.028000	0.11728	0.727000	0.25999	0.750000	0.32877	0.650000	0.86243	CCA			0.299	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000393471.1		NM_002261	
TAS2R30	259293	mdanderson.org	37	12	11285924	11285924	+	Missense_Mutation	SNP	C	C	T	rs2597924		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:11285924C>T	ENST00000539585.1	-	1	1319	c.920G>A	c.(919-921)cGt>cAt	p.R307H	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	307					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TCTATGGAGACGAAGGCTTCT	0.403																																					p.R307H													.	.			0			c.G920A												119.0	120.0	120.0					12																	11285924		1971	4181	6152	SO:0001583	missense	259293	exon1			TGGAGACGAAGGC	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.920G>A	12.37:g.11285924C>T	ENSP00000444736:p.Arg307His		105	0.0095238095	1		305	0.06	19	NM_001097643	1	1.00	1	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	8.463	0.855758	0.17106	.	.	ENSG00000256188	ENST00000539585	T	0.37411	1.2	1.89	-3.76	0.04359	.	.	.	.	.	T	0.16896	0.0406	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24154	-1.0168	9	0.72032	D	0.01	.	3.0285	0.06098	0.0:0.3931:0.2634:0.3434	rs2597924	307	P59541	T2R30_HUMAN	H	307	ENSP00000444736:R307H	ENSP00000444736:R307H	R	-	2	0	TAS2R30	11177191	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	0.014000	0.13333	-0.389000	0.07786	-0.752000	0.03492	CGT			0.403	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400238.1		NM_001097643	
PRB2	653247	broad.mit.edu	37	12	11546320	11546322	+	In_Frame_Del	DEL	TTG	TTG	-			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	TTG	TTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:11546320_11546322delTTG	ENST00000389362.4	-	3	725_727	c.690_692delCAA	c.(688-693)aacaag>aag	p.N230del	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	230	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTTGGGACTTGTTGTCTCCTT	0.601																																					p.230_231del													.	PRB2	168		0			c.690_692del																																									SO:0001651	inframe_deletion	653247	exon3			TGGGACTTGTTGT	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.690_692delCAA	12.37:g.11546323_11546325delTTG	ENSP00000374013:p.Asn230del		354	0	0		1258	0.01	8	NM_006248	1	0.00	0	O00599|P02811|P04281	In_Frame_Del	DEL	ENST00000389362.4	37	CCDS41757.2																																																																																					0.601	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346925.2		NM_006248	
WBP11	51729	broad.mit.edu	37	12	14947586	14947586	+	Silent	SNP	A	A	G			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:14947586A>G	ENST00000261167.2	-	7	839	c.606T>C	c.(604-606)ccT>ccC	p.P202P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	202	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GACCAGGGGGAGGGCCAGGAG	0.512																																					p.P202P													WBP11,right_lower_lobe,carcinoma,0,2	WBP11	66	2	0			c.T606C												100.0	107.0	105.0					12																	14947586		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon7			AGGGGGAGGGCCA	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.606T>C	12.37:g.14947586A>G			161	0.0124223602	2		574	0.01	8	NM_016312	236	0.00	1	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																					0.512	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
ITPR2	3709	broad.mit.edu	37	12	26568269	26568269	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:26568269C>T	ENST00000381340.3	-	51	7689	c.7273G>A	c.(7273-7275)Gtt>Att	p.V2425I	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2425					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGCCTATCAACTTCCATAGTG	0.413																																					p.V2425I													.	ITPR2	270		0			c.G7273A												113.0	108.0	109.0					12																	26568269		1848	4090	5938	SO:0001583	missense	3709	exon51			TATCAACTTCCAT	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7273G>A	12.37:g.26568269C>T	ENSP00000370744:p.Val2425Ile		142	0	0		534	0.01	5	NM_002223	12	0.00	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996521	0.93167	.	.	ENSG00000123104	ENST00000381340	D	0.98455	-4.94	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98760	0.9583	M	0.77712	2.385	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.98802	1.0740	10	0.23891	T	0.37	.	18.6686	0.91501	0.0:1.0:0.0:0.0	.	2425	Q14571	ITPR2_HUMAN	I	2425	ENSP00000370744:V2425I	ENSP00000370744:V2425I	V	-	1	0	ITPR2	26459536	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.638000	0.83328	2.636000	0.89361	0.591000	0.81541	GTT			0.413	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402732.1		NM_002223	
KIF21A	55605	broad.mit.edu	37	12	39735383	39735383	+	Silent	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:39735383C>T	ENST00000361418.5	-	14	1860	c.1845G>A	c.(1843-1845)gaG>gaA	p.E615E	KIF21A_ENST00000361961.3_Silent_p.E602E|KIF21A_ENST00000544797.2_Silent_p.E602E|KIF21A_ENST00000395670.3_Silent_p.E615E|KIF21A_ENST00000541463.2_Silent_p.E602E			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	615					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E602D(1)|p.E602E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				cctcctcctcctcttcttcat	0.398																																					p.E615E													KIF21A,NS,carcinoma,0,2	KIF21A	238	2	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(1)|kidney(1)	c.G1845A												85.0	82.0	83.0					12																	39735383		2203	4299	6502	SO:0001819	synonymous_variant	55605	exon14			CTCCTCCTCTTCT	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1845G>A	12.37:g.39735383C>T			74	0	0		109	0.04	4	NM_001173464	0		0	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Silent	SNP	ENST00000361418.5	37	CCDS53776.1																																																																																					0.398	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403581.1		NM_017641	
KRT2	3849	mdanderson.org	37	12	53045777	53045777	+	Silent	SNP	G	G	C	rs11835758	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:53045777G>C	ENST00000309680.3	-	1	171	c.150C>G	c.(148-150)ggC>ggG	p.G50G		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	50	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		CGAAGCCCCCGCCACCACCAC	0.617																																					p.G50G													.	.			0			c.C150G												39.0	41.0	40.0					12																	53045777		2203	4300	6503	SO:0001819	synonymous_variant	3849	exon1			GCCCCCGCCACCA		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.150C>G	12.37:g.53045777G>C			37	0	0		50	0.04	2	NM_000423	0		0	Q4VAQ2	Silent	SNP	ENST00000309680.3	37	CCDS8835.1																																																																																					0.617	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405704.1		NM_000423	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57883693	57883693	+	Silent	SNP	A	A	G			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr12:57883693A>G	ENST00000262027.5	+	5	563	c.429A>G	c.(427-429)ctA>ctG	p.L143L	ARHGAP9_ENST00000550288.1_5'Flank|ARHGAP9_ENST00000393797.2_5'Flank|MARS_ENST00000315473.5_Intron|MARS_ENST00000447721.2_Intron	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	143	GST C-terminal.				gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CAGAATCTCTAGCCGACATTG	0.453																																					p.L143L													.	.			0			c.A429G												164.0	164.0	164.0					12																	57883693		2203	4300	6503	SO:0001819	synonymous_variant	4141	exon5			ATCTCTAGCCGAC	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.429A>G	12.37:g.57883693A>G			126	0	0		234	0.19	45	NM_004990	42	0.33	14	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Silent	SNP	ENST00000262027.5	37	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	2.315	-0.357109	0.05138	.	.	ENSG00000166986	ENST00000552371	.	.	.	4.94	-2.25	0.06888	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.4963	4.8069	0.13325	0.2181:0.0:0.3937:0.3882	.	.	.	.	W	15	.	.	X	+	2	0	MARS	56169960	0.739000	0.28196	0.991000	0.47740	0.212000	0.24457	-0.097000	0.11042	-0.229000	0.09854	-0.250000	0.11733	TAG			0.453	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407014.1		NM_004990	
ATP5S	27109	bcgsc.ca	37	14	50798935	50798936	+	Frame_Shift_Del	DEL	CT	CT	-	rs373285323		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr14:50798935_50798936delCT	ENST00000358473.1	+	5	682_683	c.682_683delCT	c.(682-684)ctcfs	p.L228fs	CDKL1_ENST00000395834.1_Intron|CDKL1_ENST00000216378.2_3'UTR			Q99766	ATP5S_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)	0					ATP biosynthetic process (GO:0006754)|hydrogen ion transmembrane transport (GO:1902600)|proton transport (GO:0015992)	mitochondrial inner membrane (GO:0005743)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	12	all_epithelial(31;0.000636)|Breast(41;0.0102)			OV - Ovarian serous cystadenocarcinoma(311;0.0685)		TAGATTCCAACTCTCTGTACCA	0.475																																					.													RP11-247L20.2,NS,carcinoma,-2,2	CDKL1	50	2	0			.									4,4260		2,0,2130						0.4	0.0			143	6,8248		2,2,4123	no	intron	CDKL1	NM_004196.3		4,2,6253	A1A1,A1R,RR		0.0727,0.0938,0.0799				10,12508				SO:0001589	frameshift_variant	27109	.			TTCCAACTCTCTG	U79253	CCDS32075.1, CCDS32076.1, CCDS45102.1	14q21.3	2011-04-13	2010-06-11			ENSG00000125375			18799	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s (factor B)"""			11744738, 8619474	Standard	NM_015684		Approved	HSU79253, ATPW	uc001wxw.2	Q99766		ENST00000358473.1:c.682_683delCT	14.37:g.50798939_50798940delCT	ENSP00000351258:p.Leu228fs		48	0	0		79	0.27	21	.	0		0	A8K1U3|D9N156|Q8WWX3|Q96F77	Frame_Shift_Del	DEL	ENST00000358473.1	37																																																																																						0.475	ATP5S-011	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000410765.1		NM_015684	
VTI1B	10490	mdanderson.org	37	14	68118105	68118105	+	Silent	SNP	A	A	G	rs115023419	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr14:68118105A>G	ENST00000554659.1	-	6	1037	c.696T>C	c.(694-696)caT>caC	p.H232H	ARG2_ENST00000261783.3_3'UTR	NM_006370.2	NP_006361.1	Q9UEU0	VTI1B_HUMAN	vesicle transport through interaction with t-SNAREs 1B	232					cell proliferation (GO:0008283)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			endometrium(1)|large_intestine(2)|stomach(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)		TAGAAGTTCAATGGCTGCGAA	0.453													A|||	3	0.000599042	0.0023	0.0	5008	,	,		21265	0.0		0.0	False		,,,				2504	0.0				p.H232H													.	.			0			c.T696C							A	,	5,4401	9.9+/-24.2	0,5,2198	68.0	68.0	68.0		,696	-2.8	0.8	14	dbSNP_132	68	0,8600		0,0,4300	no	utr-3,coding-synonymous	ARG2,VTI1B	NM_001172.3,NM_006370.2	,	0,5,6498	GG,GA,AA		0.0,0.1135,0.0384	,	,232/233	68118105	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	10490	exon6			AGTTCAATGGCTG	AF060902	CCDS9786.1	14q23.3	2012-12-10	2012-12-10		ENSG00000100568	ENSG00000100568			17793	protein-coding gene	gene with protein product		603207	"""vesicle transport through interaction with t-SNAREs homolog 1B (yeast)"""			9636656, 9446565	Standard	NM_006370		Approved	VTI2	uc001xjt.3	Q9UEU0	OTTHUMG00000171251	ENST00000554659.1:c.696T>C	14.37:g.68118105A>G			45	0	0		57	0.05	3	NM_006370	496	0.00	0	O43547|Q96J28	Silent	SNP	ENST00000554659.1	37	CCDS9786.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	0.869	-0.732691	0.03135	0.001135	0.0	ENSG00000100568	ENST00000554636	.	.	.	6.17	-2.76	0.05896	.	.	.	.	.	T	0.28200	0.0696	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.34875	-0.9811	4	.	.	.	.	6.6102	0.22747	0.3194:0.0:0.437:0.2436	.	.	.	.	T	110	.	.	I	-	2	0	VTI1B	67187858	0.000000	0.05858	0.839000	0.33178	0.296000	0.27459	-0.869000	0.04232	-0.045000	0.13468	-0.256000	0.11100	ATT	0		0.453	VTI1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412558.2			
Unknown	0	hgsc.bcm.edu;bcgsc.ca	37	15	22546705	22546705	+	IGR	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr15:22546705G>T								MIR1268A (33425 upstream) : MIR4509-2 (128442 downstream)																							TCCTGCTGCCGTTCACCATGT	0.647																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	646396	.			GCTGCCGTTCACC																													15.37:g.22546705G>T			29	0	0		33	0.21	7	.	3	0.00	0		RNA	SNP		37																																																																																					0	0.647										
SERF2	10169	broad.mit.edu	37	15	44085843	44085843	+	Intron	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr15:44085843T>C	ENST00000381359.1	+	5	1045				SERF2_ENST00000409614.1_Intron|SERF2_ENST00000594896.1_Intron|SERF2_ENST00000409960.2_Silent_p.H62H|SERF2_ENST00000249786.4_Intron|SERF2_ENST00000339624.5_Intron|SERF2_ENST00000409646.1_Intron|MIR1282_ENST00000408865.1_RNA|HYPK_ENST00000406925.1_5'Flank|SERF2_ENST00000409291.1_Intron|SERF2_ENST00000402131.1_Intron|RP11-296A16.1_ENST00000417761.2_Intron|SERF2_ENST00000403425.1_Intron	NM_001199877.1	NP_001186806.1	P84101	SERF2_HUMAN	small EDRK-rich factor 2							cytosol (GO:0005829)|nucleus (GO:0005634)				lung(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		GTGCCCTTCATCCCCCTGCAT	0.537																																					p.H62H													.	SERF2	7		0			c.T186C												164.0	141.0	148.0					15																	44085843		1563	3580	5143	SO:0001627	intron_variant	10169	exon3			CCTTCATCCCCCT	AF073298	CCDS32218.1, CCDS55963.1, CCDS55964.1, CCDS55965.1	15q15.1	2008-01-18			ENSG00000140264	ENSG00000140264			10757	protein-coding gene	gene with protein product		605054				9731538	Standard	NM_001199876		Approved	H4F5rel, 4F5REL, FAM2C, HsT17089	uc010bdq.3	P84101	OTTHUMG00000059935	ENST00000381359.1:c.117-65T>C	15.37:g.44085843T>C			106	0	0		155	0.03	5	NM_001199875	74	0.00	0	A6NL45|B5MCG1|B9A026|O75918|O88891|Q9BZH7	Silent	SNP	ENST00000381359.1	37	CCDS32218.1																																																																																					0.537	SERF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000133233.2		NM_005770	
MEF2A	4205	hgsc.bcm.edu	37	15	100211846	100211846	+	Missense_Mutation	SNP	G	G	A	rs75705863		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr15:100211846G>A	ENST00000354410.5	+	5	1009	c.380G>A	c.(379-381)cGg>cAg	p.R127Q	MEF2A_ENST00000558812.1_Intron|MEF2A_ENST00000453228.2_Intron|MEF2A_ENST00000338042.6_Intron|MEF2A_ENST00000557942.1_Intron|MEF2A_ENST00000557785.1_Intron|MEF2A_ENST00000449277.2_Intron	NM_005587.2	NP_005578.2	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	127					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			AATATGATGCGGAATCATAAA	0.353																																					p.R127Q													MEF2A_ENST00000354410,NS,carcinoma,+1,1	MEF2A_ENST00000354410	1	1	0			c.G380A												23.0	21.0	22.0					15																	100211846		1829	4075	5904	SO:0001583	missense	4205	exon5			TGATGCGGAATCA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000354410.5:c.380G>A	15.37:g.100211846G>A	ENSP00000346389:p.Arg127Gln		14	0	0		49	0.04	2	NM_005587	0		0	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000354410.5	37	CCDS45362.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210988	0.39102	.	.	ENSG00000068305	ENST00000354410	T	0.53640	0.61	5.42	5.42	0.78866	Holliday junction regulator protein family C-terminal repeat (1);	0.388740	0.29028	N	0.013366	T	0.33731	0.0873	N	0.10916	0.065	0.80722	D	1	B;B	0.29301	0.241;0.203	B;B	0.37422	0.249;0.135	T	0.11916	-1.0568	10	0.05833	T	0.94	-16.9184	19.5673	0.95398	0.0:0.0:1.0:0.0	.	127;127	Q02078;Q02078-5	MEF2A_HUMAN;.	Q	127	ENSP00000346389:R127Q	ENSP00000346389:R127Q	R	+	2	0	MEF2A	98029369	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.420000	0.97426	2.706000	0.92434	0.462000	0.41574	CGG			0.353	MEF2A-001	KNOWN	overlapping_uORF|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000415980.1			
SYNGR3	9143	mdanderson.org	37	16	2042125	2042125	+	Missense_Mutation	SNP	G	G	A	rs367678643		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:2042125G>A	ENST00000248121.2	+	2	408	c.250G>A	c.(250-252)Gcc>Acc	p.A84T	SYNGR3_ENST00000562045.1_5'UTR	NM_004209.5	NP_004200.2	O43761	SNG3_HUMAN	synaptogyrin 3	84	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				positive regulation of transporter activity (GO:0032411)|substantia nigra development (GO:0021762)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|synaptic vesicle (GO:0008021)				endometrium(1)|lung(2)	3						CGCCTGCGCCGCCTTCCTGCT	0.731																																					p.A84T													.	.			0			c.G250A							T	THR/ALA	5,4157		0,5,2076	5.0	6.0	5.0		250	-0.4	1.0	16		5	0,8278		0,0,4139	no	missense	SYNGR3	NM_004209.5	58	0,5,6215	AA,AG,GG		0.0,0.1201,0.0402	benign	84/230	2042125	5,12435	2081	4139	6220	SO:0001583	missense	9143	exon2			TGCGCCGCCTTCC	AJ002309	CCDS10456.1	16p13.3	2008-05-19			ENSG00000127561	ENSG00000127561			11501	protein-coding gene	gene with protein product		603927				9760194	Standard	NM_004209		Approved		uc002cod.3	O43761	OTTHUMG00000128711	ENST00000248121.2:c.250G>A	16.37:g.2042125G>A	ENSP00000248121:p.Ala84Thr		22	0	0		39	0.08	3	NM_004209	2	0.00	0	B2R9S0	Missense_Mutation	SNP	ENST00000248121.2	37	CCDS10456.1	.	.	.	.	.	.	.	.	.	.	g	12.17	1.856739	0.32791	0.001201	0.0	ENSG00000127561	ENST00000248121;ENST00000320633	T	0.28069	1.63	4.2	-0.377	0.12501	Marvel (1);MARVEL-like domain (1);	0.365927	0.30890	N	0.008677	T	0.15869	0.0382	L	0.31926	0.97	0.80722	D	1	P	0.39520	0.676	B	0.32289	0.143	T	0.05209	-1.0899	10	0.34782	T	0.22	.	7.0559	0.25099	0.0915:0.0:0.2943:0.6142	.	84	O43761	SNG3_HUMAN	T	84	ENSP00000248121:A84T	ENSP00000248121:A84T	A	+	1	0	SYNGR3	1982126	1.000000	0.71417	0.993000	0.49108	0.108000	0.19459	0.793000	0.26944	0.174000	0.19809	-0.217000	0.12591	GCC			0.731	SYNGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250616.1			
SRRM2	23524	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																					p.S2625S													.	.			0			c.C7875T												141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon12			CTCCTCCTCTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	16.37:g.2819139C>T			69	0	0		89	0.06	5	NM_016333	536	0.00	1	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																					0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436411.1			
SEPT12	124404	mdanderson.org	37	16	4837595	4837595	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:4837595T>C	ENST00000268231.8	-	2	315	c.52A>G	c.(52-54)Agc>Ggc	p.S18G	SEPT12_ENST00000591861.1_5'UTR|SEPT12_ENST00000396693.5_Missense_Mutation_p.S18G|SMIM22_ENST00000589721.1_5'Flank|SMIM22_ENST00000589327.1_5'Flank	NM_144605.4	NP_653206.2	Q8IYM1	SEP12_HUMAN	septin 12	18					cell cycle (GO:0007049)|cell division (GO:0051301)	cleavage furrow (GO:0032154)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|sperm annulus (GO:0097227)|spindle (GO:0005819)|stress fiber (GO:0001725)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|skin(2)|stomach(3)	23						GTGCTGGGGCTGGAGGGCTGC	0.632																																					p.S18G													.	.			0			c.A52G												78.0	61.0	67.0					16																	4837595		2197	4300	6497	SO:0001583	missense	124404	exon2			TGGGGCTGGAGGG	AK058139	CCDS10522.1, CCDS53987.1	16p13.3	2013-01-21			ENSG00000140623	ENSG00000140623		"""Septins"""	26348	protein-coding gene	gene with protein product		611562				14611653, 15915442	Standard	NM_001154458		Approved	FLJ25410	uc002cxq.3	Q8IYM1	OTTHUMG00000129481	ENST00000268231.8:c.52A>G	16.37:g.4837595T>C	ENSP00000268231:p.Ser18Gly		18	0	0		38	0.08	3	NM_001154458	0		0	Q0P6B0|Q1PBH0|Q96LL0	Missense_Mutation	SNP	ENST00000268231.8	37	CCDS10522.1	.	.	.	.	.	.	.	.	.	.	T	12.85	2.061802	0.36373	.	.	ENSG00000140623	ENST00000396693;ENST00000268231	T;T	0.53423	0.64;0.62	5.03	5.03	0.67393	.	1.093270	0.06781	N	0.785238	T	0.39436	0.1078	L	0.32530	0.975	0.26536	N	0.974168	B;B	0.12013	0.005;0.003	B;B	0.14578	0.011;0.005	T	0.17561	-1.0365	10	0.33940	T	0.23	.	8.9765	0.35939	0.0:0.0871:0.0:0.9129	.	18;18	Q8IYM1-2;Q8IYM1	.;SEP12_HUMAN	G	18	ENSP00000379922:S18G;ENSP00000268231:S18G	ENSP00000268231:S18G	S	-	1	0	SEPT12	4777596	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	1.391000	0.34475	2.108000	0.64289	0.477000	0.44152	AGC			0.632	SEPT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251645.2		NM_144605	
INO80E	283899	bcgsc.ca	37	16	30016646	30016652	+	Frame_Shift_Del	DEL	TAAGATG	TAAGATG	-			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	TAAGATG	TAAGATG					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:30016646_30016652delTAAGATG	ENST00000563197.1	+	7	1635_1641	c.618_624delTAAGATG	c.(616-624)cctaagatgfs	p.PKM206fs	INO80E_ENST00000304516.7_Frame_Shift_Del_p.PKM167fs|INO80E_ENST00000567705.1_Frame_Shift_Del_p.PKM189fs	NM_173618.1	NP_775889.1	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	206	Pro-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	6						TCCCACCCCCTAAGATGCCCCCCCCCA	0.681																																					p.206_208del													.	INO80E	26		0			c.618_624del																																									SO:0001589	frameshift_variant	283899	exon7			ACCCCCTAAGATG	AK075133	CCDS10665.1	16p11.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000169592	ENSG00000169592		"""INO80 complex subunits"""	26905	protein-coding gene	gene with protein product			"""coiled-coil domain containing 95"""	CCDC95		16230350	Standard	NM_173618		Approved	FLJ90652	uc002dvg.1	Q8NBZ0	OTTHUMG00000132114	ENST00000563197.1:c.618_624delTAAGATG	16.37:g.30016646_30016652delTAAGATG	ENSP00000457016:p.Pro206fs		124	0	0		144	0.00	0	NM_173618	58	0.00	0	Q6Y2K3	Frame_Shift_Del	DEL	ENST00000563197.1	37	CCDS10665.1																																																																																					0.681	INO80E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255156.2		NM_173618	
ALDOA	226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30080966	30080966	+	Silent	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:30080966G>A	ENST00000566897.1	+	10	1923	c.771G>A	c.(769-771)ctG>ctA	p.L257L	ALDOA_ENST00000563060.2_Silent_p.L257L|ALDOA_ENST00000564595.2_Silent_p.L311L|ALDOA_ENST00000338110.5_Silent_p.L257L|ALDOA_ENST00000564546.1_Silent_p.L257L|ALDOA_ENST00000412304.2_Silent_p.L257L|ALDOA_ENST00000395240.3_Silent_p.L261L|ALDOA_ENST00000569798.1_Silent_p.L257L|ALDOA_ENST00000395248.1_Silent_p.L311L|ALDOA_ENST00000569545.1_Silent_p.L257L			P04075	ALDOA_HUMAN	aldolase A, fructose-bisphosphate	257					actin filament organization (GO:0007015)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homotetramerization (GO:0051289)|regulation of cell shape (GO:0008360)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|membrane (GO:0016020)|nucleus (GO:0005634)|platelet alpha granule lumen (GO:0031093)	actin binding (GO:0003779)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|tubulin binding (GO:0015631)			breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	17						TCACAGCGCTGCGCCGCACAG	0.572																																					p.L311L													.	.			0			c.G933A												63.0	57.0	59.0					16																	30080966		2197	4300	6497	SO:0001819	synonymous_variant	226	exon8			AGCGCTGCGCCGC	X05236	CCDS10668.1, CCDS58450.1	16p11.2	2008-03-06			ENSG00000149925	ENSG00000149925	4.1.2.13		414	protein-coding gene	gene with protein product		103850				3570299	Standard	NM_000034		Approved		uc010veg.2	P04075	OTTHUMG00000132107	ENST00000566897.1:c.771G>A	16.37:g.30080966G>A			46	0	0		33	0.39	13	NM_001243177	3837	0.38	1446	B4DXI7|Q6FH76|Q6FI10|Q96B15|Q9BWD9|Q9UCN2	Silent	SNP	ENST00000566897.1	37	CCDS10668.1																																																																																					0.572	ALDOA-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000435360.1		NM_000034	
ITGAM	3684	mdanderson.org	37	16	31284807	31284807	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:31284807G>T	ENST00000287497.8	+	8	901	c.826G>T	c.(826-828)Gac>Tac	p.D276Y	ITGAM_ENST00000544665.3_Missense_Mutation_p.D276Y			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	276	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CCCTGAGGCAGACAGAGAGGG	0.502																																					p.D276Y													.	.			0			c.G826T												95.0	89.0	91.0					16																	31284807		1985	4175	6160	SO:0001583	missense	3684	exon8			GAGGCAGACAGAG	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.826G>T	16.37:g.31284807G>T	ENSP00000287497:p.Asp276Tyr		46	0	0		46	0.07	3	NM_000632	1	0.00	0	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	37	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597595	0.46318	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.21932	1.98;1.98	4.81	2.84	0.33178	von Willebrand factor, type A (3);	.	.	.	.	T	0.38427	0.1040	M	0.67953	2.075	0.37138	D	0.901573	D;D	0.65815	0.995;0.995	P;P	0.62382	0.901;0.901	T	0.44513	-0.9323	9	0.87932	D	0	.	10.3678	0.44035	0.1635:0.0:0.8365:0.0	.	276;276	Q4VAK1;P11215	.;ITAM_HUMAN	Y	276	ENSP00000441691:D276Y;ENSP00000287497:D276Y	ENSP00000287497:D276Y	D	+	1	0	ITGAM	31192308	0.989000	0.36119	0.696000	0.30242	0.522000	0.34438	3.069000	0.50026	0.738000	0.32606	-0.150000	0.13652	GAC			0.502	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000432816.1		NM_000632	
HPR	3250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72110949	72110949	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:72110949A>G	ENST00000540303.2	+	5	1048	c.1016A>G	c.(1015-1017)cAc>cGc	p.H339R	HPR_ENST00000356967.5_Missense_Mutation_p.H339R|HPR_ENST00000228226.8_Missense_Mutation_p.H376R|HPR_ENST00000561690.1_3'UTR	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	339	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		H -> D (in dbSNP:rs12646). {ECO:0000269|PubMed:1478675, ECO:0000269|PubMed:2987228, ECO:0000269|PubMed:4018023}.			blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				TCCATCCAGCACTGGGTTCAG	0.537																																					p.H339R													.	.			0			c.A1016G												201.0	124.0	149.0					16																	72110949		2008	4158	6166	SO:0001583	missense	3250	exon5			TCCAGCACTGGGT	BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.1016A>G	16.37:g.72110949A>G	ENSP00000441828:p.His339Arg		61	0	0		63	0.21	13	NM_020995	8	0.50	4	Q7LE20|Q92658|Q92659|Q9ULB0	Missense_Mutation	SNP	ENST00000540303.2	37	CCDS42193.1	.	.	.	.	.	.	.	.	.	.	A	2.112	-0.403507	0.04832	.	.	ENSG00000257017	ENST00000356967;ENST00000540303;ENST00000228226	D;D;D	0.92595	-3.07;-3.07;-3.07	2.64	1.47	0.22746	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.349704	0.30989	N	0.008477	T	0.78387	0.4275	N	0.02985	-0.445	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.70103	-0.4964	10	0.72032	D	0.01	.	7.865	0.29533	0.5956:0.4044:0.0:0.0	.	339	P00739	HPTR_HUMAN	R	339;339;376	ENSP00000349451:H339R;ENSP00000441828:H339R;ENSP00000228226:H376R	ENSP00000228226:H376R	H	+	2	0	HP	70668450	1.000000	0.71417	0.583000	0.28640	0.039000	0.13416	2.197000	0.42696	0.217000	0.20800	0.338000	0.21704	CAC			0.537	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421696.1		NM_020995	
CHST5	23563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	75563575	75563575	+	Silent	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr16:75563575C>T	ENST00000336257.3	-	3	2102	c.708G>A	c.(706-708)gcG>gcA	p.A236A	CHST5_ENST00000541075.1_Silent_p.A242A|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	236					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						GTATCGGGCCCGCCGCCTCCC	0.716																																					p.A236A													CHST5,NS,carcinoma,-2,1	CHST5	-2	1	0			c.G708A												24.0	29.0	28.0					16																	75563575		2186	4265	6451	SO:0001819	synonymous_variant	23563	exon3			CGGGCCCGCCGCC	AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.708G>A	16.37:g.75563575C>T			32	0	0		47	0.19	9	NM_024533	0		0	B2RV23|Q7LCN3|Q9UBY3	Silent	SNP	ENST00000336257.3	37	CCDS10919.1																																																																																					0.716	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269025.2		NM_012126	
TMEM107	84314	broad.mit.edu	37	17	8079145	8079145	+	Silent	SNP	G	G	T	rs369840510		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr17:8079145G>T	ENST00000437139.2	-	3	273	c.186C>A	c.(184-186)ggC>ggA	p.G62G	TMEM107_ENST00000431792.2_Intron|TMEM107_ENST00000449985.2_Intron|TMEM107_ENST00000532998.1_Silent_p.G62G|TMEM107_ENST00000316425.5_Silent_p.G68G|RP11-599B13.7_ENST00000581248.1_lincRNA|TMEM107_ENST00000533070.1_Silent_p.G68G|SNORD118_ENST00000363593.1_RNA	NM_183065.2	NP_898888.1	Q6UX40	TM107_HUMAN	transmembrane protein 107	62					cilium assembly (GO:0042384)|embryonic digit morphogenesis (GO:0042733)|neural tube patterning (GO:0021532)	integral component of membrane (GO:0016021)				large_intestine(1)|lung(4)|ovary(1)	6						CTGCAAAGAGGCCCAGGGTGA	0.592																																					p.G68G													.	TMEM107	16		0			c.C204A												84.0	89.0	87.0					17																	8079145		2203	4300	6503	SO:0001819	synonymous_variant	84314	exon3			AAAGAGGCCCAGG	AF311338	CCDS11132.1, CCDS45607.1	17p13.1	2005-12-19				ENSG00000179029			28128	protein-coding gene	gene with protein product						12477932	Standard	NM_032354		Approved	MGC10744	uc002gkh.4	Q6UX40		ENST00000437139.2:c.186C>A	17.37:g.8079145G>T			93	0	0		133	0.03	4	NM_032354	33	0.00	0	A0PJV7|Q6NSE3|Q6ZRX9|Q96T82	Silent	SNP	ENST00000437139.2	37	CCDS45607.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.296859	0.23650	.	.	ENSG00000179029	ENST00000415860	.	.	.	5.75	3.71	0.42584	.	.	.	.	.	T	0.59810	0.2221	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62742	-0.6790	5	0.87932	D	0	-11.8545	4.0693	0.09874	0.0849:0.162:0.5851:0.168	.	.	.	.	D	93	.	ENSP00000392476:A93D	A	-	2	0	TMEM107	8019870	0.998000	0.40836	1.000000	0.80357	0.891000	0.51852	0.328000	0.19681	1.381000	0.46364	0.551000	0.68910	GCC			0.592	TMEM107-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388844.1		NM_032354	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		170	0.0764705882	13		248	0.08	21	NM_145301	36	0.44	16	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
FLJ36000	284124	hgsc.bcm.edu	37	17	21904891	21904891	+	lincRNA	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr17:21904891T>C	ENST00000581223.2	+	0	0					NR_027084.1																						CCTGGAACGCTGGCCTCTCTG	0.622																																					.													.	.			0			.																																											0	.			GAACGCTGGCCTC																													17.37:g.21904891T>C			42	0	0		57	0.14	8	.	0		0		RNA	SNP	ENST00000581223.2	37																																																																																						0.622	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
TBC1D3F	84218	bcgsc.ca	37	17	36288278	36288278	+	Missense_Mutation	SNP	T	T	A	rs11550750		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr17:36288278T>A	ENST00000327454.6	+	6	510	c.364T>A	c.(364-366)Ttg>Atg	p.L122M	TBC1D3F_ENST00000505415.1_Missense_Mutation_p.L122M|TBC1D3F_ENST00000539424.1_Missense_Mutation_p.L42M|TBC1D3F_ENST00000378174.5_Missense_Mutation_p.L122M	NM_032258.2	NP_115634.2	A6NER0	TBC3F_HUMAN	TBC1 domain family, member 3F	122	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			liver(1)|pancreas(1)	2						GGAAATGAAGTTGAAAAACCC	0.562																																					p.L122M													.	TBC1D3F	14		0			c.T364A							T	MET/LEU	15,1737		0,15,861	239.0	158.0	183.0		364		0.0	17	dbSNP_120	183	101,3869		0,101,1884	no	missense	TBC1D3F	NM_032258.2	15	0,116,2745	AA,AT,TT		2.5441,0.8562,2.0273	possibly-damaging	122/550	36288278	116,5606	876	1985	2861	SO:0001583	missense	84218	exon6			ATGAAGTTGAAAA			17q12	2014-09-16				ENSG00000275954			18257	protein-coding gene	gene with protein product		610809				16863688	Standard	NM_032258		Approved			A6NER0	OTTHUMG00000188428	ENST00000327454.6:c.364T>A	17.37:g.36288278T>A	ENSP00000329256:p.Leu122Met		58	0.0172413793	1		83	0.16	13	NM_032258	33	0.00	0		Missense_Mutation	SNP	ENST00000327454.6	37	CCDS45657.1	.	.	.	.	.	.	.	.	.	.	t	5.859	0.342710	0.11069	0.008562	0.025441	ENSG00000185128	ENST00000327454;ENST00000378174;ENST00000505415;ENST00000539424	T;T;T;T	0.11495	2.77;2.77;2.77;2.77	.	.	.	Rab-GAP/TBC domain (8);	1.135460	0.06527	U	0.740661	T	0.02807	0.0084	L	0.43923	1.385	0.09310	N	0.999995	B;B;B;B	0.31153	0.042;0.31;0.024;0.12	B;B;B;B	0.29524	0.103;0.048;0.103;0.055	T	0.37126	-0.9719	9	0.46703	T	0.11	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	122;122;122;122	B9A6J9;A6NFD7;P0C7X1;A6NER0	.;.;TBC3H_HUMAN;TBC3F_HUMAN	M	122;122;122;42	ENSP00000329256:L122M;ENSP00000367416:L122M;ENSP00000421962:L122M;ENSP00000443859:L42M	ENSP00000329256:L122M	L	+	1	2	TBC1D3F	33362660	0.686000	0.27661	0.026000	0.17262	0.026000	0.11368	-0.164000	0.09983	0.103000	0.17682	0.102000	0.15555	TTG			0.562	TBC1D3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256100.3		NM_032258.2	
AMZ2P1	201283	broad.mit.edu	37	17	62968690	62968690	+	RNA	SNP	A	A	G			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr17:62968690A>G	ENST00000430983.1	-	0	1554					NR_026903.1				archaelysin family metallopeptidase 2 pseudogene 1																		AAAATTCCACAAGTCTCTTGG	0.373																																					.													.	.			0			.																																											0	.			TTCCACAAGTCTC	AK056627		17q24.1	2012-10-16	2010-04-08		ENSG00000214174	ENSG00000214174			26491	pseudogene	pseudogene							Standard	NR_026903		Approved	FLJ32065	uc002jfb.3		OTTHUMG00000132075		17.37:g.62968690A>G			58	0	0		141	0.04	6	.	78	0.01	1		RNA	SNP	ENST00000430983.1	37																																																																																						0.373	AMZ2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000255102.1		NM_153032	
OGFOD3	79701	mdanderson.org	37	17	80361815	80361815	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr17:80361815T>C	ENST00000313056.5	-	7	848	c.697A>G	c.(697-699)Aag>Gag	p.K233E	OGFOD3_ENST00000329197.5_Missense_Mutation_p.K233E|RP13-20L14.4_ENST00000579188.1_RNA	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	233	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										GCGCTCACCTTGTCCACGTGC	0.677																																					p.K233E													C17orf101_ENST00000313056,right_lower_lobe,carcinoma,+2,2	C17orf101_ENST00000313056	2	2	0			c.A697G												75.0	56.0	62.0					17																	80361815		2203	4300	6503	SO:0001583	missense	79701	exon7			TCACCTTGTCCAC	BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.697A>G	17.37:g.80361815T>C	ENSP00000320116:p.Lys233Glu		17	0	0		27	0.11	3	NM_175902	76	0.00	0	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	37	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501299	0.85176	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.58652	0.32;1.0	5.32	4.22	0.49857	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	M	0.82193	2.58	0.53005	D	0.999969	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.975	T	0.76564	-0.2913	10	0.62326	D	0.03	-35.2441	10.4469	0.44499	0.1462:0.0:0.0:0.8538	.	233;233	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	E	233	ENSP00000320116:K233E;ENSP00000330075:K233E	ENSP00000320116:K233E	K	-	1	0	C17orf101	77955104	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.657000	0.61490	0.823000	0.34589	0.533000	0.62120	AAG			0.677	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442895.1		NM_175902	
SEMA6B	10501	bcgsc.ca	37	19	4550280	4550280	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr19:4550280C>T	ENST00000586582.1	-	12	1436	c.1126G>A	c.(1126-1128)Ggg>Agg	p.G376R	SEMA6B_ENST00000301293.3_Missense_Mutation_p.G376R|SEMA6B_ENST00000586965.1_Missense_Mutation_p.G376R	NM_032108.3	NP_115484.2	Q9H3T3	SEM6B_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B	376	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCAGCACCCGGGCCTGGGG	0.597																																					p.G376R													SEMA6B,colon,carcinoma,0,1	SEMA6B	51	1	0			c.G1126A												40.0	41.0	40.0					19																	4550280		2201	4291	6492	SO:0001583	missense	10501	exon12			AGCACCCGGGCCT	AB022433	CCDS12131.1	19p13.3	2008-07-22				ENSG00000167680		"""Semaphorins"""	10739	protein-coding gene	gene with protein product	"""Sema VIb"", ""semaphorin Z"", ""semaphorin VIB"""	608873		SEMAN		9361278	Standard	NM_032108		Approved	semaZ, SEMA-VIB, SEM-SEMA-Y	uc010dud.2	Q9H3T3		ENST00000586582.1:c.1126G>A	19.37:g.4550280C>T	ENSP00000467290:p.Gly376Arg		65	0	0		76	0.05	4	NM_032108	57	0.00	0	A5PKU4|F6IB19|Q9NRK9	Missense_Mutation	SNP	ENST00000586582.1	37	CCDS12131.1	.	.	.	.	.	.	.	.	.	.	.	16.30	3.084092	0.55861	.	.	ENSG00000167680	ENST00000301293;ENST00000301292	T	0.31510	1.49	2.6	2.6	0.31112	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	U	0.000000	T	0.66489	0.2794	H	0.96604	3.85	0.52501	D	0.999956	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78979	-0.1990	10	0.87932	D	0	.	12.9003	0.58121	0.0:1.0:0.0:0.0	.	376;376	B4DT36;Q9H3T3	.;SEM6B_HUMAN	R	376	ENSP00000301293:G376R	ENSP00000301292:G376R	G	-	1	0	SEMA6B	4501280	1.000000	0.71417	0.972000	0.41901	0.247000	0.25773	7.337000	0.79256	1.795000	0.52594	0.478000	0.44815	GGG			0.597	SEMA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458656.2		NM_032108	
SSBP4	170463	mdanderson.org	37	19	18544013	18544013	+	Silent	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr19:18544013C>T	ENST00000270061.7	+	15	1275	c.981C>T	c.(979-981)aaC>aaT	p.N327N	SSBP4_ENST00000599699.2_5'Flank|SSBP4_ENST00000348495.6_Silent_p.N305N	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	327						nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|skin(1)	4						ACCACGTGAACGGATCCCTGG	0.746																																					p.N327N													.	.			0			c.C981T												15.0	14.0	14.0					19																	18544013		2174	4265	6439	SO:0001819	synonymous_variant	170463	exon15			CGTGAACGGATCC		CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.981C>T	19.37:g.18544013C>T			22	0	0		44	0.07	3	NM_032627	137	0.00	0	Q9BWW5	Silent	SNP	ENST00000270061.7	37	CCDS12378.1																																																																																					0.746	SSBP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466348.3		NM_032627	
UPF1	5976	mdanderson.org	37	19	18971687	18971687	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr19:18971687G>A	ENST00000599848.1	+	17	2595	c.2386G>A	c.(2386-2388)Gcc>Acc	p.A796T	UPF1_ENST00000262803.5_Missense_Mutation_p.A785T			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	796					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GAAGGCAGGCGCCAAGCCGGA	0.607																																					p.A785T													.	.			0			c.G2353A												71.0	49.0	57.0					19																	18971687		2198	4300	6498	SO:0001583	missense	5976	exon17			GCAGGCGCCAAGC	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2386G>A	19.37:g.18971687G>A	ENSP00000470142:p.Ala796Thr		37	0	0		42	0.07	3	NM_002911	41	0.00	0	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	G	17.42	3.385186	0.61956	.	.	ENSG00000005007	ENST00000262803	D	0.81908	-1.55	4.52	4.52	0.55395	.	0.111727	0.64402	D	0.000009	T	0.68449	0.3002	N	0.04724	-0.175	0.80722	D	1	B;B	0.15473	0.013;0.01	B;B	0.16722	0.016;0.009	T	0.67417	-0.5676	10	0.62326	D	0.03	-32.8017	14.4046	0.67073	0.0:0.0:1.0:0.0	.	796;785	Q92900;Q92900-2	RENT1_HUMAN;.	T	785	ENSP00000262803:A785T	ENSP00000262803:A785T	A	+	1	0	UPF1	18832687	1.000000	0.71417	0.818000	0.32626	0.679000	0.39708	9.425000	0.97467	2.053000	0.61076	0.561000	0.74099	GCC			0.607	UPF1-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000464684.1		NM_002911	
HAUS5	23354	mdanderson.org	37	19	36109839	36109839	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr19:36109839A>G	ENST00000203166.5	+	13	1092	c.1067A>G	c.(1066-1068)aAg>aGg	p.K356R	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	356					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						ACGGAGCTCAAGGCCCTGCAC	0.627																																					p.K356R													.	.			0			c.A1067G												45.0	45.0	45.0					19																	36109839		2035	4185	6220	SO:0001583	missense	23354	exon13			AGCTCAAGGCCCT	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1067A>G	19.37:g.36109839A>G	ENSP00000439056:p.Lys356Arg		52	0	0		44	0.07	3	NM_015302	19	0.00	0	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	ENST00000203166.5	37	CCDS42550.1	.	.	.	.	.	.	.	.	.	.	A	9.228	1.035146	0.19590	.	.	ENSG00000249115	ENST00000203166	T	0.29397	1.57	5.08	2.96	0.34315	.	0.185186	0.46758	N	0.000263	T	0.22205	0.0535	L	0.41824	1.3	0.80722	D	1	B	0.13594	0.008	B	0.14578	0.011	T	0.05370	-1.0889	10	0.49607	T	0.09	-9.1043	5.9759	0.19379	0.784:0.0:0.216:0.0	.	356	O94927	HAUS5_HUMAN	R	356	ENSP00000439056:K356R	ENSP00000439056:K356R	K	+	2	0	HAUS5	40801679	0.993000	0.37304	1.000000	0.80357	0.239000	0.25481	0.092000	0.15066	0.416000	0.25844	0.460000	0.39030	AAG			0.627	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459055.2			
LHCGR	3973	mdanderson.org	37	2	48982764	48982764	+	Missense_Mutation	SNP	A	A	T	rs4539842		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr2:48982764A>T	ENST00000294954.7	-	1	68	c.47T>A	c.(46-48)cTg>cAg	p.L16Q	LHCGR_ENST00000401907.1_Missense_Mutation_p.L16Q|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.L16Q|LHCGR_ENST00000403273.1_Missense_Mutation_p.L16Q|LHCGR_ENST00000344775.3_Missense_Mutation_p.L16Q	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	16					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	cggctgcagcagcagcagcag	0.721																																					p.L16Q													.	.			0			c.T47A												1.0	3.0	2.0					2																	48982764		911	1841	2752	SO:0001583	missense	3973	exon1			TGCAGCAGCAGCA		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.47T>A	2.37:g.48982764A>T	ENSP00000294954:p.Leu16Gln		13	0	0		11	0.27	3	NM_000233	0		0	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.191104	0.58017	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907	D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02	4.18	4.18	0.49190	.	1.158800	0.06471	N	0.731104	D	0.83594	0.5288	L	0.29908	0.895	0.28253	N	0.925194	D	0.55172	0.97	P	0.51453	0.67	T	0.72527	-0.4266	9	.	.	.	.	9.5009	0.39017	1.0:0.0:0.0:0.0	rs4539842	16	P22888	LSHR_HUMAN	Q	16	ENSP00000344301:L16Q;ENSP00000294954:L16Q;ENSP00000386033:L16Q;ENSP00000385847:L16Q;ENSP00000385406:L16Q	.	L	-	2	0	LHCGR	48836268	0.561000	0.26578	0.862000	0.33874	0.243000	0.25628	1.821000	0.39041	1.736000	0.51660	0.421000	0.28195	CTG			0.721	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251364.4		NM_000233.3	
CHRNA1	1134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	175614728	175614728	+	Silent	SNP	G	G	A	rs141733086	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr2:175614728G>A	ENST00000261007.5	-	8	1089	c.1023C>T	c.(1021-1023)atC>atT	p.I341I	CHRNA1_ENST00000348749.5_Silent_p.I316I|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Silent_p.I234I|CHRNA1_ENST00000409219.1_Silent_p.I316I	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	341					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	GGTGTGTGTTGATGACGATGA	0.552																																					p.I341I													.	.			0			c.C1023T												222.0	168.0	186.0					2																	175614728		2203	4300	6503	SO:0001819	synonymous_variant	1134	exon8			TGTGTTGATGACG	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1023C>T	2.37:g.175614728G>A			102	0	0		145	0.27	39	NM_001039523	4	0.00	0	B4DRV6|D3DPE8	Silent	SNP	ENST00000261007.5	37	CCDS33331.1																																																																																					0.552	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000334116.1			
THAP4	51078	mdanderson.org	37	2	242573038	242573038	+	Silent	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr2:242573038T>C	ENST00000407315.1	-	2	965	c.534A>G	c.(532-534)ggA>ggG	p.G178G		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	178							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		TGGTGGCCAGTCCATCTCCTG	0.642																																					p.G178G													.	.			0			c.A534G												55.0	57.0	56.0					2																	242573038		2203	4296	6499	SO:0001819	synonymous_variant	51078	exon2			GGCCAGTCCATCT	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.534A>G	2.37:g.242573038T>C			34	0	0		48	0.06	3	NM_015963	61	0.00	0	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Silent	SNP	ENST00000407315.1	37	CCDS2551.1																																																																																					0.642	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257267.3		NM_015963	
PREX1	57580	mdanderson.org	37	20	47324813	47324813	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr20:47324813G>T	ENST00000371941.3	-	6	790	c.768C>A	c.(766-768)caC>caA	p.H256Q	PREX1_ENST00000396220.1_Missense_Mutation_p.H256Q	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	256					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGCCTTCGATGTGGGACTGCA	0.622																																					p.H256Q													.	.			0			c.C768A												91.0	89.0	89.0					20																	47324813		2203	4300	6503	SO:0001583	missense	57580	exon6			TTCGATGTGGGAC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.768C>A	20.37:g.47324813G>T	ENSP00000361009:p.His256Gln		35	0	0		47	0.06	3	NM_020820	10	0.00	0	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.740906	0.69304	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	D;D	0.87256	-2.23;-2.23	5.64	5.64	0.86602	Dbl homology (DH) domain (2);	0.000000	0.64402	U	0.000020	D	0.86347	0.5911	N	0.24115	0.695	0.58432	D	0.99999	D	0.56968	0.978	P	0.57502	0.822	D	0.86358	0.1715	10	0.45353	T	0.12	.	13.9252	0.63958	0.0724:0.0:0.9276:0.0	.	256	Q8TCU6	PREX1_HUMAN	Q	256	ENSP00000361009:H256Q;ENSP00000379522:H256Q	ENSP00000361009:H256Q	H	-	3	2	PREX1	46758220	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	2.991000	0.49409	2.657000	0.90304	0.655000	0.94253	CAC			0.622	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079623.1		NM_020820	
RNF114	55905	mdanderson.org	37	20	48558160	48558160	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr20:48558160G>A	ENST00000244061.2	+	2	205	c.203G>A	c.(202-204)cGc>cAc	p.R68H	snoU13_ENST00000459122.1_RNA	NM_018683.3	NP_061153.1	Q9Y508	RN114_HUMAN	ring finger protein 114	68					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R68H(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5						GGGGTGTGTCGCAGCGCTCTG	0.557																																					p.R68H													RNF114,NS,carcinoma,0,1	RNF114	0	1	1	Substitution - Missense(1)	endometrium(1)	c.G203A												118.0	118.0	118.0					20																	48558160		2203	4300	6503	SO:0001583	missense	55905	exon2			TGTGTCGCAGCGC	AF265215	CCDS33482.1	20q13	2013-01-09	2008-06-16	2008-06-16	ENSG00000124226	ENSG00000124226		"""RING-type (C3HC4) zinc fingers"""	13094	protein-coding gene	gene with protein product		612451	"""zinc finger protein 313"""	ZNF313		18364390	Standard	NM_018683		Approved	PSORS12	uc002xux.3	Q9Y508	OTTHUMG00000032709	ENST00000244061.2:c.203G>A	20.37:g.48558160G>A	ENSP00000244061:p.Arg68His		38	0	0		47	0.06	3	NM_018683	132	0.00	0	B2RDQ9|B4DWY5|E1P627|Q6N0B0	Missense_Mutation	SNP	ENST00000244061.2	37	CCDS33482.1	.	.	.	.	.	.	.	.	.	.	G	34	5.385817	0.95967	.	.	ENSG00000124226	ENST00000449816;ENST00000244061	T	0.23950	1.88	5.86	5.86	0.93980	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);	0.000000	0.85682	D	0.000000	T	0.58708	0.2141	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.942;0.98	T	0.64774	-0.6328	10	0.72032	D	0.01	-12.4235	17.0991	0.86644	0.0:0.0:1.0:0.0	.	68;68	Q9Y508-2;Q9Y508	.;RN114_HUMAN	H	68	ENSP00000244061:R68H	ENSP00000244061:R68H	R	+	2	0	RNF114	47991567	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.797000	0.85911	2.771000	0.95319	0.650000	0.86243	CGC			0.557	RNF114-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079663.1		NM_018683	
SON	6651	hgsc.bcm.edu	37	21	34923934	34923934	+	Silent	SNP	T	T	C	rs200724919	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr21:34923934T>C	ENST00000356577.4	+	3	2872	c.2397T>C	c.(2395-2397)agT>agC	p.S799S	SON_ENST00000290239.6_Silent_p.S799S|SON_ENST00000381679.4_Silent_p.S799S|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Silent_p.S799S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	799	17 X 10 AA tandem repeats of L-A-[ST]- [NSG]-[TS]-MDSQM.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S799S(4)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TAGCAACCAGTTCCATGGACT	0.507													T|||	3	0.000599042	0.0	0.0	5008	,	,		21644	0.0		0.001	False		,,,				2504	0.002				p.S799S													SON_ENST00000300278,NS,carcinoma,0,4	SON_ENST00000300278	0	4	4	Substitution - coding silent(4)	endometrium(4)	c.T2397C												176.0	173.0	174.0					21																	34923934		2203	4300	6503	SO:0001819	synonymous_variant	6651	exon3			AACCAGTTCCATG	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.2397T>C	21.37:g.34923934T>C			84	0.0238095238	2		152	0.05	8	NM_032195	7	0.00	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1																																																																																					0.507	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000140978.2		NM_138927	
ERG	2078	ucsc.edu;bcgsc.ca	37	21	39947610	39947610	+	Silent	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr21:39947610G>T	ENST00000417133.2	-	3	200	c.15C>A	c.(13-15)gtC>gtA	p.V5V	ERG_ENST00000398919.2_Silent_p.V5V|ERG_ENST00000398911.1_Silent_p.V5V|ERG_ENST00000398910.1_Silent_p.V5V|ERG_ENST00000442448.1_Silent_p.V5V|ERG_ENST00000485493.1_5'UTR|ERG_ENST00000398897.1_5'UTR	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	0					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CTGGGTCCGGGACAGTCTGAA	0.483			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																p.V5V	Esophageal Squamous(130;336 1700 3010 3083 40589)			Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	.	ERG	78		0			c.C15A												109.0	89.0	96.0					21																	39947610		2203	4300	6503	SO:0001819	synonymous_variant	2078	exon3			GTCCGGGACAGTC		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.15C>A	21.37:g.39947610G>T			28	0	0		28	0.14	4	NM_004449	1	0.00	0	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	ENST00000417133.2	37	CCDS46648.1																																																																																					0.483	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000207532.2		NM_182918	
SLC9B1P4	644768	bcgsc.ca	37	22	16954848	16954848	+	IGR	SNP	A	A	G	rs200170496		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr22:16954848A>G								AP000539.2 (378657 upstream) : KB-67B5.17 (47100 downstream)																							TCCAAGCCCAACTCGTATTAG	0.348																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	644768	.			AGCCCAACTCGTA																													22.37:g.16954848A>G			54	0	0		93	0.10	9	.	0		0		RNA	SNP		37																																																																																					0	0.348										
ZNF74	7625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	20759727	20759727	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr22:20759727A>T	ENST00000400451.2	+	5	918	c.404A>T	c.(403-405)cAg>cTg	p.Q135L	ZNF74_ENST00000357502.5_Silent_p.P140P|ZNF74_ENST00000405993.1_Missense_Mutation_p.Q103L|ZNF74_ENST00000403682.3_Silent_p.P106P|ZNF74_ENST00000356671.5_Missense_Mutation_p.Q135L	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	135					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GAACCGGCCCAGGAGCCCATC	0.627																																					p.Q135L													.	.			0			c.A404T												46.0	52.0	50.0					22																	20759727		1868	4089	5957	SO:0001583	missense	7625	exon5			CGGCCCAGGAGCC	X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.404A>T	22.37:g.20759727A>T	ENSP00000383301:p.Gln135Leu		108	0	0		196	0.12	23	NM_003426	6	0.67	4	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	ENST00000400451.2	37	CCDS42982.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.847144	0.32606	.	.	ENSG00000185252	ENST00000400451;ENST00000420626;ENST00000356671;ENST00000405993	T;T;T;T	0.58797	3.36;0.31;3.36;3.31	4.59	-6.35	0.01975	.	1.046330	0.07647	N	0.931250	T	0.35998	0.0951	L	0.39245	1.2	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24728	-1.0152	10	0.29301	T	0.29	-17.8933	0.1931	0.00136	0.2866:0.2141:0.1597:0.3396	.	135	Q16587	ZNF74_HUMAN	L	135;32;135;103	ENSP00000383301:Q135L;ENSP00000397011:Q32L;ENSP00000349098:Q135L;ENSP00000385855:Q103L	ENSP00000349098:Q135L	Q	+	2	0	ZNF74	19089727	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.482000	0.02320	-1.068000	0.03156	-1.142000	0.01873	CAG			0.627	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319648.2		NM_003426	
OSBP2	23762	mdanderson.org	37	22	31285598	31285598	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr22:31285598G>T	ENST00000332585.6	+	7	1702	c.1598G>T	c.(1597-1599)cGg>cTg	p.R533L	OSBP2_ENST00000535268.1_Missense_Mutation_p.R77L|OSBP2_ENST00000407373.1_Missense_Mutation_p.R360L|OSBP2_ENST00000403222.3_Missense_Mutation_p.R367L|OSBP2_ENST00000437268.2_Missense_Mutation_p.R275L|OSBP2_ENST00000446658.2_Missense_Mutation_p.R532L|OSBP2_ENST00000401475.1_Missense_Mutation_p.R166L|OSBP2_ENST00000382310.3_Intron	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	533					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						TGCATCGGCCGGGAGCTCTCC	0.607																																					p.R533L													.	.			0			c.G1598T												84.0	93.0	90.0					22																	31285598		2060	4225	6285	SO:0001583	missense	23762	exon7			TCGGCCGGGAGCT		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.1598G>T	22.37:g.31285598G>T	ENSP00000332576:p.Arg533Leu		45	0	0		77	0.05	4	NM_030758	13	0.00	0	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Missense_Mutation	SNP	ENST00000332585.6	37	CCDS43002.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.54|16.54	3.150512|3.150512	0.57151|0.57151	.|.	.|.	ENSG00000184792|ENSG00000184792	ENST00000454145;ENST00000453621;ENST00000431368|ENST00000403222;ENST00000407373;ENST00000332585;ENST00000446658;ENST00000401475;ENST00000424224;ENST00000437268;ENST00000535268;ENST00000452656	.|T;T;T;T;T;T;T;T;T	.|0.29397	.|1.57;1.57;1.57;1.57;1.57;1.65;1.57;1.57;1.57	5.03|5.03	2.86|2.86	0.33363|0.33363	.|.	.|0.056021	.|0.64402	.|D	.|0.000001	T|T	0.24967|0.24967	0.0606|0.0606	N|N	0.12471|0.12471	0.22|0.22	0.80722|0.80722	D|D	1|1	.|P;P;P;P;D;D	.|0.56746	.|0.706;0.75;0.75;0.75;0.977;0.977	.|P;P;P;P;P;P	.|0.56960	.|0.482;0.617;0.617;0.617;0.81;0.81	T|T	0.06250|0.06250	-1.0837|-1.0837	5|10	.|0.62326	.|D	.|0.03	-24.3652|-24.3652	4.5315|4.5315	0.12008|0.12008	0.4076:0.0:0.5924:0.0|0.4076:0.0:0.5924:0.0	.|.	.|275;367;275;360;532;533	.|F5H2A3;B4DKE4;B4DK24;Q6ZN50;Q0VF99;Q969R2	.|.;.;.;.;.;OSBP2_HUMAN	W|L	195;204;205|367;360;533;532;166;167;275;77;164	.|ENSP00000384213:R367L;ENSP00000385237:R360L;ENSP00000332576:R533L;ENSP00000392080:R532L;ENSP00000385254:R166L;ENSP00000388575:R167L;ENSP00000389200:R275L;ENSP00000438713:R77L;ENSP00000409838:R164L	.|ENSP00000332576:R533L	G|R	+|+	1|2	0|0	OSBP2|OSBP2	29615598|29615598	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.045000|0.045000	0.14185|0.14185	7.400000|7.400000	0.79949|0.79949	1.362000|1.362000	0.46000|0.46000	-0.136000|-0.136000	0.14681|0.14681	GGG|CGG			0.607	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000321547.2		NM_030758	
RPN1	6184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	128344482	128344482	+	Silent	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr3:128344482G>A	ENST00000296255.3	-	8	1338	c.1290C>T	c.(1288-1290)ttC>ttT	p.F430F	RPN1_ENST00000497289.1_Silent_p.F258F|RPN1_ENST00000490166.1_5'Flank	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	430					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		GCACCTTGTTGAACGTGTAGT	0.577			T	EVI1	AML																																p.F430F				Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	.	.			0			c.C1290T												151.0	147.0	148.0					3																	128344482		2203	4300	6503	SO:0001819	synonymous_variant	6184	exon8			CTTGTTGAACGTG		CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.1290C>T	3.37:g.128344482G>A			66	0	0		84	0.29	24	NM_002950	414	0.30	124	B2R5Z0|D3DNB6|Q68DT1	Silent	SNP	ENST00000296255.3	37	CCDS3051.1																																																																																					0.577	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356934.2		NM_002950	
MUC4	4585	ucsc.edu	37	3	195510666	195510666	+	Silent	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr3:195510666G>A	ENST00000463781.3	-	2	8244	c.7785C>T	c.(7783-7785)gtC>gtT	p.V2595V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.V2595V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGTGTCGGTGACAGGAAGAG	0.582																																					p.V2595V													.	MUC4	1505		0			c.C7785T												15.0	13.0	14.0					3																	195510666		642	1558	2200	SO:0001819	synonymous_variant	4585	exon2			GTCGGTGACAGGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7785C>T	3.37:g.195510666G>A			38	0.0526315789	2		68	0.09	6	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																					0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
ANKRD17	26057	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	73958006	73958006	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr4:73958006T>C	ENST00000358602.4	-	29	5455	c.5339A>G	c.(5338-5340)gAa>gGa	p.E1780G	ANKRD17_ENST00000330838.6_Missense_Mutation_p.E1529G|ANKRD17_ENST00000509867.2_Missense_Mutation_p.E1667G	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	1780	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCTTGTTGATTCAGTGCCACC	0.313																																					p.E1780G													.	ANKRD17	214		0			c.A5339G												49.0	52.0	51.0					4																	73958006		2203	4300	6503	SO:0001583	missense	26057	exon29			GTTGATTCAGTGC	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.5339A>G	4.37:g.73958006T>C	ENSP00000351416:p.Glu1780Gly		71	0.014084507	1		68	0.37	25	NM_032217	0		0	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065614	0.55539	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000426917	T;T;T	0.38240	1.15;1.15;1.15	5.28	5.28	0.74379	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.64402	D	0.000003	T	0.52613	0.1745	L	0.45137	1.4	0.54753	D	0.99998	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.81914	0.991;0.991;0.995;0.995	T	0.55134	-0.8188	10	0.87932	D	0	.	15.3678	0.74538	0.0:0.0:0.0:1.0	.	1779;1529;1780;1667	O75179-2;G5E964;O75179;E7EUV3	.;.;ANR17_HUMAN;.	G	1780;1187;1529;1667;164	ENSP00000351416:E1780G;ENSP00000332265:E1529G;ENSP00000427151:E1667G	ENSP00000332265:E1529G	E	-	2	0	ANKRD17	74176870	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.525000	0.81892	2.219000	0.72066	0.533000	0.62120	GAA			0.313	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000362475.1		NM_032217	
CD14	929	mdanderson.org	37	5	140011835	140011835	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr5:140011835G>A	ENST00000302014.6	-	2	1363	c.734C>T	c.(733-735)gCg>gTg	p.A245V	CD14_ENST00000401743.2_Missense_Mutation_p.A245V	NM_000591.3	NP_000582.1	P08571	CD14_HUMAN	CD14 molecule	245					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|phagocytosis (GO:0006909)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endocytosis (GO:0045807)|positive regulation of tumor necrosis factor production (GO:0032760)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to magnesium ion (GO:0032026)|response to tumor necrosis factor (GO:0034612)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|opsonin receptor activity (GO:0001847)|peptidoglycan receptor activity (GO:0016019)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTGCCGCCGCCAGTGCGGC	0.657																																					p.A245V													.	.			0			c.C734T												30.0	33.0	32.0					5																	140011835		2197	4291	6488	SO:0001583	missense	929	exon3			GCCGCCGCCAGTG		CCDS4232.1	5q31.3	2012-09-20	2006-03-28		ENSG00000170458	ENSG00000170458		"""CD molecules"""	1628	protein-coding gene	gene with protein product		158120	"""CD14 antigen"""			2472171, 2462937	Standard	NM_000591		Approved		uc003lgi.2	P08571	OTTHUMG00000129507	ENST00000302014.6:c.734C>T	5.37:g.140011835G>A	ENSP00000304236:p.Ala245Val		35	0	0		39	0.08	3	NM_001174105	300	0.00	1	Q53XT5|Q96FR6|Q96L99|Q9UNS3	Missense_Mutation	SNP	ENST00000302014.6	37	CCDS4232.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464069	0.43736	.	.	ENSG00000170458	ENST00000302014;ENST00000401743	D;D	0.90732	-2.72;-2.72	5.96	1.63	0.23807	.	0.569106	0.15611	N	0.253397	D	0.92401	0.7588	M	0.82323	2.585	0.20703	N	0.999861	D	0.89917	1.0	P	0.61328	0.887	T	0.82313	-0.0519	10	0.17832	T	0.49	-15.4072	4.5599	0.12154	0.0797:0.1244:0.5152:0.2807	.	245	P08571	CD14_HUMAN	V	245	ENSP00000304236:A245V;ENSP00000385519:A245V	ENSP00000304236:A245V	A	-	2	0	CD14	139992019	0.002000	0.14202	0.057000	0.19452	0.088000	0.18126	-0.225000	0.09151	0.382000	0.24878	-0.176000	0.13171	GCG			0.657	CD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251681.2		NM_000591	
EBF1	1879	broad.mit.edu	37	5	158523398	158523398	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr5:158523398T>C	ENST00000313708.6	-	3	590	c.308A>G	c.(307-309)aAg>aGg	p.K103R	EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.K103R|EBF1_ENST00000517373.1_Missense_Mutation_p.K103R	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	103					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTTATTGGTCTTTTCGCTGTT	0.567			T	HMGA2	lipoma																																p.K103R				Dom	yes		5	5q34	1879	early B-cell factor 1		M	EBF1,NS,carcinoma,+1,1	EBF1	110	1	0			c.A308G												114.0	102.0	106.0					5																	158523398		2203	4300	6503	SO:0001583	missense	1879	exon3			TTGGTCTTTTCGC	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.308A>G	5.37:g.158523398T>C	ENSP00000322898:p.Lys103Arg		49	0	0		70	0.04	3	NM_024007	0		0	Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	37	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.923039	0.92319	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.52295	0.67;0.67;0.68	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.59838	0.2223	L	0.61218	1.895	0.51482	D	0.999924	D;B;B	0.59357	0.985;0.008;0.045	P;B;B	0.54815	0.761;0.021;0.114	T	0.63310	-0.6666	10	0.59425	D	0.04	-7.1246	15.338	0.74273	0.0:0.0:0.0:1.0	.	103;103;103	A8K0Z7;Q9UH73;Q9UH73-2	.;COE1_HUMAN;.	R	103	ENSP00000322898:K103R;ENSP00000370029:K103R;ENSP00000428020:K103R	ENSP00000322898:K103R	K	-	2	0	EBF1	158455976	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.221000	0.72243	2.099000	0.63709	0.533000	0.62120	AAG			0.567	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000252649.1		NM_024007	
AC136604.1	0	broad.mit.edu	37	5	179078735	179078735	+	Missense_Mutation	SNP	T	T	C	rs571082086		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr5:179078735T>C	ENST00000425471.1	+	2	218	c.218T>C	c.(217-219)cTg>cCg	p.L73P	AC136604.1_ENST00000418535.2_Missense_Mutation_p.L73P																kidney(1)	1						CGGGCTCCCCTGGCTCCTCTG	0.632																																					.													.	.			0			.																																									SO:0001583	missense	0	.			CTCCCCTGGCTCC																												ENST00000425471.1:c.218T>C	5.37:g.179078735T>C	ENSP00000388857:p.Leu73Pro		78	0.0128205128	1		95	0.07	7	.	0		0		Missense_Mutation	SNP	ENST00000425471.1	37		.	.	.	.	.	.	.	.	.	.	C	2.694	-0.272460	0.05716	.	.	ENSG00000228259	ENST00000418535;ENST00000425471	T;T	0.51817	0.69;1.88	1.1	-0.77	0.11005	.	.	.	.	.	T	0.18002	0.0432	.	.	.	.	.	.	.	.	.	.	.	.	T	0.36841	-0.9731	5	0.02654	T	1	.	4.9002	0.13771	0.0:0.3733:0.0:0.6267	.	.	.	.	P	73	ENSP00000404996:L73P;ENSP00000388857:L73P	ENSP00000404996:L73P	L	+	2	0	AC136604.1	179011341	0.040000	0.19996	0.000000	0.03702	0.009000	0.06853	-0.477000	0.06583	-0.891000	0.03940	-0.479000	0.04858	CTG			0.632	AC136604.1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding					
MUC21	394263	mdanderson.org	37	6	30954393	30954393	+	Silent	SNP	T	T	C	rs9262330		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr6:30954393T>C	ENST00000376296.3	+	2	682	c.441T>C	c.(439-441)gcT>gcC	p.A147A	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	147	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CCAGTGGGGCTAGCACAGCCA	0.627																																					p.A147A													.	.			0			c.T441C												153.0	144.0	147.0					6																	30954393		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			TGGGGCTAGCACA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.441T>C	6.37:g.30954393T>C			39	0.0256410256	1		53	0.06	3	NM_001010909	0		0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.627	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
MOCS1	4337	mdanderson.org	37	6	39883820	39883820	+	Missense_Mutation	SNP	C	C	T	rs564888351		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr6:39883820C>T	ENST00000340692.5	-	4	578	c.575G>A	c.(574-576)cGc>cAc	p.R192H	MOCS1_ENST00000432280.2_Missense_Mutation_p.R163H|MOCS1_ENST00000373175.4_Missense_Mutation_p.R163H|MOCS1_ENST00000373188.2_Missense_Mutation_p.R192H|MOCS1_ENST00000373195.3_Missense_Mutation_p.R105H|MOCS1_ENST00000425303.2_Missense_Mutation_p.R192H|MOCS1_ENST00000373186.4_Missense_Mutation_p.R192H|MOCS1_ENST00000308559.7_Missense_Mutation_p.R192H			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	192	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					ACCTTTCCTGCGGACAATGAA	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		18170	0.0		0.0	False		,,,				2504	0.001				p.R192H	NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)												.	.			0			c.G575A												34.0	28.0	30.0					6																	39883820		2203	4300	6503	SO:0001583	missense	4337	exon4			TTCCTGCGGACAA	AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.575G>A	6.37:g.39883820C>T	ENSP00000344794:p.Arg192His		43	0	0		55	0.05	3	NM_001075098	9	0.00	0	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	ENST00000340692.5	37		.	.	.	.	.	.	.	.	.	.	C	35	5.432078	0.96150	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000373195;ENST00000340692;ENST00000425303;ENST00000432280	D;D;D;D;D;D;D;D	0.92858	-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12;-3.12	5.67	5.67	0.87782	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	D	0.96935	0.8999	M	0.91249	3.19	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.997;0.998;0.997;0.998	D	0.97089	0.9789	9	.	.	.	-25.8856	19.3581	0.94422	0.0:1.0:0.0:0.0	.	192;192;192;192;192	Q9NZB8-2;Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;.;MOCS1_HUMAN;.;.	H	192;192;163;192;105;192;192;163	ENSP00000362282:R192H;ENSP00000309843:R192H;ENSP00000362270:R163H;ENSP00000362284:R192H;ENSP00000362291:R105H;ENSP00000344794:R192H;ENSP00000416478:R192H;ENSP00000410809:R163H	.	R	-	2	0	MOCS1	39991798	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.783000	0.85696	2.675000	0.91044	0.650000	0.86243	CGC			0.617	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000040476.2		NM_005943	
FAM20C	56975	mdanderson.org	37	7	195682	195682	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr7:195682C>T	ENST00000313766.5	+	2	965	c.734C>T	c.(733-735)gCc>gTc	p.A245V	AC093627.12_ENST00000467050.1_RNA|FAM20C_ENST00000471328.1_3'UTR	NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	245					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		CACAACCCGGCCATCGAGGCC	0.632																																					p.A245V													.	.			0			c.C734T												65.0	71.0	69.0					7																	195682		2099	4207	6306	SO:0001583	missense	56975	exon2			ACCCGGCCATCGA	BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.734C>T	7.37:g.195682C>T	ENSP00000322323:p.Ala245Val		34	0	0		40	0.08	3	NM_020223	41	0.00	0	A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Missense_Mutation	SNP	ENST00000313766.5	37	CCDS47522.1	.	.	.	.	.	.	.	.	.	.	C	9.688	1.151115	0.21371	.	.	ENSG00000177706	ENST00000313766	T	0.75821	-0.97	4.81	4.81	0.61882	.	0.109428	0.35495	N	0.003169	T	0.50650	0.1628	N	0.01800	-0.715	0.49798	D	0.999828	B	0.12630	0.006	B	0.10450	0.005	T	0.48399	-0.9039	10	0.21540	T	0.41	.	17.8064	0.88602	0.0:1.0:0.0:0.0	.	245	Q8IXL6	DMP4_HUMAN	V	245	ENSP00000322323:A245V	ENSP00000322323:A245V	A	+	2	0	FAM20C	290765	0.995000	0.38212	0.121000	0.21740	0.095000	0.18619	3.086000	0.50159	2.392000	0.81423	0.561000	0.74099	GCC			0.632	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322476.2		NM_020223	
PMS2P4	5382	broad.mit.edu	37	7	66767610	66767611	+	RNA	INS	-	-	G	rs71293166|rs12531701	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr7:66767610_66767611insG	ENST00000414507.1	-	0	0				STAG3L4_ENST00000416602.2_RNA					postmeiotic segregation increased 2 pseudogene 4																		CACCGGACTGCTTTTTTTTTTT	0.545																																					.													.	.			0			.																																											0	.			GGACTGCTTTTTT	D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66767610_66767611insG			13	0	0		15	0.33	5	.	1	0.00	0		RNA	INS	ENST00000414507.1	37																																																																																						0.545	PMS2P4-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000346632.1		NR_022007	
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	121682713	121682713	+	Silent	SNP	G	G	A			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr7:121682713G>A	ENST00000393386.2	+	22	6264	c.5853G>A	c.(5851-5853)caG>caA	p.Q1951Q	PTPRZ1_ENST00000449182.1_Silent_p.Q1084Q	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1951	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GTATGTTGCAGCAGATTCAAC	0.333																																					p.Q1951Q													.	.			0			c.G5853A												124.0	106.0	112.0					7																	121682713		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon22			GTTGCAGCAGATT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5853G>A	7.37:g.121682713G>A			160	0	0		133	0.26	34	NM_002851	7	0.14	1	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																					0.333	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347288.1		NM_002851	
LURAP1L	286343	hgsc.bcm.edu	37	9	12775864	12775864	+	Silent	SNP	C	C	T	rs534390977		TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr9:12775864C>T	ENST00000319264.3	+	1	845	c.150C>T	c.(148-150)ggC>ggT	p.G50G	LURAP1L_ENST00000489107.1_3'UTR|RP11-3L8.3_ENST00000417638.1_RNA	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	53	Gly-rich.							p.G50_G52delGGG(1)									gtggtggtggcggcggcggcg	0.687																																					p.G50G													.	.			1	Deletion - In frame(1)	large_intestine(1)	c.C150T												4.0	5.0	5.0					9																	12775864		1985	3885	5870	SO:0001819	synonymous_variant	286343	exon1			TGGTGGCGGCGGC	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.150C>T	9.37:g.12775864C>T			48	0	0		69	0.10	7	NM_203403	3	0.00	0	Q5VZX7|Q8N923|Q8NCG2	Silent	SNP	ENST00000319264.3	37	CCDS6473.1																																																																																					0.687	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051730.1		NM_203403	
SET	6418	mdanderson.org	37	9	131446269	131446269	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr9:131446269G>T	ENST00000372692.4	+	1	336	c.95G>T	c.(94-96)gGc>gTc	p.G32V	SET_ENST00000409104.3_5'Flank	NM_001122821.1	NP_001116293.1	Q01105	SET_HUMAN	SET nuclear proto-oncogene	32	Dimerization.				DNA replication (GO:0006260)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of catalytic activity (GO:0043086)|negative regulation of histone acetylation (GO:0035067)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|nucleosome assembly (GO:0006334)|nucleosome disassembly (GO:0006337)|regulation of catalytic activity (GO:0050790)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone binding (GO:0042393)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(2)|kidney(1)|lung(2)	5		Myeloproliferative disorder(178;0.204)		GBM - Glioblastoma multiforme(294;3.1e-09)		GCCTCTGCAGGCTTGCCGAAG	0.517			T	NUP214	AML																																p.G32V				Dom	yes		9	9q34	6418	SET translocation		L	.	.			0			c.G95T												30.0	33.0	32.0					9																	131446269		1554	3529	5083	SO:0001583	missense	6418	exon1			CTGCAGGCTTGCC	M93651	CCDS6907.1, CCDS48037.1, CCDS59149.1, CCDS59150.1	9q34	2014-06-25	2014-06-25		ENSG00000119335	ENSG00000119335			10760	protein-coding gene	gene with protein product	"""protein phosphatase type 2A inhibitor"", ""Template-Activating Factor-I, chromatin remodelling factor"""	600960	"""SET translocation (myeloid leukemia-associated)"""			1630450, 8626647	Standard	NM_003011		Approved	PHAPII, 2PP2A, IPP2A2	uc022bol.1	Q01105	OTTHUMG00000020755	ENST00000372692.4:c.95G>T	9.37:g.131446269G>T	ENSP00000361777:p.Gly32Val		24	0	0		41	0.07	3	NM_001122821	243	0.00	0	A5A5H4|A6NGV1|B4DUE2|Q15541|Q5VXV1|Q5VXV2|Q6FHZ5	Missense_Mutation	SNP	ENST00000372692.4	37	CCDS48037.1	.	.	.	.	.	.	.	.	.	.	G	9.399	1.077605	0.20227	.	.	ENSG00000119335	ENST00000454747;ENST00000372692	T	0.33865	1.39	3.36	-0.0433	0.13860	.	0.179583	0.49305	D	0.000152	T	0.19805	0.0476	N	0.24115	0.695	0.09310	N	0.999995	B	0.19706	0.038	B	0.14023	0.01	T	0.13469	-1.0508	10	0.66056	D	0.02	.	5.617	0.17436	0.7002:0.0:0.2998:0.0	.	32	Q01105	SET_HUMAN	V	32	ENSP00000361777:G32V	ENSP00000361777:G32V	G	+	2	0	SET	130486090	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.104000	0.10923	-0.008000	0.14320	0.591000	0.81541	GGC			0.517	SET-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000054476.2		NM_001122821	
CELP	1057	broad.mit.edu	37	9	135962465	135962465	+	RNA	DEL	T	T	-	rs10901234|rs386739105|rs74753118|rs386739104	byFrequency	TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr9:135962465delT	ENST00000411440.2	+	0	972					NR_001275.2				carboxyl ester lipase pseudogene																		AGGATGCCCCTGTGCCCCTCA	0.677													T|T|-|deletion	2605	0.520168	0.3169	0.6527	5008	,	,		13192	0.6647		0.5915	False		,,,				2504	0.4785				.													.	.			0			.																																											0	.			TGCCCCTGTGCCC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962465delT			8	0	0		7	0.57	4	.	11	0.18	2		RNA	DEL	ENST00000411440.2	37																																																																																						0.677	CELP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000339837.1		NM_001808	
SLC34A3	142680	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140129149	140129149	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chr9:140129149C>T	ENST00000538474.1	+	12	1525	c.1301C>T	c.(1300-1302)gCc>gTc	p.A434V	SLC34A3_ENST00000361134.2_Missense_Mutation_p.A434V	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	434					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GCTGCCCTGGCCAGCCCCGCA	0.667																																					p.A434V													.	SLC34A3	32		0			c.C1301T												49.0	41.0	43.0					9																	140129149		2200	4296	6496	SO:0001583	missense	142680	exon12			CCCTGGCCAGCCC	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.1301C>T	9.37:g.140129149C>T	ENSP00000442397:p.Ala434Val		27	0	0		31	0.16	5	NM_001177317	1	0.00	0	A2BFA1	Missense_Mutation	SNP	ENST00000538474.1	37	CCDS7038.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668337	0.88348	.	.	ENSG00000198569	ENST00000538474;ENST00000361134	D;D	0.86230	-2.09;-2.09	3.33	3.33	0.38152	.	0.000000	0.49305	D	0.000159	D	0.89181	0.6642	L	0.46157	1.445	0.47737	D	0.999505	D	0.61697	0.99	D	0.63113	0.911	D	0.89015	0.3431	10	0.49607	T	0.09	-8.0842	12.5156	0.56030	0.0:1.0:0.0:0.0	.	434	Q8N130	NPT2C_HUMAN	V	434	ENSP00000442397:A434V;ENSP00000355353:A434V	ENSP00000355353:A434V	A	+	2	0	SLC34A3	139248970	1.000000	0.71417	0.998000	0.56505	0.903000	0.53119	5.602000	0.67612	1.861000	0.53984	0.448000	0.29417	GCC			0.667	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254712.1		NM_080877	
ZDHHC15	158866	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	74698772	74698772	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chrX:74698772G>T	ENST00000373367.3	-	3	442	c.212C>A	c.(211-213)aCc>aAc	p.T71N	ZDHHC15_ENST00000373361.3_Missense_Mutation_p.T71N|ZDHHC15_ENST00000541184.1_Missense_Mutation_p.T62N	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	71					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						CTTCCAGTAGGTCCAGGTAAA	0.338																																					p.T71N													.	ZDHHC15	65		0			c.C212A												82.0	68.0	72.0					X																	74698772		2203	4300	6503	SO:0001583	missense	158866	exon3			CAGTAGGTCCAGG	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.212C>A	X.37:g.74698772G>T	ENSP00000362465:p.Thr71Asn		28	0	0		73	0.07	5	NM_144969	6	0.00	0	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	ENST00000373367.3	37	CCDS14430.1	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921273	0.73213	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.24350	1.86;1.86;1.86	5.73	5.73	0.89815	.	0.046482	0.85682	D	0.000000	T	0.35038	0.0918	N	0.25245	0.725	0.52099	D	0.999943	D;B;P	0.71674	0.998;0.132;0.949	D;B;P	0.66351	0.943;0.105;0.777	T	0.08973	-1.0696	10	0.49607	T	0.09	-11.4774	14.0773	0.64897	0.0:0.0:1.0:0.0	.	62;62;71	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	N	71;62;71	ENSP00000362465:T71N;ENSP00000445420:T62N;ENSP00000362459:T71N	ENSP00000362459:T71N	T	-	2	0	ZDHHC15	74615497	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.168000	0.64978	2.397000	0.81536	0.544000	0.68410	ACC			0.338	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057283.1		NM_144969	
HCFC1	3054	bcgsc.ca	37	X	153217302	153217302	+	Silent	SNP	C	C	T			TCGA-2G-AALN-01A-11D-A42Y-10	TCGA-2G-AALN-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	540debee-4ab6-4a72-a38d-21a2f4f90905	b8f3aa4c-e160-4a5a-a935-b66ecb5011f2	g.chrX:153217302C>T	ENST00000310441.7	-	20	6216	c.5250G>A	c.(5248-5250)acG>acA	p.T1750T	HCFC1_ENST00000354233.3_Silent_p.T1681T|HCFC1_ENST00000369984.4_Silent_p.T1795T	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1750					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTCAGTGGCCGTTGAGGGCA	0.657																																					p.T1750T													.	HCFC1	284		0			c.G5250A												17.0	19.0	18.0					X																	153217302		2002	4120	6122	SO:0001819	synonymous_variant	3054	exon20			AGTGGCCGTTGAG		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5250G>A	X.37:g.153217302C>T			32	0	0		67	0.06	4	NM_005334	44	0.00	0	Q6P4G5	Silent	SNP	ENST00000310441.7	37	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	C	4.647	0.120342	0.08881	.	.	ENSG00000172534	ENST00000444191	.	.	.	5.03	-7.64	0.01286	.	.	.	.	.	T	0.62368	0.2422	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67883	-0.5555	4	.	.	.	.	15.9763	0.80066	0.0:0.6473:0.0:0.3527	.	.	.	.	S	326	.	.	G	-	1	0	HCFC1	152870496	0.006000	0.16342	0.415000	0.26534	0.414000	0.31173	-1.295000	0.02764	-2.003000	0.00962	-0.527000	0.04329	GGC			0.657	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061099.4		NM_005334	
