#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	broad.mit.edu	37	1	34554769	34554769	+	Silent	SNP	G	G	A	rs373612518		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:34554769G>A	ENST00000373381.4	-	2	389	c.213C>T	c.(211-213)caC>caT	p.H71H		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	31	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATTGGGACCGTGCAGTTGGA	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		21441	0.0		0.0	False		,,,				2504	0.001				p.H31H													.	CSMD2	946		0			c.C93T							G		0,4406		0,0,2203	77.0	68.0	71.0		93	-4.1	0.9	1		71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CSMD2	NM_052896.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		31/3488	34554769	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	114784	exon2			GGGACCGTGCAGT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.213C>T	1.37:g.34554769G>A			151	0.0066225166	1		141	0.03	4	NM_052896	11	0.00	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																						0.527	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_052896	
SLC2A1	6513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43395380	43395380	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:43395380T>C	ENST00000426263.3	-	6	929	c.751A>G	c.(751-753)Atg>Gtg	p.M251V	SLC2A1_ENST00000415851.2_Intron|SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	251					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	TCCCGCATCATCTGCCGACTC	0.627																																					p.M251V													.	.			0			c.A751G												141.0	133.0	136.0					1																	43395380		2203	4300	6503	SO:0001583	missense	6513	exon6			GCATCATCTGCCG	K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.751A>G	1.37:g.43395380T>C	ENSP00000416293:p.Met251Val		57	0	0		40	0.23	9	NM_006516	97	0.27	26	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Missense_Mutation	SNP	ENST00000426263.3	37	CCDS477.1	.	.	.	.	.	.	.	.	.	.	T	15.94	2.980421	0.53827	.	.	ENSG00000117394	ENST00000426263;ENST00000372501;ENST00000397019;ENST00000439722	T;T	0.73897	-0.79;-0.79	5.14	5.14	0.70334	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.70343	0.3213	M	0.62209	1.925	0.80722	D	1	B	0.24092	0.097	B	0.18263	0.021	T	0.68074	-0.5505	10	0.39692	T	0.17	.	12.9241	0.58249	0.0:0.0:0.0:1.0	.	251	P11166	GTR1_HUMAN	V	251;251;193;156	ENSP00000416293:M251V;ENSP00000395521:M156V	ENSP00000361579:M251V	M	-	1	0	SLC2A1	43167967	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	6.186000	0.72026	1.939000	0.56221	0.454000	0.30748	ATG			0.627	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000020358.2		NM_006516	
DPH2	1802	mdanderson.org	37	1	44437573	44437573	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:44437573G>T	ENST00000255108.3	+	4	1171	c.999G>T	c.(997-999)gtG>gtT	p.V333V	DPH2_ENST00000412950.2_Silent_p.V198V|DPH2_ENST00000396758.2_Intron|ATP6V0B_ENST00000472174.2_5'Flank	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	333					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				TCCCTGAGGTGGATGTCTTTG	0.592																																					p.V333V													.	.			0			c.G999T												111.0	105.0	107.0					1																	44437573		2203	4300	6503	SO:0001819	synonymous_variant	1802	exon4			TGAGGTGGATGTC	AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.999G>T	1.37:g.44437573G>T			80	0	0		45	0.07	3	NM_001384	135	0.00	0	A8MVC9|B2RDE3|B4DNI8|O60623	Silent	SNP	ENST00000255108.3	37	CCDS504.1																																																																																					0.592	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022832.1		NM_001384	
GLIS1	148979	mdanderson.org	37	1	53972366	53972366	+	Missense_Mutation	SNP	C	C	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:53972366C>A	ENST00000312233.2	-	10	2355	c.1789G>T	c.(1789-1791)Gac>Tac	p.D597Y		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						AAGCCACAGTCCTCGGGGCCG	0.622																																					p.D597Y													.	.			0			c.G1789T												74.0	70.0	71.0					1																	53972366		2203	4300	6503	SO:0001583	missense	148979	exon10			CACAGTCCTCGGG	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1789G>T	1.37:g.53972366C>A	ENSP00000309653:p.Asp597Tyr		56	0	0		40	0.08	3	NM_147193	1	0.00	0		Missense_Mutation	SNP	ENST00000312233.2	37	CCDS582.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581004	0.65992	.	.	ENSG00000174332	ENST00000312233	T	0.16196	2.36	4.3	4.3	0.51218	.	0.105638	0.41396	D	0.000881	T	0.27489	0.0675	L	0.29908	0.895	0.38736	D	0.953787	D	0.76494	0.999	D	0.68192	0.956	T	0.05903	-1.0857	10	0.87932	D	0	.	12.4509	0.55677	0.0:1.0:0.0:0.0	.	597	Q8NBF1	GLIS1_HUMAN	Y	597	ENSP00000309653:D597Y	ENSP00000309653:D597Y	D	-	1	0	GLIS1	53744954	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.712000	0.61888	2.408000	0.81797	0.484000	0.47621	GAC			0.622	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022109.1		NM_147193	
CLCC1	23155	broad.mit.edu	37	1	109492518	109492518	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:109492518T>C	ENST00000369971.2	-	3	284	c.155A>G	c.(154-156)aAg>aGg	p.K52R	CLCC1_ENST00000369968.2_Missense_Mutation_p.K52R|CLCC1_ENST00000302500.4_Missense_Mutation_p.K52R|CLCC1_ENST00000356970.2_Missense_Mutation_p.K52R|CLCC1_ENST00000369976.1_Missense_Mutation_p.K52R|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000369969.2_Missense_Mutation_p.K52R|CLCC1_ENST00000348264.2_Missense_Mutation_p.K52R|CLCC1_ENST00000369970.3_Missense_Mutation_p.K52R|CLCC1_ENST00000415331.1_Missense_Mutation_p.K52R	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	52						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		ACTGACATCCTTTTCCCCTGA	0.279																																					p.K52R													.	CLCC1	55		0			c.A155G												58.0	59.0	59.0					1																	109492518		2203	4290	6493	SO:0001583	missense	23155	exon3			ACATCCTTTTCCC	AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.155A>G	1.37:g.109492518T>C	ENSP00000358988:p.Lys52Arg		600	0	0		501	0.01	4	NM_001048210	48	0.00	0	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	ENST00000369971.2	37	CCDS41362.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.272517	0.80580	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369968;ENST00000369976;ENST00000369970;ENST00000348264;ENST00000302500	T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.41	5.41	0.78517	.	0.597033	0.18496	N	0.139493	T	0.42494	0.1205	M	0.62723	1.935	0.19775	N	0.999957	P;P;P;P	0.50819	0.827;0.827;0.804;0.939	P;B;P;P	0.51324	0.526;0.439;0.467;0.666	T	0.38564	-0.9655	10	0.51188	T	0.08	-5.3424	12.107	0.53818	0.0:0.0:0.0:1.0	.	52;52;52;52	Q96S66-4;Q96S66-3;Q96S66-2;Q96S66	.;.;.;CLCC1_HUMAN	R	52	ENSP00000349456:K52R;ENSP00000358988:K52R;ENSP00000411591:K52R;ENSP00000358986:K52R;ENSP00000358985:K52R;ENSP00000358993:K52R;ENSP00000358987:K52R;ENSP00000337243:K52R;ENSP00000306552:K52R	ENSP00000306552:K52R	K	-	2	0	CLCC1	109294041	0.008000	0.16893	0.271000	0.24616	0.493000	0.33554	1.671000	0.37513	2.166000	0.68216	0.460000	0.39030	AAG			0.279	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032405.1		NM_015127	
MTX1	4580	broad.mit.edu	37	1	155185875	155185876	+	IGR	INS	-	-	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:155185875_155185876insT	ENST00000368376.3	+	0	1632				GBAP1_ENST00000486869.1_RNA|RP11-263K19.6_ENST00000455788.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			taacttttctattttttttttt	0.48																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTTTCTATTTTTT		CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708		1.37:g.155185886_155185886dupT			11	0	0		7	0.43	3	.	0		0	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	INS	ENST00000368376.3	37	CCDS1100.1																																																																																					0.480	MTX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000086844.1		NM_198883	
METTL13	51603	broad.mit.edu	37	1	171759727	171759727	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:171759727C>T	ENST00000361735.3	+	5	1711	c.1445C>T	c.(1444-1446)gCc>gTc	p.A482V	METTL13_ENST00000362019.3_Missense_Mutation_p.A396V|METTL13_ENST00000367737.5_Missense_Mutation_p.A326V|METTL13_ENST00000458517.1_Missense_Mutation_p.A481V|METTL13_ENST00000466643.1_Intron	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	482							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GCTGGCCTTGCCCTGCTGAGA	0.537																																					p.A482V													.	METTL13	67		0			c.C1445T												84.0	85.0	85.0					1																	171759727		2203	4300	6503	SO:0001583	missense	51603	exon5			GCCTTGCCCTGCT	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1445C>T	1.37:g.171759727C>T	ENSP00000354920:p.Ala482Val		289	0	0		254	0.02	4	NM_015935	65	0.00	0	A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	ENST00000361735.3	37	CCDS1299.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059677	0.76074	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.91	5.91	0.95273	.	0.154841	0.56097	D	0.000026	T	0.77877	0.4196	L	0.49571	1.57	0.34320	D	0.686426	P;D;D	0.61697	0.956;0.99;0.986	P;P;P	0.59056	0.575;0.851;0.642	T	0.76971	-0.2761	10	0.34782	T	0.22	-34.0109	15.7586	0.78058	0.0:0.8253:0.1747:0.0	.	481;326;482	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	V	481;396;326;482	ENSP00000401955:A481V;ENSP00000355393:A396V;ENSP00000356711:A326V;ENSP00000354920:A482V	ENSP00000354920:A482V	A	+	2	0	METTL13	170026350	0.058000	0.20735	0.998000	0.56505	0.907000	0.53573	2.618000	0.46393	2.793000	0.96121	0.655000	0.94253	GCC			0.537	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084528.5		NM_014955	
IRF2BP2	359948	mdanderson.org	37	1	234745106	234745106	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:234745106G>T	ENST00000366609.3	-	1	165	c.135C>A	c.(133-135)ggC>ggA	p.G45G	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'Flank|IRF2BP2_ENST00000366610.3_Silent_p.G45G	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	45					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CGCGGTCGGCGCCCTCGTAGT	0.721																																					p.G45G													.	.			0			c.C135A												8.0	8.0	8.0					1																	234745106		2132	4207	6339	SO:0001819	synonymous_variant	359948	exon1			GTCGGCGCCCTCG	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.135C>A	1.37:g.234745106G>T			51	0	0		43	0.07	3	NM_182972	17	0.00	0	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																					0.721	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000092705.1		NM_182972	
NLRP3	114548	mdanderson.org	37	1	247599286	247599286	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr1:247599286G>T	ENST00000336119.3	+	6	3259	c.2513G>T	c.(2512-2514)tGc>tTc	p.C838F	NLRP3_ENST00000366497.2_Intron|NLRP3_ENST00000391828.3_Missense_Mutation_p.C838F|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000391827.2_Missense_Mutation_p.C781F|NLRP3_ENST00000366496.2_Intron	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	838					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GTCAGCTGCTGCCTCACATCA	0.542																																					p.C838F													.	.			0			c.G2513T												130.0	102.0	111.0					1																	247599286		2203	4300	6503	SO:0001583	missense	114548	exon6			GCTGCTGCCTCAC	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2513G>T	1.37:g.247599286G>T	ENSP00000337383:p.Cys838Phe		63	0.0158730159	1		46	0.07	3	NM_004895	7	0.00	0	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.900188	0.00517	.	.	ENSG00000162711	ENST00000391828;ENST00000336119;ENST00000391827	T;T;T	0.37411	1.2;1.2;1.2	3.78	1.82	0.25136	.	0.200198	0.25205	N	0.032353	T	0.25082	0.0609	M	0.64404	1.975	0.09310	N	1	B;B;P	0.51653	0.07;0.03;0.947	B;B;B	0.38378	0.0;0.034;0.272	T	0.22977	-1.0201	10	0.09843	T	0.71	.	6.5057	0.22194	0.0:0.2029:0.5873:0.2098	.	818;781;838	B7ZKS9;Q96P20-4;Q96P20	.;.;NALP3_HUMAN	F	838;838;781	ENSP00000375704:C838F;ENSP00000337383:C838F;ENSP00000375703:C781F	ENSP00000337383:C838F	C	+	2	0	NLRP3	245665909	0.000000	0.05858	0.681000	0.30009	0.115000	0.19883	-0.009000	0.12765	0.545000	0.28902	0.536000	0.68110	TGC			0.542	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097740.1		NM_004895	
RRP12	23223	mdanderson.org	37	10	99133626	99133626	+	Silent	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr10:99133626G>A	ENST00000370992.4	-	16	1935	c.1824C>T	c.(1822-1824)agC>agT	p.S608S	RRP12_ENST00000315563.6_Silent_p.S508S|RRP12_ENST00000479481.1_5'Flank|RRP12_ENST00000414986.1_Silent_p.S547S|RRP12_ENST00000536831.1_Silent_p.S326S	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	608						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		ATTCCACTGTGCTGCCTGCCT	0.592																																					p.S608S													.	.			0			c.C1824T												130.0	80.0	97.0					10																	99133626		2203	4300	6503	SO:0001819	synonymous_variant	23223	exon16			CACTGTGCTGCCT		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.1824C>T	10.37:g.99133626G>A			51	0	0		38	0.08	3	NM_015179	232	0.00	0	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	37	CCDS7457.1																																																																																					0.592	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049699.4		NM_015179	
OR51M1	390059	mdanderson.org	37	11	5411095	5411095	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:5411095C>T	ENST00000328611.3	+	1	489	c.467C>T	c.(466-468)gCa>gTa	p.A156V	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	156					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGGTCAGAGCAGGCCTAATT	0.547																																					p.A156V													.	.			0			c.C467T												214.0	206.0	209.0					11																	5411095		2036	4215	6251	SO:0001583	missense	390059	exon1			TCAGAGCAGGCCT	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.467C>T	11.37:g.5411095C>T	ENSP00000333196:p.Ala156Val		55	0	0		36	0.08	3	NM_001004756	0		0	Q6IF80	Missense_Mutation	SNP	ENST00000328611.3	37	CCDS53596.1	.	.	.	.	.	.	.	.	.	.	C	6.876	0.531039	0.13127	.	.	ENSG00000184698	ENST00000328611	T	0.35421	1.31	5.26	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	0.797298	0.10192	N	0.704456	T	0.18467	0.0443	N	0.11845	0.185	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.20107	-1.0285	10	0.41790	T	0.15	.	3.1778	0.06575	0.2044:0.482:0.0:0.3136	.	145	Q9H341	O51M1_HUMAN	V	156	ENSP00000333196:A156V	ENSP00000333196:A156V	A	+	2	0	OR51M1	5367671	0.000000	0.05858	0.013000	0.15412	0.172000	0.22775	-0.239000	0.08965	0.677000	0.31305	0.655000	0.94253	GCA			0.547	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142981.1		NM_001004756	
OR52D1	390066	hgsc.bcm.edu;broad.mit.edu	37	11	5510157	5510158	+	In_Frame_Ins	INS	-	-	GGC			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:5510157_5510158insGGC	ENST00000322641.5	+	1	243_244	c.221_222insGGC	c.(220-225)ctggct>ctGGCggct	p.75_76insA	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	75					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCACAGACCTGGCTCTCAGTT	0.525																																					p.L74delinsLA													.	OR52D1	66		0			c.221_222insGGC																																									SO:0001652	inframe_insertion	390066	exon1			CAGACCTGGCTCT	BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.222_224dupGGC	11.37:g.5510158_5510160dupGGC	ENSP00000326232:p.Ala75_Ala75dup		198	0	0		155	0.09	14	NM_001005163	0		0	B9EGY9|Q6IFI6	In_Frame_Ins	INS	ENST00000322641.5	37	CCDS31384.1																																																																																					0.525	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143372.1		NM_001005163	
USH1C	10083	mdanderson.org	37	11	17531263	17531263	+	Intron	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:17531263G>T	ENST00000318024.4	-	15	1393				USH1C_ENST00000005226.7_Missense_Mutation_p.F551L|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000527020.1_Intron|USH1C_ENST00000529563.1_Intron	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GGGGATAGTAGAACATGTCCA	0.637																																					p.F551L													.	.			0			c.C1653A												27.0	29.0	28.0					11																	17531263		2200	4293	6493	SO:0001627	intron_variant	10083	exon18			ATAGTAGAACATG	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1284+7684C>A	11.37:g.17531263G>T			8	0	0		10	0.20	2	NM_153676	7	0.00	0	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968388	0.53614	.	.	ENSG00000006611	ENST00000005226	T	0.37584	1.19	5.57	4.66	0.58398	.	0.442738	0.22663	N	0.057167	T	0.26846	0.0657	.	.	.	0.28744	N	0.901785	B	0.02656	0.0	B	0.04013	0.001	T	0.15093	-1.0449	9	0.48119	T	0.1	.	8.9346	0.35691	0.1705:0.0:0.8295:0.0	.	551	Q7RTU8	.	L	551	ENSP00000005226:F551L	ENSP00000005226:F551L	F	-	3	2	USH1C	17487839	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.661000	0.37408	1.358000	0.45922	0.591000	0.81541	TTC			0.637	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000389146.1		NM_005709	
BDNF	627	mdanderson.org	37	11	27681195	27681195	+	5'UTR	SNP	T	T	C	rs376982344|rs200712840|rs5790661|rs202011320	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:27681195T>C	ENST00000525528.1	-	0	10				BDNF_ENST00000395978.3_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000584049.1_Intron|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000438929.1_Intron|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000533131.1_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000395980.2_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000530861.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgtgtgtgcgcgcgcgc	0.438													T|||	31	0.0061901	0.0159	0.0029	5008	,	,		15764	0.0		0.006	False		,,,				2504	0.002				.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	627	.			TGTGTGTGCGCGC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1084A>G	11.37:g.27681195T>C			139	0.0071942446	1		109	0.07	8	.	0		0	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																					0.438	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388135.1		NM_170735	
TUT1	64852	broad.mit.edu	37	11	62346492	62346492	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:62346492T>C	ENST00000476907.1	-	5	1392	c.701A>G	c.(700-702)aAg>aGg	p.K234R	MIR3654_ENST00000496634.2_Missense_Mutation_p.K234R|TUT1_ENST00000308436.7_Missense_Mutation_p.K272R			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	234	Pro-rich.				mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TTCTGGAGCCTTTGGGACTGG	0.532																																					p.K272R													.	TUT1	122		0			c.A815G												25.0	29.0	28.0					11																	62346492		2202	4299	6501	SO:0001583	missense	0	exon5			GGAGCCTTTGGGA	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.701A>G	11.37:g.62346492T>C	ENSP00000419607:p.Lys234Arg		94	0	0		84	0.04	3	NM_022830	100	0.00	0	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	ENST00000476907.1	37		.	.	.	.	.	.	.	.	.	.	T	15.12	2.740450	0.49045	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000278279	T;T	0.38560	1.13;1.13	5.54	5.54	0.83059	.	0.152448	0.42172	D	0.000747	T	0.55721	0.1938	L	0.53249	1.67	0.27678	N	0.94655	D	0.71674	0.998	D	0.80764	0.994	T	0.50725	-0.8794	10	0.21014	T	0.42	-0.6532	12.0785	0.53657	0.0:0.0:0.0:1.0	.	272	F5H0R1	.	R	272;234;95	ENSP00000308000:K272R;ENSP00000419607:K234R	ENSP00000441670:K234R	K	-	2	0	TUT1	62103068	0.997000	0.39634	0.566000	0.28421	0.619000	0.37552	3.640000	0.54350	2.109000	0.64355	0.460000	0.39030	AAG			0.532	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000351319.2		NM_022830	
MTA2	9219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62367713	62367713	+	Missense_Mutation	SNP	C	C	G			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:62367713C>G	ENST00000278823.2	-	3	504	c.115G>C	c.(115-117)Gag>Cag	p.E39Q	MTA2_ENST00000527204.1_5'UTR|MTA2_ENST00000524902.1_5'Flank	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	39	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						acctttgcctccacatttcca	0.433																																					p.E39Q													.	.			0			c.G115C												107.0	108.0	108.0					11																	62367713		2202	4299	6501	SO:0001583	missense	9219	exon3			TTGCCTCCACATT	AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.115G>C	11.37:g.62367713C>G	ENSP00000278823:p.Glu39Gln		108	0	0		109	0.30	33	NM_004739	109	0.31	34	Q68DB1|Q9UQB5	Missense_Mutation	SNP	ENST00000278823.2	37	CCDS8022.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808388	0.90707	.	.	ENSG00000149480	ENST00000278823	D	0.85955	-2.05	5.56	5.56	0.83823	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.92054	0.7482	M	0.81239	2.535	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	D	0.91951	0.5571	10	0.49607	T	0.09	-23.289	15.0452	0.71822	0.0:1.0:0.0:0.0	.	39	O94776	MTA2_HUMAN	Q	39	ENSP00000278823:E39Q	ENSP00000278823:E39Q	E	-	1	0	MTA2	62124289	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.628000	0.61282	2.629000	0.89072	0.655000	0.94253	GAG			0.433	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395578.1		NM_004739	
C11orf95	65998	broad.mit.edu;mdanderson.org	37	11	63533328	63533328	+	lincRNA	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:63533328C>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							cctcctcctcctcttcttcct	0.682																																					p.E196E													.	.			0			c.G588A												21.0	17.0	18.0					11																	63533328		692	1590	2282			65998	exon2			CTCCTCCTCTTCT																													11.37:g.63533328C>T			36	0	0		36	0.08	3	NM_001144936	2	0.00	0		RNA	SNP	ENST00000546282.2	37																																																																																						0.682	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
SLC25A45	283130	mdanderson.org	37	11	65144435	65144435	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:65144435G>A	ENST00000527174.1	-	5	507	c.452C>T	c.(451-453)gCa>gTa	p.A151V	SLC25A45_ENST00000398802.1_Missense_Mutation_p.A151V|SLC25A45_ENST00000377152.2_Missense_Mutation_p.A47V|SLC25A45_ENST00000294187.6_Missense_Mutation_p.A109V|SLC25A45_ENST00000534028.1_Missense_Mutation_p.A127V|SLC25A45_ENST00000417511.2_Missense_Mutation_p.A109V|SLC25A45_ENST00000360662.3_Missense_Mutation_p.A127V|SLC25A45_ENST00000526432.1_Missense_Mutation_p.A89V|RP11-867O8.5_ENST00000533886.1_RNA			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	151					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						GATGGAGGCTGCACAGTGCAC	0.667																																					p.A151V													.	.			0			c.C452T												28.0	33.0	31.0					11																	65144435		1855	4091	5946	SO:0001583	missense	283130	exon6			GAGGCTGCACAGT	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.452C>T	11.37:g.65144435G>A	ENSP00000435489:p.Ala151Val		55	0	0		44	0.07	3	NM_182556	10	0.00	0	Q6PL49|Q8IW29	Missense_Mutation	SNP	ENST00000527174.1	37	CCDS41670.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.113081	0.37339	.	.	ENSG00000162241	ENST00000527174;ENST00000534028;ENST00000398802;ENST00000360662;ENST00000377152;ENST00000294187;ENST00000417511;ENST00000526432	T;T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.23	3.28	0.37604	Mitochondrial carrier domain (2);	0.278938	0.33534	N	0.004820	T	0.62295	0.2416	N	0.25060	0.705	0.36162	D	0.848205	B;B;B	0.15719	0.014;0.007;0.008	B;B;B	0.22753	0.041;0.012;0.02	T	0.57481	-0.7804	10	0.27082	T	0.32	-0.5286	8.6573	0.34071	0.2038:0.0:0.7962:0.0	.	89;127;151	E9PJQ3;Q8N413-4;Q8N413	.;.;S2545_HUMAN	V	151;127;151;127;47;109;109;89	ENSP00000435489:A151V;ENSP00000431769:A127V;ENSP00000381782:A151V;ENSP00000353879:A127V;ENSP00000366357:A47V;ENSP00000294187:A109V;ENSP00000407530:A109V;ENSP00000435547:A89V	ENSP00000294187:A109V	A	-	2	0	SLC25A45	64901011	0.004000	0.15560	0.397000	0.26308	0.839000	0.47603	1.749000	0.38319	0.631000	0.30412	0.561000	0.74099	GCA			0.667	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388744.3		NM_182556	
ZDHHC24	254359	mdanderson.org	37	11	66313361	66313361	+	Silent	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr11:66313361C>T	ENST00000310442.3	-	1	348	c.114G>A	c.(112-114)gtG>gtA	p.V38V	ZDHHC24_ENST00000526986.1_Silent_p.V38V|ZDHHC24_ENST00000525925.1_5'UTR|ACTN3_ENST00000513398.1_RNA|ACTN3_ENST00000502692.1_RNA	NM_207340.1	NP_997223.1	Q6UX98	ZDH24_HUMAN	zinc finger, DHHC-type containing 24	38						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|ovary(1)|prostate(1)|skin(1)	7						CGGGACCGAGCACCAGCACGT	0.766																																					p.V38V													.	.			0			c.G114A												2.0	3.0	3.0					11																	66313361		1608	3327	4935	SO:0001819	synonymous_variant	254359	exon1			ACCGAGCACCAGC	BC005015	CCDS8143.1	11q13.2	2008-05-02				ENSG00000174165		"""Zinc fingers, DHHC-type"""	27387	protein-coding gene	gene with protein product							Standard	NM_207340		Approved		uc001oin.1	Q6UX98		ENST00000310442.3:c.114G>A	11.37:g.66313361C>T			14	0	0		10	0.20	2	NM_207340	4	0.00	0	Q6PEW7|Q9BSJ0	Silent	SNP	ENST00000310442.3	37	CCDS8143.1																																																																																					0.766	ZDHHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393089.1		NM_207340	
SCAF11	9169	mdanderson.org	37	12	46321423	46321423	+	Silent	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr12:46321423C>T	ENST00000369367.3	-	11	2294	c.2061G>A	c.(2059-2061)tcG>tcA	p.S687S	SCAF11_ENST00000465950.1_Silent_p.S372S|SCAF11_ENST00000549162.1_Silent_p.S495S|SCAF11_ENST00000419565.2_Silent_p.S687S|SCAF11_ENST00000550629.1_5'Flank	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	687					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GTTCGGTCAGCGATTCATTCT	0.318																																					p.S687S													SCAF11,colon,carcinoma,0,1	SCAF11	0	1	0			c.G2061A												151.0	154.0	153.0					12																	46321423		2203	4299	6502	SO:0001819	synonymous_variant	9169	exon11			GGTCAGCGATTCA	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2061G>A	12.37:g.46321423C>T			48	0	0		49	0.06	3	NM_004719	70	0.00	0	A6NEU9|A6NLW5|Q8IW59	Silent	SNP	ENST00000369367.3	37	CCDS8748.2																																																																																					0.318	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313992.2		NM_004719	
KNTC1	9735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123107038	123107038	+	Missense_Mutation	SNP	C	C	G			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr12:123107038C>G	ENST00000333479.7	+	62	6576	c.6399C>G	c.(6397-6399)atC>atG	p.I2133M	KNTC1_ENST00000450485.2_Missense_Mutation_p.I1058M|HCAR1_ENST00000356987.2_Intron|KNTC1_ENST00000537348.1_3'UTR|KNTC1_ENST00000534995.1_Missense_Mutation_p.I54M|KNTC1_ENST00000436959.3_Missense_Mutation_p.I54M	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	2133					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATAATATCATCAATAAGAAGG	0.313																																					p.I2133M													KNTC1,NS,carcinoma,0,1	KNTC1	0	1	0			c.C6399G												44.0	41.0	42.0					12																	123107038		1831	4078	5909	SO:0001583	missense	9735	exon62			TATCATCAATAAG		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.6399C>G	12.37:g.123107038C>G	ENSP00000328236:p.Ile2133Met		138	0	0		146	0.10	14	NM_014708	194	0.25	48	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358575	0.24598	.	.	ENSG00000184445	ENST00000450485;ENST00000333479;ENST00000436959;ENST00000534995	T;T	0.24723	1.84;2.42	5.11	2.78	0.32641	.	0.286088	0.39210	N	0.001434	T	0.29684	0.0741	L	0.32530	0.975	0.80722	D	1	D;P	0.69078	0.997;0.668	D;B	0.64776	0.929;0.259	T	0.14309	-1.0477	10	0.72032	D	0.01	-9.5888	2.526	0.04691	0.6063:0.1646:0.0837:0.1455	.	1058;2133	E7ES84;P50748	.;KNTC1_HUMAN	M	1058;2133;54;54	ENSP00000397992:I1058M;ENSP00000328236:I2133M	ENSP00000328236:I2133M	I	+	3	3	KNTC1	121672991	0.923000	0.31300	0.652000	0.29579	0.421000	0.31385	0.973000	0.29422	0.381000	0.24851	-0.474000	0.04947	ATC			0.313	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396110.2			
DACH1	1602	mdanderson.org	37	13	72440446	72440446	+	Silent	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr13:72440446G>A	ENST00000359684.2	-	1	461	c.462C>T	c.(460-462)agC>agT	p.S154S	DACH1_ENST00000354591.4_Silent_p.S154S|DACH1_ENST00000313174.7_Silent_p.S154S|DACH1_ENST00000305425.4_Silent_p.S154S			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	154	Poly-Ser.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		tgctactactgctgctgctgc	0.662																																					p.S154S													.	.			0			c.C462T												3.0	4.0	4.0					13																	72440446		1701	3505	5206	SO:0001819	synonymous_variant	1602	exon1			ACTACTGCTGCTG	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.462C>T	13.37:g.72440446G>A			40	0.025	1		30	0.13	4	NM_080759	2	0.00	0	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Silent	SNP	ENST00000359684.2	37																																																																																						0.662	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding		OTTHUMT00000045240.1		NM_004392	
IRS2	8660	mdanderson.org	37	13	110436412	110436412	+	Silent	SNP	C	C	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr13:110436412C>A	ENST00000375856.3	-	1	2503	c.1989G>T	c.(1987-1989)gcG>gcT	p.A663A		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	663					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TCCCACTGCCCGCGAGGGCCG	0.701																																					p.A663A	Melanoma(100;613 2409 40847)												.	.			0			c.G1989T												10.0	10.0	10.0					13																	110436412		2162	4268	6430	SO:0001819	synonymous_variant	8660	exon1			ACTGCCCGCGAGG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.1989G>T	13.37:g.110436412C>A			17	0	0		10	0.20	2	NM_003749	3	0.00	0	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																					0.701	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045755.1		NM_003749	
RP11-146E13.4	0	broad.mit.edu	37	14	19857036	19857036	+	lincRNA	SNP	A	A	G	rs374719458		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr14:19857036A>G	ENST00000548109.1	+	0	72																											CTGGATAATAAAGTTCATCTC	0.373																																					.													.	.			0			.																																											0	.			ATAATAAAGTTCA																													14.37:g.19857036A>G			77	0.012987013	1		74	0.04	3	.	2	0.00	0		RNA	SNP	ENST00000548109.1	37																																																																																						0.373	RP11-146E13.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409408.1			
IGHV4-4	28401	bcgsc.ca	37	14	106478531	106478531	+	RNA	SNP	G	G	A	rs368146435		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr14:106478531G>A	ENST00000390596.2	-	0	72									immunoglobulin heavy variable 4-4																		AGAACCACAGGTGTTTCATGT	0.527																																					.													.	.			0			.							G		73,3579		0,73,1753	33.0	40.0	38.0			-3.0	0.0	14		38	2,8148		0,2,4073	no	intergenic				0,75,5826	AA,AG,GG		0.0245,1.9989,0.6355			106478531	75,11727	1826	4075	5901			28401	.			CCACAGGTGTTTC	X62112		14q32.33	2012-02-08			ENSG00000211936	ENSG00000276775		"""Immunoglobulins / IGH locus"""	5652	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152322		14.37:g.106478531G>A			218	0	0		148	0.08	12	.	483	0.15	71		RNA	SNP	ENST00000390596.2	37																																																																																						0.527	IGHV4-4-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000325884.1		NG_001019	
SRP14	6727	broad.mit.edu	37	15	40331548	40331549	+	5'Flank	DEL	CA	CA	-	rs17551891|rs397706592|rs199511159	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr15:40331548_40331549delCA	ENST00000267884.6	-	0	0				SRP14_ENST00000560773.1_5'Flank|SRP14_ENST00000558527.1_5'Flank|SRP14_ENST00000558720.1_5'Flank|SRP14-AS1_ENST00000504245.1_lincRNA|SRP14_ENST00000559081.1_5'Flank	NM_003134.4	NP_003125.3	P37108	SRP14_HUMAN	signal recognition particle 14kDa (homologous Alu RNA binding protein)						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intercellular bridge (GO:0045171)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|skin(1)|upper_aerodigestive_tract(1)	3		all_cancers(109;7.56e-18)|all_epithelial(112;4.02e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.84e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0505)		CCTGGGTCGTCACATGCGAGAA	0.644														2330	0.465256	0.3192	0.4827	5008	,	,		15518	0.2778		0.7038	False		,,,				2504	0.5982				.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			GGTCGTCACATGC		CCDS42017.1	15q22	2008-08-15	2002-08-29		ENSG00000140319	ENSG00000140319			11299	protein-coding gene	gene with protein product		600708	"""signal recognition particle 14kD (homologous Alu RNA-binding protein)"""			8196634	Standard	NM_003134		Approved	ALURBP, MGC14326	uc001zkq.2	P37108			15.37:g.40331550_40331551delCA	Exception_encountered		4	0	0		9	0.56	5	.	31	0.00	0	B5BUF5|Q6B0K5|Q96Q14	RNA	DEL	ENST00000267884.6	37	CCDS42017.1																																																																																					0.644	SRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418262.2		NM_003134	
CAPN15	6650	mdanderson.org	37	16	602370	602370	+	Silent	SNP	C	C	T	rs75045595	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr16:602370C>T	ENST00000219611.2	+	11	2940	c.2577C>T	c.(2575-2577)agC>agT	p.S859S	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	859					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGTTCGGCAGCGGCGGCCACC	0.697													c|||	4	0.000798722	0.0	0.0	5008	,	,		13943	0.0		0.002	False		,,,				2504	0.002				p.S859S													.	.			0			c.C2577T												7.0	11.0	10.0					16																	602370		2042	4071	6113	SO:0001819	synonymous_variant	6650	exon11			CGGCAGCGGCGGC	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.2577C>T	16.37:g.602370C>T			26	0	0		22	0.14	3	NM_005632	39	0.00	0	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent	SNP	ENST00000219611.2	37	CCDS10410.1																																																																																			0		0.697	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239271.1		NM_005632	
RSL1D1	26156	broad.mit.edu	37	16	11931765	11931765	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr16:11931765G>A	ENST00000571133.1	-	9	1424	c.1352C>T	c.(1351-1353)gCg>gTg	p.A451V	RSL1D1_ENST00000542106.1_Missense_Mutation_p.A231V	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	451					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						agtctgtctcgcatctttttt	0.473																																					p.A451V													.	RSL1D1	40		0			c.C1352T												231.0	249.0	243.0					16																	11931765		2197	4300	6497	SO:0001583	missense	26156	exon9			TGTCTCGCATCTT	AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.1352C>T	16.37:g.11931765G>A	ENSP00000460871:p.Ala451Val		161	0	0		165	0.02	4	NM_015659	793	0.00	2	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	ENST00000571133.1	37	CCDS10551.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.175871	0.00312	.	.	ENSG00000171490	ENST00000355674;ENST00000396503;ENST00000542106	.	.	.	4.43	-2.49	0.06403	.	0.980712	0.08343	N	0.960588	T	0.09862	0.0242	N	0.00926	-1.1	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.04013	0.001;0.001	T	0.35674	-0.9779	9	0.02654	T	1	1.6828	8.979	0.35953	0.5348:0.0:0.4652:0.0	.	451;451	Q32Q62;O76021	.;RL1D1_HUMAN	V	450;451;231	.	ENSP00000347897:A450V	A	-	2	0	RSL1D1	11839266	0.016000	0.18221	0.026000	0.17262	0.009000	0.06853	-0.302000	0.08221	-0.522000	0.06417	-1.008000	0.02478	GCG			0.473	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252059.2		NM_015659	
NOD2	64127	mdanderson.org	37	16	50733757	50733757	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr16:50733757G>T	ENST00000300589.2	+	2	537	c.432G>T	c.(430-432)agG>agT	p.R144S	NOD2_ENST00000526417.2_3'UTR	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	144	CARD 2. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				TTGTCAGGAGGCTCCACAGCC	0.612																																					p.R144S													.	.			0			c.G432T												55.0	53.0	53.0					16																	50733757		2198	4300	6498	SO:0001583	missense	64127	exon2			CAGGAGGCTCCAC	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.432G>T	16.37:g.50733757G>T	ENSP00000300589:p.Arg144Ser		44	0	0		32	0.09	3	NM_022162	6	0.00	0	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	37	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.055019	0.36277	.	.	ENSG00000167207	ENST00000526417;ENST00000531674;ENST00000300589	T;T	0.19806	2.45;2.12	5.29	1.78	0.24846	DEATH-like (2);Caspase Recruitment (2);	0.118192	0.38058	N	0.001822	T	0.14184	0.0343	L	0.56769	1.78	0.37205	D	0.904546	P	0.43231	0.801	B	0.31946	0.138	T	0.18304	-1.0341	10	0.27082	T	0.32	.	6.421	0.21744	0.693:0.0:0.307:0.0	.	144	Q9HC29	NOD2_HUMAN	S	117;117;144	ENSP00000431681:R117S;ENSP00000300589:R144S	ENSP00000300589:R144S	R	+	3	2	NOD2	49291258	0.999000	0.42202	1.000000	0.80357	0.490000	0.33462	0.541000	0.23207	0.310000	0.22990	-0.469000	0.05056	AGG			0.612	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256876.2		NM_022162	
SMPD3	55512	mdanderson.org	37	16	68395599	68395599	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr16:68395599G>T	ENST00000219334.5	-	8	2376	c.1773C>A	c.(1771-1773)ggC>ggA	p.G591G	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000563226.1_Silent_p.G583G|SMPD3_ENST00000568373.1_Silent_p.G574G	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	591					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GCCCCTTCTGGCCCGAGCTCT	0.662																																					p.G591G													.	.			0			c.C1773A												56.0	46.0	49.0					16																	68395599		2198	4300	6498	SO:0001819	synonymous_variant	55512	exon8			CTTCTGGCCCGAG	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1773C>A	16.37:g.68395599G>T			55	0	0		39	0.08	3	NM_018667	15	0.00	0	B7ZL82|Q2M1S8	Silent	SNP	ENST00000219334.5	37	CCDS10867.1																																																																																					0.662	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268895.3		NM_018667	
ATP2C2	9914	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84456001	84456001	+	Silent	SNP	G	G	A	rs200504983	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr16:84456001G>A	ENST00000262429.4	+	8	719	c.630G>A	c.(628-630)acG>acA	p.T210T	ATP2C2_ENST00000416219.2_Silent_p.T210T|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	210					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CCTAGGTCACGGACCTCTTGG	0.537													G|||	3	0.000599042	0.0015	0.0	5008	,	,		18513	0.0		0.001	False		,,,				2504	0.0				p.T210T													.	ATP2C2	75		0			c.G630A							G		0,3904		0,0,1952	88.0	92.0	91.0		630	-5.4	1.0	16		91	2,8280		0,2,4139	no	coding-synonymous	ATP2C2	NM_014861.2		0,2,6091	AA,AG,GG		0.0241,0.0,0.0164		210/947	84456001	2,12184	1952	4141	6093	SO:0001819	synonymous_variant	9914	exon8			GGTCACGGACCTC	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.630G>A	16.37:g.84456001G>A			129	0.007751938	1		101	0.18	18	NM_014861	0		0	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Silent	SNP	ENST00000262429.4	37	CCDS42207.1																																																																																					0.537	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433404.1		NM_014861	
FAM83G	644815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18882003	18882003	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:18882003T>C	ENST00000388995.6	-	5	1199	c.976A>G	c.(976-978)Att>Gtt	p.I326V	SLC5A10_ENST00000317977.6_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.I326V|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.I326V|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395643.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	326					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						GGCAGCACAATAGGCTCCGGC	0.602																																					p.I326V													.	.			0			c.A976G												78.0	90.0	86.0					17																	18882003		2079	4190	6269	SO:0001583	missense	644815	exon5			GCACAATAGGCTC	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.976A>G	17.37:g.18882003T>C	ENSP00000373647:p.Ile326Val		118	0	0		58	0.14	8	NM_001039999	12	0.08	1	Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	ENST00000388995.6	37	CCDS42276.1	.	.	.	.	.	.	.	.	.	.	T	0.192	-1.052536	0.01981	.	.	ENSG00000188522	ENST00000388995;ENST00000345041	T;T	0.10573	2.86;2.86	4.86	1.37	0.22104	.	0.371554	0.25535	N	0.030015	T	0.05318	0.0141	N	0.25201	0.72	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44726	-0.9309	10	0.09843	T	0.71	-5.8483	5.2311	0.15422	0.1479:0.4236:0.0:0.4285	.	326	A6ND36	FA83G_HUMAN	V	326	ENSP00000373647:I326V;ENSP00000343279:I326V	ENSP00000343279:I326V	I	-	1	0	FAM83G	18822728	0.000000	0.05858	0.264000	0.24511	0.417000	0.31264	-0.247000	0.08866	-0.046000	0.13446	0.260000	0.18958	ATT			0.602	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253108.4			
ALDH3A1	218	mdanderson.org	37	17	19642929	19642929	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:19642929G>T	ENST00000457500.2	-	7	1337	c.1008C>A	c.(1006-1008)ttC>ttA	p.F336L	RP11-311F12.2_ENST00000580884.1_RNA|ALDH3A1_ENST00000395555.3_Missense_Mutation_p.F272L|ALDH3A1_ENST00000444455.1_Missense_Mutation_p.F336L|ALDH3A1_ENST00000494157.2_Missense_Mutation_p.F263L|ALDH3A1_ENST00000225740.6_Missense_Mutation_p.F336L	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	336					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		GCACAGGCCCGAAGATCTCCT	0.632																																					p.F336L													.	.			0			c.C1008A												68.0	57.0	61.0					17																	19642929		2203	4300	6503	SO:0001583	missense	218	exon7			AGGCCCGAAGATC	M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.1008C>A	17.37:g.19642929G>T	ENSP00000411821:p.Phe336Leu		48	0	0		39	0.08	3	NM_001135168	0		0	A8K828|Q9BT37	Missense_Mutation	SNP	ENST00000457500.2	37	CCDS11212.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268765	0.59540	.	.	ENSG00000108602	ENST00000225740;ENST00000395555;ENST00000379258;ENST00000444455;ENST00000457500;ENST00000457844;ENST00000439102	D;D;D;D;D	0.90563	-2.69;-2.31;-2.69;-2.69;-2.69	4.82	-9.65	0.00537	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.95207	0.8446	H	0.97077	3.935	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95048	0.8184	10	0.87932	D	0	-36.3952	11.3327	0.49485	0.3734:0.0:0.5305:0.0961	.	336;453;336	A8K828;Q8N9T9;P30838	.;.;AL3A1_HUMAN	L	336;272;394;336;336;263;336	ENSP00000225740:F336L;ENSP00000378923:F272L;ENSP00000388469:F336L;ENSP00000411821:F336L;ENSP00000389766:F336L	ENSP00000225740:F336L	F	-	3	2	ALDH3A1	19583521	0.000000	0.05858	0.076000	0.20297	0.675000	0.39556	-1.824000	0.01708	-2.518000	0.00499	-1.578000	0.00866	TTC			0.632	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132265.4		NM_000691	
TBC1D3P3	653017	broad.mit.edu	37	17	20452860	20452861	+	lincRNA	INS	-	-	AGA			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:20452860_20452861insAGA	ENST00000591705.1	+	0	4177_4178																											CAGGACCTGGGAGAAGGAGTGC	0.653																																					.													.	.			0			.																																											0	.			ACCTGGGAGAAGG																													17.37:g.20452861_20452863dupAGA			15	0.3333333333	5		12	0.42	5	.	0		0		RNA	INS	ENST00000591705.1	37																																																																																						0.653	RP11-434D2.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000441761.2			
TBC1D3P5	440419	hgsc.bcm.edu	37	17	25756182	25756182	+	RNA	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:25756182G>A	ENST00000586223.1	+	0	1595					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		CTCCTCCAGGGGTGCCAGGAC	0.597																																					.													.	.			0			.																																											440419	.			TCCAGGGGTGCCA			17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25756182G>A			31	0	0		36	0.17	6	.	0		0		RNA	SNP	ENST00000586223.1	37																																																																																						0.597	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	pseudogene		OTTHUMT00000451073.1		NR_033892	
NF1	4763	hgsc.bcm.edu;broad.mit.edu	37	17	29486050	29486051	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	AA	AA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:29486050_29486051delAA	ENST00000358273.4	+	3	610_611	c.227_228delAA	c.(226-228)gaafs	p.E76fs	NF1_ENST00000431387.4_Frame_Shift_Del_p.E76fs|NF1_ENST00000356175.3_Frame_Shift_Del_p.E76fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	76					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.E76fs*31(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GAAGCTGCTGAAAAAAATTTAT	0.327			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.76_76del			yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.,1	NF1	1586		13	Whole gene deletion(8)|Unknown(4)|Insertion - Frameshift(1)	soft_tissue(8)|autonomic_ganglia(3)|central_nervous_system(2)	c.226_227del																																									SO:0001589	frameshift_variant	4763	exon3	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	CTGCTGAAAAAAA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.227_228delAA	17.37:g.29486054_29486055delAA	ENSP00000351015:p.Glu76fs		47	0	0		60	0.17	10	NM_001042492	8	0.00	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																					0.327	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256351.2		NM_000267	
XYLT2	64132	mdanderson.org	37	17	48431836	48431836	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:48431836G>T	ENST00000017003.2	+	3	745	c.696G>T	c.(694-696)gtG>gtT	p.V232V	XYLT2_ENST00000507602.1_Silent_p.V232V	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	232					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					GCCCCCCGGTGCGAATCGCCT	0.622																																					p.V232V													.	.			0			c.G696T												35.0	36.0	36.0					17																	48431836		2203	4300	6503	SO:0001819	synonymous_variant	64132	exon3			CCCGGTGCGAATC	AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.696G>T	17.37:g.48431836G>T			42	0	0		23	0.13	3	NM_022167	49	0.00	0	Q6UY41|Q86V00	Silent	SNP	ENST00000017003.2	37	CCDS11563.1																																																																																					0.622	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367046.1		NM_022167	
VMP1	81671	mdanderson.org	37	17	57886171	57886171	+	Silent	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:57886171G>A	ENST00000262291.4	+	8	1039	c.729G>A	c.(727-729)cgG>cgA	p.R243R	VMP1_ENST00000537567.1_Silent_p.R109R|VMP1_ENST00000545362.1_Silent_p.R187R|VMP1_ENST00000536180.1_Silent_p.R146R|VMP1_ENST00000539763.1_Silent_p.R51R	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1	243					autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						TTGCCTCCCGGGCCAAACTGG	0.353																																					p.R243R													.	.			0			c.G729A												81.0	81.0	81.0					17																	57886171		2203	4300	6503	SO:0001819	synonymous_variant	81671	exon8			CTCCCGGGCCAAA		CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.729G>A	17.37:g.57886171G>A			51	0	0		33	0.09	3	NM_030938	130	0.00	0	B4DVV9|Q9H0P4|Q9P089	Silent	SNP	ENST00000262291.4	37	CCDS11619.1																																																																																					0.353	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448793.1		NM_030938	
LPHN1	22859	mdanderson.org	37	19	14268080	14268080	+	Missense_Mutation	SNP	C	C	T	rs370012631		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr19:14268080C>T	ENST00000340736.6	-	15	3040	c.2743G>A	c.(2743-2745)Gac>Aac	p.D915N	LPHN1_ENST00000361434.3_Missense_Mutation_p.D910N|CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|CTB-55O6.12_ENST00000588658.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	915					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGAGTCTTGTCGATCCCGACC	0.637																																					p.D915N													LPHN1,NS,carcinoma,0,1	LPHN1	0	1	0			c.G2743A							C	ASN/ASP,ASN/ASP	0,4406		0,0,2203	131.0	119.0	123.0		2743,2728	3.6	0.9	19		123	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LPHN1	NM_001008701.2,NM_014921.4	23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	915/1475,910/1470	14268080	1,13005	2203	4300	6503	SO:0001583	missense	22859	exon15			TCTTGTCGATCCC	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.2743G>A	19.37:g.14268080C>T	ENSP00000340688:p.Asp915Asn		35	0	0		40	0.08	3	NM_001008701	161	0.01	1	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	C	0.316	-0.964967	0.02249	0.0	1.16E-4	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.37235	1.21;1.21	4.62	3.57	0.40892	GPCR, family 2-like (1);	0.054782	0.64402	D	0.000001	T	0.17238	0.0414	N	0.11284	0.12	0.54753	D	0.999987	P;P	0.43701	0.632;0.815	B;B	0.39299	0.296;0.244	T	0.04268	-1.0964	10	0.07325	T	0.83	.	12.0269	0.53375	0.1744:0.8256:0.0:0.0	.	910;915	O94910-2;O94910	.;LPHN1_HUMAN	N	915;910	ENSP00000340688:D915N;ENSP00000355328:D910N	ENSP00000340688:D915N	D	-	1	0	LPHN1	14129080	1.000000	0.71417	0.890000	0.34922	0.295000	0.27426	4.871000	0.63042	1.036000	0.39998	0.491000	0.48974	GAC			0.637	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000459696.1		NM_014921	
SIPA1L3	23094	hgsc.bcm.edu	37	19	38673203	38673203	+	Missense_Mutation	SNP	C	C	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr19:38673203C>A	ENST00000222345.6	+	16	4762	c.4253C>A	c.(4252-4254)aCt>aAt	p.T1418N	CTB-102L5.7_ENST00000594299.1_RNA	NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1418					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GTTTACAAAACTGCCAGTGCA	0.537																																					p.T1418N													.	.			0			c.C4253A												93.0	106.0	102.0					19																	38673203		2203	4300	6503	SO:0001583	missense	23094	exon16			ACAAAACTGCCAG	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.4253C>A	19.37:g.38673203C>A	ENSP00000222345:p.Thr1418Asn		146	0	0		123	0.04	5	NM_015073	45	0.00	0	Q2TV87	Missense_Mutation	SNP	ENST00000222345.6	37	CCDS33007.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999080	0.35226	.	.	ENSG00000105738	ENST00000222345	T	0.76448	-1.02	5.28	4.25	0.50352	.	0.320791	0.28052	N	0.016796	T	0.69305	0.3096	L	0.46157	1.445	0.32404	N	0.551564	B	0.18610	0.029	B	0.15052	0.012	T	0.71381	-0.4610	10	0.51188	T	0.08	-5.1979	9.0596	0.36427	0.0:0.7688:0.149:0.0822	.	1418	O60292	SI1L3_HUMAN	N	1418	ENSP00000222345:T1418N	ENSP00000222345:T1418N	T	+	2	0	SIPA1L3	43365043	0.847000	0.29606	0.746000	0.31095	0.722000	0.41435	1.562000	0.36353	1.218000	0.43458	0.555000	0.69702	ACT			0.537	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000156294.2		XM_032278	
NKPD1	284353	mdanderson.org	37	19	45656858	45656858	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr19:45656858G>T	ENST00000438936.2	-	3	382	c.171C>A	c.(169-171)atC>atA	p.I57I	NKPD1_ENST00000589776.1_Silent_p.I57I|AC005757.7_ENST00000589594.1_lincRNA|NKPD1_ENST00000317951.4_Silent_p.I279I|NKPD1_ENST00000429338.1_Silent_p.I57I			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1	57	KAP NTPase.					integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		CGCTAAAGCGGATGAAAAGGA	0.662																																					p.I279I													.	.			0			c.C837A												12.0	15.0	14.0					19																	45656858		2091	4191	6282	SO:0001819	synonymous_variant	284353	exon4			AAAGCGGATGAAA	AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521	ENST00000438936.2:c.171C>A	19.37:g.45656858G>T			21	0	0		14	0.14	2	NM_198478	13	0.00	0	B7ZLG6|D6RH15|Q8N2A2	Silent	SNP	ENST00000438936.2	37																																																																																						0.662	NKPD1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000360950.2		NM_198478	
TRIM28	10155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	59060468	59060468	+	Missense_Mutation	SNP	T	T	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr19:59060468T>A	ENST00000253024.5	+	12	1812	c.1523T>A	c.(1522-1524)gTc>gAc	p.V508D	TRIM28_ENST00000341753.6_Missense_Mutation_p.V426D	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	508	HP1 box.				convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GTCTTCAAGGTCTTCCCAGGC	0.617																																					p.V508D													TRIM28,NS,carcinoma,+1,1	TRIM28	1	1	0			c.T1523A												66.0	68.0	67.0					19																	59060468		2202	4299	6501	SO:0001583	missense	10155	exon12			TCAAGGTCTTCCC		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.1523T>A	19.37:g.59060468T>A	ENSP00000253024:p.Val508Asp		307	0	0		244	0.20	48	NM_005762	2245	0.44	977	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	37	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	T	18.94	3.730149	0.69074	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.75154	-0.66;-0.91	4.95	4.95	0.65309	.	0.000000	0.53938	D	0.000047	T	0.76300	0.3968	N	0.19112	0.55	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.994;0.998	D;D;D	0.80764	0.994;0.937;0.987	T	0.79722	-0.1684	10	0.72032	D	0.01	-35.0716	12.8726	0.57972	0.0:0.0:0.0:1.0	.	426;508;508	Q13263-2;B2R8R5;Q13263	.;.;TIF1B_HUMAN	D	508;426	ENSP00000253024:V508D;ENSP00000342232:V426D	ENSP00000253024:V508D	V	+	2	0	TRIM28	63752280	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	4.695000	0.61767	2.000000	0.58554	0.448000	0.29417	GTC			0.617	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467074.1		NM_005762	
SNTG2	54221	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	1133331	1133331	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr2:1133331G>T	ENST00000308624.5	+	5	478	c.349G>T	c.(349-351)Gta>Tta	p.V117L	SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	117	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GATGTTGTTCGTAGGAGATGC	0.378																																					p.V117L													.	SNTG2	125		0			c.G349T												108.0	105.0	106.0					2																	1133331		2026	4191	6217	SO:0001583	missense	54221	exon5			TTGTTCGTAGGAG	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.349G>T	2.37:g.1133331G>T	ENSP00000311837:p.Val117Leu		128	0	0		102	0.05	5	NM_018968	0		0	Q05AH5	Missense_Mutation	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009312	0.35415	.	.	ENSG00000172554	ENST00000308624	T	0.31247	1.5	4.69	0.701	0.18104	PDZ/DHR/GLGF (4);	0.377399	0.28036	N	0.016847	T	0.33323	0.0859	M	0.62209	1.925	0.80722	D	1	B	0.28324	0.207	B	0.38880	0.284	T	0.10451	-1.0629	10	0.51188	T	0.08	.	8.4388	0.32803	0.8271:0.0:0.1729:0.0	.	117	Q9NY99	SNTG2_HUMAN	L	117	ENSP00000311837:V117L	ENSP00000311837:V117L	V	+	1	0	SNTG2	1123331	1.000000	0.71417	0.996000	0.52242	0.584000	0.36387	1.027000	0.30115	-0.161000	0.10983	-0.384000	0.06662	GTA			0.378	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322454.1		NM_018968	
ANKRD36BP2	645784	broad.mit.edu	37	2	89104503	89104504	+	RNA	INS	-	-	C	rs149625899|rs67367050	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr2:89104503_89104504insC	ENST00000393525.3	+	0	4868									ankyrin repeat domain 36B pseudogene 2																		gtagatttttttcagattttgg	0.307													-|-|C|insertion	512	0.102236	0.1067	0.0965	5008	,	,		29304	0.0694		0.1064	False		,,,				2504	0.1299				.													.	.			0			.																																											0	.			ATTTTTTTCAGAT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104503_89104504insC			16	0.0625	1		16	0.44	7	.	1	1.00	1		RNA	INS	ENST00000393525.3	37																																																																																						0.307	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
CPXM1	56265	mdanderson.org	37	20	2778886	2778886	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr20:2778886G>T	ENST00000380605.2	-	4	566	c.502C>A	c.(502-504)Cag>Aag	p.Q168K		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	168	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.Q168*(1)		endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TCGGCGTCCTGCTCCTCAGCA	0.607																																					p.Q168K													CPXM1,NS,carcinoma,0,1	CPXM1	0	1	1	Substitution - Nonsense(1)	ovary(1)	c.C502A												66.0	64.0	65.0					20																	2778886		2203	4300	6503	SO:0001583	missense	56265	exon4			CGTCCTGCTCCTC	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.502C>A	20.37:g.2778886G>T	ENSP00000369979:p.Gln168Lys		39	0	0		47	0.06	3	NM_001184699	147	0.00	0	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512238	0.27036	.	.	ENSG00000088882	ENST00000380605	D	0.98192	-4.78	4.41	3.41	0.39046	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.294026	0.31922	N	0.006844	D	0.92306	0.7559	N	0.05330	-0.07	0.09310	N	0.999993	B;B	0.10296	0.003;0.001	B;B	0.17098	0.017;0.004	T	0.83216	-0.0071	10	0.24483	T	0.36	-10.1737	6.7184	0.23316	0.0:0.2059:0.6082:0.1859	.	168;168	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	K	168	ENSP00000369979:Q168K	ENSP00000369979:Q168K	Q	-	1	0	CPXM1	2726886	0.008000	0.16893	0.922000	0.36590	0.723000	0.41478	0.339000	0.19875	2.295000	0.77249	0.563000	0.77884	CAG			0.607	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077643.2		NM_019609	
OVOL2	58495	mdanderson.org	37	20	18037394	18037394	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr20:18037394G>T	ENST00000278780.6	-	2	470	c.228C>A	c.(226-228)gcC>gcA	p.A76A	OVOL2_ENST00000483661.1_5'UTR|RP4-726N1.2_ENST00000429853.1_RNA	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	76					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						CGCTCTCGGGGGCGTGCGGGG	0.726																																					p.A76A													.	.			0			c.C228A												4.0	5.0	4.0					20																	18037394		2033	4022	6055	SO:0001819	synonymous_variant	58495	exon2			CTCGGGGGCGTGC	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.228C>A	20.37:g.18037394G>T			26	0	0		11	0.18	2	NM_021220	5	0.00	0	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Silent	SNP	ENST00000278780.6	37	CCDS13132.1																																																																																					0.726	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078148.5		NM_021220	
CSRP2BP	57325	mdanderson.org	37	20	18139746	18139746	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr20:18139746G>T	ENST00000435364.3	+	4	860	c.519G>T	c.(517-519)tgG>tgT	p.W173C	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.W45C|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.W173C	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	173					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						CGTCTACCTGGTGGAGCACCG	0.458																																					p.W173C													.	.			0			c.G519T												64.0	63.0	63.0					20																	18139746		2203	4300	6503	SO:0001583	missense	57325	exon4			TACCTGGTGGAGC	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.519G>T	20.37:g.18139746G>T	ENSP00000392318:p.Trp173Cys		100	0	0		78	0.05	4	NM_020536	89	0.00	0	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206510	0.79127	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.34859	1.88;1.9;1.88;1.34	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.61825	0.2378	M	0.66297	2.02	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.62586	-0.6823	10	0.87932	D	0	-6.1029	20.0149	0.97475	0.0:0.0:1.0:0.0	.	45;173	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	C	173;173;173;45	ENSP00000278816:W173C;ENSP00000366909:W173C;ENSP00000392318:W173C;ENSP00000425909:W45C	ENSP00000278816:W173C	W	+	3	0	CSRP2BP	18087746	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	9.254000	0.95512	2.793000	0.96121	0.650000	0.86243	TGG			0.458	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078152.5		NM_020536	
RALY	22913	broad.mit.edu	37	20	32664877	32664877	+	Silent	SNP	C	C	T	rs539352667	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr20:32664877C>T	ENST00000246194.3	+	8	1204	c.702C>T	c.(700-702)ggC>ggT	p.G234G	RALY_ENST00000375114.3_Silent_p.G218G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	234	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						gcggcggcggcggtggtggtg	0.667																																					p.G234G													.	RALY	44		0			c.C702T												5.0	7.0	7.0					20																	32664877		2080	4086	6166	SO:0001819	synonymous_variant	22913	exon8			CGGCGGCGGTGGT	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.702C>T	20.37:g.32664877C>T			96	0.0104166667	1		75	0.05	4	NM_016732	170	0.00	0	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	ENST00000246194.3	37	CCDS13230.1																																																																																					0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078753.1			
NPEPL1	79716	hgsc.bcm.edu	37	20	57266755	57266755	+	5'Flank	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr20:57266755T>C	ENST00000356091.6	+	0	0				NPEPL1_ENST00000525817.1_Intron|NPEPL1_ENST00000525967.1_Intron|STX16-NPEPL1_ENST00000530122.1_Intron	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			ttttctttttttttttttttt	0.413																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	100534593	.			CTTTTTTTTTTTT	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060		20.37:g.57266755T>C	Exception_encountered		26	0	0		30	0.13	4	.	0		0	A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	RNA	SNP	ENST00000356091.6	37	CCDS46621.1																																																																																					0.413	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080402.6		NM_024663	
MRPL40	64976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	19422334	19422334	+	Missense_Mutation	SNP	G	G	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr22:19422334G>C	ENST00000333130.3	+	3	866	c.213G>C	c.(211-213)aaG>aaC	p.K71N	HIRA_ENST00000546308.1_Intron|MRPL40_ENST00000443660.1_3'UTR|HIRA_ENST00000541063.1_Intron	NM_003776.2	NP_003767.2	Q9NQ50	RM40_HUMAN	mitochondrial ribosomal protein L40	71					anatomical structure morphogenesis (GO:0009653)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					TGAAAAGGAAGATCCGAAAAC	0.358																																					p.K71N													.	.			0			c.G213C												94.0	98.0	97.0					22																	19422334		2203	4300	6503	SO:0001583	missense	64976	exon3			AAGGAAGATCCGA	AB051624	CCDS13760.1	22q11.2	2012-09-13	2002-11-13		ENSG00000185608	ENSG00000185608		"""Mitochondrial ribosomal proteins / large subunits"""	14491	protein-coding gene	gene with protein product		605089	"""nuclear localization signal deleted in velocardiofacial syndrome"""	NLVCF		9790763, 11543634	Standard	NM_003776		Approved	MRP-L22	uc002zpg.3	Q9NQ50	OTTHUMG00000150136	ENST00000333130.3:c.213G>C	22.37:g.19422334G>C	ENSP00000333401:p.Lys71Asn		133	0	0		115	0.10	12	NM_003776	181	0.20	36	B3KVZ7|O95134	Missense_Mutation	SNP	ENST00000333130.3	37	CCDS13760.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908879	0.52439	.	.	ENSG00000185608	ENST00000333130	T	0.45276	0.9	4.45	0.0548	0.14312	.	0.210263	0.48286	D	0.000188	T	0.44456	0.1294	M	0.70595	2.14	0.28613	N	0.908588	P	0.35493	0.505	B	0.42319	0.383	T	0.49303	-0.8954	10	0.72032	D	0.01	-13.3201	9.6876	0.40109	0.3076:0.0:0.6924:0.0	.	71	Q9NQ50	RM40_HUMAN	N	71	ENSP00000333401:K71N	ENSP00000333401:K71N	K	+	3	2	MRPL40	17802334	1.000000	0.71417	0.997000	0.53966	0.925000	0.55904	1.636000	0.37144	0.232000	0.21100	0.563000	0.77884	AAG			0.358	MRPL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316491.2		NM_003776	
POM121L9P	29774	broad.mit.edu	37	22	24659809	24659809	+	RNA	SNP	G	G	A	rs376621154		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr22:24659809G>A	ENST00000414583.2	+	0	3334					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CCCTATCTGCGCACCCGGAGG	0.612																																					.													.	.			0			.																																											0	.			ATCTGCGCACCCG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659809G>A			13	0	0		30	0.30	9	.	3	0.00	0		RNA	SNP	ENST00000414583.2	37																																																																																						0.612	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
POM121L9P	29774	broad.mit.edu	37	22	24659813	24659813	+	RNA	SNP	C	C	T	rs368832816		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr22:24659813C>T	ENST00000414583.2	+	0	3338					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		ATCTGCGCACCCGGAGGTGGG	0.607																																					.													.	.			0			.																																											0	.			GCGCACCCGGAGG	AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24659813C>T			12	0	0		30	0.30	9	.	3	0.00	0		RNA	SNP	ENST00000414583.2	37																																																																																						0.607	POM121L9P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000319991.1		NM_014549	
SLC35E4	339665	mdanderson.org	37	22	31042971	31042971	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr22:31042971G>T	ENST00000343605.4	+	2	1805	c.1006G>T	c.(1006-1008)Gcc>Tcc	p.A336S	SLC35E4_ENST00000300385.8_Intron|SLC35E4_ENST00000406566.1_Intron	NM_001001479.2	NP_001001479.1	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	336						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	10						CTCCTGGGCTGCCCGTCGGGG	0.632																																					p.A336S													.	.			0			c.G1006T												45.0	40.0	42.0					22																	31042971		2203	4300	6503	SO:0001583	missense	339665	exon2			TGGGCTGCCCGTC		CCDS13882.1	22q12.2	2013-05-22			ENSG00000100036	ENSG00000100036		"""Solute carriers"""	17058	protein-coding gene	gene with protein product							Standard	NM_001001479		Approved		uc003ais.1	Q6ICL7	OTTHUMG00000151110	ENST00000343605.4:c.1006G>T	22.37:g.31042971G>T	ENSP00000339626:p.Ala336Ser		53	0	0		34	0.09	3	NM_001001479	20	0.00	0	Q567P0	Missense_Mutation	SNP	ENST00000343605.4	37	CCDS13882.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.146031	0.37923	.	.	ENSG00000100036	ENST00000343605	.	.	.	4.35	-0.385	0.12470	.	0.483471	0.21657	N	0.071096	T	0.22475	0.0542	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.05666	-1.0871	9	0.12766	T	0.61	-17.6666	4.1664	0.10308	0.2864:0.0:0.5535:0.1601	.	336	Q6ICL7	S35E4_HUMAN	S	336	.	ENSP00000339626:A336S	A	+	1	0	SLC35E4	29372971	0.003000	0.15002	0.771000	0.31576	0.884000	0.51177	0.274000	0.18680	-0.076000	0.12775	0.561000	0.74099	GCC			0.632	SLC35E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321382.1		XM_290973	
CDC42EP1	11135	broad.mit.edu	37	22	37964340	37964340	+	Missense_Mutation	SNP	A	A	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr22:37964340A>C	ENST00000249014.4	+	3	1109	c.689A>C	c.(688-690)aAc>aCc	p.N230T		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	230	8 X 7 AA tandem repeats of [PT]-[AT]-A- [ENT]-[PT]-[PTS]-[AG].				positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					CCCGCTGCAAACCCCCCAGCC	0.672																																					p.N230T													CDC42EP1,middle_lobe,carcinoma,0,1	CDC42EP1	53	1	0			c.A689C												17.0	21.0	20.0					22																	37964340		2184	4280	6464	SO:0001583	missense	11135	exon3			CTGCAAACCCCCC	M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.689A>C	22.37:g.37964340A>C	ENSP00000249014:p.Asn230Thr		51	0.0980392157	5		46	0.15	7	NM_152243	112	0.02	2	A8K825|Q96GN1	Missense_Mutation	SNP	ENST00000249014.4	37	CCDS13949.1	.	.	.	.	.	.	.	.	.	.	A	4.423	0.078246	0.08485	.	.	ENSG00000128283	ENST00000249014	T	0.31247	1.5	2.85	0.571	0.17352	.	3.264500	0.01892	N	0.038603	T	0.19725	0.0474	N	0.22421	0.69	0.09310	N	0.999999	B	0.30068	0.267	B	0.25291	0.059	T	0.12319	-1.0552	10	0.16420	T	0.52	-9.8417	6.2924	0.21067	0.7618:0.0:0.2382:0.0	.	230	Q00587	BORG5_HUMAN	T	230	ENSP00000249014:N230T	ENSP00000249014:N230T	N	+	2	0	CDC42EP1	36294286	0.000000	0.05858	0.006000	0.13384	0.095000	0.18619	-1.297000	0.02759	-0.037000	0.13646	0.459000	0.35465	AAC			0.672	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318993.1		NM_152243	
TYMP	1890	mdanderson.org	37	22	50965054	50965054	+	Silent	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr22:50965054G>A	ENST00000252029.3	-	7	1041	c.879C>T	c.(877-879)tgC>tgT	p.C293C	CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000252785.3_5'Flank|TYMP_ENST00000395678.3_Silent_p.C293C|TYMP_ENST00000395680.1_Silent_p.C293C|SCO2_ENST00000543927.1_5'Flank|SCO2_ENST00000535425.1_5'Flank|TYMP_ENST00000395681.1_Silent_p.C293C|SCO2_ENST00000395693.3_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	293					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CGCCGTCCATGCAGAGCAGCG	0.731																																					p.C293C													.	.			0			c.C879T												10.0	9.0	9.0					22																	50965054		2163	4248	6411	SO:0001819	synonymous_variant	1890	exon6			GTCCATGCAGAGC	M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.879C>T	22.37:g.50965054G>A			33	0	0		29	0.10	3	NM_001113756	261	0.00	0	A8MW15|H9KVA0|Q13390|Q8WVB7	Silent	SNP	ENST00000252029.3	37	CCDS14096.1																																																																																					0.731	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000317081.1		NM_001953	
SUCLG2	8801	mdanderson.org	37	3	67426205	67426205	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr3:67426205G>A	ENST00000307227.5	-	11	1289	c.1262C>T	c.(1261-1263)gCa>gTa	p.A421V	SUCLG2_ENST00000493112.1_Intron	NM_003848.3	NP_003839.2	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	421					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	CTTCTTGGCTGCATCCTCCAG	0.498																																					p.A421V													.	.			0			c.C1262T												64.0	64.0	64.0					3																	67426205		1944	4159	6103	SO:0001583	missense	8801	exon11			TTGGCTGCATCCT	AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000307227.5:c.1262C>T	3.37:g.67426205G>A	ENSP00000307432:p.Ala421Val		84	0	0		76	0.05	4	NM_003848	104	0.00	0	C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	ENST00000307227.5	37	CCDS43104.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280911	0.80692	.	.	ENSG00000172340	ENST00000307227;ENST00000541608	T	0.79749	-1.3	5.38	5.38	0.77491	Succinyl-CoA synthetase-like (2);ATP-citrate lyase/succinyl-CoA ligase (1);	0.000000	0.85682	D	0.000000	D	0.90086	0.6903	M	0.82923	2.615	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.955;0.982	D	0.91217	0.5003	10	0.87932	D	0	.	16.4035	0.83650	0.0:0.0:1.0:0.0	.	239;421	F5H4S7;Q96I99	.;SUCB2_HUMAN	V	421;239	ENSP00000307432:A421V	ENSP00000307432:A421V	A	-	2	0	SUCLG2	67508895	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.492000	0.90471	2.676000	0.91093	0.563000	0.77884	GCA			0.498	SUCLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351993.1		NM_003848	
PLXND1	23129	mdanderson.org	37	3	129277296	129277296	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr3:129277296G>T	ENST00000324093.4	-	33	5598	c.5420C>A	c.(5419-5421)tCc>tAc	p.S1807Y	PLXND1_ENST00000393239.1_3'UTR|PLXND1_ENST00000504689.1_5'Flank	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1807					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GTCAGAGATGGAGCAGGCGTC	0.602																																					p.S1807Y	Ovarian(97;366 1484 3738 22084 39045)												.	.			0			c.C5420A												56.0	56.0	56.0					3																	129277296		2203	4300	6503	SO:0001583	missense	23129	exon33			GAGATGGAGCAGG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5420C>A	3.37:g.129277296G>T	ENSP00000317128:p.Ser1807Tyr		67	0	0		37	0.08	3	NM_015103	315	0.00	0	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	G	31	5.082219	0.94050	.	.	ENSG00000004399	ENST00000324093	T	0.20881	2.04	4.68	4.68	0.58851	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.129222	0.52532	D	0.000064	T	0.52853	0.1760	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.995;0.999	T	0.63462	-0.6632	10	0.87932	D	0	.	16.6036	0.84822	0.0:0.0:1.0:0.0	.	403;1807	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	Y	1807	ENSP00000317128:S1807Y	ENSP00000317128:S1807Y	S	-	2	0	PLXND1	130759986	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.641000	0.98458	2.138000	0.66242	0.561000	0.74099	TCC			0.602	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356132.4		NM_015103	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599320	55599320	+	Missense_Mutation	SNP	G	G	T	rs121913506		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr4:55599320G>T	ENST00000288135.5	+	17	2543	c.2446G>T	c.(2446-2448)Gac>Tac	p.D816Y		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816Y(46)|p.D816H(42)|p.D816F(6)|p.D816I(2)|p.D816N(1)|p.R815_D816insVI(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTAGCCAGAGACATCAAGAA	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816Y			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,932	KIT	0	932	98	Substitution - Missense(97)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(68)|testis(15)|ovary(10)|soft_tissue(3)|genital_tract(1)|skin(1)	c.G2446T												144.0	146.0	145.0					4																	55599320		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GCCAGAGACATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2446G>T	4.37:g.55599320G>T	ENSP00000288135:p.Asp816Tyr		82	0	0		45	0.24	11	NM_000222	369	0.31	114	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976091	0.92982	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83755	-1.76;-1.76	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.87869	0.6286	L	0.39692	1.235	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.65684	0.937;0.919	D	0.88642	0.3176	10	0.87932	D	0	.	19.6484	0.95791	0.0:0.0:1.0:0.0	.	812;816	P10721-2;P10721	.;KIT_HUMAN	Y	816;812	ENSP00000288135:D816Y;ENSP00000390987:D812Y	ENSP00000288135:D816Y	D	+	1	0	KIT	55294077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.659000	0.90383	0.585000	0.79938	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
NUP155	9631	mdanderson.org	37	5	37309257	37309257	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr5:37309257G>T	ENST00000231498.3	-	24	2944	c.2741C>A	c.(2740-2742)tCc>tAc	p.S914Y	NUP155_ENST00000513532.1_Missense_Mutation_p.S850Y|NUP155_ENST00000381843.2_Missense_Mutation_p.S855Y|NUP155_ENST00000502533.1_5'UTR	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	914					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACAAACATTGGAAAGGTCCAC	0.333																																					p.S914Y													.	.			0			c.C2741A												157.0	152.0	153.0					5																	37309257		2203	4300	6503	SO:0001583	missense	9631	exon24			ACATTGGAAAGGT	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.2741C>A	5.37:g.37309257G>T	ENSP00000231498:p.Ser914Tyr		157	0	0		122	0.04	5	NM_153485	53	0.00	0	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	37	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579711	0.46006	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.78364	-1.17;-1.17;-1.15	5.71	4.81	0.61882	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.378987	0.33180	N	0.005194	T	0.73233	0.3561	N	0.24115	0.695	0.24000	N	0.99622	B;B	0.33044	0.395;0.263	B;B	0.42495	0.287;0.389	T	0.69884	-0.5024	10	0.56958	D	0.05	-1.6006	16.7636	0.85519	0.0:0.1285:0.8715:0.0	.	850;914	E9PF10;O75694	.;NU155_HUMAN	Y	914;855;876;850	ENSP00000231498:S914Y;ENSP00000371265:S855Y;ENSP00000422019:S850Y	ENSP00000231498:S914Y	S	-	2	0	NUP155	37345014	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.487000	0.81328	2.712000	0.92718	0.650000	0.86243	TCC			0.333	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207593.2		NM_153485, NM_004298	
RIOK2	55781	broad.mit.edu	37	5	96504548	96504548	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr5:96504548T>C	ENST00000283109.3	-	7	856	c.788A>G	c.(787-789)gAc>gGc	p.D263G	CTD-2215E18.1_ENST00000509481.1_Intron|RIOK2_ENST00000508447.1_Missense_Mutation_p.D263G	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	263							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		AACATCTCTGTCAAAATACCT	0.313																																					p.D263G													.	RIOK2	82		0			c.A788G												70.0	78.0	76.0					5																	96504548		2203	4296	6499	SO:0001583	missense	55781	exon7			TCTCTGTCAAAAT	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.788A>G	5.37:g.96504548T>C	ENSP00000283109:p.Asp263Gly		173	0	0		134	0.03	4	NM_001159749	50	0.00	0	D6RDI3|Q9NUT0	Missense_Mutation	SNP	ENST00000283109.3	37	CCDS4089.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.821857	0.90873	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.06687	3.27;3.27	5.81	5.81	0.92471	Protein kinase-like domain (1);RIO-like kinase (1);	0.085230	0.85682	D	0.000000	T	0.29093	0.0723	M	0.82716	2.605	0.80722	D	1	D;D	0.59767	0.986;0.958	P;P	0.59012	0.85;0.833	T	0.03945	-1.0990	10	0.87932	D	0	-14.6681	15.8292	0.78739	0.0:0.0:0.0:1.0	.	263;263	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	G	263	ENSP00000283109:D263G;ENSP00000420932:D263G	ENSP00000283109:D263G	D	-	2	0	RIOK2	96530304	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.686000	0.84128	2.218000	0.71995	0.528000	0.53228	GAC			0.313	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250628.1		NM_018343	
WRNIP1	56897	broad.mit.edu	37	6	2766364	2766375	+	In_Frame_Del	DEL	GGCGACGGCGAT	GGCGACGGCGAT	-	rs535821800	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	GGCGACGGCGAT	GGCGACGGCGAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr6:2766364_2766375delGGCGACGGCGAT	ENST00000380773.4	+	1	717_728	c.508_519delGGCGACGGCGAT	c.(508-519)ggcgacggcgatdel	p.GDGD174del	WRNIP1_ENST00000380764.1_5'Flank|WRNIP1_ENST00000380771.4_In_Frame_Del_p.GDGD174del|WRNIP1_ENST00000380769.4_5'UTR	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1											breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				ggaggccgtgggcgacggcgatggcgacgggg	0.802														90	0.0179712	0.003	0.0461	5008	,	,		10142	0.0		0.0457	False		,,,				2504	0.0082				p.170_173del													.	WRNIP1	39		0			c.508_519del								,	8,1784		3,2,891					,	1.6	0.4			2	63,3291		23,17,1637	no	coding,coding	WRNIP1	NM_130395.1,NM_020135.2	,	26,19,2528	A1A1,A1R,RR		1.8784,0.4464,1.3797	,	,		71,5075				SO:0001651	inframe_deletion	56897	exon1			GCCGTGGGCGACG	AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.508_519delGGCGACGGCGAT	6.37:g.2766364_2766375delGGCGACGGCGAT	ENSP00000370150:p.Gly174_Asp177del		10	0	0		6	0.50	3	NM_130395	4	0.00	0		In_Frame_Del	DEL	ENST00000380773.4	37	CCDS4475.1																																																																																					0.802	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039641.1		NM_130395	
UBD	10537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29523770	29523770	+	Missense_Mutation	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr6:29523770T>C	ENST00000377050.4	-	2	608	c.385A>G	c.(385-387)Acc>Gcc	p.T129A	GABBR1_ENST00000355973.3_3'UTR	NM_006398.3	NP_006389.2	O15205	UBD_HUMAN	ubiquitin D	129	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				aggresome assembly (GO:0070842)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein modification by small protein conjugation (GO:0032446)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to organonitrogen compound (GO:0010243)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	proteasome binding (GO:0070628)			kidney(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						ACAATCTGGGTCTCAGGGATT	0.493																																					p.T129A													.	.			0			c.A385G												172.0	141.0	152.0					6																	29523770		1511	2709	4220	SO:0001583	missense	10537	exon2			TCTGGGTCTCAGG	Y12653	CCDS4662.1	6p21.3	2008-04-11			ENSG00000213886	ENSG00000213886			18795	protein-coding gene	gene with protein product		606050				9368598, 8662070	Standard	NM_006398		Approved	FAT10	uc003nmo.3	O15205	OTTHUMG00000031289	ENST00000377050.4:c.385A>G	6.37:g.29523770T>C	ENSP00000366249:p.Thr129Ala		257	0	0		301	0.15	44	NM_006398	918	0.00	4	B0UZT6|Q5STL2|Q5SUK2|Q96EC7	Missense_Mutation	SNP	ENST00000377050.4	37	CCDS4662.1	.	.	.	.	.	.	.	.	.	.	T	6.597	0.478563	0.12521	.	.	ENSG00000213886	ENST00000377050	T	0.72835	-0.69	5.12	-3.92	0.04155	Ubiquitin supergroup (1);Ubiquitin (2);	2.284950	0.02602	U	0.101120	T	0.17534	0.0421	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.15578	-1.0432	10	0.72032	D	0.01	-0.1806	0.49	0.00562	0.3028:0.2958:0.1554:0.246	.	129	O15205	UBD_HUMAN	A	129	ENSP00000366249:T129A	ENSP00000366249:T129A	T	-	1	0	UBD	29631749	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-1.517000	0.02248	-0.286000	0.09076	0.496000	0.49642	ACC			0.493	UBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076628.3			
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152702176	152702176	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr6:152702176C>T	ENST00000367255.5	-	56	9575	c.8974G>A	c.(8974-8976)Gat>Aat	p.D2992N	SYNE1_ENST00000423061.1_Missense_Mutation_p.D2999N|SYNE1_ENST00000341594.5_Missense_Mutation_p.D3031N|SYNE1_ENST00000265368.4_Missense_Mutation_p.D2992N|SYNE1_ENST00000448038.1_Missense_Mutation_p.D2999N|SYNE1-AS1_ENST00000412161.1_RNA	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2992					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATCTCCTCATCCGTGTTCTTG	0.473										HNSCC(10;0.0054)																											p.D2999N													.	.			0			c.G8995A												145.0	147.0	146.0					6																	152702176		2203	4300	6503	SO:0001583	missense	23345	exon56			CCTCATCCGTGTT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8974G>A	6.37:g.152702176C>T	ENSP00000356224:p.Asp2992Asn		121	0	0		150	0.11	17	NM_033071	3	0.00	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	36	5.711328	0.96821	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.54866	0.64;0.67;0.55;0.67;0.71	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000004	T	0.61739	0.2371	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.972;0.965;0.972;0.991	D;P;P;P;P	0.64144	0.922;0.632;0.629;0.632;0.798	T	0.50415	-0.8831	10	0.21014	T	0.42	.	20.5211	0.99222	0.0:1.0:0.0:0.0	.	2975;2992;109;2992;2999	B3W695;Q8NF91;B7ZBC4;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	N	2992;2999;2992;2999;3031	ENSP00000356224:D2992N;ENSP00000396024:D2999N;ENSP00000265368:D2992N;ENSP00000390975:D2999N;ENSP00000341887:D3031N	ENSP00000265368:D2992N	D	-	1	0	SYNE1	152743869	0.999000	0.42202	0.687000	0.30102	0.987000	0.75469	4.580000	0.60942	2.861000	0.98227	0.650000	0.86243	GAT			0.473	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000334755.2		NM_182961	
ZAN	7455	broad.mit.edu	37	7	100365263	100365263	+	RNA	DEL	A	A	-	rs200259720	byFrequency	TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr7:100365263delA	ENST00000348028.3	+	0	5025				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ctgcacggctaattttttttt	0.532													?|AA|A|unsure	148	0.0295527	0.0038	0.036	5008	,	,		17576	0.001		0.0527	False		,,,				2504	0.0654				.													.	ZAN	658		0			.																																											7455	.			ACGGCTAATTTTT	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100365263delA			7	0	0		8	0.88	7	.	0		0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	DEL	ENST00000348028.3	37																																																																																						0.532	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene		OTTHUMT00000347214.1		NM_003386	
PPP1R3A	5506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	113518539	113518539	+	Missense_Mutation	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr7:113518539G>A	ENST00000284601.3	-	4	2676	c.2608C>T	c.(2608-2610)Cca>Tca	p.P870S		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	870					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTGTCTGTTGGTAACATTCCC	0.363																																					p.P870S													.	.			0			c.C2608T												129.0	123.0	125.0					7																	113518539		2203	4300	6503	SO:0001583	missense	5506	exon4			CTGTTGGTAACAT	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2608C>T	7.37:g.113518539G>A	ENSP00000284601:p.Pro870Ser		86	0	0		110	0.09	10	NM_002711	1	0.00	0	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.689487	0.00738	.	.	ENSG00000154415	ENST00000284601	T	0.17213	2.29	5.81	3.49	0.39957	.	0.347262	0.25344	N	0.031354	T	0.11879	0.0289	L	0.41824	1.3	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.37244	-0.9714	10	0.13108	T	0.6	-7.1547	7.1923	0.25832	0.1222:0.1533:0.7246:0.0	.	870	Q16821	PPR3A_HUMAN	S	870	ENSP00000284601:P870S	ENSP00000284601:P870S	P	-	1	0	PPP1R3A	113305775	0.070000	0.21116	0.365000	0.25901	0.006000	0.05464	0.646000	0.24797	0.449000	0.26747	0.650000	0.86243	CCA			0.363	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346724.1		NM_002711	
DLC1	10395	broad.mit.edu	37	8	12957624	12957624	+	Missense_Mutation	SNP	C	C	G			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr8:12957624C>G	ENST00000276297.4	-	9	2631	c.2222G>C	c.(2221-2223)aGc>aCc	p.S741T	DLC1_ENST00000520226.1_Missense_Mutation_p.S230T|DLC1_ENST00000358919.2_Missense_Mutation_p.S304T|DLC1_ENST00000512044.2_Missense_Mutation_p.S338T	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	741	Focal adhesion-targeting (FAT).|Poly-Ser.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GCTGCTGCTGCTGGTCTGCGT	0.627																																					p.S741T													DLC1,bladder,carcinoma,0,3	DLC1	411	3	0			c.G2222C												56.0	47.0	50.0					8																	12957624		2203	4300	6503	SO:0001583	missense	10395	exon9			CTGCTGCTGGTCT	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.2222G>C	8.37:g.12957624C>G	ENSP00000276297:p.Ser741Thr		66	0	0		59	0.05	3	NM_182643	29	0.00	0	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	ENST00000276297.4	37	CCDS5989.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320479	0.81469	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000512044;ENST00000520226	T;T;T;T	0.07688	3.42;3.19;3.19;3.17	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	M	0.80422	2.495	0.80722	D	1	D;B;D	0.65815	0.995;0.103;0.99	P;B;D	0.72982	0.795;0.132;0.979	T	0.09975	-1.0650	10	0.66056	D	0.02	.	17.9274	0.88987	0.0:1.0:0.0:0.0	.	741;338;304	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	T	741;304;338;230	ENSP00000276297:S741T;ENSP00000351797:S304T;ENSP00000422595:S338T;ENSP00000428028:S230T	ENSP00000276297:S741T	S	-	2	0	DLC1	13001995	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.462000	0.80851	2.527000	0.85204	0.561000	0.74099	AGC			0.627	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000207632.2		NM_182643, NM_006094	
PLEC	5339	mdanderson.org	37	8	144992458	144992458	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr8:144992458C>T	ENST00000322810.4	-	32	12111	c.11942G>A	c.(11941-11943)cGc>cAc	p.R3981H	PLEC_ENST00000356346.3_Missense_Mutation_p.R3830H|PLEC_ENST00000398774.2_Missense_Mutation_p.R3812H|PLEC_ENST00000527096.1_Missense_Mutation_p.R3867H|PLEC_ENST00000354589.3_Missense_Mutation_p.R3844H|PLEC_ENST00000345136.3_Missense_Mutation_p.R3844H|PLEC_ENST00000357649.2_Missense_Mutation_p.R3848H|PLEC_ENST00000436759.2_Missense_Mutation_p.R3871H|PLEC_ENST00000354958.2_Missense_Mutation_p.R3822H	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3981	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CACGTAGCTGCGCACCTCGCT	0.682																																					p.R3981H													.	.			0			c.G11942A												18.0	25.0	22.0					8																	144992458		2051	4183	6234	SO:0001583	missense	5339	exon32			TAGCTGCGCACCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11942G>A	8.37:g.144992458C>T	ENSP00000323856:p.Arg3981His		8	0	0		10	0.20	2	NM_201380	381	0.22	84	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337799	0.24253	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	3.67	3.67	0.42095	.	0.373188	0.20642	U	0.088396	T	0.69424	0.3109	L	0.46157	1.445	0.32885	D	0.511013	D;D;D;D;D;D;D;D	0.63880	0.993;0.993;0.993;0.988;0.993;0.993;0.993;0.993	P;P;P;P;P;P;P;P	0.52823	0.71;0.71;0.71;0.517;0.71;0.71;0.71;0.71	T	0.79198	-0.1902	10	0.72032	D	0.01	.	14.6511	0.68797	0.0:1.0:0.0:0.0	.	3871;3830;3822;3981;3812;3844;3848;3844	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	H	3844;3848;3844;3812;3981;3822;3830;3871;3867	ENSP00000344848:R3844H;ENSP00000350277:R3848H;ENSP00000346602:R3844H;ENSP00000381756:R3812H;ENSP00000323856:R3981H;ENSP00000347044:R3822H;ENSP00000348702:R3830H;ENSP00000388180:R3871H;ENSP00000434583:R3867H	ENSP00000323856:R3981H	R	-	2	0	PLEC	145064446	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.620000	0.46410	2.050000	0.60909	0.448000	0.29417	CGC			0.682	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
OPLAH	26873	mdanderson.org	37	8	145108284	145108284	+	Missense_Mutation	SNP	G	G	T	rs186909122		TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr8:145108284G>T	ENST00000426825.1	-	20	2780	c.2699C>A	c.(2698-2700)gCc>gAc	p.A900D	OPLAH_ENST00000534424.1_5'UTR|CTD-3065J16.6_ENST00000528912.1_RNA|CTD-3065J16.6_ENST00000561181.1_RNA	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	900					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCGCAGGGCCTCCGTCAC	0.647																																					p.A900D													.	.			0			c.C2699A												44.0	52.0	50.0					8																	145108284		2081	4210	6291	SO:0001583	missense	26873	exon20			CGCAGGGCCTCCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.2699C>A	8.37:g.145108284G>T	ENSP00000475943:p.Ala900Asp		64	0.015625	1		30	0.13	4	NM_017570	1	0.00	0	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	37		.	.	.	.	.	.	.	.	.	.	G	14.54	2.564475	0.45694	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.56	3.44	0.39384	.	0.106428	0.64402	D	0.000007	T	0.48132	0.1483	.	.	.	0.52099	D	0.999941	B	0.18863	0.031	B	0.25405	0.06	T	0.61317	-0.7087	7	0.62326	D	0.03	.	10.7882	0.46417	0.1156:0.0:0.8844:0.0	.	900	O14841	OPLA_HUMAN	D	900	.	ENSP00000412071:A900D	A	-	2	0	OPLAH	145180272	1.000000	0.71417	0.999000	0.59377	0.867000	0.49689	3.294000	0.51787	2.069000	0.61940	0.448000	0.29417	GCC			0.647	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_017570	
NDUFB6	4712	mdanderson.org	37	9	32558939	32558939	+	Missense_Mutation	SNP	C	C	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr9:32558939C>T	ENST00000379847.3	-	3	388	c.287G>A	c.(286-288)gGc>gAc	p.G96D	TOPORS-AS1_ENST00000425533.1_RNA|NDUFB6_ENST00000350021.2_Intron|TOPORS-AS1_ENST00000458036.1_RNA	NM_002493.4	NP_002484.1	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa	96					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|urinary_tract(1)	8			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)		TTCAACTATGCCATATGGTTT	0.308																																					p.G96D													.	.			0			c.G287A												193.0	202.0	199.0					9																	32558939		2203	4300	6503	SO:0001583	missense	4712	exon3			ACTATGCCATATG	AF035840	CCDS6528.1, CCDS6529.1, CCDS75826.1	9p13.2	2011-07-04	2002-08-29		ENSG00000165264	ENSG00000165264		"""Mitochondrial respiratory chain complex / Complex I"""	7701	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase beta subunit, 6"", ""NADH-ubiquinone oxidoreductase B17 subunit"", ""complex I, mitochondrial respiratory chain, B17 subunit"""	603322	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (17kD, B17)"""			9763677, 9760212	Standard	NM_002493		Approved	B17, CI	uc003zre.2	O95139	OTTHUMG00000019741	ENST00000379847.3:c.287G>A	9.37:g.32558939C>T	ENSP00000369176:p.Gly96Asp		61	0	0		45	0.07	3	NM_002493	149	0.00	0	A8K0Y7|Q5VYT2|Q6IB84	Missense_Mutation	SNP	ENST00000379847.3	37	CCDS6528.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.775400	0.31411	.	.	ENSG00000165264	ENST00000379847	.	.	.	5.58	1.27	0.21489	.	0.720818	0.13555	N	0.379193	T	0.64702	0.2622	L	0.52573	1.65	0.80722	D	1	D	0.54772	0.968	P	0.55303	0.773	T	0.66148	-0.5996	9	0.52906	T	0.07	-22.9869	15.5088	0.75764	0.0:0.685:0.315:0.0	.	96	O95139	NDUB6_HUMAN	D	96	.	ENSP00000369176:G96D	G	-	2	0	NDUFB6	32548939	0.346000	0.24844	0.970000	0.41538	0.127000	0.20565	-0.421000	0.07053	0.252000	0.21531	-0.256000	0.11100	GGC			0.308	NDUFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052001.1		NM_002493	
PHF19	26147	mdanderson.org	37	9	123631480	123631480	+	Silent	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr9:123631480G>A	ENST00000373896.3	-	6	846	c.594C>T	c.(592-594)tgC>tgT	p.C198C	PHF19_ENST00000487555.1_5'Flank|PHF19_ENST00000419155.1_5'Flank	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19	198					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CGCCGCAGTAGCAGTAGCATT	0.682																																					p.C198C													.	.			0			c.C594T												23.0	20.0	21.0					9																	123631480		2203	4300	6503	SO:0001819	synonymous_variant	26147	exon6			GCAGTAGCAGTAG	BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.594C>T	9.37:g.123631480G>A			80	0	0		47	0.06	3	NM_015651	21	0.00	0	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Silent	SNP	ENST00000373896.3	37	CCDS35116.1																																																																																					0.682	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053838.3		XM_045308	
SLC2A6	11182	mdanderson.org	37	9	136342253	136342253	+	Silent	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr9:136342253G>T	ENST00000371899.4	-	3	443	c.366C>A	c.(364-366)ggC>ggA	p.G122G	SLC2A6_ENST00000485978.1_5'UTR|SLC2A6_ENST00000371897.4_Silent_p.G122G	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	122					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		TGAGCGCATAGCCGGCCGCCG	0.682																																					p.G122G													.	.			0			c.C366A												14.0	14.0	14.0					9																	136342253		1928	3706	5634	SO:0001819	synonymous_variant	11182	exon3			CGCATAGCCGGCC	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.366C>A	9.37:g.136342253G>T			63	0	0		53	0.06	3	NM_017585	21	0.00	0	A6NNU6|Q5SXD7|Q8NCC2	Silent	SNP	ENST00000371899.4	37	CCDS6975.1																																																																																					0.682	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054909.1		NM_017585	
MT-ND1	4535	hgsc.bcm.edu	37	M	1016	1016	+	5'Flank	SNP	T	T	C			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chrM:1016T>C	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTTGACACAAAATAGACTACG	0.418																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	6052	.			ACAAAATAGACTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1016T>C	Exception_encountered		88	0	0		25	0.60	15	.	0		0	C0JKH6|Q37523	RNA	SNP	ENST00000361390.2	37																																																																																						0.418	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024026	
MT-ND6	4541	hgsc.bcm.edu	37	M	15986	15986	+	5'Flank	SNP	G	G	A			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chrM:15986G>A	ENST00000361681.2	-	0	0				MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6						cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CTCCACCATTAGCACCCAAAG	0.403																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			CCATTAGCACCCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923			M.37:g.15986G>A	Exception_encountered		40	0	0		11	0.82	9	.	0		0	Q34774|Q8HG30	RNA	SNP	ENST00000361681.2	37																																																																																						0.403	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024037	
CLDN2	9075	mdanderson.org	37	X	106172012	106172012	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chrX:106172012G>T	ENST00000541806.1	+	2	1073	c.554G>T	c.(553-555)tGc>tTc	p.C185F	CLDN2_ENST00000336803.1_Missense_Mutation_p.C185F|CLDN2_ENST00000540876.1_Missense_Mutation_p.C185F	NM_001171092.1	NP_001164563.1	P57739	CLD2_HUMAN	claudin 2	185					calcium-independent cell-cell adhesion (GO:0016338)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	9						TGCTTTTCCTGCTCATCCCAG	0.498																																					p.C185F													.	.			0			c.G554T												139.0	134.0	136.0					X																	106172012		2203	4300	6503	SO:0001583	missense	9075	exon2			TTTCCTGCTCATC	AK075405	CCDS14524.1	Xq22.3-q23	2008-05-14			ENSG00000165376	ENSG00000165376		"""Claudins"""	2041	protein-coding gene	gene with protein product		300520				9892664	Standard	NM_020384		Approved		uc022ccc.1	P57739	OTTHUMG00000022154	ENST00000541806.1:c.554G>T	X.37:g.106172012G>T	ENSP00000441283:p.Cys185Phe		35	0	0		39	0.08	3	NM_001171092	0		0	B2R6B9	Missense_Mutation	SNP	ENST00000541806.1	37	CCDS14524.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535758	0.45176	.	.	ENSG00000165376	ENST00000541806;ENST00000540876;ENST00000336803	D;D;D	0.88354	-2.37;-2.37;-2.37	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.87763	0.6259	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.90320	0.4344	10	0.62326	D	0.03	.	14.4779	0.67559	0.0:0.0:1.0:0.0	.	185	P57739	CLD2_HUMAN	F	185	ENSP00000441283:C185F;ENSP00000443230:C185F;ENSP00000336571:C185F	ENSP00000336571:C185F	C	+	2	0	CLDN2	106058668	1.000000	0.71417	0.878000	0.34440	0.530000	0.34684	9.692000	0.98682	2.085000	0.62840	0.529000	0.55759	TGC			0.498	CLDN2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057815.1			
BAHCC1	57597	mdanderson.org	37	17	79408982	79408982	+	Missense_Mutation	SNP	G	G	T			TCGA-2X-A9D6-01A-11D-A435-10	TCGA-2X-A9D6-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	b979e342-5eb9-45ee-a81e-0e39fb7ad8d8	a1cea35c-93b2-46a3-88f0-2115e5c0e5ed	g.chr17:79408982G>T	ENST00000307745.7	+	9	607	c.607G>T	c.(607-609)Ggt>Tgt	p.G203C																								TCGAGACCGGGGTGAGGCAGG	0.711																																					.													.	.			0			.												26.0	32.0	30.0					17																	79408982		1957	4132	6089	SO:0001583	missense	57597	.			GACCGGGGTGAGG																												ENST00000307745.7:c.607G>T	17.37:g.79408982G>T	ENSP00000303486:p.Gly203Cys		142	0	0		74	0.07	5	.	17	0.00	0		Missense_Mutation	SNP	ENST00000307745.7	37		.	.	.	.	.	.	.	.	.	.	g	13.18	2.159052	0.38119	.	.	ENSG00000171282	ENST00000307745	T	0.20332	2.08	3.17	2.18	0.27775	.	.	.	.	.	T	0.20780	0.0500	L	0.43152	1.355	0.24863	N	0.992339	D	0.55172	0.97	P	0.47206	0.541	T	0.11203	-1.0597	9	0.87932	D	0	.	5.5857	0.17274	0.1575:0.0:0.8425:0.0	.	203	Q9P281	BAHC1_HUMAN	C	203	ENSP00000303486:G203C	ENSP00000303486:G203C	G	+	1	0	AC110285.1	77023577	1.000000	0.71417	0.526000	0.27913	0.446000	0.32137	4.655000	0.61476	0.881000	0.35993	0.298000	0.19748	GGT			0.711	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding					
