#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SCNN1D	6339	broad.mit.edu	37	1	1222192	1222192	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:1222192C>T	ENST00000338555.2	+	5	1608	c.464C>T	c.(463-465)gCc>gTc	p.A155V	SCNN1D_ENST00000379116.5_Missense_Mutation_p.A319V|SCNN1D_ENST00000400928.3_Missense_Mutation_p.A155V|SCNN1D_ENST00000325425.8_Missense_Mutation_p.A221V			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	155					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	GACGAGTTTGCCAGGGAGAAC	0.677																																					p.A319V													.	SCNN1D	60		0			c.C956T												40.0	45.0	44.0					1																	1222192		2198	4290	6488	SO:0001583	missense	6339	exon8			AGTTTGCCAGGGA	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.464C>T	1.37:g.1222192C>T	ENSP00000339504:p.Ala155Val		279	0	0		183	0.02	4	NM_001130413	6	0.00	0	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Missense_Mutation	SNP	ENST00000338555.2	37		.	.	.	.	.	.	.	.	.	.	C	14.81	2.645092	0.47258	.	.	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	4.38	2.47	0.30058	.	0.426470	0.19069	U	0.123551	T	0.63510	0.2517	L	0.43152	1.355	0.09310	N	1	D;D	0.62365	0.975;0.991	P;P	0.58660	0.843;0.837	T	0.51702	-0.8672	10	0.44086	T	0.13	.	7.6135	0.28144	0.0:0.7866:0.0:0.2134	.	155;319	P51172;A6NNF7	SCNND_HUMAN;.	V	186;319;155;221;155	ENSP00000368411:A319V;ENSP00000339504:A155V;ENSP00000321594:A221V;ENSP00000383717:A155V	ENSP00000321594:A221V	A	+	2	0	SCNN1D	1212055	0.000000	0.05858	0.033000	0.17914	0.020000	0.10135	0.063000	0.14410	0.823000	0.34589	0.313000	0.20887	GCC			0.677	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000005802.2		NM_002978	
SSU72	29101	mdanderson.org	37	1	1477477	1477477	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:1477477C>T	ENST00000291386.3	-	5	865	c.554G>A	c.(553-555)cGc>cAc	p.R185H	TMEM240_ENST00000425828.1_5'Flank|TMEM240_ENST00000378733.4_5'Flank	NM_014188.2	NP_054907.1	Q9NP77	SSU72_HUMAN	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	185					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|mRNA polyadenylation (GO:0006378)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)	p.R185H(1)		large_intestine(2)|lung(5)	7	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CAGAAAGGTGCGGCCACTCTT	0.567																																					p.R185H													SSU72,caecum,carcinoma,0,1	SSU72	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.G554A												112.0	78.0	90.0					1																	1477477		2201	4296	6497	SO:0001583	missense	29101	exon5			AAGGTGCGGCCAC	AJ276409	CCDS32.1	1p36	2010-03-24	2006-04-04		ENSG00000160075	ENSG00000160075			25016	protein-coding gene	gene with protein product			"""Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)"""			15125841, 15659578	Standard	NM_014188		Approved	HSPC182	uc001agd.3	Q9NP77	OTTHUMG00000000576	ENST00000291386.3:c.554G>A	1.37:g.1477477C>T	ENSP00000291386:p.Arg185His		55	0	0		42	0.07	3	NM_014188	508	0.00	0	Q9BZS6|Q9H933	Missense_Mutation	SNP	ENST00000291386.3	37	CCDS32.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235158	0.39498	.	.	ENSG00000160075	ENST00000291386;ENST00000378726	T	0.44881	0.91	5.07	2.14	0.27477	.	0.000000	0.85682	D	0.000000	T	0.34048	0.0884	L	0.45228	1.405	0.42507	D	0.992957	D	0.60575	0.988	P	0.45946	0.498	T	0.05869	-1.0859	10	0.39692	T	0.17	-2.7791	6.4779	0.22047	0.1465:0.6944:0.0:0.1591	.	185	Q9NP77	SSU72_HUMAN	H	185;102	ENSP00000291386:R185H	ENSP00000291386:R185H	R	-	2	0	SSU72	1467340	1.000000	0.71417	0.000000	0.03702	0.004000	0.04260	3.724000	0.54962	0.170000	0.19704	-0.181000	0.13052	CGC			0.567	SSU72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001366.1		NM_014188	
COL8A2	1296	mdanderson.org	37	1	36564848	36564848	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:36564848T>C	ENST00000397799.1	-	4	658	c.434A>G	c.(433-435)gAg>gGg	p.E145G	COL8A2_ENST00000481785.1_Missense_Mutation_p.E80G|COL8A2_ENST00000303143.4_Missense_Mutation_p.E145G			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	145	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TATTCCTGGCTCCCCCCGAAG	0.721																																					p.E145G													.	.			0			c.A434G												2.0	3.0	3.0					1																	36564848		1758	3563	5321	SO:0001583	missense	1296	exon2			CCTGGCTCCCCCC	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.434A>G	1.37:g.36564848T>C	ENSP00000380901:p.Glu145Gly		45	0.0222222222	1		23	0.13	3	NM_005202	5	0.00	0	Q5JV31|Q8TEJ5	Missense_Mutation	SNP	ENST00000397799.1	37	CCDS403.1	.	.	.	.	.	.	.	.	.	.	T	16.69	3.192272	0.58017	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785;ENST00000373172	D;D;D	0.93712	-3.27;-3.27;-3.27	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.95822	0.8640	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	D	0.95051	0.8187	10	0.35671	T	0.21	.	13.4789	0.61324	0.0:0.0:0.0:1.0	.	145	P25067	CO8A2_HUMAN	G	145;145;80;145	ENSP00000305913:E145G;ENSP00000380901:E145G;ENSP00000436433:E80G	ENSP00000305913:E145G	E	-	2	0	COL8A2	36337435	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.117000	0.71577	1.856000	0.53863	0.418000	0.28097	GAG			0.721	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313674.1		NM_005202	
SZT2	23334	mdanderson.org	37	1	43908679	43908679	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:43908679G>T	ENST00000562955.1	+	58	8170	c.8170G>T	c.(8170-8172)Ggt>Tgt	p.G2724C	SZT2_ENST00000372442.1_Missense_Mutation_p.G1882C	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2781					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTCCGTACTTGGTCCTGTGCC	0.607																																					p.G2724C													.	.			0			c.G8170T												58.0	61.0	60.0					1																	43908679		2203	4300	6503	SO:0001583	missense	23334	exon58			GTACTTGGTCCTG	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.8170G>T	1.37:g.43908679G>T	ENSP00000457168:p.Gly2724Cys		103	0	0		57	0.05	3	NM_015284	60	0.00	0	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	14.03	2.415006	0.42817	.	.	ENSG00000198198	ENST00000372442	.	.	.	4.94	3.97	0.46021	.	0.078057	0.56097	D	0.000037	T	0.39517	0.1081	N	0.22421	0.69	0.29303	N	0.868551	P	0.48764	0.915	P	0.53062	0.717	T	0.29549	-1.0008	9	0.59425	D	0.04	.	9.9341	0.41541	0.1793:0.0:0.8207:0.0	.	2724	Q5T011-5	.	C	1882	.	ENSP00000361519:G1882C	G	+	1	0	SZT2	43681266	1.000000	0.71417	0.947000	0.38551	0.990000	0.78478	4.517000	0.60503	1.339000	0.45563	0.561000	0.74099	GGT			0.607	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019517.3		NM_015284	
ABCA4	24	mdanderson.org	37	1	94528293	94528293	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:94528293G>T	ENST00000370225.3	-	13	1863	c.1777C>A	c.(1777-1779)Ccc>Acc	p.P593T	ABCA4_ENST00000535735.1_Missense_Mutation_p.P593T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	593					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCAGCTCTGGGACCAGAATCC	0.567																																					p.P593T													.	.			0			c.C1777A												49.0	49.0	49.0					1																	94528293		2203	4300	6503	SO:0001583	missense	24	exon13			CTCTGGGACCAGA	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1777C>A	1.37:g.94528293G>T	ENSP00000359245:p.Pro593Thr		47	0	0		27	0.11	3	NM_000350	0		0	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.904757	0.72868	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.98329	-4.87;-4.87	4.95	3.04	0.35103	.	0.000000	0.85682	D	0.000000	D	0.98579	0.9525	M	0.85710	2.77	0.58432	D	0.999998	D;D	0.89917	1.0;0.971	D;P	0.87578	0.998;0.856	D	0.99257	1.0889	10	0.87932	D	0	.	11.7179	0.51663	0.0:0.1342:0.726:0.1398	.	593;593	F5H6E5;P78363	.;ABCA4_HUMAN	T	593	ENSP00000359245:P593T;ENSP00000437682:P593T	ENSP00000359245:P593T	P	-	1	0	ABCA4	94300881	1.000000	0.71417	0.948000	0.38648	0.993000	0.82548	7.691000	0.84191	0.654000	0.30846	0.561000	0.74099	CCC			0.567	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000029320.1		NM_000350	
OVGP1	5016	bcgsc.ca	37	1	111957533	111957533	+	Silent	SNP	C	C	T	rs112145355		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:111957533C>T	ENST00000369732.3	-	11	1645	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	530					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGGTCACAGACTGATGACCCA	0.542																																					p.Q530Q													.	OVGP1	177		0			c.G1590A												59.0	57.0	58.0					1																	111957533		2197	4207	6404	SO:0001819	synonymous_variant	5016	exon11			CACAGACTGATGA	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1590G>A	1.37:g.111957533C>T			94	0.0106382979	1		107	0.16	17	NM_002557	4	0.00	0	A0AV19|B9EGE1|Q15841	Silent	SNP	ENST00000369732.3	37	CCDS834.1																																																																																					0.542	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032461.1		NM_002557	
VPS45	11311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150053547	150053547	+	Missense_Mutation	SNP	T	T	G			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:150053547T>G	ENST00000369130.3	+	8	1357	c.811T>G	c.(811-813)Ttc>Gtc	p.F271V	VPS45_ENST00000369128.5_Missense_Mutation_p.F166V|VPS45_ENST00000535106.1_Missense_Mutation_p.F202V	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	271					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAATGATGAATTCTATGCTAA	0.363																																					p.F271V													VPS45,NS,carcinoma,-2,1	VPS45	-2	1	0			c.T811G												90.0	92.0	92.0					1																	150053547		2203	4300	6503	SO:0001583	missense	11311	exon8			GATGAATTCTATG	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.811T>G	1.37:g.150053547T>G	ENSP00000358126:p.Phe271Val		99	0	0		108	0.14	15	NM_007259	27	0.41	11	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Missense_Mutation	SNP	ENST00000369130.3	37	CCDS944.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.035877	0.75617	.	.	ENSG00000136631	ENST00000369130;ENST00000369128;ENST00000543996;ENST00000535106;ENST00000419023	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	5.36	5.36	0.76844	.	0.044234	0.85682	D	0.000000	D	0.88555	0.6468	H	0.95004	3.61	0.80722	D	1	D;D;D;D	0.64830	0.994;0.975;0.97;0.975	P;P;P;P	0.61722	0.88;0.893;0.835;0.893	D	0.91543	0.5251	10	0.72032	D	0.01	.	14.6962	0.69124	0.0:0.0:0.0:1.0	.	166;271;91;271	F5H8K1;Q53FR8;A0AR27;Q9NRW7	.;.;.;VPS45_HUMAN	V	271;166;146;202;202	ENSP00000358126:F271V;ENSP00000358124:F166V;ENSP00000440690:F202V;ENSP00000400143:F202V	ENSP00000358124:F166V	F	+	1	0	VPS45	148320171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.841000	0.86834	2.250000	0.74265	0.455000	0.32223	TTC			0.363	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034964.1		NM_007259	
IVL	3713	broad.mit.edu	37	1	152883285	152883285	+	Missense_Mutation	SNP	G	G	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:152883285G>C	ENST00000368764.3	+	2	1076	c.1012G>C	c.(1012-1014)Gag>Cag	p.E338Q	IVL_ENST00000392667.2_Missense_Mutation_p.E192Q			P07476	INVO_HUMAN	involucrin	338	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.E338Q(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcagctggaggagcaggaggg	0.667																																					p.E338Q													IVL,NS,carcinoma,0,1	IVL	100	1	1	Substitution - Missense(1)	endometrium(1)	c.G1012C												16.0	15.0	15.0					1																	152883285		2119	4176	6295	SO:0001583	missense	3713	exon2			CTGGAGGAGCAGG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1012G>C	1.37:g.152883285G>C	ENSP00000357753:p.Glu338Gln		129	0.015503876	2		111	0.05	5	NM_005547	0		0	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	a	1.418	-0.573547	0.03882	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.09255	3.15;3.0	3.88	-1.02	0.10135	.	.	.	.	.	T	0.00724	0.0024	N	0.00483	-1.445	0.09310	N	1	B	0.18741	0.03	B	0.21708	0.036	T	0.45425	-0.9262	9	0.02654	T	1	.	14.4783	0.67562	0.0:0.4237:0.5763:0.0	.	338	P07476	INVO_HUMAN	Q	338;192	ENSP00000357753:E338Q;ENSP00000376435:E192Q	ENSP00000357753:E338Q	E	+	1	0	IVL	151149909	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.399000	0.07250	-0.056000	0.13221	-1.514000	0.00941	GAG			0.667	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000034664.1		NM_005547	
CHTOP	26097	broad.mit.edu	37	1	153610804	153610804	+	Silent	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:153610804G>T	ENST00000368694.3	+	3	411	c.99G>T	c.(97-99)acG>acT	p.T33T	CHTOP_ENST00000368686.1_5'Flank|CHTOP_ENST00000368687.1_Silent_p.T8T|CHTOP_ENST00000403433.1_Silent_p.T33T|CHTOP_ENST00000495554.1_3'UTR|CHTOP_ENST00000368690.3_Silent_p.T33T	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	33					mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						AACAGCCGACGCCAGTGAATA	0.428																																					p.T33T													CHTOP,NS,carcinoma,+1,1	CHTOP	34	1	0			c.G99T												74.0	77.0	76.0					1																	153610804		2203	4300	6503	SO:0001819	synonymous_variant	26097	exon3			GCCGACGCCAGTG		CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.99G>T	1.37:g.153610804G>T			344	0	0		334	0.01	4	NM_001206612	371	0.00	0	D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Silent	SNP	ENST00000368694.3	37	CCDS1048.1																																																																																					0.428	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000089967.1		NM_015607	
CHRNB2	1141	mdanderson.org	37	1	154544498	154544498	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:154544498C>T	ENST00000368476.3	+	5	1463	c.1199C>T	c.(1198-1200)gCc>gTc	p.A400V		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	400					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CAGGGGTTGGCCGGGGCCTTC	0.746																																					p.A400V													.	.			0			c.C1199T												2.0	2.0	2.0					1																	154544498		1455	3052	4507	SO:0001583	missense	1141	exon5			GGTTGGCCGGGGC	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1199C>T	1.37:g.154544498C>T	ENSP00000357461:p.Ala400Val		15	0	0		12	0.17	2	NM_000748	4	0.00	0	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	C	3.082	-0.188750	0.06299	.	.	ENSG00000160716	ENST00000368476	D	0.85013	-1.93	3.97	1.04	0.20106	Neurotransmitter-gated ion-channel transmembrane domain (2);	2.088980	0.04356	U	0.356635	T	0.52789	0.1756	N	0.21545	0.675	0.09310	N	1	B	0.20164	0.042	B	0.25506	0.061	T	0.45760	-0.9239	10	0.12766	T	0.61	.	3.6558	0.08220	0.1312:0.5697:0.1442:0.1549	.	400	P17787	ACHB2_HUMAN	V	400	ENSP00000357461:A400V	ENSP00000357461:A400V	A	+	2	0	CHRNB2	152811122	0.667000	0.27484	0.022000	0.16811	0.094000	0.18550	1.796000	0.38794	0.410000	0.25675	0.313000	0.20887	GCC			0.746	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090697.1		NM_000748	
APOA1BP	128240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156563324	156563324	+	Missense_Mutation	SNP	T	T	C	rs200378020		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:156563324T>C	ENST00000368235.3	+	5	684	c.641T>C	c.(640-642)aTt>aCt	p.I214T	GPATCH4_ENST00000497287.1_5'Flank|APOA1BP_ENST00000368234.3_Silent_p.H195H|APOA1BP_ENST00000368233.3_Missense_Mutation_p.I214T	NM_144772.2	NP_658985.2			apolipoprotein A-I binding protein											central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|urinary_tract(1)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACTGTGCCCATTGCCAGCATC	0.577																																					p.I214T													.	.			0			c.T641C							T	THR/ILE	0,4406		0,0,2203	116.0	95.0	102.0		641	5.6	1.0	1		102	1,8599	1.2+/-3.3	0,1,4299	yes	missense	APOA1BP	NM_144772.2	89	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	214/289	156563324	1,13005	2203	4300	6503	SO:0001583	missense	128240	exon5			TGCCCATTGCCAG	AJ315849	CCDS1145.1	1q21	2008-08-14			ENSG00000163382	ENSG00000163382			18453	protein-coding gene	gene with protein product	"""apoA-I binding protein"""	608862				11991719, 17533573	Standard	NM_144772		Approved	AIBP, MGC119143, MGC119144, MGC119145, YJEFN1	uc001fph.3	Q8NCW5	OTTHUMG00000033206	ENST00000368235.3:c.641T>C	1.37:g.156563324T>C	ENSP00000357218:p.Ile214Thr		110	0	0		107	0.10	11	NM_144772	385	0.30	116		Missense_Mutation	SNP	ENST00000368235.3	37	CCDS1145.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.054090	0.75960	0.0	1.16E-4	ENSG00000163382	ENST00000446584;ENST00000368235;ENST00000368233	T;T	0.46819	0.86;0.86	5.55	5.55	0.83447	YjeF-related protein, N-terminal (5);	0.176557	0.48767	D	0.000170	T	0.62612	0.2442	M	0.81179	2.53	0.58432	D	0.999999	D;D	0.71674	0.966;0.998	D;D	0.75020	0.926;0.985	T	0.69068	-0.5243	10	0.66056	D	0.02	.	13.6475	0.62290	0.0:0.0:0.0:1.0	.	214;214	Q8NCW5;Q5T3I4	AIBP_HUMAN;.	T	232;214;214	ENSP00000357218:I214T;ENSP00000357216:I214T	ENSP00000357216:I214T	I	+	2	0	APOA1BP	154829948	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.119000	0.64679	2.097000	0.63578	0.533000	0.62120	ATT			0.577	APOA1BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000081044.1		NM_144772	
APOA2	336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161193189	161193189	+	Start_Codon_SNP	SNP	C	C	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:161193189C>A	ENST00000367990.3	-	2	60	c.3G>T	c.(1-3)atG>atT	p.M1I	TOMM40L_ENST00000545897.1_5'Flank|TOMM40L_ENST00000367988.3_5'Flank|APOA2_ENST00000464492.1_Missense_Mutation_p.M34I|APOA2_ENST00000470459.2_Start_Codon_SNP_p.M1I|APOA2_ENST00000463812.1_Intron|APOA2_ENST00000468465.1_5'UTR|APOA2_ENST00000491350.1_Start_Codon_SNP_p.M1I|TOMM40L_ENST00000367987.1_5'Flank	NM_001643.1	NP_001634.1	P02652	APOA2_HUMAN	apolipoprotein A-II	1					acute inflammatory response (GO:0002526)|cellular lipid metabolic process (GO:0044255)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol import (GO:0060621)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cholesterol transporter activity (GO:0060695)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of lipase activity (GO:0060192)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid catabolic process (GO:0009395)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of lipid catabolic process (GO:0050996)|protein folding (GO:0006457)|protein oxidation (GO:0018158)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein stability (GO:0031647)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|viral process (GO:0016032)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein receptor binding (GO:0034190)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(2)|skin(2)	6	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CGAGCAGCTTCATGTTGGTAA	0.577																																					p.M1I													.	.			0			c.G3T												99.0	80.0	87.0					1																	161193189		2203	4300	6503	SO:0001582	initiator_codon_variant	336	exon2			CAGCTTCATGTTG		CCDS1226.1	1q23.3	2013-01-24			ENSG00000158874	ENSG00000158874		"""Apolipoproteins"""	601	protein-coding gene	gene with protein product		107670				2415515	Standard	NM_001643		Approved		uc001fzc.1	P02652	OTTHUMG00000034346	ENST00000367990.3:c.3G>T	1.37:g.161193189C>A	ENSP00000356969:p.Met1Ile		66	0	0		94	0.14	13	NM_001643	49	0.00	0	B2R524	Missense_Mutation	SNP	ENST00000367990.3	37	CCDS1226.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.840025	0.32513	.	.	ENSG00000158874	ENST00000367990	.	.	.	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000003	T	0.72542	0.3473	.	.	.	0.80722	A	1.000000	D	0.63880	0.993	D	0.70935	0.971	T	0.76664	-0.2876	7	0.87932	D	0	-28.4461	13.5866	0.61935	0.0:1.0:0.0:0.0	.	1	P02652	APOA2_HUMAN	I	1	.	ENSP00000356969:M1I	M	-	3	0	APOA2	159459813	1.000000	0.71417	1.000000	0.80357	0.094000	0.18550	3.347000	0.52200	2.664000	0.90586	0.655000	0.94253	ATG			0.577	APOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000083037.1		NM_001643	Missense_Mutation
ATP2B4	493	mdanderson.org	37	1	203669390	203669390	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:203669390G>T	ENST00000357681.5	+	5	1829	c.706G>T	c.(706-708)Gag>Tag	p.E236*	ATP2B4_ENST00000391954.2_Nonsense_Mutation_p.E236*|ATP2B4_ENST00000341360.2_Nonsense_Mutation_p.E236*|ATP2B4_ENST00000367218.3_Nonsense_Mutation_p.E236*|ATP2B4_ENST00000367219.3_Nonsense_Mutation_p.E236*	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	236					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GAAGATTGATGAGAGCTCTCT	0.507																																					p.E236X													.	.			0			c.G706T												112.0	107.0	109.0					1																	203669390		2203	4300	6503	SO:0001587	stop_gained	493	exon5			ATTGATGAGAGCT	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.706G>T	1.37:g.203669390G>T	ENSP00000350310:p.Glu236*		86	0	0		74	0.05	4	NM_001684	19	0.00	0	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Nonsense_Mutation	SNP	ENST00000357681.5	37	CCDS1440.1	.	.	.	.	.	.	.	.	.	.	G	41	9.117793	0.99071	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	.	.	.	4.9	4.9	0.64082	.	0.000000	0.51477	D	0.000097	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.2804	18.036	0.89302	0.0:0.0:1.0:0.0	.	.	.	.	X	236	.	ENSP00000340930:E236X	E	+	1	0	ATP2B4	201936013	1.000000	0.71417	0.993000	0.49108	0.925000	0.55904	9.807000	0.99171	2.427000	0.82271	0.561000	0.74099	GAG			0.507	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087462.1		NM_001001396	
SRP9	6726	broad.mit.edu	37	1	225976948	225976948	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr1:225976948G>T	ENST00000304786.7	+	3	260	c.148G>T	c.(148-150)Gtg>Ttg	p.V50L	SRP9_ENST00000366839.4_3'UTR|SRP9_ENST00000366838.1_3'UTR	NM_003133.5	NP_003124.1	P49458	SRP09_HUMAN	signal recognition particle 9kDa	50					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|negative regulation of translational elongation (GO:0045900)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|signal recognition particle receptor complex (GO:0005785)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|RNA binding (GO:0003723)|signal recognition particle binding (GO:0005047)			endometrium(1)|kidney(1)|skin(1)	3						ACAGTGTTTGGTGTATAAAAC	0.333																																					p.V50L													.	SRP9	5		0			c.G148T												50.0	46.0	48.0					1																	225976948		2203	4300	6503	SO:0001583	missense	6726	exon3			TGTTTGGTGTATA	BC015094	CCDS1546.1, CCDS44323.1	1q42.12	2010-06-03	2002-08-29		ENSG00000143742	ENSG00000143742			11304	protein-coding gene	gene with protein product		600707	"""signal recognition particle 9kD"""			7730321	Standard	NM_001130440		Approved		uc001hpg.3	P49458	OTTHUMG00000037738	ENST00000304786.7:c.148G>T	1.37:g.225976948G>T	ENSP00000305230:p.Val50Leu		445	0	0		445	0.01	5	NM_003133	78	0.00	0	A8K0N0|Q6NVX0|Q8WTW0	Missense_Mutation	SNP	ENST00000304786.7	37	CCDS1546.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818056	0.32145	.	.	ENSG00000143742	ENST00000304786	.	.	.	5.55	2.37	0.29283	Signal recognition particle, SRP9/SRP14 subunit (2);	0.263344	0.31589	U	0.007384	T	0.38268	0.1034	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.10086	-1.0645	8	0.25106	T	0.35	-0.009	5.7833	0.18318	0.1943:0.2611:0.5446:0.0	.	50	P49458	SRP09_HUMAN	L	50	.	ENSP00000305230:V50L	V	+	1	0	SRP9	224043571	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.120000	0.57897	0.644000	0.30656	-0.345000	0.07892	GTG			0.333	SRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092054.1		NM_003133	
FRMD4A	55691	hgsc.bcm.edu;broad.mit.edu	37	10	13838519	13838519	+	Silent	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr10:13838519G>T	ENST00000357447.2	-	5	644	c.276C>A	c.(274-276)ccC>ccA	p.P92P	FRMD4A_ENST00000358621.4_Silent_p.P77P|FRMD4A_ENST00000378503.1_Silent_p.P92P|FRMD4A_ENST00000342409.2_Silent_p.P108P	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	92	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						ATAAAACCACGGGTCCTGACT	0.428																																					p.P92P													FRMD4A,NS,malignant_melanoma,-1,1	FRMD4A	-1	1	0			c.C276A												150.0	148.0	149.0					10																	13838519		2203	4300	6503	SO:0001819	synonymous_variant	55691	exon5			AACCACGGGTCCT	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.276C>A	10.37:g.13838519G>T			120	0	0		115	0.04	5	NM_018027	0		0	A7E2Y3|Q5T377	Silent	SNP	ENST00000357447.2	37	CCDS7101.1																																																																																					0.428	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000046889.1		NM_018027	
RASSF4	83937	mdanderson.org	37	10	45479556	45479556	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr10:45479556G>T	ENST00000340258.5	+	5	481	c.368G>T	c.(367-369)aGc>aTc	p.S123I	RASSF4_ENST00000334940.6_Missense_Mutation_p.S132I|RASSF4_ENST00000472561.1_Intron|RASSF4_ENST00000374417.2_Intron	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	288	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						TCCACAGACAGCTCGGGTAAG	0.592																																					p.S123I													.	.			0			c.G368T												46.0	42.0	44.0					10																	45479556		2199	4297	6496	SO:0001583	missense	83937	exon5			CAGACAGCTCGGG	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.368G>T	10.37:g.45479556G>T	ENSP00000339692:p.Ser123Ile		56	0	0		42	0.07	3	NM_032023	142	0.00	0	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000340258.5	37	CCDS7208.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589068	0.28357	.	.	ENSG00000107551	ENST00000334940;ENST00000340258;ENST00000427758;ENST00000374411	T;T;T	0.44482	0.92;0.92;1.08	4.33	4.33	0.51752	.	1.487590	0.04975	U	0.464549	T	0.41880	0.1178	L	0.50333	1.59	0.80722	D	1	B;B	0.28258	0.205;0.001	B;B	0.18561	0.022;0.003	T	0.23332	-1.0191	10	0.51188	T	0.08	-7.0866	12.6362	0.56685	0.0:0.0:1.0:0.0	.	214;123	Q59FL4;Q9H2L5	.;RASF4_HUMAN	I	132;123;150;214	ENSP00000334543:S132I;ENSP00000339692:S123I;ENSP00000409767:S150I	ENSP00000334543:S132I	S	+	2	0	RASSF4	44799562	0.002000	0.14202	0.757000	0.31301	0.043000	0.13939	0.727000	0.25999	2.709000	0.92574	0.655000	0.94253	AGC			0.592	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047745.2		NM_032023	
GRK5	2869	mdanderson.org	37	10	121086095	121086095	+	Silent	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr10:121086095C>T	ENST00000392870.2	+	2	449	c.120C>T	c.(118-120)agC>agT	p.S40S		NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	40	N-terminal.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		CTCACATTAGCCAGTGTGAAG	0.547																																					p.S40S													.	.			0			c.C120T												71.0	66.0	67.0					10																	121086095		2203	4300	6503	SO:0001819	synonymous_variant	2869	exon2			CATTAGCCAGTGT	L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.120C>T	10.37:g.121086095C>T			60	0	0		36	0.08	3	NM_005308	46	0.00	0	D3DRD0|Q5T059	Silent	SNP	ENST00000392870.2	37	CCDS7612.1																																																																																					0.547	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050652.2		NM_005308	
C10orf120	399814	hgsc.bcm.edu	37	10	124459132	124459132	+	Splice_Site	SNP	G	G	T	rs76198528		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr10:124459132G>T	ENST00000329446.4	-	1	206	c.175C>A	c.(175-177)Cgg>Agg	p.R59R		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	59										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				CAGACTCACCGCAACGGTGAA	0.493																																					p.R59R													.	.			0			c.C175A												90.0	78.0	82.0					10																	124459132		2203	4300	6503	SO:0001630	splice_region_variant	399814	exon1			CTCACCGCAACGG		CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.176+1C>A	10.37:g.124459132G>T			82	0	0		77	0.05	4	NM_001010912	0		0	B2RU17	Silent	SNP	ENST00000329446.4	37	CCDS31302.1	.	.	.	.	.	.	.	.	.	.	G	4.994	0.184619	0.09495	.	.	ENSG00000183559	ENST00000432000	.	.	.	4.28	-2.38	0.06622	.	.	.	.	.	.	.	.	.	.	.	0.31654	N	0.646401	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.8705	0.1566	0.00098	0.304:0.2578:0.1515:0.2867	.	.	.	.	X	51	.	.	C	-	3	2	C10orf120	124449122	0.003000	0.15002	0.028000	0.17463	0.004000	0.04260	-0.428000	0.06991	-0.345000	0.08325	-0.139000	0.14373	TGC			0.493	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050803.1		NM_001010912	Silent
CCDC73	493860	mdanderson.org	37	11	32739669	32739669	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:32739669G>T	ENST00000335185.5	-	3	203	c.160C>A	c.(160-162)Cag>Aag	p.Q54K	CCDC73_ENST00000531481.1_Missense_Mutation_p.Q54K|CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	54										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TTACCAATCTGCTCTTCATAA	0.343																																					p.C54S													.	.			0			c.T160A												158.0	157.0	157.0					11																	32739669		1821	4074	5895	SO:0001583	missense	493860	exon3			CAATCTGCTCTTC	AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.160C>A	11.37:g.32739669G>T	ENSP00000335325:p.Gln54Lys		41	0	0		22	0.09	2	NM_001008391	0		0	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	ENST00000335185.5	37	CCDS41630.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961827	0.53400	.	.	ENSG00000186714	ENST00000335185;ENST00000531481	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	T	0.55194	0.1905	L	0.50333	1.59	0.32161	N	0.582984	B;P;D	0.55385	0.447;0.59;0.971	B;B;P	0.53401	0.202;0.275;0.725	T	0.60332	-0.7284	8	0.37606	T	0.19	.	15.4922	0.75615	0.0:0.0:1.0:0.0	.	54;54;54	A6H8Y7;Q6ZRK6-2;Q6ZRK6	.;.;CCD73_HUMAN	K	54	.	ENSP00000335325:Q54K	Q	-	1	0	CCDC73	32696245	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	5.109000	0.64615	2.793000	0.96121	0.655000	0.94253	CAG			0.343	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388874.2		NM_001008391	
MADD	8567	mdanderson.org	37	11	47296560	47296560	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:47296560G>T	ENST00000311027.5	+	3	674	c.509G>T	c.(508-510)cGc>cTc	p.R170L	MADD_ENST00000349238.3_Missense_Mutation_p.R170L|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000395336.3_Missense_Mutation_p.R170L|MADD_ENST00000395344.3_Missense_Mutation_p.R170L|MADD_ENST00000402799.1_Missense_Mutation_p.R170L|MADD_ENST00000406482.1_Missense_Mutation_p.R170L|RP11-17G12.3_ENST00000543925.1_RNA|MADD_ENST00000342922.4_Missense_Mutation_p.R170L|MADD_ENST00000402192.2_Missense_Mutation_p.R170L|MADD_ENST00000407859.3_Missense_Mutation_p.R170L	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		AGCCGCTCCCGCAACAGTACT	0.602																																					p.R170L													MADD,colon,carcinoma,+1,1	MADD	1	1	0			c.G509T												67.0	70.0	69.0					11																	47296560		2201	4298	6499	SO:0001583	missense	8567	exon3			GCTCCCGCAACAG	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.509G>T	11.37:g.47296560G>T	ENSP00000310933:p.Arg170Leu		29	0	0		43	0.07	3	NM_001135944	24	0.00	0		Missense_Mutation	SNP	ENST00000311027.5	37	CCDS7930.1	.	.	.	.	.	.	.	.	.	.	G	35	5.489119	0.96323	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.06933	3.33;3.25;3.25;3.33;3.34;3.24;3.24;3.33;3.33	6.07	6.07	0.98685	.	0.051434	0.85682	N	0.000000	T	0.20941	0.0504	L	0.29908	0.895	0.80722	D	1	P;P;D;B;B;B;P;D;P;D	0.76494	0.899;0.683;0.994;0.269;0.269;0.269;0.601;0.999;0.889;0.995	P;B;D;B;B;B;B;D;P;D	0.85130	0.545;0.298;0.913;0.191;0.191;0.191;0.405;0.997;0.663;0.955	T	0.00842	-1.1544	9	.	.	.	-16.0216	20.6593	0.99626	0.0:0.0:1.0:0.0	.	170;170;170;170;170;170;170;170;170;170	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	L	170	ENSP00000343902:R170L;ENSP00000385585:R170L;ENSP00000384435:R170L;ENSP00000304505:R170L;ENSP00000310933:R170L;ENSP00000384204:R170L;ENSP00000378753:R170L;ENSP00000378745:R170L;ENSP00000384287:R170L	.	R	+	2	0	MADD	47253136	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.426000	0.80270	2.885000	0.99019	0.655000	0.94253	CGC			0.602	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317746.1			
SPTBN2	6712	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	66461270	66461270	+	Missense_Mutation	SNP	G	G	T	rs149464236		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:66461270G>T	ENST00000533211.1	-	23	4897	c.4566C>A	c.(4564-4566)agC>agA	p.S1522R	SPTBN2_ENST00000529997.1_Missense_Mutation_p.S1522R|SPTBN2_ENST00000309996.2_Missense_Mutation_p.S1522R			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1522					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GAAGCTGGACGCTGGGCAGGT	0.572																																					p.S1522R													.	SPTBN2	188		0			c.C4566A												63.0	58.0	60.0					11																	66461270		2200	4295	6495	SO:0001583	missense	6712	exon22			CTGGACGCTGGGC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4566C>A	11.37:g.66461270G>T	ENSP00000432568:p.Ser1522Arg		76	0	0		93	0.05	5	NM_006946	54	0.00	0	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	g	14.03	2.413664	0.42817	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.53640	0.61;0.61;0.61	4.09	-6.16	0.02098	.	0.171581	0.48767	D	0.000177	T	0.51024	0.1650	L	0.52905	1.665	0.29301	N	0.868662	D	0.56746	0.977	P	0.57720	0.826	T	0.59532	-0.7437	10	0.54805	T	0.06	.	13.4713	0.61283	0.2266:0.0:0.6703:0.1031	.	1522	O15020	SPTN2_HUMAN	R	1522	ENSP00000432568:S1522R;ENSP00000311489:S1522R;ENSP00000433593:S1522R	ENSP00000311489:S1522R	S	-	3	2	SPTBN2	66217846	0.000000	0.05858	0.796000	0.32109	0.783000	0.44284	-2.348000	0.01094	-1.855000	0.01162	-2.433000	0.00214	AGC			0.572	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393892.2		NM_006946	
CHKA	1119	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	67842260	67842260	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:67842260G>A	ENST00000265689.4	-	4	580	c.554C>T	c.(553-555)gCc>gTc	p.A185V	CHKA_ENST00000356135.5_Missense_Mutation_p.A167V	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	185					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	TGCGAGAATGGCAAACATAAC	0.493																																					p.A185V													.	.			0			c.C554T												124.0	113.0	116.0					11																	67842260		2200	4294	6494	SO:0001583	missense	1119	exon4			AGAATGGCAAACA	D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.554C>T	11.37:g.67842260G>A	ENSP00000265689:p.Ala185Val		100	0	0		67	0.07	5	NM_001277	18	0.00	0	Q8NE29	Missense_Mutation	SNP	ENST00000265689.4	37	CCDS8178.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710043	0.89018	.	.	ENSG00000110721	ENST00000265689;ENST00000356135;ENST00000531341	T;T;T	0.57752	0.38;0.38;0.38	4.97	4.97	0.65823	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.000000	0.85682	D	0.000000	T	0.78451	0.4285	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.99;0.998	T	0.82833	-0.0262	10	0.62326	D	0.03	-15.6671	18.423	0.90598	0.0:0.0:1.0:0.0	.	167;185	P35790-2;P35790	.;CHKA_HUMAN	V	185;167;63	ENSP00000265689:A185V;ENSP00000348454:A167V;ENSP00000435032:A63V	ENSP00000265689:A185V	A	-	2	0	CHKA	67598836	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.544000	0.98092	2.579000	0.87056	0.563000	0.77884	GCC			0.493	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000394570.1		NM_001277	
PDE2A	5138	mdanderson.org	37	11	72288535	72288535	+	Missense_Mutation	SNP	G	G	T	rs17854062		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:72288535G>T	ENST00000334456.5	-	31	2964	c.2719C>A	c.(2719-2721)Ctc>Atc	p.L907I	PDE2A_ENST00000444035.2_Missense_Mutation_p.L898I|PDE2A_ENST00000376450.3_Missense_Mutation_p.L651I|PDE2A_ENST00000418754.2_Missense_Mutation_p.L792I|PDE2A_ENST00000540345.1_Missense_Mutation_p.L898I|PDE2A_ENST00000544570.1_Missense_Mutation_p.L900I	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	907					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	TTACTTGGGAGGCCGCGGATG	0.602																																					p.L907I													.	.			0			c.C2719A												133.0	105.0	114.0					11																	72288535		2200	4293	6493	SO:0001583	missense	5138	exon31			TTGGGAGGCCGCG	U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.2719C>A	11.37:g.72288535G>T	ENSP00000334910:p.Leu907Ile		50	0	0		25	0.08	2	NM_002599	41	0.00	0	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	ENST00000334456.5	37	CCDS8216.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063248	0.55432	.	.	ENSG00000186642	ENST00000334456;ENST00000376450;ENST00000444035;ENST00000544570;ENST00000418754;ENST00000540345	T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.65	5.65	0.86999	.	0.547984	0.16534	N	0.210239	T	0.79028	0.4377	L	0.27053	0.805	0.46061	D	0.998842	P;B;B;B;B;B	0.47962	0.903;0.029;0.029;0.023;0.029;0.004	D;B;B;B;B;B	0.63793	0.918;0.025;0.025;0.037;0.025;0.012	T	0.77493	-0.2567	10	0.56958	D	0.05	.	9.1196	0.36780	0.1545:0.0:0.8455:0.0	rs17854062	792;907;898;900;907;651	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646;Q6ZMR1	.;PDE2A_HUMAN;.;.;.;.	I	907;651;898;900;792;898	ENSP00000334910:L907I;ENSP00000365633:L651I;ENSP00000411657:L898I;ENSP00000442256:L900I;ENSP00000410310:L792I;ENSP00000446399:L898I	ENSP00000334910:L907I	L	-	1	0	PDE2A	71966183	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.811000	0.47986	2.824000	0.97209	0.655000	0.94253	CTC			0.602	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219839.2		NM_002599	
CHORDC1	26973	mdanderson.org	37	11	89935586	89935586	+	Missense_Mutation	SNP	G	G	C	rs1045861	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:89935586G>C	ENST00000320585.6	-	11	1395	c.986C>G	c.(985-987)gCc>gGc	p.A329G	CHORDC1_ENST00000457199.2_Missense_Mutation_p.A310G|CHORDC1_ENST00000529987.1_Missense_Mutation_p.A141G|CHORDC1_ENST00000529726.1_Missense_Mutation_p.A141G	NM_012124.2	NP_036256.2	Q9UHD1	CHRD1_HUMAN	cysteine and histidine-rich domain (CHORD) containing 1	329			A -> D (in dbSNP:rs1045861). {ECO:0000269|PubMed:10571178, ECO:0000269|PubMed:14702039, ECO:0000269|Ref.2, ECO:0000269|Ref.5}.		chaperone-mediated protein folding (GO:0061077)|negative regulation of Rho-dependent protein serine/threonine kinase activity (GO:2000299)|regulation of cellular response to heat (GO:1900034)|regulation of centrosome duplication (GO:0010824)|response to stress (GO:0006950)		Hsp90 protein binding (GO:0051879)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(1)|lung(6)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)				ATCTGTTGTGGCATCTTTTTG	0.403																																					p.A329G													.	.			0			c.C986G												126.0	105.0	112.0					11																	89935586		2200	4298	6498	SO:0001583	missense	26973	exon11			GTTGTGGCATCTT	AF192466	CCDS8289.1, CCDS44705.1	11q14.3	2011-01-25	2011-01-25		ENSG00000110172	ENSG00000110172			14525	protein-coding gene	gene with protein product		604353	"""cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1"", ""cysteine and histidine-rich domain (CHORD)-containing 1"""			10571178	Standard	NM_012124		Approved	CHP1	uc001pdg.2	Q9UHD1	OTTHUMG00000167305	ENST00000320585.6:c.986C>G	11.37:g.89935586G>C	ENSP00000319255:p.Ala329Gly		116	0	0		74	0.03	2	NM_012124	122	0.00	0	B2R6P8|Q6IN49|Q8WVL9|Q9H3D6	Missense_Mutation	SNP	ENST00000320585.6	37	CCDS8289.1	.	.	.	.	.	.	.	.	.	.	T	0.074	-1.196709	0.01594	.	.	ENSG00000110172	ENST00000320585;ENST00000529987;ENST00000457199;ENST00000529726	T;T;T;T	0.44881	0.92;0.91;0.91;0.91	5.24	4.08	0.47627	HSP20-like chaperone (1);	1.095060	0.06902	N	0.806057	T	0.25791	0.0628	N	0.08118	0	0.09310	P	0.99999999876564	B;B	0.19817	0.039;0.001	B;B	0.16289	0.015;0.004	T	0.31613	-0.9937	8	.	.	.	0.1129	11.064	0.47964	0.0:0.0:0.2982:0.7018	.	310;329	Q9UHD1-2;Q9UHD1	.;CHRD1_HUMAN	G	329;141;310;141	ENSP00000319255:A329G;ENSP00000433719:A141G;ENSP00000401080:A310G;ENSP00000436632:A141G	.	A	-	2	0	CHORDC1	89575234	0.036000	0.19791	0.718000	0.30602	0.172000	0.22775	1.500000	0.35682	0.292000	0.22492	-0.262000	0.10625	GCC			0.403	CHORDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394111.1		NM_012124	
MMP3	4314	mdanderson.org	37	11	102711321	102711321	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:102711321G>T	ENST00000299855.5	-	5	885	c.629C>A	c.(628-630)aCc>aAc	p.T210N		NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	210					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	AAATAAATTGGTCCCTATTTA	0.388																																					p.T210N													.	.			0			c.C629A												75.0	75.0	75.0					11																	102711321		2203	4299	6502	SO:0001583	missense	4314	exon5			AAATTGGTCCCTA	X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.629C>A	11.37:g.102711321G>T	ENSP00000299855:p.Thr210Asn		80	0	0		38	0.08	3	NM_002422	0		0	B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	ENST00000299855.5	37	CCDS8323.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446632	0.25987	.	.	ENSG00000149968	ENST00000299855	T	0.21932	1.98	4.98	-0.485	0.12067	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	1.216660	0.06490	N	0.734413	T	0.36608	0.0973	L	0.58925	1.835	0.09310	N	1	P	0.47545	0.897	P	0.59761	0.863	T	0.33828	-0.9853	10	0.66056	D	0.02	.	7.4648	0.27316	0.4036:0.0:0.4934:0.103	.	210	P08254	MMP3_HUMAN	N	210	ENSP00000299855:T210N	ENSP00000299855:T210N	T	-	2	0	MMP3	102216531	0.000000	0.05858	0.946000	0.38457	0.310000	0.27922	-0.773000	0.04689	-0.202000	0.10268	-1.119000	0.02030	ACC			0.388	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109758.2		NM_002422	
DYNC2H1	79659	mdanderson.org	37	11	103027467	103027467	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:103027467G>T	ENST00000375735.2	+	26	4239	c.4095G>T	c.(4093-4095)caG>caT	p.Q1365H	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.Q1365H	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1365	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CAAAAGAACAGACACGCTTCA	0.353																																					p.Q1365H													.	.			0			c.G4095T												57.0	57.0	57.0					11																	103027467		1846	4090	5936	SO:0001583	missense	79659	exon26			AGAACAGACACGC	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4095G>T	11.37:g.103027467G>T	ENSP00000364887:p.Gln1365His		42	0	0		32	0.09	3	NM_001080463	0		0	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	37	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154496	0.38021	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.61392	0.11;0.11	5.27	2.37	0.29283	Dynein heavy chain, domain-2 (1);	0.543055	0.15709	N	0.248517	T	0.49304	0.1549	L	0.53671	1.685	0.35796	D	0.822758	B;B	0.32101	0.356;0.307	B;B	0.36030	0.213;0.216	T	0.53542	-0.8424	10	0.44086	T	0.13	.	4.5181	0.11945	0.3448:0.0:0.5058:0.1494	.	1365;1365	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	H	1365	ENSP00000364887:Q1365H;ENSP00000381167:Q1365H	ENSP00000364887:Q1365H	Q	+	3	2	DYNC2H1	102532677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.808000	0.38912	0.610000	0.30035	0.563000	0.77884	CAG			0.353	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387196.1		XM_370652	
TMEM25	84866	mdanderson.org	37	11	118403027	118403027	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:118403027G>T	ENST00000313236.5	+	3	286	c.233G>T	c.(232-234)aGa>aTa	p.R78I	TMEM25_ENST00000533102.1_Missense_Mutation_p.R78I|RP11-770J1.3_ENST00000532597.1_RNA|RP11-770J1.3_ENST00000528578.1_RNA|TMEM25_ENST00000524725.1_Missense_Mutation_p.R78I|RP11-770J1.3_ENST00000554407.1_RNA|TMEM25_ENST00000359862.4_Missense_Mutation_p.R78I|TMEM25_ENST00000442938.2_Missense_Mutation_p.R78I|TMEM25_ENST00000354284.4_Missense_Mutation_p.R78I|TMEM25_ENST00000544878.1_Missense_Mutation_p.R78I|TMEM25_ENST00000411589.2_Missense_Mutation_p.R78I|RP11-770J1.3_ENST00000556583.1_RNA|RP11-770J1.3_ENST00000525992.2_RNA|TMEM25_ENST00000529001.1_3'UTR|TMEM25_ENST00000354064.7_Intron	NM_032780.3	NP_116169.2	Q86YD3	TMM25_HUMAN	transmembrane protein 25	78	Ig-like.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	13	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		AGCACCTCAAGACTGCTGAGC	0.642																																					p.R78I													.	.			0			c.G233T												62.0	64.0	63.0					11																	118403027		2200	4295	6495	SO:0001583	missense	84866	exon3			CCTCAAGACTGCT	AK075437	CCDS8398.1, CCDS44745.1, CCDS44746.1, CCDS44747.1, CCDS44748.1	11q23.3	2013-01-11			ENSG00000149582	ENSG00000149582		"""Immunoglobulin superfamily / C2-set domain containing"""	25890	protein-coding gene	gene with protein product		613934				15254712, 12975309	Standard	NM_001144034		Approved	FLJ14399	uc010rye.2	Q86YD3	OTTHUMG00000166339	ENST00000313236.5:c.233G>T	11.37:g.118403027G>T	ENSP00000315635:p.Arg78Ile		62	0	0		37	0.08	3	NM_001144038	13	0.08	1	A8K8J4|B0YJA6|B0YJA7|B0YJA9|G5E9U4|Q6UW89|Q86UA7|Q8NBL5|Q96KA6|Q96MW9	Missense_Mutation	SNP	ENST00000313236.5	37	CCDS8398.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085844	0.76642	.	.	ENSG00000149582	ENST00000411589;ENST00000442938;ENST00000359862;ENST00000528373;ENST00000544878;ENST00000354284;ENST00000533137;ENST00000532762;ENST00000533102;ENST00000313236;ENST00000524725;ENST00000533689	T;T;T;T;T;T;T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01	5.07	4.16	0.48862	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.260127	0.35838	N	0.002955	T	0.76357	0.3976	L	0.29908	0.895	0.42590	D	0.993248	P;P;P;P;P;P;D;P	0.55800	0.514;0.773;0.57;0.896;0.729;0.874;0.973;0.514	B;P;P;P;B;B;P;B	0.57679	0.283;0.503;0.507;0.503;0.284;0.369;0.825;0.283	T	0.77469	-0.2576	10	0.66056	D	0.02	-4.1068	9.2849	0.37751	0.1001:0.0:0.8999:0.0	.	78;78;78;78;78;78;78;78	F5H294;Q86YD3;B7Z4E4;Q8NBL5;G5E9U4;Q86YD3-4;E9PKP3;Q86YD3-2	.;TMM25_HUMAN;.;.;.;.;.;.	I	78;78;78;78;78;78;46;78;78;78;78;78	ENSP00000411882:R78I;ENSP00000416071:R78I;ENSP00000352924:R78I;ENSP00000432040:R78I;ENSP00000439408:R78I;ENSP00000346237:R78I;ENSP00000433938:R46I;ENSP00000433906:R78I;ENSP00000431548:R78I;ENSP00000315635:R78I;ENSP00000431205:R78I;ENSP00000436746:R78I	ENSP00000315635:R78I	R	+	2	0	TMEM25	117908237	0.054000	0.20591	0.887000	0.34795	0.992000	0.81027	2.479000	0.45197	1.130000	0.42092	0.561000	0.74099	AGA			0.642	TMEM25-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389266.1		NM_032780	
VPS26B	112936	mdanderson.org	37	11	134114860	134114860	+	Silent	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr11:134114860G>T	ENST00000281187.5	+	5	1228	c.750G>T	c.(748-750)ctG>ctT	p.L250L	VPS26B_ENST00000525095.2_Silent_p.L250L	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	250					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		GGCTCTTCCTGGCCGGGTATG	0.597											OREG0021548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L250L	Colon(171;1263 1952 15904 45703 47982)												.	.			0			c.G750T												71.0	66.0	68.0					11																	134114860		2201	4297	6498	SO:0001819	synonymous_variant	112936	exon5			CTTCCTGGCCGGG		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.750G>T	11.37:g.134114860G>T			45	0	0	1608	26	0.12	3	NM_052875	82	0.00	0	Q96A55	Silent	SNP	ENST00000281187.5	37	CCDS8495.1																																																																																					0.597	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393591.1		NM_052875	
GPR162	27239	hgsc.bcm.edu	37	12	6935869	6935869	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:6935869C>T	ENST00000311268.3	+	5	2054	c.1267C>T	c.(1267-1269)Cct>Tct	p.P423S	GPR162_ENST00000428545.2_Missense_Mutation_p.P139S|LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000251761.8_RNA|GPR162_ENST00000382315.3_Missense_Mutation_p.P119S|LEPREL2_ENST00000606935.1_RNA	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	423						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						CTTCTCTACCCCTCGGGAACC	0.617																																					p.P423S													GPR162,caecum,carcinoma,0,1	GPR162	0	1	0			c.C1267T												103.0	115.0	111.0					12																	6935869		2203	4300	6503	SO:0001583	missense	27239	exon5			TCTACCCCTCGGG	U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.1267C>T	12.37:g.6935869C>T	ENSP00000311528:p.Pro423Ser		80	0	0		96	0.04	4	NM_019858	9	0.00	0	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094990	0.56075	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.41065	3.17;1.01;1.01	5.1	5.1	0.69264	.	.	.	.	.	T	0.43853	0.1266	L	0.36672	1.1	0.37974	D	0.933386	D;P	0.54964	0.969;0.608	P;B	0.48677	0.586;0.19	T	0.37957	-0.9683	9	0.33940	T	0.23	.	18.6917	0.91585	0.0:1.0:0.0:0.0	.	139;423	Q16538-2;Q16538	.;GP162_HUMAN	S	423;139;119	ENSP00000311528:P423S;ENSP00000399670:P139S;ENSP00000371752:P119S	ENSP00000311528:P423S	P	+	1	0	GPR162	6806130	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.041000	0.57339	2.652000	0.90054	0.561000	0.74099	CCT			0.617	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399478.1		NM_019858	
STRAP	11171	mdanderson.org	37	12	16036515	16036515	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:16036515G>T	ENST00000419869.2	+	2	466	c.153G>T	c.(151-153)tgG>tgT	p.W51C	STRAP_ENST00000025399.6_Missense_Mutation_p.W64C|STRAP_ENST00000538352.1_Intron	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	51					maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				CAGGAGACTGGATTGGAACAT	0.388																																					p.W51C													.	.			0			c.G153T												89.0	78.0	81.0					12																	16036515		2203	4300	6503	SO:0001583	missense	11171	exon2			AGACTGGATTGGA	AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.153G>T	12.37:g.16036515G>T	ENSP00000392270:p.Trp51Cys		43	0	0		46	0.07	3	NM_007178	419	0.00	0	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Missense_Mutation	SNP	ENST00000419869.2	37	CCDS8676.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250319	0.80024	.	.	ENSG00000023734	ENST00000025399;ENST00000419869	T;T	0.80393	-1.37;-1.37	4.39	4.39	0.52855	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78220	0.4249	N	0.03903	-0.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83025	-0.0165	10	0.42905	T	0.14	-4.3811	17.5463	0.87863	0.0:0.0:1.0:0.0	.	64;51	B4DNJ6;Q9Y3F4	.;STRAP_HUMAN	C	64;51	ENSP00000025399:W64C;ENSP00000392270:W51C	ENSP00000025399:W64C	W	+	3	0	STRAP	15927782	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.595000	0.98260	2.436000	0.82500	0.655000	0.94253	TGG			0.388	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401114.1		NM_007178	
MSRB3	253827	hgsc.bcm.edu;mdanderson.org	37	12	65672601	65672601	+	Missense_Mutation	SNP	G	G	C	rs377713148		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:65672601G>C	ENST00000355192.3	+	1	179	c.53G>C	c.(52-54)tGc>tCc	p.C18S	MSRB3_ENST00000540804.1_Missense_Mutation_p.C18S|RP11-305O6.3_ENST00000545709.1_RNA|MSRB3_ENST00000535664.1_5'UTR|MSRB3_ENST00000308259.5_5'UTR|MSRB3_ENST00000538725.1_3'UTR	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	18					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		ctctccctctgcctctgcctc	0.731																																					p.C18S													.	.			0			c.G53C												19.0	17.0	18.0					12																	65672601		2164	4234	6398	SO:0001583	missense	253827	exon1			CCCTCTGCCTCTG	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.53G>C	12.37:g.65672601G>C	ENSP00000347324:p.Cys18Ser		108	0	0		127	0.05	6	NM_198080	5	0.00	0	B4DR19|B7ZAQ0|Q6UXS2	Missense_Mutation	SNP	ENST00000355192.3	37	CCDS8973.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.976760	0.53720	.	.	ENSG00000174099	ENST00000355192;ENST00000540804	T;T	0.62498	0.05;0.02	.	.	.	.	521.918000	0.00166	N	0.000000	T	0.41282	0.1152	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28202	-1.0051	7	.	.	.	.	.	.	.	.	18	Q8IXL7	MSRB3_HUMAN	S	18	ENSP00000347324:C18S;ENSP00000437623:C18S	.	C	+	2	0	MSRB3	63958868	0.947000	0.32204	0.951000	0.38953	0.832000	0.47134	0.829000	0.27449	0.119000	0.18210	0.121000	0.15741	TGC			0.731	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000401421.1		NM_198080	
GLTP	51228	mdanderson.org	37	12	110318081	110318081	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:110318081G>T	ENST00000318348.4	-	1	212	c.99C>A	c.(97-99)ttC>ttA	p.F33L	RP1-7G5.6_ENST00000446473.2_lincRNA|GLTP_ENST00000544393.1_Missense_Mutation_p.F33L	NM_016433.3	NP_057517.1	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein	33					glycolipid transport (GO:0046836)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|lipid binding (GO:0008289)			endometrium(1)|kidney(1)|lung(1)|upper_aerodigestive_tract(1)	4		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		GCTCACCGAAGAAGGGCGGCA	0.677																																					p.F33L													.	.			0			c.C99A												22.0	23.0	23.0					12																	110318081		2200	4296	6496	SO:0001583	missense	51228	exon1			ACCGAAGAAGGGC	AF209704, AY372530	CCDS9136.1	12q24.11	2008-08-08			ENSG00000139433	ENSG00000139433			24867	protein-coding gene	gene with protein product		608949				15287756, 15901739	Standard	NM_016433		Approved		uc001tpm.3	Q9NZD2	OTTHUMG00000169278	ENST00000318348.4:c.99C>A	12.37:g.110318081G>T	ENSP00000315263:p.Phe33Leu		26	0	0		35	0.09	3	NM_016433	51	0.00	0	Q53Z13|Q96J68	Missense_Mutation	SNP	ENST00000318348.4	37	CCDS9136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	19.15|19.15	3.771438|3.771438	0.69992|0.69992	.|.	.|.	ENSG00000139433|ENSG00000139433	ENST00000318348;ENST00000544393|ENST00000540772	.|.	.|.	.|.	4.49|4.49	4.49|4.49	0.54785|0.54785	Glycolipid transfer protein domain (3);|.	0.051282|.	0.85682|.	D|.	0.000000|.	T|T	0.41534|0.41534	0.1163|0.1163	N|N	0.13299|0.13299	0.325|0.325	0.49299|0.49299	D|D	0.999779|0.999779	B|.	0.10296|.	0.003|.	B|.	0.12837|.	0.008|.	T|T	0.27088|0.27088	-1.0084|-1.0084	9|5	0.05721|.	T|.	0.95|.	.|.	13.1305|13.1305	0.59380|0.59380	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	33|.	Q9NZD2|.	GLTP_HUMAN|.	L|Y	33|17	.|.	ENSP00000315263:F33L|.	F|S	-|-	3|2	2|0	GLTP|GLTP	108802464|108802464	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.936000|0.936000	0.57629|0.57629	1.885000|1.885000	0.39678|0.39678	2.230000|2.230000	0.72887|0.72887	0.459000|0.459000	0.35465|0.35465	TTC|TCT			0.677	GLTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403278.2		NM_016433	
HECTD4	283450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112605270	112605270	+	Silent	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:112605270G>A	ENST00000430131.2	-	71	12264	c.11119C>T	c.(11119-11121)Ctg>Ttg	p.L3707L	HECTD4_ENST00000377560.5_Silent_p.L3957L|HECTD4_ENST00000550722.1_Silent_p.L3983L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3707	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GCAATCCCCAGCAGCTGCCCC	0.642																																					p.L3995L													.	.			0			c.C11983T												46.0	52.0	50.0					12																	112605270		1981	4143	6124	SO:0001819	synonymous_variant	283450	exon72			TCCCCAGCAGCTG	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11119C>T	12.37:g.112605270G>A			99	0	0		91	0.21	19	NM_001109662	99	0.30	30	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																						0.642	HECTD4-202	KNOWN	basic	protein_coding	protein_coding				NM_173813	
RBM19	9904	mdanderson.org	37	12	114374911	114374911	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:114374911C>T	ENST00000545145.2	-	16	2047	c.1969G>A	c.(1969-1971)Gct>Act	p.A657T	RBM19_ENST00000392561.3_Missense_Mutation_p.A657T|RP11-780K2.1_ENST00000550206.1_RNA|RBM19_ENST00000261741.5_Missense_Mutation_p.A657T	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	657	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CCAACTGGAGCCCACTCCAGA	0.547																																					p.A657T													.	.			0			c.G1969A												106.0	106.0	106.0					12																	114374911		2203	4300	6503	SO:0001583	missense	9904	exon16			CTGGAGCCCACTC	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1969G>A	12.37:g.114374911C>T	ENSP00000442053:p.Ala657Thr		111	0	0		115	0.04	5	NM_001146699	42	0.00	0	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	37	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	C	33	5.272705	0.95429	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.08634	3.07;3.07;3.07	4.8	4.8	0.61643	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.46092	0.1375	H	0.98155	4.16	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.68800	-0.5313	10	0.87932	D	0	-11.8045	16.8661	0.86029	0.0:1.0:0.0:0.0	.	657	Q9Y4C8	RBM19_HUMAN	T	657	ENSP00000442053:A657T;ENSP00000376344:A657T;ENSP00000261741:A657T	ENSP00000261741:A657T	A	-	1	0	RBM19	112859294	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.869000	0.75521	2.222000	0.72286	0.655000	0.94253	GCT			0.547	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405251.1		NM_016196	
RPLP0	6175	broad.mit.edu	37	12	120634654	120634654	+	Silent	SNP	A	A	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr12:120634654A>T	ENST00000551150.1	-	7	1191	c.876T>A	c.(874-876)gcT>gcA	p.A292A	RPLP0_ENST00000313104.5_Silent_p.A230A|RPLP0_ENST00000546989.1_Silent_p.A256A|RPLP0_ENST00000552292.1_Silent_p.A82A|GCN1L1_ENST00000300648.6_5'Flank|RPLP0_ENST00000228306.4_Silent_p.A292A|RPLP0_ENST00000550296.1_5'Flank|RPLP0_ENST00000392514.4_Silent_p.A292A			P05388	RLA0_HUMAN	ribosomal protein, large, P0	292					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGGGGCTgcagcagcagcag	0.552																																					p.A292A													.	RPLP0	27		0			c.T876A												21.0	23.0	22.0					12																	120634654		2186	4241	6427	SO:0001819	synonymous_variant	6175	exon8			GGCTGCAGCAGCA	AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.876T>A	12.37:g.120634654A>T			263	0	0		313	0.01	4	NM_053275	11730	0.00	7	Q3B7A4|Q9BVK4	Silent	SNP	ENST00000551150.1	37	CCDS9193.1																																																																																					0.552	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403448.3		NM_053275	
PCDH8	5100	mdanderson.org	37	13	53420269	53420269	+	Missense_Mutation	SNP	A	A	G			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr13:53420269A>G	ENST00000377942.3	-	1	2506	c.2303T>C	c.(2302-2304)aTc>aCc	p.I768T	PCDH8_ENST00000338862.4_Missense_Mutation_p.I768T	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	768					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GGCGATGGCGATGATGGCGGC	0.721																																					p.I768T	GBM(36;25 841 9273 49207)												.	.			0			c.T2303C												22.0	32.0	29.0					13																	53420269		2061	4098	6159	SO:0001583	missense	5100	exon1			ATGGCGATGATGG	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2303T>C	13.37:g.53420269A>G	ENSP00000367177:p.Ile768Thr		27	0	0		16	0.19	3	NM_002590	0		0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.058833	0.76074	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.55588	0.51;0.58	4.49	4.49	0.54785	.	0.000000	0.44902	D	0.000401	T	0.57989	0.2091	L	0.29908	0.895	0.48632	D	0.999682	D;D	0.69078	0.988;0.997	P;P	0.62382	0.871;0.901	T	0.63346	-0.6658	10	0.87932	D	0	.	13.9673	0.64216	1.0:0.0:0.0:0.0	.	768;768	O95206-2;O95206	.;PCDH8_HUMAN	T	768;768;294;611	ENSP00000367177:I768T;ENSP00000341350:I768T	ENSP00000341350:I768T	I	-	2	0	PCDH8	52318270	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.737000	0.91562	1.879000	0.54435	0.533000	0.62120	ATC			0.721	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000045108.2		NM_002590	
FANCM	57697	mdanderson.org	37	14	45606273	45606273	+	Splice_Site	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr14:45606273G>T	ENST00000267430.5	+	2	595	c.510G>T	c.(508-510)ggG>ggT	p.G170G	FKBP3_ENST00000216330.3_5'Flank|FANCM_ENST00000542564.2_Splice_Site_p.G170G|FKBP3_ENST00000396062.3_5'Flank|FANCM_ENST00000556036.1_Splice_Site_p.G170G	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	170	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TATTTTCAGGGTCTACACAAG	0.373								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.G170G													.	.			0			c.G510T												90.0	93.0	92.0					14																	45606273		2203	4300	6503	SO:0001630	splice_region_variant	57697	exon2	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTCAGGGTCTACA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.509-1G>T	14.37:g.45606273G>T			48	0.0416666667	2		38	0.08	3	NM_020937	13	0.00	0	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	CCDS32070.1																																																																																					0.373	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000410474.1		XM_048128	Silent
PLEKHH1	57475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	68044798	68044798	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr14:68044798C>T	ENST00000329153.5	+	19	2765	c.2633C>T	c.(2632-2634)tCc>tTc	p.S878F	PLEKHH1_ENST00000417684.2_5'Flank	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	878	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TACCATGTGTCCCTGGCCCAG	0.622																																					p.S878F													.	.			0			c.C2633T												86.0	88.0	87.0					14																	68044798		2164	4269	6433	SO:0001583	missense	57475	exon19			ATGTGTCCCTGGC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2633C>T	14.37:g.68044798C>T	ENSP00000330278:p.Ser878Phe		116	0	0		150	0.21	32	NM_020715	83	0.25	21	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933586	0.92458	.	.	ENSG00000054690	ENST00000329153	D	0.92048	-2.96	5.14	5.14	0.70334	MyTH4 domain (3);	0.000000	0.85682	D	0.000000	D	0.96147	0.8744	M	0.80028	2.48	0.80722	D	1	D	0.54601	0.967	D	0.70227	0.968	D	0.96261	0.9191	10	0.66056	D	0.02	.	18.7908	0.91973	0.0:1.0:0.0:0.0	.	878	Q9ULM0	PKHH1_HUMAN	F	878	ENSP00000330278:S878F	ENSP00000330278:S878F	S	+	2	0	PLEKHH1	67114551	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	7.320000	0.79064	2.665000	0.90641	0.655000	0.94253	TCC			0.622	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412730.3		XM_031054	
ADAM21P1	145241	broad.mit.edu	37	14	70714357	70714357	+	RNA	SNP	T	T	G	rs370130121	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr14:70714357T>G	ENST00000530196.1	-	0	161					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TGATGTACACTAGGGTCCCAT	0.537													T|||	2	0.000399361	0.0015	0.0	5008	,	,		23687	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			GTACACTAGGGTC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714357T>G			68	0.0441176471	3		70	0.06	4	.	0		0		RNA	SNP	ENST00000530196.1	37																																																																																						0.537	ADAM21P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000390451.1		NG_002467	
CCDC64B	146439	mdanderson.org	37	16	3080718	3080718	+	Silent	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr16:3080718C>T	ENST00000572449.1	-	4	656	c.594G>A	c.(592-594)cgG>cgA	p.R198R	CCDC64B_ENST00000389347.4_Silent_p.R198R|CCDC64B_ENST00000573514.1_5'UTR|RP11-473M20.5_ENST00000382225.3_RNA			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	198										breast(1)|endometrium(2)|large_intestine(1)	4						GACTCTCCAGCCGCGTCCTCA	0.657																																					p.R198R													.	.			0			c.G594A												22.0	26.0	25.0					16																	3080718		1990	4161	6151	SO:0001819	synonymous_variant	146439	exon3			CTCCAGCCGCGTC	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.594G>A	16.37:g.3080718C>T			56	0	0		46	0.07	3	NM_001103175	1	0.00	0	Q658L9	Silent	SNP	ENST00000572449.1	37	CCDS45393.1																																																																																					0.657	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000436991.1			
KIAA0430	9665	broad.mit.edu;mdanderson.org	37	16	15719657	15719657	+	Splice_Site	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr16:15719657G>A	ENST00000396368.3	-	8	1731	c.1525C>T	c.(1525-1527)Cag>Tag	p.Q509*	KIAA0430_ENST00000548025.1_Splice_Site_p.Q506*|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000344181.3_Splice_Site_p.Q331*|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000602337.1_Splice_Site_p.Q506*	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	509					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						GTGTGGCACTGCTAATACAGA	0.433																																					p.Q509X													.	KIAA0430	154		0			c.C1525T												71.0	65.0	67.0					16																	15719657		1906	4127	6033	SO:0001630	splice_region_variant	9665	exon8			GGCACTGCTAATA	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.1525-1C>T	16.37:g.15719657G>A			36	0	0		37	0.35	13	NM_014647	20	0.15	3	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Splice_Site	SNP	ENST00000396368.3	37	CCDS10562.2	.	.	.	.	.	.	.	.	.	.	G	35	5.470514	0.96274	.	.	ENSG00000166783	ENST00000396368;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551298	.	.	.	5.43	5.43	0.79202	.	0.211651	0.40385	N	0.001112	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	15.1345	0.72552	0.0:0.1823:0.8177:0.0	.	.	.	.	X	509;508;331;506;509	.	ENSP00000315718:Q508X	Q	-	1	0	KIAA0430	15627158	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.667000	0.68067	2.537000	0.85549	0.591000	0.81541	CAG			0.433	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252131.2		NM_014647	Nonsense_Mutation
PDP2	57546	mdanderson.org	37	16	66918754	66918754	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr16:66918754G>A	ENST00000311765.2	+	2	901	c.567G>A	c.(565-567)tgG>tgA	p.W189*	PDP2_ENST00000568720.1_Intron	NM_020786.2	NP_065837.1	Q9P2J9	PDP2_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 2	189					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|magnesium-dependent protein serine/threonine phosphatase activity (GO:0004724)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		TCCTGCATTGGCTCAAGCACC	0.517																																					p.W189X													.	.			0			c.G567A												106.0	76.0	86.0					16																	66918754		2200	4300	6500	SO:0001587	stop_gained	57546	exon2			GCATTGGCTCAAG	AB037769	CCDS10822.1	16q22.1	2012-04-17			ENSG00000172840	ENSG00000172840		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	30263	protein-coding gene	gene with protein product	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit 2"""	615499				9651365	Standard	NM_020786		Approved	KIAA1348, PPM2C2	uc002eqk.2	Q9P2J9	OTTHUMG00000137512	ENST00000311765.2:c.567G>A	16.37:g.66918754G>A	ENSP00000309548:p.Trp189*		82	0	0		46	0.07	3	NM_020786	7	0.00	0	A8K924	Nonsense_Mutation	SNP	ENST00000311765.2	37	CCDS10822.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267491	0.80469	.	.	ENSG00000172840	ENST00000311765	.	.	.	5.72	5.72	0.89469	.	0.063065	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5025	20.2516	0.98409	0.0:0.0:1.0:0.0	.	.	.	.	X	189	.	ENSP00000309548:W189X	W	+	3	0	PDP2	65476255	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.778000	0.99011	2.867000	0.98391	0.637000	0.83480	TGG			0.517	PDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268831.2		NM_020786	
LRRC37BP1	147172	hgsc.bcm.edu;broad.mit.edu	37	17	28961033	28961033	+	RNA	SNP	T	T	G	rs397833613		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr17:28961033T>G	ENST00000417404.1	+	0	1291									leucine rich repeat containing 37B pseudogene 1																		AGTTCCAGGATATGACTATAA	0.264																																					.													.	.			0			.																																											147172	.			CCAGGATATGACT	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28961033T>G			106	0	0		113	0.04	5	.	28	0.00	0		RNA	SNP	ENST00000417404.1	37																																																																																						0.264	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000256203.1		NR_015341	
SCRN2	90507	mdanderson.org	37	17	45915296	45915296	+	Silent	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr17:45915296G>A	ENST00000290216.9	-	8	1317	c.1192C>T	c.(1192-1194)Ctg>Ttg	p.L398L	SCRN2_ENST00000407215.3_3'UTR|SCRN2_ENST00000584123.1_Silent_p.L406L	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	398						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						TCGCCGGCCAGCAGCCCCTGT	0.632																																					p.L398L													.	.			0			c.C1192T												25.0	27.0	26.0					17																	45915296		2203	4300	6503	SO:0001819	synonymous_variant	90507	exon8			CGGCCAGCAGCCC	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1192C>T	17.37:g.45915296G>A			36	0	0		31	0.10	3	NM_138355	36	0.00	0	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Silent	SNP	ENST00000290216.9	37	CCDS11519.1																																																																																					0.632	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441383.1		NM_138355	
HGS	9146	mdanderson.org	37	17	79663412	79663412	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr17:79663412G>T	ENST00000329138.4	+	16	1554	c.1419G>T	c.(1417-1419)aaG>aaT	p.K473N		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	473	Interaction with SNAP25 and TRAK2. {ECO:0000250}.|Interaction with SNX1. {ECO:0000250}.|Interaction with STAM1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			TGCAGGACAAGCTGGCACAGA	0.672																																					p.K473N													.	.			0			c.G1419T												22.0	25.0	24.0					17																	79663412		2194	4283	6477	SO:0001583	missense	9146	exon16			GGACAAGCTGGCA	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.1419G>T	17.37:g.79663412G>T	ENSP00000331201:p.Lys473Asn		50	0	0		46	0.07	3	NM_004712	128	0.00	0	Q9NR36	Missense_Mutation	SNP	ENST00000329138.4	37	CCDS11784.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881605	0.72294	.	.	ENSG00000185359	ENST00000329138;ENST00000442335	T	0.09445	2.98	4.78	3.81	0.43845	Hepatocyte growth factor-regulated tyrosine kinase substrate, helical domain (1);	0.152649	0.56097	D	0.000034	T	0.24431	0.0592	L	0.57536	1.79	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.00880	-1.1529	10	0.87932	D	0	-52.2692	6.9306	0.24439	0.2783:0.0:0.7217:0.0	.	473	O14964	HGS_HUMAN	N	473	ENSP00000331201:K473N	ENSP00000331201:K473N	K	+	3	2	HGS	77273817	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	2.190000	0.42630	1.136000	0.42199	0.579000	0.79373	AAG			0.672	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440541.1		NM_004712	
TPGS2	25941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	34378389	34378389	+	Intron	SNP	A	A	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr18:34378389A>C	ENST00000334295.4	-	6	1085				TPGS2_ENST00000383056.3_Intron|TPGS2_ENST00000587129.1_Intron|TPGS2_ENST00000590842.1_Intron|TPGS2_ENST00000590652.1_Intron|TPGS2_ENST00000589049.1_Missense_Mutation_p.L227W|TPGS2_ENST00000593035.1_Intron	NM_015476.2	NP_056291.2	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2							cytoplasm (GO:0005737)|microtubule (GO:0005874)											CATAGTTTACAATGGCAGGTG	0.517																																					p.L227W													.	.			0			c.T680G												81.0	87.0	85.0					18																	34378389		2203	4300	6503	SO:0001627	intron_variant	25941	exon6			GTTTACAATGGCA	BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000334295.4:c.657+22T>G	18.37:g.34378389A>C			79	0	0		80	0.34	27	NM_001271954	5	0.20	1	B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Missense_Mutation	SNP	ENST00000334295.4	37	CCDS32817.1																																																																																					0.517	TPGS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000440410.2		NM_015476	
SSBP4	170463	mdanderson.org	37	19	18541711	18541711	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr19:18541711G>A	ENST00000270061.7	+	5	634	c.340G>A	c.(340-342)Gca>Aca	p.A114T	SSBP4_ENST00000598159.2_3'UTR|SSBP4_ENST00000348495.6_Missense_Mutation_p.A114T|SSBP4_ENST00000599699.2_5'Flank	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	114						nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.A114T(1)		endometrium(2)|kidney(1)|skin(1)	4						CACAATGGCCGCAGGCTCCAT	0.662																																					p.A114T													SSBP4,NS,carcinoma,0,1	SSBP4	0	1	1	Substitution - Missense(1)	endometrium(1)	c.G340A												31.0	33.0	32.0					19																	18541711		2203	4299	6502	SO:0001583	missense	170463	exon5			ATGGCCGCAGGCT		CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.340G>A	19.37:g.18541711G>A	ENSP00000270061:p.Ala114Thr		39	0	0		26	0.08	2	NM_001009998	200	0.00	0	Q9BWW5	Missense_Mutation	SNP	ENST00000270061.7	37	CCDS12378.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.777053	0.31411	.	.	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	2.64	1.54	0.23209	.	0.167223	0.36628	U	0.002484	T	0.34687	0.0906	L	0.29908	0.895	0.33712	D	0.615875	B;B	0.12630	0.003;0.006	B;B	0.13407	0.009;0.005	T	0.28459	-1.0043	9	0.33141	T	0.24	.	6.9326	0.24449	0.0:0.0:0.7039:0.2961	.	114;114	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	T	114	.	ENSP00000270061:A114T	A	+	1	0	SSBP4	18402711	1.000000	0.71417	0.990000	0.47175	0.380000	0.30137	3.240000	0.51368	0.368000	0.24481	0.561000	0.74099	GCA			0.662	SSBP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466348.3		NM_032627	
LRFN1	57622	mdanderson.org	37	19	39805736	39805736	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr19:39805736G>T	ENST00000248668.4	-	1	240	c.241C>A	c.(241-243)Cgc>Agc	p.R81S	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	81						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			TCTCGGCGGCGCACGGCGGCG	0.677																																					p.R81S													.	.			0			c.C241A												10.0	13.0	12.0					19																	39805736		2161	4249	6410	SO:0001583	missense	57622	exon1			GGCGGCGCACGGC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.241C>A	19.37:g.39805736G>T	ENSP00000248668:p.Arg81Ser		19	0	0		14	0.14	2	NM_020862	18	0.00	0	Q8TBS9	Missense_Mutation	SNP	ENST00000248668.4	37	CCDS46071.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.268984	0.40095	.	.	ENSG00000128011	ENST00000248668	T	0.56275	0.47	4.43	3.36	0.38483	.	0.000000	0.40640	N	0.001055	T	0.42944	0.1225	L	0.46670	1.46	0.58432	D	0.999999	B	0.30068	0.267	B	0.32289	0.143	T	0.18147	-1.0346	10	0.12766	T	0.61	.	11.8672	0.52501	0.0:0.1783:0.8216:0.0	.	81	Q9P244	LRFN1_HUMAN	S	81	ENSP00000248668:R81S	ENSP00000248668:R81S	R	-	1	0	LRFN1	44497576	1.000000	0.71417	0.939000	0.37840	0.885000	0.51271	2.433000	0.44793	1.032000	0.39892	0.557000	0.71058	CGC			0.677	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463835.1		NM_020862	
SRRM5	100170229	mdanderson.org	37	19	44118004	44118004	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr19:44118004G>T	ENST00000607544.1	+	3	2053	c.1731G>T	c.(1729-1731)aaG>aaT	p.K577N	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000526798.1_Missense_Mutation_p.K592N|SRRM5_ENST00000417606.1_Missense_Mutation_p.K577N			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	577	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						GCCCCAGCAAGGAGAGAGAGC	0.547																																					p.K577N													.	.			0			c.G1731T												118.0	134.0	129.0					19																	44118004		692	1591	2283	SO:0001583	missense	100170229	exon1			CAGCAAGGAGAGA	AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1731G>T	19.37:g.44118004G>T	ENSP00000476253:p.Lys577Asn		74	0	0		48	0.06	3	NM_001145641	4	0.00	0	B4DNF0	Missense_Mutation	SNP	ENST00000607544.1	37	CCDS46095.1	.	.	.	.	.	.	.	.	.	.	g	14.75	2.629560	0.46944	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	4.63	-4.71	0.03279	.	.	.	.	.	T	0.14056	0.0340	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.25916	-1.0118	8	0.19590	T	0.45	.	1.319	0.02112	0.3962:0.2605:0.2112:0.1322	.	577	B3KS81	SRRM5_HUMAN	N	592;577	.	ENSP00000414512:K577N	K	+	3	2	SRRM5	48809844	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.801000	0.00761	-0.551000	0.06175	-0.219000	0.12488	AAG			0.547	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding		OTTHUMT00000384398.2		NM_001145641	
ERCC1	2067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45920093	45920093	+	Missense_Mutation	SNP	C	C	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr19:45920093C>A	ENST00000300853.3	-	6	1179	c.588G>T	c.(586-588)ttG>ttT	p.L196F	ERCC1_ENST00000013807.5_Missense_Mutation_p.L196F|ERCC1_ENST00000589165.1_Missense_Mutation_p.L196F|ERCC1_ENST00000340192.7_Missense_Mutation_p.L196F|ERCC1_ENST00000423698.2_Missense_Mutation_p.L124F|ERCC1_ENST00000591636.1_Missense_Mutation_p.L196F|ERCC1_ENST00000588738.1_5'Flank	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	196					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		AGGCGAGGATCAATGTGCAGT	0.572								Nucleotide excision repair (NER)																													p.L196F													.	.			0			c.G588T												75.0	61.0	66.0					19																	45920093		2203	4300	6503	SO:0001583	missense	2067	exon6			GAGGATCAATGTG		CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.588G>T	19.37:g.45920093C>A	ENSP00000300853:p.Leu196Phe		71	0	0		71	0.10	7	NM_001983	190	0.25	48	B2RC01|B3KRR0|Q7Z7F5|Q96S40	Missense_Mutation	SNP	ENST00000300853.3	37	CCDS12662.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.902549	0.52227	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000423698;ENST00000013807	T;T;T;T	0.69040	-0.2;-0.25;-0.18;-0.37	4.54	2.23	0.28157	Restriction endonuclease, type II-like (1);	0.000000	0.64402	D	0.000001	T	0.81987	0.4939	M	0.92459	3.31	0.50632	D	0.999882	D;D;D;D	0.76494	0.999;0.993;0.998;0.998	P;P;P;P	0.62184	0.899;0.786;0.835;0.835	D	0.83667	0.0164	10	0.87932	D	0	-12.4534	10.4034	0.44243	0.0:0.6121:0.3879:0.0	.	196;124;196;196	Q7Z7F5;B3KRR0;Q96S40;P07992	.;.;.;ERCC1_HUMAN	F	196;196;124;196	ENSP00000300853:L196F;ENSP00000345203:L196F;ENSP00000394875:L124F;ENSP00000013807:L196F	ENSP00000013807:L196F	L	-	3	2	ERCC1	50611933	1.000000	0.71417	0.954000	0.39281	0.553000	0.35397	1.073000	0.30691	0.458000	0.26988	0.313000	0.20887	TTG			0.572	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459542.1		NM_001983	
LAIR1	3903	broad.mit.edu	37	19	54871676	54871676	+	Missense_Mutation	SNP	G	G	C	rs190462445		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr19:54871676G>C	ENST00000391742.2	-	4	520	c.368C>G	c.(367-369)aCc>aGc	p.T123S	LAIR1_ENST00000391743.3_Missense_Mutation_p.T105S|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000434277.2_Missense_Mutation_p.T122S|LAIR1_ENST00000313038.6_Missense_Mutation_p.T116S|LAIR1_ENST00000474878.1_Intron|LAIR1_ENST00000348231.4_Intron			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	123					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		GCCTCCAGAGGTTTCTGTAAA	0.627																																					p.T123S													.	LAIR1	44		0			c.C368G																																									SO:0001583	missense	3903	exon4			CCAGAGGTTTCTG	AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.368C>G	19.37:g.54871676G>C	ENSP00000375622:p.Thr123Ser		105	0.019047619	2		97	0.04	4	NM_002287	59	0.08	5		Missense_Mutation	SNP	ENST00000391742.2	37	CCDS12891.1	26	0.011904761904761904	2	0.0040650406504065045	3	0.008287292817679558	4	0.006993006993006993	17	0.022427440633245383	.	5.350	0.249947	0.10130	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000313038;ENST00000444687	T;T;T;T;T	0.47528	7.09;7.19;7.2;7.15;0.84	1.95	-0.399	0.12415	.	.	.	.	.	T	0.15392	0.0371	L	0.43152	1.355	0.09310	N	1	B;B;B;B	0.24533	0.022;0.105;0.017;0.01	B;B;B;B	0.14023	0.01;0.009;0.005;0.005	T	0.17684	-1.0361	9	0.09338	T	0.73	.	2.5523	0.04751	0.1781:0.0:0.5376:0.2842	.	123;105;122;123	Q6GTX8-4;A8MZ84;D3YTC8;Q6GTX8	.;.;.;LAIR1_HUMAN	S	105;123;122;116;13	ENSP00000375623:T105S;ENSP00000375622:T123S;ENSP00000391003:T122S;ENSP00000319204:T116S;ENSP00000392722:T13S	ENSP00000319204:T116S	T	-	2	0	LAIR1	59563488	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.786000	0.04623	-0.001000	0.14495	0.479000	0.44913	ACC			0.627	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000140506.1			
PTCD3	55037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	86361968	86361968	+	Missense_Mutation	SNP	G	G	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr2:86361968G>C	ENST00000254630.7	+	21	1702	c.1636G>C	c.(1636-1638)Gtg>Ctg	p.V546L	SNORD94_ENST00000386037.1_RNA	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	546					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TCAGCTTCAGGTGGCATTTGC	0.453																																					p.V546L													.	.			0			c.G1636C												114.0	121.0	118.0					2																	86361968		2203	4300	6503	SO:0001583	missense	55037	exon21			CTTCAGGTGGCAT		CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.1636G>C	2.37:g.86361968G>C	ENSP00000254630:p.Val546Leu		210	0	0		201	0.19	38	NM_017952	169	0.09	15	A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	37	CCDS33235.1	.	.	.	.	.	.	.	.	.	.	G	7.862	0.726342	0.15439	.	.	ENSG00000132300	ENST00000254630	T	0.28666	1.6	5.7	3.9	0.45041	.	0.707946	0.14522	N	0.314383	T	0.24314	0.0589	L	0.52573	1.65	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.002	T	0.06935	-1.0799	10	0.28530	T	0.3	-2.1813	4.3801	0.11290	0.1435:0.1308:0.6049:0.1208	.	137;546	Q96EY7-2;Q96EY7	.;PTCD3_HUMAN	L	546	ENSP00000254630:V546L	ENSP00000254630:V546L	V	+	1	0	PTCD3	86215479	0.831000	0.29352	0.992000	0.48379	0.403000	0.30841	0.962000	0.29280	0.759000	0.33084	0.650000	0.86243	GTG			0.453	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000329854.1		NM_017952	
ANKRD36BP2	645784	broad.mit.edu	37	2	89102605	89102605	+	RNA	DEL	C	C	-	rs375479592	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr2:89102605delC	ENST00000393525.3	+	0	3079									ankyrin repeat domain 36B pseudogene 2																		CTCTGGCTTTCATTCTGCCGT	0.249													C|C|-|deletion	1312	0.261981	0.2458	0.2147	5008	,	,		19364	0.2688		0.2843	False		,,,				2504	0.2873				.													.	.			0			.																																											0	.			GGCTTTCATTCTG			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89102605delC			4	0	0		6	0.33	2	.	2	0.00	0		RNA	DEL	ENST00000393525.3	37																																																																																						0.249	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
WASH2P	375260	broad.mit.edu	37	2	114355774	114355784	+	RNA	DEL	GAGGTGGCTGG	GAGGTGGCTGG	-	rs7578831		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	GAGGTGGCTGG	GAGGTGGCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr2:114355774_114355784delGAGGTGGCTGG	ENST00000538033.2	+	0	2154							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ccctgtccccgaggtggctgggaggTGGCTC	0.611																																					.													.	.			0			.																																											0	.			GTCCCCGAGGTGG			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355774_114355784delGAGGTGGCTGG			9	0	0		10	0.40	4	.	4	0.00	0		RNA	DEL	ENST00000538033.2	37																																																																																						0.611	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene		OTTHUMT00000467782.1		NM_198943	
FAM171B	165215	hgsc.bcm.edu	37	2	187559029	187559029	+	Silent	SNP	A	A	G	rs549897920|rs56669143	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr2:187559029A>G	ENST00000304698.5	+	1	332	c.129A>G	c.(127-129)caA>caG	p.Q43Q	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	43	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GCCTCATCcaacagcagcagc	0.642																																					p.Q43Q													.	.			0			c.A129G												18.0	20.0	19.0					2																	187559029		2201	4300	6501	SO:0001819	synonymous_variant	165215	exon1			CATCCAACAGCAG	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.129A>G	2.37:g.187559029A>G			58	0	0		49	0.08	4	NM_177454	2	0.00	0	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	ENST00000304698.5	37	CCDS33347.1																																																																																					0.642	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334679.1		NM_177454	
FRG1B	284802	bcgsc.ca	37	20	29628225	29628225	+	Splice_Site	SNP	A	A	G			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr20:29628225A>G	ENST00000278882.3	+	6	608		c.e6-1		FRG1B_ENST00000439954.2_Splice_Site|FRG1B_ENST00000358464.4_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTTTCACTTAGGGGAAAATG	0.358																																					.													.	FRG1B	181		0			c.529-2A>G																																									SO:0001630	splice_region_variant	284802	exon5			TCACTTAGGGGAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.229-1A>G	20.37:g.29628225A>G			431	0.0162412993	7		438	0.05	21	NR_003579	5	0.00	0	C4AME5	Splice_Site	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	.	8.410	0.843922	0.16963	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.89	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7774	0.29046	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28241886	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.946000	0.87746	1.131000	0.42111	0.147000	0.16070	.			0.358	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	Intron
EEF1A2	1917	bcgsc.ca	37	20	62119705	62119705	+	Silent	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr20:62119705G>T	ENST00000298049.7	-	7	1408	c.1338C>A	c.(1336-1338)ggC>ggA	p.G446G	EEF1A2_ENST00000217182.3_Silent_p.G446G			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	446					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			TGCCGGCGCCGCCGCTCTTCT	0.746																																					p.G446G													EEF1A2,colon,carcinoma,-1,1	EEF1A2	60	1	0			c.C1338A												7.0	6.0	6.0					20																	62119705		1932	3816	5748	SO:0001819	synonymous_variant	1917	exon8			GGCGCCGCCGCTC	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1338C>A	20.37:g.62119705G>T			56	0	0		39	0.10	4	NM_001958	16	0.00	0	B5BUF3|E1P5J1|P54266|Q0VGC7	Silent	SNP	ENST00000298049.7	37	CCDS13522.1																																																																																					0.746	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080495.1		NM_001958	
STMN3	50861	mdanderson.org	37	20	62275211	62275211	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr20:62275211G>T	ENST00000370053.1	-	3	270	c.189C>A	c.(187-189)gaC>gaA	p.D63E	STMN3_ENST00000540534.1_Missense_Mutation_p.D52E	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	63	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			CTGGGGACAGGTCAGAAGGGG	0.612																																					p.D63E													STMN3,NS,carcinoma,-2,1	STMN3	-2	1	0			c.C189A												96.0	90.0	92.0					20																	62275211		2203	4300	6503	SO:0001583	missense	50861	exon3			GGACAGGTCAGAA	AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.189C>A	20.37:g.62275211G>T	ENSP00000359070:p.Asp63Glu		43	0	0		35	0.09	3	NM_015894	310	0.00	0	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	ENST00000370053.1	37	CCDS13529.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585543	0.28268	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	5.09	2.75	0.32379	.	0.000000	0.64402	U	0.000006	T	0.50633	0.1627	L	0.51422	1.61	0.38234	D	0.941131	D	0.65815	0.995	P	0.53490	0.727	T	0.50996	-0.8761	9	0.12766	T	0.61	-31.6846	8.3115	0.32073	0.3008:0.0:0.6992:0.0	.	63	Q9NZ72	STMN3_HUMAN	E	63;52	.	ENSP00000359070:D63E	D	-	3	2	STMN3	61745655	1.000000	0.71417	0.997000	0.53966	0.012000	0.07955	2.367000	0.44213	1.148000	0.42385	0.491000	0.48974	GAC			0.612	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080163.1		NM_015894	
AC008132.13	0	broad.mit.edu	37	22	18842332	18842332	+	Intron	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr22:18842332C>T	ENST00000412938.1	+	4	2208																											CTTTAGACATCGGTGGAGAAC	0.587																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			AGACATCGGTGGA																												ENST00000412938.1:c.2209-971C>T	22.37:g.18842332C>T			111	0	0		133	0.09	12	.	0		0		RNA	SNP	ENST00000412938.1	37																																																																																						0.587	AC008132.13-002	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000471615.1			
NIPSNAP1	8508	mdanderson.org	37	22	29957542	29957542	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr22:29957542G>T	ENST00000216121.7	-	6	786	c.532C>A	c.(532-534)Ccc>Acc	p.P178T		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	178					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						CCCATTCTGGGCTGTGGCTCA	0.587																																					p.P178T													.	.			1	Unknown(1)	lung(1)	c.C532A												90.0	91.0	91.0					22																	29957542		2203	4300	6503	SO:0001583	missense	8508	exon6			TTCTGGGCTGTGG	AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.532C>A	22.37:g.29957542G>T	ENSP00000216121:p.Pro178Thr		74	0	0		51	0.06	3	NM_003634	206	0.00	0	B2RAY3|O43800	Missense_Mutation	SNP	ENST00000216121.7	37	CCDS13860.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.465317|4.465317	0.84425|0.84425	.|.	.|.	ENSG00000184117|ENSG00000184117	ENST00000415100|ENST00000216121;ENST00000437094	.|T	.|0.61980	.|0.06	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Dimeric alpha-beta barrel (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79969|0.79969	0.4538|0.4538	M|M	0.86953|0.86953	2.85|2.85	0.80722|0.80722	D|D	1|1	.|D;D	.|0.59357	.|0.984;0.985	.|P;P	.|0.59288	.|0.855;0.811	T|T	0.83314|0.83314	-0.0021|-0.0021	5|10	.|0.59425	.|D	.|0.04	.|.	18.4748|18.4748	0.90788|0.90788	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|158;178	.|B4DQI7;Q9BPW8	.|.;NIPS1_HUMAN	D|T	194|178;43	.|ENSP00000216121:P178T	.|ENSP00000216121:P178T	A|P	-|-	2|1	0|0	NIPSNAP1|NIPSNAP1	28287542|28287542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.824000|0.824000	0.46624|0.46624	6.053000|6.053000	0.71089|0.71089	2.681000|2.681000	0.91329|0.91329	0.462000|0.462000	0.41574|0.41574	GCC|CCC			0.587	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322117.1			
SCAP	22937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47455365	47455365	+	Silent	SNP	A	A	G			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr3:47455365A>G	ENST00000265565.5	-	23	4231	c.3819T>C	c.(3817-3819)tcT>tcC	p.S1273S	SCAP_ENST00000545718.1_Silent_p.S880S|SCAP_ENST00000441517.2_Silent_p.S1017S	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	1273	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		TCTCCAGCACAGAGGGCACAT	0.622																																					p.S1273S	Pancreas(149;978 1908 29304 37806 46700)												.	.			0			c.T3819C												131.0	137.0	135.0					3																	47455365		2203	4300	6503	SO:0001819	synonymous_variant	22937	exon23			CAGCACAGAGGGC	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.3819T>C	3.37:g.47455365A>G			115	0	0		127	0.17	21	NM_012235	278	0.26	71	Q8N2E0|Q8WUA1	Silent	SNP	ENST00000265565.5	37	CCDS2755.2																																																																																					0.622	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246872.2		NM_012235	
BSN	8927	mdanderson.org	37	3	49700906	49700906	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr3:49700906C>T	ENST00000296452.4	+	7	11429	c.11315C>T	c.(11314-11316)gCa>gTa	p.A3772V		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3772					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCTGGGGCAGCATCACGCCAG	0.642																																					p.A3772V													.	.			0			c.C11315T												20.0	23.0	22.0					3																	49700906		2202	4297	6499	SO:0001583	missense	8927	exon7			GGGCAGCATCACG	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.11315C>T	3.37:g.49700906C>T	ENSP00000296452:p.Ala3772Val		36	0	0		38	0.08	3	NM_003458	36	0.00	0	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.498205	0.26861	.	.	ENSG00000164061	ENST00000296452	T	0.18657	2.2	5.02	4.13	0.48395	.	1.239200	0.05725	N	0.598590	T	0.20659	0.0497	N	0.22421	0.69	0.33724	D	0.617393	B	0.20052	0.041	B	0.21917	0.037	T	0.16041	-1.0416	10	0.46703	T	0.11	-0.4909	14.9701	0.71226	0.0:0.856:0.144:0.0	.	3772	Q9UPA5	BSN_HUMAN	V	3772	ENSP00000296452:A3772V	ENSP00000296452:A3772V	A	+	2	0	BSN	49675910	0.371000	0.25056	0.081000	0.20488	0.708000	0.40852	1.763000	0.38461	1.061000	0.40601	0.462000	0.41574	GCA			0.642	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000258164.1		NM_003458	
SEMA3G	56920	mdanderson.org	37	3	52475647	52475647	+	Silent	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr3:52475647G>T	ENST00000231721.2	-	6	609	c.610C>A	c.(610-612)Cga>Aga	p.R204R		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	204	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CCTCCACTTCGGAAGATCATG	0.642																																					p.R204R													SEMA3G,colon,carcinoma,0,1	SEMA3G	0	1	0			c.C610A												54.0	54.0	54.0					3																	52475647		2203	4300	6503	SO:0001819	synonymous_variant	56920	exon6			CACTTCGGAAGAT		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.610C>A	3.37:g.52475647G>T			60	0	0		52	0.06	3	NM_020163	8	0.00	0	Q7L9D9|Q9H7Q3	Silent	SNP	ENST00000231721.2	37	CCDS2856.1																																																																																					0.642	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351354.1		NM_020163	
MUC4	4585	broad.mit.edu	37	3	195507694	195507694	+	Missense_Mutation	SNP	A	A	G	rs369368122	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr3:195507694A>G	ENST00000463781.3	-	2	11216	c.10757T>C	c.(10756-10758)cTt>cCt	p.L3586P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3586P	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTCGGTGACAAGAAGAGGGGT	0.592													.|||	2221	0.44349	0.466	0.3617	5008	,	,		10635	0.6131		0.3926	False		,,,				2504	0.3487				p.L3586P													.	MUC4	1505		0			c.T10757C												4.0	4.0	4.0					3																	195507694		499	1321	1820	SO:0001583	missense	4585	exon2			GTGACAAGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10757T>C	3.37:g.195507694A>G	ENSP00000417498:p.Leu3586Pro		75	0.0133333333	1		70	0.16	11	NM_018406	2	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	2.393	-0.339389	0.05243	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.42;1.33	.	.	.	.	.	.	.	.	T	0.17280	0.0415	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22941	-1.0202	6	.	.	.	.	.	.	.	.	3458	E7ESK3	.	P	3586	ENSP00000417498:L3586P;ENSP00000420243:L3586P	.	L	-	2	0	MUC4	196992473	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-0.026000	0.12392	-0.942000	0.03695	0.000000	0.15137	CTT			0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599340	55599340	+	Missense_Mutation	SNP	T	T	G	rs121913514		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr4:55599340T>G	ENST00000288135.5	+	17	2563	c.2466T>G	c.(2464-2466)aaT>aaG	p.N822K		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> K (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N822K(34)|p.N822N(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATGATTCTAATTATGTGGTTA	0.383	N822K(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.N822K			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,+2,48	KIT	2	48	35	Substitution - Missense(34)|Substitution - coding silent(1)	soft_tissue(17)|haematopoietic_and_lymphoid_tissue(11)|skin(4)|testis(2)|genital_tract(1)	c.T2466G												149.0	151.0	151.0					4																	55599340		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TTCTAATTATGTG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2466T>G	4.37:g.55599340T>G	ENSP00000288135:p.Asn822Lys		68	0	0		89	0.40	36	NM_000222	541	0.76	410	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	18.32	3.597891	0.66332	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82344	-1.6;-1.6	5.47	3.01	0.34805	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.84284	0.5438	L	0.33293	1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.987;1.0	D	0.83792	0.0231	10	0.87932	D	0	.	8.7243	0.34460	0.0:0.2153:0.0:0.7847	.	818;822	P10721-2;P10721	.;KIT_HUMAN	K	822;818	ENSP00000288135:N822K;ENSP00000390987:N818K	ENSP00000288135:N822K	N	+	3	2	KIT	55294097	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.920000	0.40025	0.883000	0.36040	0.477000	0.44152	AAT			0.383	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
ART3	419	mdanderson.org	37	4	77003112	77003112	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr4:77003112G>T	ENST00000355810.4	+	3	324	c.205G>T	c.(205-207)Gtg>Ttg	p.V69L	ART3_ENST00000341029.5_Missense_Mutation_p.V69L|ART3_ENST00000349321.3_Missense_Mutation_p.V69L|ART3_ENST00000513494.1_3'UTR	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	69					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ATTAGATACTGTGTGGGAAAA	0.403																																					p.V69L													.	.			0			c.G205T												87.0	89.0	88.0					4																	77003112		2203	4300	6503	SO:0001583	missense	419	exon3			GATACTGTGTGGG	X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.205G>T	4.37:g.77003112G>T	ENSP00000348064:p.Val69Leu		56	0	0		52	0.06	3	NM_001130016	0		0	Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Missense_Mutation	SNP	ENST00000355810.4	37	CCDS47079.1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.773791	0.69992	.	.	ENSG00000156219	ENST00000513353;ENST00000341029;ENST00000513122;ENST00000504914;ENST00000355810;ENST00000349321;ENST00000510423	T;T;T;T;T;T;T	0.08102	3.13;3.13;3.13;3.13;3.13;3.13;3.13	6.04	6.04	0.98038	.	0.244896	0.36519	N	0.002541	T	0.27594	0.0678	M	0.68593	2.085	0.34325	D	0.687034	D;D;D;D;D;D;B	0.69078	0.994;0.962;0.981;0.97;0.997;0.996;0.34	P;P;P;P;D;P;B	0.65573	0.859;0.677;0.869;0.686;0.936;0.894;0.343	T	0.04495	-1.0947	10	0.49607	T	0.09	-16.0553	18.0887	0.89466	0.0:0.0:1.0:0.0	.	39;69;69;69;69;69;69	D6RBN3;E7ESB3;B4DHX3;E7ER42;Q13508;Q13508-3;Q13508-2	.;.;.;.;NAR3_HUMAN;.;.	L	69	ENSP00000421345:V69L;ENSP00000343843:V69L;ENSP00000422287:V69L;ENSP00000421431:V69L;ENSP00000348064:V69L;ENSP00000304313:V69L;ENSP00000425327:V69L	ENSP00000343843:V69L	V	+	1	0	ART3	77222136	1.000000	0.71417	0.968000	0.41197	0.387000	0.30353	4.272000	0.58908	2.873000	0.98535	0.563000	0.77884	GTG			0.403	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252416.2		NM_001179	
NR3C2	4306	mdanderson.org	37	4	149357077	149357077	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr4:149357077G>T	ENST00000358102.3	-	2	1298	c.936C>A	c.(934-936)agC>agA	p.S312R	NR3C2_ENST00000512865.1_Missense_Mutation_p.S312R|NR3C2_ENST00000511528.1_Missense_Mutation_p.S312R|NR3C2_ENST00000355292.3_Missense_Mutation_p.S312R|NR3C2_ENST00000344721.4_Missense_Mutation_p.S312R	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	312	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TGTTCGAAGGGCTGGAAACAG	0.473																																					p.S312R	Melanoma(27;428 957 40335 51025 51111)												.	.			0			c.C936A												86.0	89.0	88.0					4																	149357077		2203	4300	6503	SO:0001583	missense	4306	exon2			CGAAGGGCTGGAA	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.936C>A	4.37:g.149357077G>T	ENSP00000350815:p.Ser312Arg		109	0	0		71	0.07	5	NM_001166104	0		0	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503442	0.26949	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.47;-2.45;-2.88	5.13	5.13	0.70059	.	0.362839	0.33199	N	0.005179	D	0.87928	0.6301	L	0.27053	0.805	0.40221	D	0.977739	D;P	0.56035	0.974;0.94	P;B	0.47299	0.543;0.306	D	0.86883	0.2043	9	.	.	.	.	12.3353	0.55062	0.078:0.0:0.922:0.0	.	312;312	B0ZBF5;B0ZBF6	.;.	R	312	ENSP00000341390:S312R;ENSP00000347441:S312R;ENSP00000350815:S312R;ENSP00000423510:S312R;ENSP00000343907:S312R;ENSP00000421481:S312R	.	S	-	3	2	NR3C2	149576527	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.778000	0.55371	2.543000	0.85770	0.655000	0.94253	AGC			0.473	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364986.1			
C5orf51	285636	mdanderson.org	37	5	41917162	41917162	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr5:41917162G>T	ENST00000381647.2	+	6	665	c.646G>T	c.(646-648)Gaa>Taa	p.E216*		NM_175921.4	NP_787117.3	A6NDU8	CE051_HUMAN	chromosome 5 open reading frame 51	216										endometrium(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GTACAGTGGAGAAATGTGTTA	0.403																																					p.E216X													C5orf51,colon,carcinoma,0,1	C5orf51	0	1	0			c.G646T												125.0	121.0	123.0					5																	41917162		2203	4300	6503	SO:0001587	stop_gained	285636	exon6			AGTGGAGAAATGT	AL833916, AK094002	CCDS34151.1	5p13.1	2008-07-18			ENSG00000205765	ENSG00000205765			27750	protein-coding gene	gene with protein product						14702039	Standard	NM_175921		Approved	LOC285636	uc003jmo.3	A6NDU8	OTTHUMG00000162084	ENST00000381647.2:c.646G>T	5.37:g.41917162G>T	ENSP00000371061:p.Glu216*		63	0	0		50	0.06	3	NM_175921	18	0.00	0	A2RRM9	Nonsense_Mutation	SNP	ENST00000381647.2	37	CCDS34151.1	.	.	.	.	.	.	.	.	.	.	G	34	5.353089	0.95830	.	.	ENSG00000205765	ENST00000381647	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-27.6678	17.946	0.89038	0.0:0.0:1.0:0.0	.	.	.	.	X	216	.	ENSP00000371061:E216X	E	+	1	0	C5orf51	41952919	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.846000	0.92159	2.659000	0.90383	0.655000	0.94253	GAA			0.403	C5orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367144.1		NM_175921	
DND1	373863	mdanderson.org	37	5	140052386	140052386	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr5:140052386C>T	ENST00000542735.1	-	3	291	c.248G>A	c.(247-249)cGc>cAc	p.R83H		NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	83	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGTAGAGGCGGCCCACGCG	0.692																																					p.R83H													.	.			0			c.G248A												11.0	17.0	15.0					5																	140052386		2165	4273	6438	SO:0001583	missense	373863	exon3			TAGAGGCGGCCCA	AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.248G>A	5.37:g.140052386C>T	ENSP00000445366:p.Arg83His		17	0	0		15	0.13	2	NM_194249	135	0.00	0		Missense_Mutation	SNP	ENST00000542735.1	37	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	C	10.41	1.341232	0.24339	.	.	ENSG00000256453	ENST00000542735	T	0.16457	2.34	5.45	5.45	0.79879	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.187052	0.37304	N	0.002144	T	0.30166	0.0756	L	0.55103	1.725	0.18873	N	0.999982	D	0.76494	0.999	D	0.63877	0.919	T	0.17899	-1.0354	10	0.49607	T	0.09	-19.1629	7.5009	0.27518	0.0:0.7955:0.0:0.2045	.	83	Q8IYX4	DND1_HUMAN	H	83	ENSP00000445366:R83H	ENSP00000445366:R83H	R	-	2	0	DND1	140032570	0.578000	0.26717	1.000000	0.80357	0.077000	0.17291	1.523000	0.35932	2.555000	0.86185	0.467000	0.42956	CGC			0.692	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251669.2		NM_194249	
FOXC1	2296	mdanderson.org	37	6	1610746	1610746	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr6:1610746G>T	ENST00000380874.2	+	1	66	c.66G>T	c.(64-66)gaG>gaT	p.E22D		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	22					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		TCGGCGGCGAGCAGAGCTACT	0.776																																					p.E22D	Pancreas(133;719 1821 3197 26645 35015)												.	.			0			c.G66T												2.0	2.0	2.0					6																	1610746		1369	2681	4050	SO:0001583	missense	2296	exon1			CGGCGAGCAGAGC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.66G>T	6.37:g.1610746G>T	ENSP00000370256:p.Glu22Asp		56	0	0		42	0.07	3	NM_001453	0		0	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	37	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	g	10.78	1.446465	0.25987	.	.	ENSG00000054598	ENST00000541209;ENST00000380874	D	0.92595	-3.07	3.31	3.31	0.37934	.	0.325457	0.26549	U	0.023758	T	0.64605	0.2613	N	0.01202	-0.96	0.38812	D	0.955431	B	0.09022	0.002	B	0.08055	0.003	T	0.60637	-0.7224	10	0.15499	T	0.54	.	14.7586	0.69588	0.0:0.0:1.0:0.0	.	22	Q12948	FOXC1_HUMAN	D	22	ENSP00000370256:E22D	ENSP00000370256:E22D	E	+	3	2	FOXC1	1555745	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.028000	0.41088	1.838000	0.53458	0.450000	0.29827	GAG			0.776	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043450.1			
RUNX2	860	hgsc.bcm.edu	37	6	45390445	45390445	+	Silent	SNP	A	A	G	rs563987595	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr6:45390445A>G	ENST00000371438.1	+	2	532	c.174A>G	c.(172-174)caA>caG	p.Q58Q	RUNX2_ENST00000359524.5_Silent_p.Q44Q|RUNX2_ENST00000576263.1_Silent_p.Q58Q|RUNX2_ENST00000371436.6_Silent_p.Q58Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000352853.5_Silent_p.Q126Q|RUNX2_ENST00000371432.3_Silent_p.Q44Q|RUNX2_ENST00000541979.1_Silent_p.Q126Q|RUNX2_ENST00000465038.2_Silent_p.Q58Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	58	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	6	0.00119808	0.0015	0.0	5008	,	,		8050	0.002		0.0	False		,,,				2504	0.002				p.Q58Q													RUNX2_ENST00000352853,lower_third,carcinoma,0,2	RUNX2_ENST00000352853	0	2	0			c.A174G												16.0	24.0	21.0					6																	45390445		1589	3298	4887	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.174A>G	6.37:g.45390445A>G			51	0	0		49	0.06	3	NM_001024630	1	0.00	0	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																					0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040755.2		NM_004348	
LRRC1	55227	mdanderson.org	37	6	53660068	53660068	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr6:53660068T>C	ENST00000370888.1	+	1	291	c.14T>C	c.(13-15)aTc>aCc	p.I5T	LRRC1_ENST00000370882.1_Missense_Mutation_p.I5T|RP13-476E20.1_ENST00000429053.1_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	5						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TTCCACTGCATCCCCCTGTGG	0.716																																					p.I5T													.	.			0			c.T14C												31.0	28.0	29.0					6																	53660068		2203	4300	6503	SO:0001583	missense	55227	exon1			ACTGCATCCCCCT	AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.14T>C	6.37:g.53660068T>C	ENSP00000359925:p.Ile5Thr		45	0	0		47	0.06	3	NM_018214	5	0.00	0	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	ENST00000370888.1	37	CCDS4953.2	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735420	0.89482	.	.	ENSG00000137269	ENST00000370888;ENST00000370882	T;T	0.57907	3.63;0.37	4.66	4.66	0.58398	.	0.071395	0.52532	D	0.000067	T	0.63616	0.2526	M	0.75264	2.295	0.58432	D	0.999999	D	0.57899	0.981	D	0.69824	0.966	T	0.70022	-0.4986	10	0.87932	D	0	.	12.9155	0.58203	0.0:0.0:0.0:1.0	.	5	Q9BTT6	LRRC1_HUMAN	T	5	ENSP00000359925:I5T;ENSP00000359919:I5T	ENSP00000359919:I5T	I	+	2	0	LRRC1	53768027	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.939000	0.75911	1.714000	0.51371	0.460000	0.39030	ATC			0.716	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040970.2		NM_025168	
MRAP2	112609	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	84772667	84772667	+	Missense_Mutation	SNP	T	T	G			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr6:84772667T>G	ENST00000257776.4	+	3	318	c.183T>G	c.(181-183)ttT>ttG	p.F61L		NM_138409.2	NP_612418.2	Q96G30	MRAP2_HUMAN	melanocortin 2 receptor accessory protein 2	61					energy homeostasis (GO:0097009)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|identical protein binding (GO:0042802)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(4)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	19						TTTTTATGTTTTTTGTGCTGA	0.408																																					p.F61L													.	.			0			c.T183G												251.0	223.0	233.0					6																	84772667		2203	4300	6503	SO:0001583	missense	112609	exon3			TATGTTTTTTGTG	AK090775	CCDS5001.1	6q14.3	2009-10-06	2008-07-16	2008-07-16	ENSG00000135324	ENSG00000135324			21232	protein-coding gene	gene with protein product		615410	"""chromosome 6 open reading frame 117"""	C6orf117			Standard	NM_138409		Approved	bA51G5.2	uc003pkg.4	Q96G30	OTTHUMG00000015121	ENST00000257776.4:c.183T>G	6.37:g.84772667T>G	ENSP00000257776:p.Phe61Leu		121	0	0		146	0.15	22	NM_138409	17	0.41	7	A8K9M1|Q8IXM9|Q8N2D1	Missense_Mutation	SNP	ENST00000257776.4	37	CCDS5001.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.317097	0.81469	.	.	ENSG00000135324	ENST00000257776	D	0.91521	-2.86	5.81	3.46	0.39613	.	0.000000	0.85682	D	0.000000	D	0.91965	0.7455	M	0.73217	2.22	0.53688	D	0.999976	D	0.71674	0.998	D	0.80764	0.994	D	0.92071	0.5664	10	0.87932	D	0	-4.5026	8.5635	0.33525	0.0:0.2735:0.0:0.7265	.	61	Q96G30	MRAP2_HUMAN	L	61	ENSP00000257776:F61L	ENSP00000257776:F61L	F	+	3	2	MRAP2	84829386	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.253000	0.32886	1.031000	0.39867	0.533000	0.62120	TTT			0.408	MRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041367.1		NM_138409	
HSF2	3298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	122744744	122744744	+	Silent	SNP	T	T	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr6:122744744T>C	ENST00000368455.4	+	10	1281	c.1089T>C	c.(1087-1089)taT>taC	p.Y363Y	HSF2_ENST00000452194.1_Silent_p.Y363Y	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	363	Hydrophobic repeat HR-C.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		TGTTGGATTATCTTGACAGTA	0.358																																					p.Y363Y													.	.			0			c.T1089C												128.0	115.0	119.0					6																	122744744		2203	4300	6503	SO:0001819	synonymous_variant	3298	exon10			GGATTATCTTGAC	M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.1089T>C	6.37:g.122744744T>C			58	0	0		60	0.20	12	NM_004506	65	0.26	17	B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Silent	SNP	ENST00000368455.4	37	CCDS5124.1																																																																																					0.358	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043520.1		NM_004506	
SCAF8	22828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155154403	155154403	+	Silent	SNP	A	A	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr6:155154403A>T	ENST00000367178.3	+	20	4266	c.3690A>T	c.(3688-3690)gtA>gtT	p.V1230V	SCAF8_ENST00000367186.4_Silent_p.V1296V|SCAF8_ENST00000417268.1_Silent_p.V1230V|TIAM2_ENST00000461783.3_5'UTR	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	1230					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						CTATACCAGTACAGAATGATC	0.393																																					p.V1230V													.	.			0			c.A3690T												77.0	74.0	75.0					6																	155154403		2203	4300	6503	SO:0001819	synonymous_variant	22828	exon20			ACCAGTACAGAAT	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.3690A>T	6.37:g.155154403A>T			107	0	0		106	0.17	18	NM_014892	269	0.28	75	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	ENST00000367178.3	37	CCDS5247.1																																																																																					0.393	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042798.1		NM_014892	
TNRC18	84629	mdanderson.org	37	7	5391702	5391702	+	Missense_Mutation	SNP	C	C	T	rs3801048	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr7:5391702C>T	ENST00000430969.1	-	17	5566	c.5218G>A	c.(5218-5220)Gaa>Aaa	p.E1740K	TNRC18_ENST00000399537.4_Missense_Mutation_p.E1740K	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1740							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TTCAGGAATTCTTCGTCTTCC	0.507																																					p.E1740K													.	.			0			c.G5218A												39.0	36.0	37.0					7																	5391702		1568	3582	5150	SO:0001583	missense	84629	exon17			GGAATTCTTCGTC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5218G>A	7.37:g.5391702C>T	ENSP00000395538:p.Glu1740Lys		125	0	0		127	0.02	3	NM_001080495	215	0.00	0	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	c	15.65	2.896896	0.52121	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.47177	2.68;2.67;0.85	4.92	4.0	0.46444	.	0.946100	0.08634	N	0.916650	T	0.44705	0.1306	M	0.62723	1.935	0.46131	P	0.0011149999999999771	B;B	0.32245	0.02;0.361	B;B	0.22386	0.022;0.039	T	0.48603	-0.9021	9	0.15499	T	0.54	.	14.7976	0.69889	0.0:0.8547:0.1453:0.0	.	795;1740	A8MSW5;O15417	.;TNC18_HUMAN	K	1740;1740;795;230	ENSP00000382452:E1740K;ENSP00000395538:E1740K;ENSP00000395990:E230K	ENSP00000382452:E1740K	E	-	1	0	TNRC18	5358228	0.733000	0.28132	0.005000	0.12908	0.952000	0.60782	2.845000	0.48254	0.997000	0.38969	0.561000	0.74099	GAA			0.507	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding					
STK17A	9263	mdanderson.org	37	7	43635533	43635533	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr7:43635533G>T	ENST00000319357.5	+	2	419	c.240G>T	c.(238-240)aaG>aaT	p.K80N	STK17A_ENST00000462448.1_3'UTR	NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	80	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						AATGTATAAAGAAAGATTCTG	0.348																																					p.K80N													.	.			0			c.G240T												65.0	70.0	68.0					7																	43635533		2203	4300	6503	SO:0001583	missense	9263	exon2			TATAAAGAAAGAT	AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.240G>T	7.37:g.43635533G>T	ENSP00000319192:p.Lys80Asn		65	0	0		52	0.06	3	NM_004760	71	0.00	0	A4D1V6|Q8IVC8	Missense_Mutation	SNP	ENST00000319357.5	37	CCDS5470.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796867	0.50208	.	.	ENSG00000164543	ENST00000319357	T	0.65178	-0.14	5.03	2.18	0.27775	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.459701	0.17976	N	0.155714	T	0.33962	0.0881	N	0.04373	-0.215	0.29254	N	0.871778	P	0.40731	0.728	B	0.37267	0.245	T	0.30416	-0.9979	10	0.87932	D	0	.	5.4104	0.16344	0.2218:0.0:0.6378:0.1404	.	80	Q9UEE5	ST17A_HUMAN	N	80	ENSP00000319192:K80N	ENSP00000319192:K80N	K	+	3	2	STK17A	43602058	1.000000	0.71417	0.989000	0.46669	0.996000	0.88848	2.492000	0.45311	0.138000	0.18790	0.591000	0.81541	AAG			0.348	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250902.1		NM_004760	
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000424859.1_5'UTR|LHFPL3_ENST00000401970.2_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A													LHFPL3,NS,carcinoma,0,1	LHFPL3	0	1	1	Substitution - coding silent(1)	kidney(1)	c.C24T												11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	7.37:g.103969251C>T			46	0.0217391304	1		49	0.06	3	NM_199000	0		0	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	37																																																																																						0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding				NM_199000	
FOXP2	93986	mdanderson.org	37	7	114270000	114270000	+	Silent	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr7:114270000G>A	ENST00000393494.2	+	5	816	c.537G>A	c.(535-537)caG>caA	p.Q179Q	FOXP2_ENST00000360232.4_Silent_p.Q179Q|FOXP2_ENST00000393500.3_Silent_p.Q104Q|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000408937.3_Silent_p.Q204Q|FOXP2_ENST00000393491.3_Silent_p.Q87Q|FOXP2_ENST00000350908.4_Silent_p.Q179Q|FOXP2_ENST00000393498.2_Silent_p.Q159Q|FOXP2_ENST00000378237.3_Silent_p.Q179Q|FOXP2_ENST00000403559.4_Silent_p.Q196Q|FOXP2_ENST00000390668.3_Silent_p.Q203Q|FOXP2_ENST00000393489.3_Silent_p.Q87Q			O15409	FOXP2_HUMAN	forkhead box P2	179	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q204Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						agcaacaacagcagcagcagc	0.498																																					p.Q204Q													FOXP2,NS,carcinoma,0,6	FOXP2	0	6	1	Substitution - coding silent(1)	lung(1)	c.G612A												41.0	38.0	39.0					7																	114270000		2199	4282	6481	SO:0001819	synonymous_variant	93986	exon6			ACAACAGCAGCAG	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.537G>A	7.37:g.114270000G>A			24	0	0		31	0.10	3	NM_148898	2	0.00	0	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	ENST00000393494.2	37	CCDS5760.1																																																																																					0.498	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317366.1		NM_014491	
ATP6V1H	51606	broad.mit.edu	37	8	54742088	54742088	+	Silent	SNP	A	A	G			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr8:54742088A>G	ENST00000359530.2	-	4	485	c.222T>C	c.(220-222)gcT>gcC	p.A74A	ATP6V1H_ENST00000396774.2_Silent_p.A74A|ATP6V1H_ENST00000355221.3_Silent_p.A74A|ATP6V1H_ENST00000520188.1_Silent_p.A34A	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H	74					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			TAAATGTTTTAGCACACTAAA	0.294																																					p.A74A													.	ATP6V1H	66		0			c.T222C												77.0	77.0	77.0					8																	54742088		2203	4299	6502	SO:0001819	synonymous_variant	51606	exon4			TGTTTTAGCACAC	AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.222T>C	8.37:g.54742088A>G			18	0	0		38	0.11	4	NM_015941	91	0.00	0	B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Silent	SNP	ENST00000359530.2	37	CCDS6153.1																																																																																					0.294	ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377865.1		NM_015941	
FAM122A	116224	broad.mit.edu	37	9	71395159	71395159	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr9:71395159G>A	ENST00000394264.3	+	1	196	c.79G>A	c.(79-81)Ggc>Agc	p.G27S	PIP5K1B_ENST00000541509.1_Intron|PIP5K1B_ENST00000265382.3_Intron	NM_138333.3	NP_612206.3	Q96E09	F122A_HUMAN	family with sequence similarity 122A	27	Poly-Gly.									endometrium(1)|lung(2)	3						CGGTGGCAGCGGCGGCGGCGG	0.741																																					p.G27S													.	FAM122A	14		0			c.G79A												6.0	9.0	8.0					9																	71395159		1945	3936	5881	SO:0001583	missense	116224	exon1			GGCAGCGGCGGCG	AK126379	CCDS6623.1	9q21.13	2011-02-10	2006-07-11	2006-07-11	ENSG00000187866	ENSG00000187866			23490	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 42"""	C9orf42		12477932	Standard	NM_138333		Approved	MGC17347	uc004agw.1	Q96E09	OTTHUMG00000019971	ENST00000394264.3:c.79G>A	9.37:g.71395159G>A	ENSP00000377807:p.Gly27Ser		66	0.0151515152	1		81	0.04	3	NM_138333	42	0.00	0		Missense_Mutation	SNP	ENST00000394264.3	37	CCDS6623.1	.	.	.	.	.	.	.	.	.	.	G	0.903	-0.721572	0.03182	.	.	ENSG00000187866	ENST00000394264;ENST00000377279	T	0.52754	0.65	4.92	-0.807	0.10872	.	0.487974	0.15323	N	0.268444	T	0.16300	0.0392	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.21861	-1.0233	10	0.02654	T	1	-3.9947	1.6671	0.02804	0.1714:0.1345:0.4232:0.2709	.	27	Q96E09	F122A_HUMAN	S	27	ENSP00000377807:G27S	ENSP00000366492:G27S	G	+	1	0	FAM122A	70584979	.	.	0.017000	0.16124	0.196000	0.23810	.	.	-0.032000	0.13758	-0.253000	0.11424	GGC			0.741	FAM122A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052556.1		NM_138333	
ABCA1	19	mdanderson.org	37	9	107554227	107554227	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr9:107554227G>T	ENST00000374736.3	-	43	6204	c.5810C>A	c.(5809-5811)cCt>cAt	p.P1937H		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1937	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTCACCAGGAGGAATGCCCAC	0.428																																					p.P1937H													.	.			0			c.C5810A												105.0	84.0	91.0					9																	107554227		2203	4300	6503	SO:0001583	missense	19	exon43			CCAGGAGGAATGC	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5810C>A	9.37:g.107554227G>T	ENSP00000363868:p.Pro1937His		66	0	0		46	0.07	3	NM_005502	30	0.00	0	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866243	0.71949	.	.	ENSG00000165029	ENST00000374736	D	0.93763	-3.28	5.82	5.82	0.92795	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.90621	0.7059	L	0.42744	1.35	0.80722	D	1	B	0.31949	0.348	B	0.32762	0.152	D	0.89043	0.3450	10	0.48119	T	0.1	.	15.5631	0.76266	0.0:0.1372:0.8628:0.0	.	1937	O95477	ABCA1_HUMAN	H	1937	ENSP00000363868:P1937H	ENSP00000363868:P1937H	P	-	2	0	ABCA1	106594048	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.720000	0.61944	2.762000	0.94881	0.561000	0.74099	CCT			0.428	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053491.1		NM_005502	
AK1	203	mdanderson.org	37	9	130635029	130635029	+	Silent	SNP	T	T	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chr9:130635029T>C	ENST00000373176.1	-	4	299	c.147A>G	c.(145-147)tcA>tcG	p.S49S	RP11-203J24.9_ENST00000476274.2_RNA|AK1_ENST00000373156.1_Silent_p.S49S|AK1_ENST00000223836.10_Silent_p.S65S	NM_000476.2	NP_000467.1			adenylate kinase 1											endometrium(1)|prostate(1)	2						TGGCCGAGCCTGAGCTGACCT	0.637																																					p.S49S													.	.			0			c.A147G												72.0	65.0	67.0					9																	130635029		2203	4300	6503	SO:0001819	synonymous_variant	203	exon4			CGAGCCTGAGCTG	J04809	CCDS6881.1	9q34.1	2008-02-05			ENSG00000106992	ENSG00000106992	2.7.4.3	"""Adenylate kinases"""	361	protein-coding gene	gene with protein product		103000					Standard	NM_000476		Approved		uc004bsm.4	P00568	OTTHUMG00000020722	ENST00000373176.1:c.147A>G	9.37:g.130635029T>C			83	0	0		50	0.06	3	NM_000476	34	0.00	0		Silent	SNP	ENST00000373176.1	37	CCDS6881.1																																																																																					0.637	AK1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054307.1			
FAM104B	90736	mdanderson.org	37	X	55172630	55172630	+	Nonsense_Mutation	SNP	G	G	A	rs113263757		TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chrX:55172630G>A	ENST00000358460.4	-	3	388	c.235C>T	c.(235-237)Cag>Tag	p.Q79*	FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000489298.1_Nonsense_Mutation_p.Q78*|FAM104B_ENST00000425133.2_Nonsense_Mutation_p.Q80*|FAM104B_ENST00000332132.4_Nonsense_Mutation_p.Q80*|FAM104B_ENST00000477847.2_Nonsense_Mutation_p.Q76*|FAM104B_ENST00000478918.1_5'Flank			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	79										endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						TGCAAGAACTGGGGAAAGTTT	0.493																																					p.Q80X													.	.			0			c.C238T												127.0	104.0	112.0					X																	55172630		2203	4300	6503	SO:0001587	stop_gained	90736	exon3			AGAACTGGGGAAA	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.235C>T	X.37:g.55172630G>A	ENSP00000364101:p.Gln79*		27	0.037037037	1		38	0.13	5	NM_001166700	109	0.00	0	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Nonsense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	g	11.17	1.559418	0.27827	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	.	.	.	1.6	1.6	0.23607	.	0.325359	0.21941	U	0.066869	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-0.2487	6.0913	0.19995	0.0:0.0:1.0:0.0	.	.	.	.	X	79;80;80;76;78	.	ENSP00000333394:Q80X	Q	-	1	0	FAM104B	55189355	0.905000	0.30787	0.015000	0.15790	0.033000	0.12548	1.600000	0.36762	1.084000	0.41184	0.436000	0.28706	CAG			0.493	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
FAM104B	90736	mdanderson.org	37	X	55172645	55172645	+	Missense_Mutation	SNP	C	C	G	rs1047042	byFrequency	TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chrX:55172645C>G	ENST00000358460.4	-	3	373	c.220G>C	c.(220-222)Gat>Cat	p.D74H	FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000489298.1_Missense_Mutation_p.D73H|FAM104B_ENST00000425133.2_Missense_Mutation_p.D75H|FAM104B_ENST00000332132.4_Missense_Mutation_p.D75H|FAM104B_ENST00000477847.2_Missense_Mutation_p.D71H|FAM104B_ENST00000478918.1_5'Flank			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	74				D -> V (in Ref. 1; BAG61768). {ECO:0000305}.						endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						AAGTTTGCATCGGGTTCAGTA	0.468													C|||	5	0.0013245	0.0023	0.0	3775	,	,		14416	0.0		0.0	False		,,,				2504	0.002				p.D75H													.	.			0			c.G223C												136.0	110.0	119.0					X																	55172645		2203	4300	6503	SO:0001583	missense	90736	exon3			TTGCATCGGGTTC	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.220G>C	X.37:g.55172645C>G	ENSP00000364101:p.Asp74His		29	0.0344827586	1		38	0.08	3	NM_001166700	114	0.00	0	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	c	3.193	-0.165363	0.06461	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	1.59	-1.04	0.10068	.	0.505297	0.17523	U	0.171170	T	0.25044	0.0608	N	0.14661	0.345	0.09310	N	1	B;P;P	0.46859	0.002;0.774;0.885	B;P;B	0.46479	0.001;0.518;0.241	T	0.15065	-1.0450	10	0.56958	D	0.05	-1.547	4.2247	0.10575	0.0:0.4679:0.0:0.5321	.	75;74;75	Q5XKR9-3;Q5XKR9;Q5XKR9-2	.;F104B_HUMAN;.	H	74;75;75;71;73	ENSP00000364101:D74H;ENSP00000333394:D75H;ENSP00000397188:D75H;ENSP00000421161:D71H;ENSP00000423164:D73H	ENSP00000333394:D75H	D	-	1	0	FAM104B	55189370	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.019000	0.12546	-0.355000	0.08199	-0.556000	0.04195	GAT			0.468	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
TCP11X3P	106481605	bcgsc.ca;mdanderson.org	37	X	101437560	101437560	+	RNA	SNP	G	G	C			TCGA-2X-A9D5-01A-11D-A435-10	TCGA-2X-A9D5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	c2d2797f-df6f-4d7d-b19d-5abe92fc9533	e62d817f-988d-403f-919c-116b44eeffc7	g.chrX:101437560G>C	ENST00000508552.1	+	0	177									t-complex 11 family, X-linked 3, pseudogene																		CTCTGGTGAAGTTTTATTCAG	0.458																																					.													.	.			0			.																																											0	.			GGTGAAGTTTTAT			Xq22.1	2013-05-14			ENSG00000251525	ENSG00000251525			48370	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000022051		X.37:g.101437560G>C			504	0	0		584	0.26	152	.	0		0		RNA	SNP	ENST00000508552.1	37		.	.	.	.	.	.	.	.	.	.	g	3.618	-0.078226	0.07184	.	.	ENSG00000250489	ENST00000508552	.	.	.	0.931	0.931	0.19460	.	.	.	.	.	T	0.40546	0.1121	.	.	.	.	.	.	.	.	.	.	.	.	T	0.49244	-0.8960	3	.	.	.	.	7.5184	0.27614	1.0E-4:0.0:0.9999:0.0	.	.	.	.	N	59	.	.	K	+	3	2	RP1-158I15.2	101324216	0.007000	0.16637	0.706000	0.30403	0.065000	0.16274	1.478000	0.35442	0.762000	0.33152	0.081000	0.15443	AAG			0.458	TCP11X3P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000332190.1			
