#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	mdanderson.org	37	1	6614471	6614471	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr1:6614471C>T	ENST00000377705.5	-	1	124	c.92G>A	c.(91-93)cGc>cAc	p.R31H	TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank|TAS1R1_ENST00000328191.4_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	31					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		gcggggccggcggcTGAGGAT	0.736																																					p.R31H													.	.			0			c.G92A												5.0	7.0	6.0					1																	6614471		1179	2721	3900	SO:0001583	missense	79707	exon1			GGCCGGCGGCTGA	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.92G>A	1.37:g.6614471C>T	ENSP00000366934:p.Arg31His		21	0	0		23	0.09	2	NM_024654	0		0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410995	0.25465	.	.	ENSG00000162408	ENST00000377705	T	0.21932	1.98	4.07	1.12	0.20585	.	0.148255	0.31784	N	0.007075	T	0.13030	0.0316	L	0.29908	0.895	0.09310	N	0.999992	B	0.15473	0.013	B	0.10450	0.005	T	0.18085	-1.0348	10	0.52906	T	0.07	-6.6929	6.2269	0.20714	0.0:0.6699:0.0:0.3301	.	31	Q5SY16	NOL9_HUMAN	H	31	ENSP00000366934:R31H	ENSP00000366934:R31H	R	-	2	0	NOL9	6537058	0.991000	0.36638	0.157000	0.22605	0.018000	0.09664	0.511000	0.22739	0.136000	0.18733	0.561000	0.74099	CGC			0.736	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000002625.1		NM_024654	
PADI6	353238	broad.mit.edu	37	1	17706676	17706676	+	RNA	DEL	G	G	-			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr1:17706676delG	ENST00000434762.2	+	0	485							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TTTCTTTTGTGGGGTATtttt	0.403																																					.													.	PADI6	51		0			.																																											353238	.			TTTTGTGGGGTAT	AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17706676delG			8	0	0		6	0.33	2	.	0		0	Q330K5|Q70SX3	RNA	DEL	ENST00000434762.2	37																																																																																						0.403	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000006804.4		NM_207421	
RLF	6018	mdanderson.org	37	1	40661433	40661433	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr1:40661433G>T	ENST00000372771.4	+	4	631	c.604G>T	c.(604-606)Gaa>Taa	p.E202*		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	202					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AGAAACGGAGGAAGGTAAGTC	0.348																																					p.E202X													.	.			0			c.G604T												67.0	70.0	69.0					1																	40661433		2203	4300	6503	SO:0001587	stop_gained	6018	exon4			ACGGAGGAAGGTA		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.604G>T	1.37:g.40661433G>T	ENSP00000361857:p.Glu202*		55	0	0		43	0.07	3	NM_012421	0		0	Q14CQ1|Q9NU60	Nonsense_Mutation	SNP	ENST00000372771.4	37	CCDS448.1	.	.	.	.	.	.	.	.	.	.	G	31	5.096152	0.94197	.	.	ENSG00000117000	ENST00000372771	.	.	.	5.1	5.1	0.69264	.	0.092728	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.157	18.5035	0.90890	0.0:0.0:1.0:0.0	.	.	.	.	X	202	.	ENSP00000361857:E202X	E	+	1	0	RLF	40434020	1.000000	0.71417	0.999000	0.59377	0.770000	0.43624	5.277000	0.65586	2.369000	0.80426	0.460000	0.39030	GAA			0.348	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000015767.1		NM_012421	
MROH7	374977	mdanderson.org	37	1	55134566	55134566	+	Silent	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr1:55134566C>T	ENST00000421030.2	+	5	1630	c.1345C>T	c.(1345-1347)Ctg>Ttg	p.L449L	MROH7_ENST00000454855.2_5'UTR|MROH7_ENST00000545244.1_Silent_p.L17L|MROH7_ENST00000339553.5_Silent_p.L449L|MROH7_ENST00000395690.2_Silent_p.L449L|MROH7_ENST00000409996.1_Silent_p.L17L|MROH7-TTC4_ENST00000414150.2_Silent_p.L449L	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	449						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CCAGGATCTGCTGGAGGCAGA	0.562																																					p.L449L													.	.			0			c.C1345T												93.0	90.0	91.0					1																	55134566		1896	4129	6025	SO:0001819	synonymous_variant	374977	exon5			GATCTGCTGGAGG	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.1345C>T	1.37:g.55134566C>T			44	0	0		51	0.06	3	NM_001039464	1	0.00	0	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	37	CCDS41342.2																																																																																					0.562	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346978.1		NM_198547	
KIF26B	55083	mdanderson.org	37	1	245861584	245861584	+	Nonsense_Mutation	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr1:245861584C>T	ENST00000407071.2	+	13	6441	c.6001C>T	c.(6001-6003)Cag>Tag	p.Q2001*	KIF26B_ENST00000366518.4_Nonsense_Mutation_p.Q1620*	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	2001					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GGAGCGCCTGCAGCGGCGACG	0.652																																					p.Q2001X													.	.			0			c.C6001T												25.0	29.0	28.0					1																	245861584		1976	4156	6132	SO:0001587	stop_gained	55083	exon13			CGCCTGCAGCGGC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.6001C>T	1.37:g.245861584C>T	ENSP00000385545:p.Gln2001*		29	0	0		37	0.08	3	NM_018012	0		0	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Nonsense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	49	15.932238	0.99849	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0543	0.93056	0.0:1.0:0.0:0.0	.	.	.	.	X	2001;1620;1617	.	ENSP00000355475:Q1620X	Q	+	1	0	KIF26B	243928207	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.387000	0.79785	2.496000	0.84212	0.655000	0.94253	CAG			0.652	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381037.1		XM_371354	
ZEB1	6935	mdanderson.org	37	10	31803542	31803542	+	Silent	SNP	G	G	T	rs149166539		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr10:31803542G>T	ENST00000320985.10	+	6	806	c.696G>T	c.(694-696)acG>acT	p.T232T	ZEB1_ENST00000446923.2_Silent_p.T216T|ZEB1_ENST00000361642.5_Silent_p.T233T|ZEB1_ENST00000542815.3_Silent_p.T165T|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000560721.2_Silent_p.T212T			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	232					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				GACATGTGACGCAGTCTGGGT	0.338																																					p.T233T	Ovarian(40;423 959 14296 36701 49589)												.	.			0			c.G699T												90.0	87.0	88.0					10																	31803542		2203	4299	6502	SO:0001819	synonymous_variant	6935	exon6			TGTGACGCAGTCT	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.696G>T	10.37:g.31803542G>T			52	0	0		49	0.06	3	NM_001174096	2	0.00	0	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Silent	SNP	ENST00000320985.10	37	CCDS7169.1																																																																																					0.338	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000419083.2		NM_030751	
ZNF33A	7581	mdanderson.org	37	10	38343734	38343734	+	Missense_Mutation	SNP	C	C	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr10:38343734C>A	ENST00000458705.2	+	5	837	c.679C>A	c.(679-681)Ctc>Atc	p.L227I	ZNF33A_ENST00000307441.9_Missense_Mutation_p.L227I|ZNF33A_ENST00000374618.3_Missense_Mutation_p.L228I|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000432900.2_Missense_Mutation_p.L234I			Q06730	ZN33A_HUMAN	zinc finger protein 33A	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TCAGGAAACCCTCCTTGAAAA	0.368																																					p.L228I													.	.			0			c.C682A												86.0	83.0	84.0					10																	38343734		2203	4299	6502	SO:0001583	missense	7581	exon5			GAAACCCTCCTTG	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.679C>A	10.37:g.38343734C>A	ENSP00000387713:p.Leu227Ile		62	0	0		46	0.07	3	NM_006954	7	0.00	0	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	C	7.391	0.630810	0.14322	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.06218	3.37;3.33;3.33;3.33	2.33	-0.394	0.12434	.	0.809444	0.10110	N	0.714793	T	0.04407	0.0121	N	0.24115	0.695	0.09310	N	1	B;B;B	0.16166	0.013;0.008;0.016	B;B;B	0.21151	0.033;0.006;0.017	T	0.42632	-0.9440	10	0.87932	D	0	.	3.5845	0.07966	0.0:0.146:0.2269:0.6271	.	234;227;228	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	I	228;234;227;227	ENSP00000363747:L228I;ENSP00000402467:L234I;ENSP00000387713:L227I;ENSP00000304268:L227I	ENSP00000304268:L227I	L	+	1	0	ZNF33A	38383740	0.057000	0.20700	0.086000	0.20670	0.014000	0.08584	1.071000	0.30666	-0.227000	0.09884	-1.396000	0.01147	CTC			0.368	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000047614.1		NM_006974	
FAM21EP	100421577	hgsc.bcm.edu	37	10	51823051	51823051	+	RNA	SNP	T	T	C	rs60451660	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr10:51823051T>C	ENST00000456967.1	-	0	1278					NR_038275.1																						TACCCCCCCCTACTCCCCGTC	0.547																																					.													.	.			0			.																																											0	.			CCCCCCTACTCCC																													10.37:g.51823051T>C			74	0	0		68	0.31	21	.	0		0		RNA	SNP	ENST00000456967.1	37																																																																																						0.547	RP11-324H6.5-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000048059.1			
PACSIN3	29763	mdanderson.org	37	11	47202203	47202203	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr11:47202203A>G	ENST00000539589.1	-	5	592	c.250T>C	c.(250-252)Ttt>Ctt	p.F84L	PACSIN3_ENST00000298838.6_Missense_Mutation_p.F84L	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	84	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						GCCGTGAAAAAGGCATGCCAG	0.682																																					p.F84L													.	.			0			c.T250C												22.0	24.0	24.0					11																	47202203		2200	4296	6496	SO:0001583	missense	29763	exon5			TGAAAAAGGCATG	AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.250T>C	11.37:g.47202203A>G	ENSP00000440945:p.Phe84Leu		18	0	0		16	0.13	2	NM_001184975	41	0.00	0	A6NH84|Q9H331|Q9NWV9	Missense_Mutation	SNP	ENST00000539589.1	37	CCDS31481.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.206559	0.39003	.	.	ENSG00000165912	ENST00000298838;ENST00000415232;ENST00000539589;ENST00000528462;ENST00000531226;ENST00000525725	T;T;T;T;T	0.13420	2.59;2.59;2.59;2.59;2.59	5.38	5.38	0.77491	Fps/Fes/Fer/CIP4 homology (2);	0.000000	0.85682	D	0.000000	T	0.22044	0.0531	N	0.26042	0.785	0.58432	D	0.999998	D	0.76494	0.999	D	0.80764	0.994	T	0.05649	-1.0872	10	0.09590	T	0.72	-17.7821	15.3959	0.74794	1.0:0.0:0.0:0.0	.	84	Q9UKS6	PACN3_HUMAN	L	84	ENSP00000298838:F84L;ENSP00000440945:F84L;ENSP00000437252:F84L;ENSP00000434699:F84L;ENSP00000435638:F84L	ENSP00000298838:F84L	F	-	1	0	PACSIN3	47158779	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	4.528000	0.60580	2.048000	0.60808	0.459000	0.35465	TTT			0.682	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391632.1		NM_016223	
OR4C3	256144	broad.mit.edu	37	11	48346502	48346502	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr11:48346502G>T	ENST00000319856.4	+	1	31	c.10G>T	c.(10-12)Gtt>Ttt	p.V4F		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						CATGCAATTAGTTCTATTACT	0.338																																					p.V4F													.	OR4C3	75		0			c.G10T												114.0	118.0	117.0					11																	48346502		2201	4298	6499	SO:0001583	missense	256144	exon1			CAATTAGTTCTAT	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.10G>T	11.37:g.48346502G>T	ENSP00000321419:p.Val4Phe		101	0	0		93	0.04	4	NM_001004702	0		0	B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567952	0.28003	.	.	ENSG00000176547	ENST00000319856	T	0.08634	3.07	4.04	-6.61	0.01818	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38265	-0.9669	6	0.66056	D	0.02	.	0.789	0.01054	0.4461:0.1281:0.169:0.2568	.	.	.	.	F	4	ENSP00000321419:V4F	ENSP00000321419:V4F	V	+	1	0	OR4C3	48303078	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-1.700000	0.01905	-1.112000	0.02984	-0.539000	0.04255	GTT			0.338	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390557.1		NM_001004702	
CD248	57124	mdanderson.org	37	11	66083957	66083957	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr11:66083957G>A	ENST00000311330.3	-	1	558	c.542C>T	c.(541-543)aCg>aTg	p.T181M	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	181	Sushi.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						GTGGAAGGGCGTGGTATACAC	0.677																																					p.T181M													.	.			0			c.C542T												13.0	16.0	15.0					11																	66083957		2184	4288	6472	SO:0001583	missense	57124	exon1			AAGGGCGTGGTAT	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.542C>T	11.37:g.66083957G>A	ENSP00000308117:p.Thr181Met		19	0	0		11	0.18	2	NM_020404	17	0.00	0	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769758	0.49680	.	.	ENSG00000174807	ENST00000311330	T	0.57273	0.41	4.19	4.19	0.49359	.	0.308092	0.30850	N	0.008755	T	0.66056	0.2751	M	0.72353	2.195	0.42382	D	0.992496	D	0.89917	1.0	D	0.69142	0.962	T	0.69131	-0.5226	10	0.72032	D	0.01	-9.053	7.7986	0.29162	0.1133:0.0:0.8867:0.0	.	181	Q9HCU0	CD248_HUMAN	M	181	ENSP00000308117:T181M	ENSP00000308117:T181M	T	-	2	0	CD248	65840533	1.000000	0.71417	0.989000	0.46669	0.311000	0.27955	6.631000	0.74277	2.171000	0.68590	0.561000	0.74099	ACG			0.677	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392922.2		NM_020404	
FAM86C2P	645332	broad.mit.edu	37	11	67560590	67560590	+	RNA	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr11:67560590C>T	ENST00000528089.1	-	0	1160							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		AAGTTTTATCCGCTTTCCCAT	0.413																																					.													.	.			0			.																																											0	.			TTTATCCGCTTTC			11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67560590C>T			98	0.0102040816	1		75	0.08	6	.	3	0.00	0		RNA	SNP	ENST00000528089.1	37																																																																																						0.413	FAM86C2P-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000393796.1			
HEPACAM	220296	mdanderson.org	37	11	124805885	124805885	+	Silent	SNP	T	T	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr11:124805885T>C	ENST00000298251.4	-	1	423	c.18A>G	c.(16-18)ggA>ggG	p.G6G		NM_152722.4	NP_689935.2			hepatic and glial cell adhesion molecule											breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		TGGACAGGGCTCCCCTTTCTC	0.547																																					p.G6G													.	.			0			c.A18G												69.0	67.0	67.0					11																	124805885		2201	4299	6500	SO:0001819	synonymous_variant	220296	exon1			CAGGGCTCCCCTT	AK098396	CCDS8456.1	11q24.2	2013-01-29	2011-02-11		ENSG00000165478	ENSG00000165478		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26361	protein-coding gene	gene with protein product	"""glial cell adhesion molecule"""	611642	"""hepatocyte cell adhesion molecule"""			15885354, 15917256	Standard	NM_152722		Approved	FLJ25530, hepaCAM, GLIALCAM	uc001qbk.3	Q14CZ8	OTTHUMG00000165938	ENST00000298251.4:c.18A>G	11.37:g.124805885T>C			81	0	0		52	0.06	3	NM_152722	0		0		Silent	SNP	ENST00000298251.4	37	CCDS8456.1																																																																																					0.547	HEPACAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387125.1		NM_152722	
NCAPD3	23310	bcgsc.ca	37	11	134027845	134027845	+	Silent	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr11:134027845G>A	ENST00000534548.2	-	31	4216	c.4152C>T	c.(4150-4152)agC>agT	p.S1384S		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1384					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TTTTTTCTGGGCTTCCAGAAT	0.448																																					p.S1384S													.	NCAPD3	141		0			c.C4152T												209.0	214.0	212.0					11																	134027845		2201	4297	6498	SO:0001819	synonymous_variant	23310	exon31			TTCTGGGCTTCCA	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.4152C>T	11.37:g.134027845G>A			74	0	0		45	0.09	4	NM_015261	28	0.00	0	A6NFS2|Q4KMQ9	Silent	SNP	ENST00000534548.2	37	CCDS31723.1																																																																																					0.448	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393575.2		NM_015261	
FGF6	2251	mdanderson.org	37	12	4554548	4554548	+	Silent	SNP	G	G	T	rs7358740	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr12:4554548G>T	ENST00000228837.2	-	1	232	c.189C>A	c.(187-189)gcC>gcA	p.A63A		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	63			A -> V (in dbSNP:rs17183529). {ECO:0000269|Ref.2}.		angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CAGCTAGCCCGGCGCGAGACC	0.647																																					p.A63A													FGF6,colon,carcinoma,-2,2	FGF6	-2	2	0			c.C189A												89.0	83.0	85.0					12																	4554548		2203	4300	6503	SO:0001819	synonymous_variant	2251	exon1			TAGCCCGGCGCGA	X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.189C>A	12.37:g.4554548G>T			46	0	0		67	0.04	3	NM_020996	0		0	Q0VAE1	Silent	SNP	ENST00000228837.2	37	CCDS8527.1																																																																																			0		0.647	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398939.1		NM_020996	
CLSTN3	9746	broad.mit.edu	37	12	7281645	7281674	+	5'Flank	DEL	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	-	rs148894272|rs6144602|rs552263970		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr12:7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	ENST00000266546.6	+	0	0				RBP5_ENST00000266560.3_5'Flank|RBP5_ENST00000542370.1_5'Flank|RP11-273B20.1_ENST00000538062.1_RNA|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTTGGCTTTTCCTGAGGAAGGAACCTGGAGCAGGATCCTTCCTGAGGA	0.57														5008	1.0	1.0	1.0	5008	,	,		18442	1.0		1.0	False		,,,				2504	1.0				.													.	RBP5	20		0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCTTTTCCTGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	Exception_encountered		6	0	0		13	0.31	4	.	6	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	ENST00000266546.6	37	CCDS8575.1																																																																																					0.570	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	G	rs121913527		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr12:25378562C>G	ENST00000256078.4	-	4	499	c.436G>C	c.(436-438)Gca>Cca	p.A146P	KRAS_ENST00000311936.3_Missense_Mutation_p.A146P|KRAS_ENST00000557334.1_Intron|AC087239.1_ENST00000594112.1_5'Flank	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146P	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,colon,carcinoma,+1,137	KRAS_ENST00000256078	1	137	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436C												207.0	188.0	195.0					12																	25378562		2203	4300	6503	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	TCTTTGCTGATGT	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>C	12.37:g.25378562C>G	ENSP00000256078:p.Ala146Pro		54	0.0185185185	1		118	0.08	9	NM_004985	34	0.09	3	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861547	0.91433	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88975	-2.45;-2.45	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	N	0.000000	D	0.97368	0.9139	H	0.99454	4.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98839	1.0754	10	0.87932	D	0	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	P	146	ENSP00000308495:A146P;ENSP00000256078:A146P	ENSP00000256078:A146P	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA			0.323	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
APAF1	317	broad.mit.edu	37	12	99052954	99052954	+	Silent	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr12:99052954A>G	ENST00000551964.1	+	5	1279	c.543A>G	c.(541-543)ggA>ggG	p.G181G	APAF1_ENST00000333991.1_Silent_p.G181G|APAF1_ENST00000357310.1_Silent_p.G181G|APAF1_ENST00000552268.1_Silent_p.G181G|APAF1_ENST00000339433.3_Silent_p.G181G|APAF1_ENST00000549007.1_Silent_p.G181G|APAF1_ENST00000547045.1_Silent_p.G181G|APAF1_ENST00000550527.1_Silent_p.G170G|APAF1_ENST00000359972.2_Silent_p.G170G	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	181	NB-ARC.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	TCCCAGGGGGAGTGCATTGGG	0.423																																					p.G181G													.	APAF1	111		0			c.A543G												122.0	125.0	124.0					12																	99052954		2203	4300	6503	SO:0001819	synonymous_variant	317	exon5			AGGGGGAGTGCAT	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.543A>G	12.37:g.99052954A>G			121	0	0		153	0.03	4	NM_181868	1	0.00	0	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Silent	SNP	ENST00000551964.1	37	CCDS9069.1																																																																																					0.423	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000408006.1		NM_181861.1	
PABPC3	5042	bcgsc.ca	37	13	25671027	25671027	+	Missense_Mutation	SNP	A	A	G	rs78826513	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr13:25671027A>G	ENST00000281589.3	+	1	728	c.691A>G	c.(691-693)Aaa>Gaa	p.K231E		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	231	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGGAAAATCCAAAGGATTTGG	0.418																																					p.K231E													.	PABPC3	129		0			c.A691G												81.0	76.0	78.0					13																	25671027		2203	4300	6503	SO:0001583	missense	5042	exon1			AAATCCAAAGGAT	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.691A>G	13.37:g.25671027A>G	ENSP00000281589:p.Lys231Glu		109	0.0091743119	1		74	0.12	9	NM_030979	29	0.00	0	Q8NHV0|Q9H086	Missense_Mutation	SNP	ENST00000281589.3	37	CCDS9311.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631048	0.46944	.	.	ENSG00000151846	ENST00000281589	T	0.08807	3.05	0.993	0.993	0.19825	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.49916	U	0.000136	T	0.27063	0.0663	M	0.90198	3.095	0.34162	D	0.668825	D	0.65815	0.995	D	0.67725	0.953	T	0.36553	-0.9743	10	0.87932	D	0	.	6.1165	0.20130	1.0:0.0:0.0:0.0	.	231	Q9H361	PABP3_HUMAN	E	231	ENSP00000281589:K231E	ENSP00000281589:K231E	K	+	1	0	PABPC3	24569027	0.998000	0.40836	0.994000	0.49952	0.967000	0.64934	2.374000	0.44274	0.692000	0.31613	0.374000	0.22700	AAA			0.418	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044220.2		NM_030979	
NKX2-1	7080	mdanderson.org	37	14	36988207	36988207	+	Missense_Mutation	SNP	T	T	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr14:36988207T>G	ENST00000518149.1	-	2	961	c.356A>C	c.(355-357)gAc>gCc	p.D119A	NKX2-1_ENST00000498187.2_Missense_Mutation_p.D119A|NKX2-1-AS1_ENST00000521292.2_RNA|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1_ENST00000522719.2_Missense_Mutation_p.D119A|NKX2-1_ENST00000354822.5_Missense_Mutation_p.D149A			P43699	NKX21_HUMAN	NK2 homeobox 1	119					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		GAAGCGCGGGTCTGGGTTGGC	0.706			A		NSCLC																																p.D149A				Dom	yes		14	14q13	7080	NK2 homeobox 1		E	.	.			0			c.A446C												6.0	9.0	8.0					14																	36988207		2016	4143	6159	SO:0001583	missense	7080	exon2			CGCGGGTCTGGGT		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.356A>C	14.37:g.36988207T>G	ENSP00000428341:p.Asp119Ala		13	0.2307692308	3		17	0.41	7	NM_001079668	0		0	D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Missense_Mutation	SNP	ENST00000518149.1	37	CCDS9659.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878332	0.72294	.	.	ENSG00000136352	ENST00000354822;ENST00000498187;ENST00000518149;ENST00000522719	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	D	0.84727	0.5536	M	0.89095	3.005	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.986	D	0.85629	0.1269	10	0.36615	T	0.2	.	13.3643	0.60674	0.0:0.0:0.0:1.0	.	149;119	P43699-3;P43699	.;NKX21_HUMAN	A	149;119;119;119	ENSP00000346879:D149A;ENSP00000429607:D119A;ENSP00000428341:D119A;ENSP00000429519:D119A	ENSP00000346879:D149A	D	-	2	0	NKX2-1	36057958	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.181000	0.77682	1.819000	0.53055	0.374000	0.22700	GAC			0.706	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376225.2		NM_003317	
INO80	54617	broad.mit.edu	37	15	41277616	41277616	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr15:41277616G>A	ENST00000361937.3	-	32	4265	c.3841C>T	c.(3841-3843)Cgg>Tgg	p.R1281W	INO80_ENST00000401393.3_Missense_Mutation_p.R1281W|INO80_ENST00000561244.1_5'UTR			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1281	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.R1281W(2)		NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TCTTCCTGCCGCAGCCTCACT	0.463																																					p.R1281W													INOC1,NS,carcinoma,0,2	INO80	122	2	2	Substitution - Missense(2)	endometrium(2)	c.C3841T												138.0	108.0	118.0					15																	41277616		2203	4300	6503	SO:0001583	missense	54617	exon32			CCTGCCGCAGCCT	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3841C>T	15.37:g.41277616G>A	ENSP00000355205:p.Arg1281Trp		139	0.0071942446	1		131	0.04	5	NM_017553	14	0.00	0	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	37	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767173	0.69878	.	.	ENSG00000128908	ENST00000263793;ENST00000361937;ENST00000401393	T;T	0.08193	3.12;3.12	4.79	4.79	0.61399	.	0.065211	0.64402	D	0.000008	T	0.18425	0.0442	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.00305	-1.1831	10	0.72032	D	0.01	.	12.6983	0.57016	0.0:0.0:0.8353:0.1647	.	1281	Q9ULG1	INO80_HUMAN	W	75;1281;1281	ENSP00000355205:R1281W;ENSP00000384686:R1281W	ENSP00000263793:R75W	R	-	1	2	INO80	39064908	1.000000	0.71417	0.971000	0.41717	0.749000	0.42624	3.469000	0.53093	2.492000	0.84095	0.563000	0.77884	CGG			0.463	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252527.2		NM_017553	
VPS13C	54832	hgsc.bcm.edu;mdanderson.org	37	15	62199517	62199517	+	Silent	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr15:62199517G>T	ENST00000261517.5	-	66	9124	c.9051C>A	c.(9049-9051)acC>acA	p.T3017T	VPS13C_ENST00000395896.4_Silent_p.T3017T|VPS13C_ENST00000249837.3_Silent_p.T2974T|VPS13C_ENST00000395898.3_Silent_p.T2974T	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TAAGTTTTCTGGTACCAGTAG	0.423																																					p.T3017T													VPS13C,NS,carcinoma,-1,1	VPS13C	-1	1	0			c.C9051A												185.0	165.0	171.0					15																	62199517		2203	4300	6503	SO:0001819	synonymous_variant	54832	exon66			TTTTCTGGTACCA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.9051C>A	15.37:g.62199517G>T			122	0	0		119	0.05	6	NM_020821	5	0.00	0		Silent	SNP	ENST00000261517.5	37	CCDS32257.1																																																																																					0.423	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000415997.1		NM_017684	
ZNF213	7760	mdanderson.org	37	16	3191015	3191015	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:3191015G>T	ENST00000396878.3	+	6	1522	c.1047G>T	c.(1045-1047)gaG>gaT	p.E349D	ZNF213_ENST00000576416.1_Missense_Mutation_p.E349D|ZNF213_ENST00000416391.2_Missense_Mutation_p.E191D|ZNF213_ENST00000574902.1_Missense_Mutation_p.E349D	NM_001134655.1|NM_004220.2	NP_001128127.1|NP_004211.1	O14771	ZN213_HUMAN	zinc finger protein 213	349					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	16						AGTGCCCTGAGTGCGACAAGA	0.672																																					p.E349D													.	.			0			c.G1047T												29.0	29.0	29.0					16																	3191015		2197	4300	6497	SO:0001583	missense	7760	exon6			CCCTGAGTGCGAC	AF017433	CCDS10495.1	16p13.3	2014-05-13	2007-02-20	2007-02-20	ENSG00000085644	ENSG00000085644		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13005	protein-coding gene	gene with protein product		608387				9653642, 10023065	Standard	NM_004220		Approved	CR53, ZKSCAN21, ZSCAN53	uc010uws.2	O14771	OTTHUMG00000177519	ENST00000396878.3:c.1047G>T	16.37:g.3191015G>T	ENSP00000380087:p.Glu349Asp		28	0	0		32	0.09	3	NM_001134655	1	0.00	0	A8K1B9|B4DMG6|Q96IS1	Missense_Mutation	SNP	ENST00000396878.3	37	CCDS10495.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816022	0.32145	.	.	ENSG00000085644	ENST00000396878;ENST00000416391	T;T	0.07567	3.18;3.18	4.81	-2.8	0.05823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000421	T	0.05547	0.0146	L	0.33245	0.995	0.28429	N	0.917379	B	0.12630	0.006	B	0.16722	0.016	T	0.20140	-1.0284	10	0.72032	D	0.01	.	6.7343	0.23401	0.4369:0.1241:0.4389:0.0	.	349	O14771	ZN213_HUMAN	D	349;191	ENSP00000380087:E349D;ENSP00000403892:E191D	ENSP00000380087:E349D	E	+	3	2	ZNF213	3131016	0.004000	0.15560	0.795000	0.32087	0.877000	0.50540	0.016000	0.13377	-0.370000	0.08016	-0.448000	0.05591	GAG			0.672	ZNF213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437334.1		NM_004220	
SNX29P2	440352	hgsc.bcm.edu	37	16	29375984	29375984	+	RNA	SNP	T	T	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:29375984T>C	ENST00000507381.1	+	0	743				SNX29P2_ENST00000398878.3_lincRNA			Q8IUI4	S29P2_HUMAN	sorting nexin 29 pseudogene 2																		ttcttttttttcttttttttt	0.343																																					.													.	.			0			.												16.0	16.0	16.0					16																	29375984		1895	4084	5979			440352	.			TTTTTTTCTTTTT	BX648280		16p11.2	2014-03-21	2011-08-16	2011-08-16	ENSG00000198106	ENSG00000198106			31914	pseudogene	pseudogene			"""RUN domain containing 2C"""	RUNDC2C			Standard	NR_002939		Approved		uc021tfw.1	Q8IUI4			16.37:g.29375984T>C			128	0	0		115	0.04	5	.	0		0		RNA	SNP	ENST00000507381.1	37																																																																																						0.343	SNX29P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000361855.1		NR_002939	
ITGAL	3683	mdanderson.org	37	16	30531261	30531261	+	Silent	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:30531261G>T	ENST00000356798.6	+	30	3492	c.3312G>T	c.(3310-3312)ctG>ctT	p.L1104L	ITGAL_ENST00000358164.5_Silent_p.L1020L|ITGAL_ENST00000433423.2_Silent_p.L338L	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	1104					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	TGCTGCTGCTGCTGCTCATTT	0.607																																					p.L1104L	NSCLC(110;1462 1641 3311 33990 49495)												.	.			0			c.G3312T												111.0	105.0	107.0					16																	30531261		2197	4300	6497	SO:0001819	synonymous_variant	3683	exon30			GCTGCTGCTGCTC		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.3312G>T	16.37:g.30531261G>T			29	0	0		24	0.13	3	NM_002209	15	0.00	0	O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	ENST00000356798.6	37	CCDS32433.1																																																																																					0.607	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434508.2			
TEPP	374739	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	58011892	58011892	+	Missense_Mutation	SNP	A	A	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:58011892A>C	ENST00000441824.2	+	2	374	c.337A>C	c.(337-339)Aag>Cag	p.K113Q	TEPP_ENST00000569996.1_Intron|TEPP_ENST00000290871.5_Missense_Mutation_p.K113Q	NM_199456.2	NP_955535.2	Q6URK8	TEPP_HUMAN	testis, prostate and placenta expressed	113						extracellular region (GO:0005576)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	8						GGACACCGTCAAGGCCTGCCT	0.632																																					p.K113Q													.	.			0			c.A337C												57.0	44.0	48.0					16																	58011892		2198	4300	6498	SO:0001583	missense	374739	exon2			ACCGTCAAGGCCT	BC104458	CCDS10790.1, CCDS45496.1	16q13	2009-04-20			ENSG00000159648	ENSG00000159648			33745	protein-coding gene	gene with protein product		610264				14652002	Standard	NM_199456		Approved		uc002emv.4	Q6URK8	OTTHUMG00000133463	ENST00000441824.2:c.337A>C	16.37:g.58011892A>C	ENSP00000401917:p.Lys113Gln		95	0	0		72	0.07	5	NM_199046	0		0	Q6URK7	Missense_Mutation	SNP	ENST00000441824.2	37	CCDS45496.1	.	.	.	.	.	.	.	.	.	.	A	10.46	1.357108	0.24598	.	.	ENSG00000159648	ENST00000290871;ENST00000441824	T;T	0.46819	0.86;0.87	4.36	4.36	0.52297	.	1.117080	0.06731	N	0.776588	T	0.44329	0.1288	M	0.63428	1.95	0.26406	N	0.976337	P;P	0.37276	0.589;0.589	B;B	0.33454	0.164;0.164	T	0.29941	-0.9995	10	0.18276	T	0.48	-15.5853	10.2416	0.43316	1.0:0.0:0.0:0.0	.	113;113	Q6URK8;Q6URK8-2	TEPP_HUMAN;.	Q	113	ENSP00000290871:K113Q;ENSP00000401917:K113Q	ENSP00000290871:K113Q	K	+	1	0	TEPP	56569393	0.004000	0.15560	0.944000	0.38274	0.854000	0.48673	1.114000	0.31196	1.724000	0.51502	0.346000	0.21813	AAG			0.632	TEPP-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000431966.1		NM_199456	
C16orf70	80262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67165195	67165195	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:67165195G>C	ENST00000219139.3	+	4	426	c.238G>C	c.(238-240)Gaa>Caa	p.E80Q	C16orf70_ENST00000569600.1_Missense_Mutation_p.E80Q|C16orf70_ENST00000569683.1_3'UTR	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	80										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		TTAGGTGATCGAAGTATGTGA	0.289																																					p.E80Q													.	.			0			c.G238C												86.0	82.0	83.0					16																	67165195		2198	4299	6497	SO:0001583	missense	80262	exon4			GTGATCGAAGTAT	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.238G>C	16.37:g.67165195G>C	ENSP00000219139:p.Glu80Gln		215	0	0		182	0.11	20	NM_025187	10	0.00	0	Q9HA86	Missense_Mutation	SNP	ENST00000219139.3	37	CCDS10828.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.868156	0.51588	.	.	ENSG00000125149	ENST00000219139	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.83207	0.5204	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.997;1.0	D	0.84704	0.0730	9	0.87932	D	0	-0.482	17.7204	0.88349	0.0:0.0:1.0:0.0	.	58;80	Q9BSU1-2;Q9BSU1	.;CP070_HUMAN	Q	80	.	ENSP00000219139:E80Q	E	+	1	0	C16orf70	65722696	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	8.055000	0.89453	2.769000	0.95229	0.655000	0.94253	GAA			0.289	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268829.2		NM_025187	
ST3GAL2	6483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70415679	70415679	+	Missense_Mutation	SNP	C	C	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:70415679C>G	ENST00000393640.4	-	6	3073	c.966G>C	c.(964-966)aaG>aaC	p.K322N	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.K322N			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	322					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				GCACGCCAGTCTTCCGGAACT	0.662																																					p.K322N													.	.			0			c.G966C												81.0	70.0	74.0					16																	70415679		2198	4300	6498	SO:0001583	missense	6483	exon7			GCCAGTCTTCCGG	U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.966G>C	16.37:g.70415679C>G	ENSP00000377257:p.Lys322Asn		126	0	0		141	0.16	23	NM_006927	26	0.19	5	O00654	Missense_Mutation	SNP	ENST00000393640.4	37	CCDS10890.1	.	.	.	.	.	.	.	.	.	.	c	19.36	3.813249	0.70912	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.31247	1.5;1.5	6.07	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	L	0.55990	1.75	0.58432	D	0.999999	D	0.53151	0.958	P	0.55011	0.766	T	0.15122	-1.0448	10	0.18276	T	0.48	-18.25	11.3972	0.49849	0.0:0.8628:0.0:0.1372	.	322	Q16842	SIA4B_HUMAN	N	322	ENSP00000345477:K322N;ENSP00000377257:K322N	ENSP00000345477:K322N	K	-	3	2	ST3GAL2	68973180	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.973000	0.49264	1.592000	0.50018	-0.235000	0.12190	AAG			0.662	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268968.1		NM_006927	
RP11-252A24.2	0	broad.mit.edu	37	16	74372644	74372644	+	RNA	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:74372644A>G	ENST00000429810.2	-	0	1552																											TACCCTTGTCAGGGGGAACAA	0.443																																					.													.	.			0			.																																											0	.			CTTGTCAGGGGGA																													16.37:g.74372644A>G			114	0	0		81	0.05	4	.	5	0.00	0		RNA	SNP	ENST00000429810.2	37																																																																																						0.443	RP11-252A24.2-003	KNOWN	basic	retained_intron	pseudogene		OTTHUMT00000434683.1			
CDYL2	124359	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	80718479	80718479	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr16:80718479C>T	ENST00000570137.2	-	2	727	c.572G>A	c.(571-573)gGt>gAt	p.G191D	CDYL2_ENST00000566173.1_Missense_Mutation_p.G191D|CDYL2_ENST00000563890.1_Missense_Mutation_p.G191D|CDYL2_ENST00000562753.1_5'Flank|CDYL2_ENST00000562812.1_Missense_Mutation_p.G191D	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	191						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						GTCACATTCACCCATATCTTG	0.527																																					p.G191D													.	.			0			c.G572A												141.0	118.0	126.0					16																	80718479		2203	4300	6503	SO:0001583	missense	124359	exon2			CATTCACCCATAT	AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.572G>A	16.37:g.80718479C>T	ENSP00000476295:p.Gly191Asp		121	0	0		115	0.06	7	NM_152342	1	0.00	0	Q7Z5I8	Missense_Mutation	SNP	ENST00000570137.2	37	CCDS32493.1	.	.	.	.	.	.	.	.	.	.	C	4.918	0.170578	0.09391	.	.	ENSG00000166446	ENST00000299564	T	0.57436	0.4	5.14	1.87	0.25490	.	0.689975	0.13789	N	0.362631	T	0.33585	0.0868	N	0.19112	0.55	0.09310	N	1	B	0.19935	0.04	B	0.22601	0.04	T	0.19128	-1.0315	10	0.31617	T	0.26	.	6.8926	0.24238	0.0:0.5323:0.3237:0.144	.	191	Q8N8U2	CDYL2_HUMAN	D	191	ENSP00000299564:G191D	ENSP00000299564:G191D	G	-	2	0	CDYL2	79275980	0.002000	0.14202	0.231000	0.23993	0.057000	0.15508	0.389000	0.20751	0.715000	0.32103	-0.282000	0.10007	GGT			0.527	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434727.2		NM_152342	
NLRP1	22861	mdanderson.org	37	17	5440172	5440172	+	Splice_Site	SNP	G	G	T	rs199748129		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:5440172G>T	ENST00000572272.1	-	8	2958	c.2959C>A	c.(2959-2961)Cgg>Agg	p.R987R	NLRP1_ENST00000269280.4_Splice_Site_p.R987R|NLRP1_ENST00000262467.5_Splice_Site_p.R987R|NLRP1_ENST00000345221.3_Splice_Site_p.R987R|NLRP1_ENST00000354411.3_Intron|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000577119.1_Intron			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	987					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.R987W(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CCCCCTTACCGTCTGCTGAAG	0.587																																					p.R987R													NLRP1,colon,carcinoma,0,1	NLRP1	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2959A												74.0	61.0	65.0					17																	5440172		2203	4300	6503	SO:0001630	splice_region_variant	22861	exon8			CTTACCGTCTGCT	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2960+1C>A	17.37:g.5440172G>T			67	0	0		38	0.08	3	NM_014922	2	0.00	0	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	ENST00000572272.1	37	CCDS42246.1																																																																																					0.587	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000439517.1		NM_033004	Silent
ALOX12B	242	mdanderson.org	37	17	7984268	7984268	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:7984268G>T	ENST00000319144.4	-	4	721	c.461C>A	c.(460-462)cCc>cAc	p.P154H	ALOX12B_ENST00000577351.1_5'Flank|AC129492.6_ENST00000399413.3_3'UTR	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	154	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CACATAGCTGGGCAGGCCAGG	0.642										Multiple Myeloma(8;0.094)																											p.P154H													.	.			0			c.C461A												72.0	68.0	69.0					17																	7984268		2203	4300	6503	SO:0001583	missense	242	exon4			TAGCTGGGCAGGC	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.461C>A	17.37:g.7984268G>T	ENSP00000315167:p.Pro154His		60	0	0		42	0.07	3	NM_001139	0		0		Missense_Mutation	SNP	ENST00000319144.4	37	CCDS11129.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211118	0.58343	.	.	ENSG00000179477	ENST00000319144	D	0.90385	-2.66	4.78	4.78	0.61160	Lipoxygenase, C-terminal (2);	0.097537	0.41938	D	0.000797	D	0.94185	0.8134	M	0.65498	2.005	0.38514	D	0.94855	D	0.89917	1.0	D	0.97110	1.0	D	0.95288	0.8392	10	0.87932	D	0	-26.3805	13.7238	0.62745	0.0:0.0:1.0:0.0	.	154	O75342	LX12B_HUMAN	H	154	ENSP00000315167:P154H	ENSP00000315167:P154H	P	-	2	0	ALOX12B	7924993	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	4.651000	0.61447	2.382000	0.81193	0.555000	0.69702	CCC			0.642	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226984.3			
TBC1D29	26083	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	28887161	28887161	+	Silent	SNP	T	T	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:28887161T>C	ENST00000580161.1	+	3	2536	c.39T>C	c.(37-39)ggT>ggC	p.G13G	RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_Silent_p.G13G|TBC1D29_ENST00000584297.1_Silent_p.G13G			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	13	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCACACAGGGTTCCTCATTCA	0.602																																					p.G13G													.	TBC1D29	19		0			c.T39C												52.0	48.0	49.0					17																	28887161		2203	4300	6503	SO:0001819	synonymous_variant	26083	exon2			ACAGGGTTCCTCA	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.39T>C	17.37:g.28887161T>C			237	0.0042194093	1		206	0.23	47	NM_015594	0		0		Silent	SNP	ENST00000580161.1	37	CCDS32606.1																																																																																					0.602	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000443632.1		NM_015594	
LRRC37BP1	147172	broad.mit.edu	37	17	28960991	28960991	+	RNA	DEL	C	C	-	rs375551118|rs373494507|rs57752761|rs543292747	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:28960991delC	ENST00000417404.1	+	0	1269									leucine rich repeat containing 37B pseudogene 1																		tttcttttttctttttttttt	0.299																																					.													.	.			0			.																																											0	.			TTTTTTCTTTTTT	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28960991delC			59	0	0		88	0.16	14	.	2	0.00	0		RNA	DEL	ENST00000417404.1	37																																																																																						0.299	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000256203.1		NR_015341	
LRRC37A4P	55073	broad.mit.edu	37	17	43590674	43590675	+	RNA	INS	-	-	A	rs373528477		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:43590674_43590675insA	ENST00000579913.1	-	0	1289				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		AACAAAAAAACAAAAAAAAAAC	0.332																																					.													.	.			0			.																																											0	.			AAAAAACAAAAAA	AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43590684_43590684dupA			58	0.1896551724	11		88	0.23	20	.	0		0		RNA	INS	ENST00000579913.1	37																																																																																						0.332	LRRC37A4P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000445300.1		NR_002940	
MAP3K3	4215	mdanderson.org	37	17	61729923	61729923	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:61729923A>G	ENST00000361733.3	+	4	494	c.174A>G	c.(172-174)atA>atG	p.I58M	MAP3K3_ENST00000579585.1_Missense_Mutation_p.I89M|MAP3K3_ENST00000577395.1_Missense_Mutation_p.I58M|MAP3K3_ENST00000584573.1_Missense_Mutation_p.I89M|MAP3K3_ENST00000361357.3_Missense_Mutation_p.I89M	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	58	OPR.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						TCAGAATTATAGCGTTCAGCC	0.368																																					p.I89M													.	.			0			c.A267G												144.0	129.0	134.0					17																	61729923		2203	4300	6503	SO:0001583	missense	4215	exon5			AATTATAGCGTTC	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.174A>G	17.37:g.61729923A>G	ENSP00000354485:p.Ile58Met		63	0	0		45	0.07	3	NM_203351	4	0.00	0	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	A	7.843	0.722402	0.15439	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.51817	0.69;0.69	5.76	0.143	0.14820	Phox/Bem1p (2);	0.057393	0.64402	D	0.000001	T	0.42585	0.1209	L	0.54323	1.7	0.41319	D	0.987164	B;B;B;P	0.36378	0.287;0.287;0.287;0.55	B;B;B;B	0.41666	0.363;0.363;0.363;0.292	T	0.36578	-0.9742	10	0.54805	T	0.06	.	8.0308	0.30463	0.4166:0.4002:0.0:0.1832	.	58;26;58;89	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	M	89;58	ENSP00000354927:I89M;ENSP00000354485:I58M	ENSP00000354927:I89M	I	+	3	3	MAP3K3	59083655	0.609000	0.26975	0.985000	0.45067	0.756000	0.42949	0.082000	0.14847	0.390000	0.25115	0.533000	0.62120	ATA			0.368	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000443867.1		NM_002401	
TNRC6C	57690	mdanderson.org	37	17	76063992	76063992	+	Silent	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:76063992A>G	ENST00000588061.1	+	7	3493	c.2766A>G	c.(2764-2766)aaA>aaG	p.K922K	TNRC6C_ENST00000588847.1_Silent_p.K919K|TNRC6C_ENST00000301624.4_Silent_p.K922K|TNRC6C_ENST00000544502.1_Silent_p.K919K|RNU6-625P_ENST00000459412.1_RNA|TNRC6C_ENST00000335749.4_Silent_p.K919K|TNRC6C_ENST00000541771.1_Silent_p.K922K			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	922	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CCCCCAAAAAAGGACTTCAAA	0.478																																					p.K922K													.	.			0			c.A2766G												83.0	85.0	84.0					17																	76063992		1927	4130	6057	SO:0001819	synonymous_variant	57690	exon6			CAAAAAAGGACTT	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2766A>G	17.37:g.76063992A>G			59	0	0		54	0.06	3	NM_018996	12	0.00	0	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	37	CCDS45798.1																																																																																					0.478	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000395947.1		NM_018996	
PGS1	9489	mdanderson.org	37	17	76396833	76396833	+	Silent	SNP	C	C	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr17:76396833C>A	ENST00000262764.6	+	6	803	c.777C>A	c.(775-777)gcC>gcA	p.A259A	PGS1_ENST00000588281.1_3'UTR|PGS1_ENST00000329897.7_Silent_p.A124A|SNORA30_ENST00000363193.1_RNA	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	259					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CGGAGATTGCCGACTTCTTCA	0.602																																					p.A259A	Esophageal Squamous(45;182 1126 10685 43198)												.	.			0			c.C777A												110.0	117.0	115.0					17																	76396833		2157	4253	6410	SO:0001819	synonymous_variant	9489	exon6			GATTGCCGACTTC		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.777C>A	17.37:g.76396833C>A			64	0	0		51	0.06	3	NM_024419	26	0.00	0	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Silent	SNP	ENST00000262764.6	37	CCDS42391.1																																																																																					0.602	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437301.1		NM_024419	
CHAF1A	10036	broad.mit.edu	37	19	4422659	4422661	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:4422659_4422661delAAG	ENST00000301280.5	+	5	1215_1217	c.1114_1116delAAG	c.(1114-1116)aagdel	p.K375del		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	375	Arg/Glu/Lys-rich.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGGAGGCCAagaagaagaagg	0.557								Chromatin Structure																													p.372_372del													.	CHAF1A	69		0			c.1114_1116del																																									SO:0001651	inframe_deletion	10036	exon5			GAGGCCAAGAAGA	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1114_1116delAAG	19.37:g.4422668_4422670delAAG	ENSP00000301280:p.Lys375del		118	0	0		130	0.05	7	NM_005483	33	0.00	0	Q6NXG5|Q7Z7K3|Q9UJY8	In_Frame_Del	DEL	ENST00000301280.5	37	CCDS32875.1																																																																																					0.557	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458310.2		NM_005483	
EMR1	2015	broad.mit.edu	37	19	6904062	6904062	+	Missense_Mutation	SNP	G	G	A	rs528274667		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:6904062G>A	ENST00000312053.4	+	8	855	c.818G>A	c.(817-819)cGc>cAc	p.R273H	EMR1_ENST00000250572.8_Missense_Mutation_p.R273H|EMR1_ENST00000381407.5_Missense_Mutation_p.R132H|EMR1_ENST00000450315.3_Intron|EMR1_ENST00000381404.4_Missense_Mutation_p.R221H	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	273	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					GATGAGTGCCGCCAAGATCCA	0.473													G|||	0	0.0	0.0	0.0	5008	,	,		19963	0.0		0.0	False		,,,				2504	0.0				p.R273H													.	EMR1	153		0			c.G818A												100.0	95.0	97.0					19																	6904062		2203	4300	6503	SO:0001583	missense	2015	exon8			AGTGCCGCCAAGA	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.818G>A	19.37:g.6904062G>A	ENSP00000311545:p.Arg273His		98	0	0		126	0.03	4	NM_001256253	0		0	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809819	0.31961	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	4.06	-8.13	0.01073	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.88522	0.6459	N	0.25992	0.78	0.09310	N	1	P;D;D;D	0.65815	0.884;0.984;0.989;0.995	B;P;P;P	0.57548	0.179;0.536;0.756;0.823	D	0.83852	0.0263	9	0.46703	T	0.11	.	8.6338	0.33935	0.0:0.152:0.224:0.6239	.	132;273;221;273	B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;EMR1_HUMAN	H	273;273;221;273;132	ENSP00000311545:R273H;ENSP00000370811:R221H;ENSP00000250572:R273H;ENSP00000370814:R132H	ENSP00000250572:R273H	R	+	2	0	EMR1	6855062	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.052000	0.01401	-1.890000	0.01111	-1.753000	0.00675	CGC			0.473	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458485.1			
MAG	4099	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	35790581	35790581	+	Silent	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:35790581G>T	ENST00000392213.3	+	5	699	c.540G>T	c.(538-540)ctG>ctT	p.L180L	MAG_ENST00000597035.1_3'UTR|MAG_ENST00000537831.2_Silent_p.L155L|MAG_ENST00000361922.4_Silent_p.L180L	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	180	Ig-like C2-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ACGAGGGGCTGGGGGAGCCCG	0.706																																					p.L180L													.	.			0			c.G540T												13.0	16.0	15.0					19																	35790581		2194	4293	6487	SO:0001819	synonymous_variant	4099	exon5			GGGGCTGGGGGAG	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.540G>T	19.37:g.35790581G>T			43	0	0		46	0.15	7	NM_080600	0		0	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	ENST00000392213.3	37	CCDS12455.1																																																																																					0.706	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000466071.1		NM_080600	
LMTK3	114783	broad.mit.edu	37	19	49001926	49001926	+	Silent	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:49001926A>G	ENST00000600059.1	-	11	2627	c.2400T>C	c.(2398-2400)ccT>ccC	p.P800P	LMTK3_ENST00000270238.3_Silent_p.P829P			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	800	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CTGGGGAAAAAGGGGTCTCGG	0.766																																					p.P829P													.	LMTK3	125		0			c.T2487C												2.0	2.0	2.0					19																	49001926		935	2373	3308	SO:0001819	synonymous_variant	114783	exon12			GGAAAAAGGGGTC	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.2400T>C	19.37:g.49001926A>G			63	0.0158730159	1		53	0.06	3	NM_001080434	4	0.00	0	Q4G0U1	Silent	SNP	ENST00000600059.1	37																																																																																						0.766	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000466137.1		NM_052895	
SPACA4	171169	broad.mit.edu;mdanderson.org	37	19	49110410	49110410	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:49110410C>T	ENST00000321762.1	+	1	411	c.175C>T	c.(175-177)Ccg>Tcg	p.P59S	FAM83E_ENST00000263266.3_Intron	NM_133498.2	NP_598005.1	Q8TDM5	SACA4_HUMAN	sperm acrosome associated 4	59	UPAR/Ly6 1.				cell adhesion (GO:0007155)	anchored component of membrane (GO:0031225)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		GGGCACTGGTCCGGTCATCAA	0.632																																					p.P59S													.	SPACA4	9		0			c.C175T												50.0	48.0	49.0					19																	49110410		2203	4300	6503	SO:0001583	missense	171169	exon1			ACTGGTCCGGTCA		CCDS12725.1	19q13.33	2013-10-24			ENSG00000177202	ENSG00000177202			16441	protein-coding gene	gene with protein product		609932					Standard	NM_133498		Approved	SAMP14	uc002pjo.3	Q8TDM5	OTTHUMG00000183316	ENST00000321762.1:c.175C>T	19.37:g.49110410C>T	ENSP00000312774:p.Pro59Ser		51	0	0		46	0.09	4	NM_133498	0		0		Missense_Mutation	SNP	ENST00000321762.1	37	CCDS12725.1	.	.	.	.	.	.	.	.	.	.	C	7.549	0.662224	0.14645	.	.	ENSG00000177202	ENST00000321762	T	0.67345	-0.26	5.19	2.98	0.34508	CD59 antigen (1);	0.639404	0.15665	N	0.250672	T	0.66426	0.2788	M	0.63428	1.95	0.09310	N	1	P	0.38300	0.626	B	0.43413	0.419	T	0.59710	-0.7403	10	0.87932	D	0	-16.9569	8.6458	0.34005	0.1734:0.6597:0.167:0.0	.	59	Q8TDM5	SACA4_HUMAN	S	59	ENSP00000312774:P59S	ENSP00000312774:P59S	P	+	1	0	SPACA4	53802222	0.000000	0.05858	0.004000	0.12327	0.013000	0.08279	-0.100000	0.10990	0.662000	0.31006	0.591000	0.81541	CCG			0.632	SPACA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466149.1		NM_133498	
TULP2	7288	mdanderson.org	37	19	49399726	49399726	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:49399726G>A	ENST00000221399.3	-	4	316	c.172C>T	c.(172-174)Cgc>Tgc	p.R58C		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	58					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		AGACAAGAGCGCCAAAGCCAC	0.637																																					p.R58C													.	.			0			c.C172T												45.0	47.0	46.0					19																	49399726		2203	4300	6503	SO:0001583	missense	7288	exon4			AAGAGCGCCAAAG	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.172C>T	19.37:g.49399726G>A	ENSP00000221399:p.Arg58Cys		56	0	0		48	0.06	3	NM_003323	0		0	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323221	0.60634	.	.	ENSG00000104804	ENST00000221399;ENST00000518572;ENST00000522945;ENST00000520977;ENST00000522229	D;T;T;T	0.86562	-2.14;1.52;0.82;0.27	5.03	2.78	0.32641	Tubby, N-terminal (1);	0.678460	0.13857	N	0.357935	D	0.88887	0.6559	L	0.56199	1.76	0.19300	N	0.999977	D	0.76494	0.999	P	0.57324	0.818	T	0.79313	-0.1855	10	0.56958	D	0.05	-1.6322	9.8786	0.41220	0.0:0.1519:0.6906:0.1575	.	58	O00295	TULP2_HUMAN	C	58;58;58;39;14	ENSP00000221399:R58C;ENSP00000428420:R58C;ENSP00000430040:R58C;ENSP00000428535:R39C	ENSP00000221399:R58C	R	-	1	0	TULP2	54091538	0.025000	0.19082	0.008000	0.14137	0.009000	0.06853	0.972000	0.29409	0.574000	0.29417	0.596000	0.82720	CGC			0.637	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378633.1		NM_003323	
POLD1	5424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50918215	50918215	+	Silent	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr19:50918215C>T	ENST00000440232.2	+	20	2585	c.2532C>T	c.(2530-2532)gtC>gtT	p.V844V	CTD-2545M3.6_ENST00000599632.1_5'Flank|POLD1_ENST00000595904.1_Silent_p.V870V|POLD1_ENST00000599857.1_Silent_p.V844V	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	844					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		CCAACCTGGTCACTGCCTCAC	0.701								DNA polymerases (catalytic subunits)																													p.V844V													.	.			0			c.C2532T												43.0	35.0	37.0					19																	50918215		2201	4297	6498	SO:0001819	synonymous_variant	5424	exon20			CCTGGTCACTGCC		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2532C>T	19.37:g.50918215C>T			42	0	0		44	0.14	6	NM_002691	120	0.12	14	Q8NER3|Q96H98	Silent	SNP	ENST00000440232.2	37	CCDS12795.1																																																																																					0.701	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464732.1			
ALMS1	7840	broad.mit.edu	37	2	73829423	73829423	+	Missense_Mutation	SNP	C	C	T	rs368113488		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:73829423C>T	ENST00000264448.6	+	20	12334	c.12223C>T	c.(12223-12225)Cgg>Tgg	p.R4075W	ALMS1_ENST00000409009.1_Missense_Mutation_p.R4033W|ALMS1_ENST00000464408.2_3'UTR	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	4075	ALMS motif.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ACAGACCGAGCGGGATGCACT	0.562																																					p.R4075W													.	ALMS1	384		0			c.C12223T							C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	70.0	72.0	71.0		12223	5.2	1.0	2		71	0,8600		0,0,4300	no	missense	ALMS1	NM_015120.4	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	4075/4168	73829423	1,13005	2203	4300	6503	SO:0001583	missense	7840	exon20			ACCGAGCGGGATG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.12223C>T	2.37:g.73829423C>T	ENSP00000264448:p.Arg4075Trp		276	0	0		255	0.02	5	NM_015120	41	0.00	0	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710565	0.48517	2.27E-4	0.0	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.12465	2.68;2.68	5.17	5.17	0.71159	.	0.084306	0.46442	D	0.000298	T	0.28863	0.0716	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.00525	-1.1689	10	0.87932	D	0	.	11.1498	0.48451	0.1835:0.8165:0.0:0.0	.	4033;4075	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	W	4033;4075	ENSP00000386627:R4033W;ENSP00000264448:R4075W	ENSP00000264448:R4075W	R	+	1	2	ALMS1	73682931	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	1.279000	0.33191	2.683000	0.91414	0.655000	0.94253	CGG			0.562	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000327776.1		NM_015120	
ANKRD36BP2	645784	broad.mit.edu	37	2	89082294	89082295	+	RNA	INS	-	-	TT	rs368332037		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:89082294_89082295insTT	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		TTAAAGTCTCATATGTTGAACT	0.332																																					.													.	.			0			.																																											0	.			AGTCTCATATGTT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082294_89082295insTT			5	0	0		9	0.33	3	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89082296	89082297	+	RNA	INS	-	-	TC	rs370959214		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:89082296_89082297insTC	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		AAAGTCTCATATGTTGAACTAT	0.332																																					.													.	.			0			.																																											0	.			TCTCATATGTTGA			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082296_89082297insTC			5	0	0		9	0.33	3	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89104384	89104384	+	RNA	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:89104384G>A	ENST00000393525.3	+	0	4858									ankyrin repeat domain 36B pseudogene 2																		ATCCTGCAGCGTTCAAGTTTG	0.348																																					.													.	.			0			.																																											0	.			TGCAGCGTTCAAG			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104384G>A			32	0	0		35	0.09	3	.	7	0.00	0		RNA	SNP	ENST00000393525.3	37																																																																																						0.348	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ADRA2B	151	mdanderson.org	37	2	96781577	96781577	+	Silent	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:96781577G>A	ENST00000409345.3	-	1	407	c.312C>T	c.(310-312)tgC>tgT	p.C104C		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	104					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGCTGATGGCGCACAGGTGCA	0.652																																					p.C104C													.	.			0			c.C312T												42.0	43.0	43.0					2																	96781577		2203	4300	6503	SO:0001819	synonymous_variant	151	exon1			GATGGCGCACAGG	M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.312C>T	2.37:g.96781577G>A			76	0	0		55	0.07	4	NM_000682	1	0.00	0	Q4TUH9|Q53RF2|Q9BZK0	Silent	SNP	ENST00000409345.3	37	CCDS56129.1																																																																																					0.652	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000334990.1			
TUBA3D	113457	ucsc.edu	37	2	132237983	132237983	+	Silent	SNP	A	A	G	rs6423208	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:132237983A>G	ENST00000321253.6	+	4	824	c.717A>G	c.(715-717)acA>acG	p.T239T		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	239					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		CCTCCATCACAGCCTCCCTGC	0.557																																					p.T239T	Ovarian(137;2059 2432 35543 39401)												.	TUBA3D	60		0			c.A717G												102.0	133.0	123.0					2																	132237983		1926	4246	6172	SO:0001819	synonymous_variant	113457	exon4			CATCACAGCCTCC	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.717A>G	2.37:g.132237983A>G			83	0.1084337349	9		75	0.28	21	NM_080386	22	0.00	0	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	ENST00000321253.6	37	CCDS33290.1																																																																																					0.557	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331800.2		NM_080386	
PTMA	5757	mdanderson.org	37	2	232577532	232577532	+	Missense_Mutation	SNP	A	A	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr2:232577532A>C	ENST00000341369.7	+	5	498	c.307A>C	c.(307-309)Aag>Cag	p.K103Q	PTMA_ENST00000466801.1_3'UTR|PTMA_ENST00000409115.3_Missense_Mutation_p.K102Q|PTMA_ENST00000409683.1_Missense_Mutation_p.K99Q|PTMA_ENST00000410064.1_Missense_Mutation_p.K128Q|PTMA_ENST00000409321.1_Missense_Mutation_p.K123Q	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	103					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TGTCGATACCAAGAAGCAGAA	0.517																																					p.K103Q													.	.			0			c.A307C												40.0	43.0	42.0					2																	232577532		1847	4075	5922	SO:0001583	missense	5757	exon5			GATACCAAGAAGC		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.307A>C	2.37:g.232577532A>C	ENSP00000344547:p.Lys103Gln		49	0	0		63	0.08	5	NM_001099285	1382	0.00	0	Q15249|Q15592	Missense_Mutation	SNP	ENST00000341369.7	37	CCDS42833.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.719999	0.30503	.	.	ENSG00000187514	ENST00000409321;ENST00000409115;ENST00000341369;ENST00000409683;ENST00000410064;ENST00000358839	.	.	.	4.43	4.43	0.53597	.	0.000000	0.64402	U	0.000004	T	0.80412	0.4618	M	0.87381	2.88	0.41195	D	0.986339	D;D	0.69078	0.997;0.997	D;D	0.81914	0.995;0.995	D	0.83954	0.0318	9	0.59425	D	0.04	.	13.1827	0.59663	1.0:0.0:0.0:0.0	.	103;102	P06454;Q53S24	PTMA_HUMAN;.	Q	123;102;103;99;128;127	.	ENSP00000344547:K103Q	K	+	1	0	PTMA	232285776	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.963000	0.87922	1.769000	0.52152	0.448000	0.29417	AAG			0.517	PTMA-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000332553.1			
ZNF343	79175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2464083	2464083	+	Silent	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr20:2464083G>A	ENST00000278772.4	-	6	2011	c.1524C>T	c.(1522-1524)ctC>ctT	p.L508L	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	508					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						GGTGTCTGATGAGATTTGACT	0.493																																					p.L508L													.	.			0			c.C1524T												131.0	121.0	124.0					20																	2464083		2203	4300	6503	SO:0001819	synonymous_variant	79175	exon6			TCTGATGAGATTT	AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.1524C>T	20.37:g.2464083G>A			101	0	0		127	0.17	21	NM_024325	13	0.00	0	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Silent	SNP	ENST00000278772.4	37	CCDS13028.1																																																																																					0.493	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077617.1		NM_024325	
FRG1B	284802	mdanderson.org	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																					.													.	.			2	Substitution - Missense(2)	endometrium(2)	.																																									SO:0001583	missense	284802	.			AGAGAACCAAATT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr		165	0.0060606061	1		171	0.03	5	.	96	0.04	4	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA			0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2	rescued with RNA-seq	NR_003579	
DUSP15	128853	ucsc.edu	37	20	30454893	30454893	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr20:30454893G>T	ENST00000278979.3	-	3	186	c.110C>A	c.(109-111)tCa>tAa	p.S37*	DUSP15_ENST00000375966.4_Nonsense_Mutation_p.S37*|DUSP15_ENST00000398084.2_5'UTR|DUSP15_ENST00000398083.1_5'UTR|DUSP15_ENST00000486996.1_5'UTR|DUSP15_ENST00000493115.1_5'UTR|DUSP15_ENST00000339738.5_Nonsense_Mutation_p.S40*			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	37					positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			AGGCTGGGGTGACTCATGGAT	0.517																																					p.S40X													.	DUSP15	28		0			c.C119A												126.0	100.0	109.0					20																	30454893		2203	4300	6503	SO:0001587	stop_gained	128853	exon3			TGGGGTGACTCAT		CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.110C>A	20.37:g.30454893G>T	ENSP00000278979:p.Ser37*		39	0	0		38	0.11	4	NM_080611	26	0.00	0	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	ENST00000278979.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	7.947778|7.947778	0.98577|0.98577	.|.	.|.	ENSG00000149599|ENSG00000149599	ENST00000375953;ENST00000428829|ENST00000278979;ENST00000339738;ENST00000375966	.|.	.|.	.|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.312255	.|0.29791	.|N	.|0.011187	T|.	0.35508|.	0.0934|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32322|.	-0.9911|.	4|.	0.87932|0.02654	D|T	0|1	.|.	14.6851|14.6851	0.69044|0.69044	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	N|X	29|37;40;37	.|.	ENSP00000365120:H29N|ENSP00000278979:S37X	H|S	-|-	1|2	0|0	DUSP15|DUSP15	29918554|29918554	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.199000|7.199000	0.77831|0.77831	2.243000|2.243000	0.73865|0.73865	0.313000|0.313000	0.20887|0.20887	CAC|TCA			0.517	DUSP15-004	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000078555.3		NM_080611	
TRPC4AP	26133	mdanderson.org	37	20	33589862	33589862	+	IGR	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr20:33589862C>T	ENST00000252015.2	-	0	3226				MYH7B_ENST00000262873.7_Missense_Mutation_p.R1972W			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GCTGCGGGCACGGACCCGGGA	0.652											OREG0025884	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1972W													.	.			0			c.C5914T												41.0	53.0	49.0					20																	33589862		2183	4284	6467	SO:0001628	intergenic_variant	57644	exon44			CGGGCACGGACCC	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319		20.37:g.33589862C>T			43	0	0	841	46	0.07	3	NM_020884	9	0.00	0	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	37	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141320	0.77775	.	.	ENSG00000078814	ENST00000262873;ENST00000446156;ENST00000453028;ENST00000435272;ENST00000433934;ENST00000456649	T;T;T;T;T;T	0.79554	-1.19;-1.28;-1.19;-1.19;-1.19;-1.19	4.45	3.48	0.39840	Myosin tail (1);	0.000000	0.32593	N	0.005886	D	0.89670	0.6782	M	0.86651	2.83	0.41615	D	0.988939	D	0.76494	0.999	D	0.68765	0.96	D	0.91336	0.5093	10	0.87932	D	0	.	13.3567	0.60631	0.1642:0.8358:0.0:0.0	.	1930	A7E2Y1	MYH7B_HUMAN	W	1972;127;105;132;132;105	ENSP00000262873:R1972W;ENSP00000395858:R127W;ENSP00000409103:R105W;ENSP00000391939:R132W;ENSP00000412594:R132W;ENSP00000396368:R105W	ENSP00000262873:R1972W	R	+	1	2	MYH7B	33053523	0.992000	0.36948	0.978000	0.43139	0.994000	0.84299	2.982000	0.49337	1.038000	0.40049	0.561000	0.74099	CGG			0.652	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078832.2		NM_015638	
LAMA5	3911	mdanderson.org	37	20	60893995	60893995	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr20:60893995G>T	ENST00000252999.3	-	52	7012	c.6946C>A	c.(6946-6948)Ctg>Atg	p.L2316M		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2316	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ACCTCGGCCAGTGTCCGGAGC	0.687																																					p.L2316M													.	.			0			c.C6946A												9.0	11.0	11.0					20																	60893995		2154	4260	6414	SO:0001583	missense	3911	exon52			CGGCCAGTGTCCG	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6946C>A	20.37:g.60893995G>T	ENSP00000252999:p.Leu2316Met		37	0	0		29	0.10	3	NM_005560	16	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	0.658	-0.806967	0.02819	.	.	ENSG00000130702	ENST00000252999	T	0.13089	2.62	4.25	0.859	0.19036	Laminin I (1);	0.278379	0.36972	U	0.002311	T	0.06280	0.0162	N	0.08118	0	0.80722	D	1	B	0.12013	0.005	B	0.19391	0.025	T	0.30851	-0.9964	10	0.39692	T	0.17	.	7.7164	0.28706	0.0:0.1271:0.318:0.5549	.	2316	O15230	LAMA5_HUMAN	M	2316	ENSP00000252999:L2316M	ENSP00000252999:L2316M	L	-	1	2	LAMA5	60327390	0.020000	0.18652	0.275000	0.24674	0.011000	0.07611	0.026000	0.13599	0.268000	0.21939	-0.177000	0.13119	CTG			0.687	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
KRTAP10-6	386674	ucsc.edu	37	21	46011987	46011987	+	Missense_Mutation	SNP	A	A	G	rs201334923	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr21:46011987A>G	ENST00000400368.1	-	1	399	c.379T>C	c.(379-381)Tcc>Ccc	p.S127P	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	127	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						CAGCAGACGGACACACAGCAC	0.642													.|||	980	0.195687	0.3873	0.1282	5008	,	,		18410	0.2401		0.0855	False		,,,				2504	0.0521				p.S127P													.	KRTAP10-6	57		0			c.T379C							G	,PRO/SER	346,3600		9,328,1636	65.0	101.0	89.0		,379	-1.7	0.0	21	dbSNP_132	89	122,8214		6,110,4052	no	intron,missense	TSPEAR,KRTAP10-6	NM_144991.2,NM_198688.2	,74	15,438,5688	GG,GA,AA		1.4635,8.7684,3.8105	,benign	,127/366	46011987	468,11814	1973	4168	6141	SO:0001583	missense	386674	exon1			AGACGGACACACA	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.379T>C	21.37:g.46011987A>G	ENSP00000383219:p.Ser127Pro		74	0.2702702703	20		72	0.39	28	NM_198688	0		0		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	g	0.017	-1.506709	0.00992	0.087684	0.014635	ENSG00000188155	ENST00000400368	T	0.01397	4.94	2.44	-1.71	0.08133	.	.	.	.	.	T	0.00039	0.0001	N	0.00793	-1.18	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.39522	-0.9610	8	0.02654	T	1	.	2.6267	0.04931	0.3892:0.0:0.2528:0.358	.	127	P60371	KR106_HUMAN	P	127	ENSP00000383219:S127P	ENSP00000383219:S127P	S	-	1	0	KRTAP10-6	44836415	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.886000	0.04157	-0.713000	0.04981	-1.032000	0.02404	TCC			0.642	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128037.1		NM_198688	
PLXNB2	23654	mdanderson.org	37	22	50727515	50727515	+	Silent	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr22:50727515G>A	ENST00000449103.1	-	4	1265	c.1125C>T	c.(1123-1125)agC>agT	p.S375S	PLXNB2_ENST00000359337.4_Silent_p.S375S|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	375	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCCCGTCGCGGCTGCCCAGCG	0.667																																					p.S375S													.	.			0			c.C1125T												12.0	15.0	14.0					22																	50727515		2039	4185	6224	SO:0001819	synonymous_variant	23654	exon4			GTCGCGGCTGCCC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1125C>T	22.37:g.50727515G>A			30	0	0		31	0.10	3	NM_012401	3	0.00	0	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																					0.667	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316874.3		NM_012401	
CFAP44	55779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113115371	113115371	+	Silent	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr3:113115371G>A	ENST00000295868.2	-	14	1935	c.1773C>T	c.(1771-1773)gcC>gcT	p.A591A	WDR52_ENST00000475568.1_5'UTR|WDR52_ENST00000393845.2_Silent_p.A591A	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TTACCCCTGTGGCTAGAATTT	0.353																																					p.A591A													.	.			0			c.C1773T												83.0	80.0	81.0					3																	113115371		2203	4300	6503	SO:0001819	synonymous_variant	55779	exon14			CCCTGTGGCTAGA																												ENST00000295868.2:c.1773C>T	3.37:g.113115371G>A			55	0	0		77	0.36	28	NM_001164496	0		0		Silent	SNP	ENST00000295868.2	37	CCDS2972.1																																																																																					0.353	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354128.3			
FAM131A	131408	broad.mit.edu	37	3	184059803	184059803	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr3:184059803G>T	ENST00000310585.4	+	1	1546	c.182G>T	c.(181-183)tGc>tTc	p.C61F	FAM131A_ENST00000453072.1_Intron|FAM131A_ENST00000340957.5_Intron|EIF2B5_ENST00000444495.1_Intron|FAM131A_ENST00000450976.1_Intron|FAM131A_ENST00000383847.2_Intron|FAM131A_ENST00000418281.1_Intron			Q6UXB0	F131A_HUMAN	family with sequence similarity 131, member A	61						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(9)|skin(1)	14	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGCACCTGTGCTCCCTGGCC	0.587																																					.													.	FAM131A	37		0			.												233.0	196.0	208.0					3																	184059803		2203	4300	6503	SO:0001583	missense	131408	.			ACCTGTGCTCCCT	BC026221	CCDS3262.1, CCDS3262.2, CCDS54689.1	3q27.1	2007-03-20	2007-03-20	2007-03-20	ENSG00000175182	ENSG00000175182			28308	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 40"""	C3orf40		12975309	Standard	NM_144635		Approved	MGC21688	uc003foe.3	Q6UXB0	OTTHUMG00000156206	ENST00000310585.4:c.182G>T	3.37:g.184059803G>T	ENSP00000310135:p.Cys61Phe		173	0	0		228	0.02	5	.	0		0	D3DNT6|G5E9B1|Q8TA84	Missense_Mutation	SNP	ENST00000310585.4	37		.	.	.	.	.	.	.	.	.	.	g	8.106	0.777668	0.16120	.	.	ENSG00000175182	ENST00000310585	T	0.21191	2.02	4.64	-4.65	0.03339	.	.	.	.	.	T	0.11367	0.0277	.	.	.	0.09310	N	1	B	0.18968	0.032	B	0.12837	0.008	T	0.33163	-0.9879	8	0.62326	D	0.03	.	2.3346	0.04244	0.4101:0.1163:0.3556:0.1181	.	61	Q6UXB0	F131A_HUMAN	F	61	ENSP00000310135:C61F	ENSP00000310135:C61F	C	+	2	0	FAM131A	185542497	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.041000	0.12084	-0.853000	0.04136	-1.930000	0.00511	TGC			0.587	FAM131A-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000343462.1		NM_144635	
GK2	2712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	80328968	80328968	+	Missense_Mutation	SNP	T	T	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr4:80328968T>A	ENST00000358842.3	-	1	404	c.387A>T	c.(385-387)aaA>aaT	p.K129N		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						TTCCTGGAATTTTTTTACTAA	0.428																																					p.K129N													.	.			0			c.A387T												129.0	129.0	129.0					4																	80328968		2203	4300	6503	SO:0001583	missense	2712	exon1			TGGAATTTTTTTA	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.387A>T	4.37:g.80328968T>A	ENSP00000351706:p.Lys129Asn		140	0	0		97	0.15	15	NM_033214	0		0	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	T	6.497	0.459832	0.12342	.	.	ENSG00000196475	ENST00000358842	T	0.58940	0.3	3.76	0.102	0.14522	Carbohydrate kinase, FGGY, N-terminal (1);	0.153087	0.64402	D	0.000019	T	0.56558	0.1993	L	0.53561	1.675	0.35740	D	0.818604	P	0.41188	0.741	P	0.51550	0.673	T	0.57458	-0.7808	10	0.28530	T	0.3	2.296	6.8776	0.24155	0.0:0.3125:0.0:0.6875	.	129	Q14410	GLPK2_HUMAN	N	129	ENSP00000351706:K129N	ENSP00000351706:K129N	K	-	3	2	GK2	80547992	1.000000	0.71417	0.739000	0.30968	0.012000	0.07955	0.723000	0.25939	0.032000	0.15435	-0.361000	0.07541	AAA			0.428	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252517.2		NM_033214	
ANKRD50	57182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	125590598	125590598	+	Missense_Mutation	SNP	C	C	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr4:125590598C>G	ENST00000504087.1	-	4	4871	c.3834G>C	c.(3832-3834)aaG>aaC	p.K1278N	ANKRD50_ENST00000515641.1_Missense_Mutation_p.K1099N	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1278	Ser-rich.									NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CTGATCCAGACTTGGCAGAAT	0.388																																					p.K1278N													.	.			0			c.G3834C												145.0	156.0	152.0					4																	125590598		2203	4300	6503	SO:0001583	missense	57182	exon4			TCCAGACTTGGCA	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3834G>C	4.37:g.125590598C>G	ENSP00000425658:p.Lys1278Asn		110	0	0		95	0.21	20	NM_020337	11	0.55	6	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.505046	0.44558	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.68025	-0.3;-0.25	5.36	0.451	0.16629	.	0.051197	0.85682	D	0.000000	T	0.42494	0.1205	N	0.19112	0.55	0.34761	D	0.73276	B	0.26635	0.155	B	0.26517	0.07	T	0.45160	-0.9280	10	0.05959	T	0.93	.	9.7756	0.40616	0.0:0.4428:0.0:0.5572	.	1278	Q9ULJ7	ANR50_HUMAN	N	1278;1099	ENSP00000425658:K1278N;ENSP00000425355:K1099N	ENSP00000425658:K1278N	K	-	3	2	ANKRD50	125810048	0.982000	0.34865	0.906000	0.35671	0.970000	0.65996	0.261000	0.18442	-0.016000	0.14127	-0.459000	0.05422	AAG			0.388	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364775.1		NM_020337	
ADAMTS19	171019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	128984530	128984530	+	Silent	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr5:128984530A>G	ENST00000274487.4	+	13	2170	c.2025A>G	c.(2023-2025)aaA>aaG	p.K675K	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	675	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GTCCCAGAAAACAATACAGAA	0.378																																					p.K675K													.	.			0			c.A2025G												108.0	113.0	111.0					5																	128984530		2203	4300	6503	SO:0001819	synonymous_variant	171019	exon13			CAGAAAACAATAC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2025A>G	5.37:g.128984530A>G			213	0	0		147	0.14	20	NM_133638	2	0.50	1		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																					0.378	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250979.2		NM_133638	
FAM8A1	51439	hgsc.bcm.edu	37	6	17602826	17602826	+	Nonsense_Mutation	SNP	G	G	T	rs74444948	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr6:17602826G>T	ENST00000259963.3	+	2	773	c.718G>T	c.(718-720)Gaa>Taa	p.E240*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	240						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TACAGGCAGAGAATATGTTAT	0.328																																					p.E240X													FAM8A1,NS,carcinoma,-1,2	FAM8A1	-1	2	0			c.G718T												100.0	101.0	101.0					6																	17602826		2203	4299	6502	SO:0001587	stop_gained	51439	exon2			GGCAGAGAATATG	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.718G>T	6.37:g.17602826G>T	ENSP00000259963:p.Glu240*		36	0	0		42	0.14	6	NM_016255	0		0	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	37	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	G	37	6.420554	0.97555	.	.	ENSG00000137414	ENST00000259963	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.04	18.5673	0.91121	0.0:0.0:1.0:0.0	.	.	.	.	X	240	.	ENSP00000259963:E240X	E	+	1	0	FAM8A1	17710805	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.467000	0.97671	2.356000	0.79943	0.644000	0.83932	GAA	0.008		0.328	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039950.1			
VN1R10P	387316	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27293144	27293144	+	IGR	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr6:27293144G>A								POM121L2 (13195 upstream) : ZNF391 (49249 downstream)																							TGTAAAACAAGACTGTTTATA	0.368																																					.													.	.			0			.												206.0	188.0	194.0					6																	27293144		1911	4118	6029	SO:0001628	intergenic_variant	387316	.			AAACAAGACTGTT																													6.37:g.27293144G>A			179	0	0		168	0.18	31	.	0		0		RNA	SNP		37																																																																																					0	0.368										
MUC21	394263	bcgsc.ca	37	6	30954559	30954560	+	Missense_Mutation	DNP	AC	AC	CT	rs531044924|rs140820905	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	AC	AC					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr6:30954559_30954560AC>CT	ENST00000376296.3	+	2	848_849	c.607_608AC>CT	c.(607-609)ACc>CTc	p.T203L	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	203	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GTCCAGCACAACCTCCAGTGGG	0.619																																					p.T203L													.	MUC21	98		0			c.C608T																																									SO:0001583	missense	394263	exon2			AGCACAACCTCCA	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	Exception_encountered	6.37:g.30954559_30954560delinsCT	ENSP00000365473:p.Thr203Leu		83	0.0240963855	2		58	0.12	7	NM_001010909	5	0.00	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Missense_Mutation	DNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.619	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
TDRD6	221400	mdanderson.org	37	6	46656464	46656464	+	Missense_Mutation	SNP	T	T	G	rs200156736		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr6:46656464T>G	ENST00000316081.6	+	1	599	c.599T>G	c.(598-600)gTg>gGg	p.V200G	RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000422284.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.V200G|RP11-446F17.3_ENST00000434329.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	200					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GCTCGGCGGGTGCCCGACAGC	0.677																																					p.V200G													.	.			0			c.T599G												37.0	45.0	42.0					6																	46656464		2202	4291	6493	SO:0001583	missense	221400	exon1			GGCGGGTGCCCGA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.599T>G	6.37:g.46656464T>G	ENSP00000346065:p.Val200Gly		18	0.3888888889	7		11	0.73	8	NM_001168359	0		0	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	T	13.84	2.358525	0.41801	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.20598	2.06;2.07	5.97	5.97	0.96955	.	0.510376	0.21132	N	0.079628	T	0.31544	0.0800	M	0.66939	2.045	0.26493	N	0.974912	D;D	0.69078	0.997;0.995	D;P	0.64410	0.925;0.856	T	0.16305	-1.0407	10	0.45353	T	0.12	-7.6911	16.1238	0.81380	0.0:0.0:0.0:1.0	.	200;200	F5H5M3;O60522	.;TDRD6_HUMAN	G	200	ENSP00000443299:V200G;ENSP00000346065:V200G	ENSP00000346065:V200G	V	+	2	0	TDRD6	46764423	0.850000	0.29656	0.981000	0.43875	0.455000	0.32408	4.661000	0.61518	2.288000	0.76882	0.533000	0.62120	GTG	0.004		0.677	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040800.1		XM_166443	
RAC1	5879	mdanderson.org	37	7	6414400	6414400	+	Splice_Site	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr7:6414400G>A	ENST00000348035.4	+	1	247	c.34G>A	c.(34-36)Gga>Aga	p.G12R	RAC1_ENST00000356142.4_Splice_Site_p.G12R|RAC1_ENST00000488373.1_3'UTR	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	12					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	GGTGGGAGACGGGTGAGTGCG	0.791																																					p.G12R													.	.			0			c.G34A												2.0	3.0	2.0					7																	6414400		1640	3324	4964	SO:0001630	splice_region_variant	5879	exon1			GGAGACGGGTGAG	AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.35+1G>A	7.37:g.6414400G>A			9	0	0		12	0.33	4	NM_006908	72	0.13	9	O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Missense_Mutation	SNP	ENST00000348035.4	37	CCDS5348.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.278446	0.80692	.	.	ENSG00000136238	ENST00000348035;ENST00000356142	T;T	0.78246	-1.16;-1.16	4.1	3.2	0.36748	Small GTP-binding protein domain (1);	0.360970	0.29752	N	0.011285	D	0.88220	0.6378	H	0.94771	3.58	0.51482	D	0.99992	P;P	0.48694	0.914;0.683	P;P	0.56042	0.79;0.688	D	0.89377	0.3679	10	0.87932	D	0	.	10.7385	0.46139	0.0:0.0:0.809:0.191	.	12;12	P63000;A4D2P0	RAC1_HUMAN;.	R	12	ENSP00000258737:G12R;ENSP00000348461:G12R	ENSP00000258737:G12R	G	+	1	0	RAC1	6380925	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	2.536000	0.45693	0.799000	0.34018	0.454000	0.30748	GGA			0.791	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000242868.2		NM_018890	Missense_Mutation
WBSCR22	114049	broad.mit.edu	37	7	73111840	73111840	+	Intron	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr7:73111840C>T	ENST00000265758.2	+	11	759				STX1A_ENST00000484736.1_5'Flank|WBSCR22_ENST00000423166.2_Intron|WBSCR22_ENST00000423497.1_Missense_Mutation_p.T249I	NM_017528.4	NP_059998.2	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|large_intestine(2)|lung(9)|prostate(1)	13		Lung NSC(55;0.0908)|all_lung(88;0.198)				GGCCACCAGACTCGGAGGTAA	0.582																																					p.T249I													.	WBSCR22	27		0			c.C746T																																									SO:0001627	intron_variant	114049	exon11			ACCAGACTCGGAG	AF420248	CCDS5557.1, CCDS56490.1	7q11.23	2012-06-12			ENSG00000071462	ENSG00000071462			16405	protein-coding gene	gene with protein product	"""metastasis-related methyltransferase 1"""	615733				12073013, 11978965, 21148752	Standard	NM_001202560		Approved	MGC19709, MGC2022, MGC5140, PP3381, WBMT, MERM1	uc003tyt.3	O43709	OTTHUMG00000023306	ENST00000265758.2:c.702-95C>T	7.37:g.73111840C>T			20	0	0		30	0.20	6	NM_001202560	76	0.43	33	A8K501|C9K060|Q96P12|Q9BQ58|Q9HBP9	Missense_Mutation	SNP	ENST00000265758.2	37	CCDS5557.1	.	.	.	.	.	.	.	.	.	.	C	10.15	1.272128	0.23221	.	.	ENSG00000071462	ENST00000423497	T	0.43688	0.94	3.1	-0.253	0.12996	.	.	.	.	.	T	0.13286	0.0322	N	0.01576	-0.805	0.09310	N	1	B	0.33413	0.411	B	0.28709	0.093	T	0.13953	-1.0490	9	0.44086	T	0.13	.	3.9218	0.09247	0.1574:0.5782:0.1547:0.1098	.	249	C9K060	.	I	249	ENSP00000401191:T249I	ENSP00000401191:T249I	T	+	2	0	WBSCR22	72749776	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.368000	0.02580	-0.547000	0.06207	-1.134000	0.01955	ACT			0.582	WBSCR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252303.1			
SLC25A13	10165	hgsc.bcm.edu;broad.mit.edu	37	7	95822404	95822406	+	In_Frame_Del	DEL	ATG	ATG	-	rs181615775		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	ATG	ATG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr7:95822404_95822406delATG	ENST00000265631.5	-	6	694_696	c.558_560delCAT	c.(556-561)atcatg>atg	p.I186del	SLC25A13_ENST00000542654.1_In_Frame_Del_p.I78del|SLC25A13_ENST00000416240.2_In_Frame_Del_p.I186del			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	186	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	GATGGTGACCATGATGTCTCGGA	0.448																																					p.187_187del													.	SLC25A13	131		0			c.559_561del																																									SO:0001651	inframe_deletion	10165	exon6			GTGACCATGATGT	AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.558_560delCAT	7.37:g.95822407_95822409delATG	ENSP00000265631:p.Ile186del		130	0	0		169	0.09	16	NM_001160210	12	0.00	0	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	In_Frame_Del	DEL	ENST00000265631.5	37	CCDS5645.1																																																																																					0.448	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059395.2		NM_014251	
PPP1R35	221908	bcgsc.ca	37	7	100033039	100033039	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr7:100033039G>T	ENST00000292330.2	-	4	896	c.706C>A	c.(706-708)Cgc>Agc	p.R236S	RP11-758P17.2_ENST00000492523.1_RNA|RP11-758P17.3_ENST00000475250.1_RNA|PPP1R35_ENST00000476185.1_5'UTR	NM_145030.2	NP_659467.1	Q8TAP8	PPR35_HUMAN	protein phosphatase 1, regulatory subunit 35	236					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TCTGAAGGGCGGGGCCGGAGT	0.547																																					p.R236S													C7orf47,caecum,carcinoma,+1,1	.		1	0			c.C706A												70.0	69.0	69.0					7																	100033039		2203	4300	6503	SO:0001583	missense	221908	exon4			AAGGGCGGGGCCG	BC026269	CCDS5694.1	7q22.1	2012-04-17	2011-10-11	2011-10-11	ENSG00000160813	ENSG00000160813		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28320	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 47"""	C7orf47		12477932	Standard	NM_145030		Approved	MGC22793	uc003uuy.1	Q8TAP8	OTTHUMG00000159540	ENST00000292330.2:c.706C>A	7.37:g.100033039G>T	ENSP00000292330:p.Arg236Ser		81	0	0		52	0.08	4	NM_145030	142	0.00	0	A4D2C5	Missense_Mutation	SNP	ENST00000292330.2	37	CCDS5694.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885925	0.91814	.	.	ENSG00000160813	ENST00000292330	.	.	.	4.52	4.52	0.55395	.	0.194028	0.32473	N	0.006051	T	0.49406	0.1555	N	0.14661	0.345	0.44834	D	0.997849	D	0.63880	0.993	P	0.62435	0.902	T	0.38200	-0.9672	9	0.19590	T	0.45	-17.5132	12.6364	0.56685	0.0:0.0:1.0:0.0	.	236	Q8TAP8	PPR35_HUMAN	S	236	.	ENSP00000292330:R236S	R	-	1	0	C7orf47	99870975	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.931000	0.63469	2.352000	0.79861	0.491000	0.48974	CGC			0.547	PPP1R35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356095.2		NM_145030	
EPO	2056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	100320334	100320334	+	Silent	SNP	G	G	A	rs374875798		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr7:100320334G>A	ENST00000252723.2	+	4	475	c.294G>A	c.(292-294)tcG>tcA	p.S98S		NM_000799.2	NP_000790.2	P01588	EPO_HUMAN	erythropoietin	98					aging (GO:0007568)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular hyperosmotic response (GO:0071474)|cellular response to hypoxia (GO:0071456)|embryo implantation (GO:0007566)|erythrocyte maturation (GO:0043249)|hemoglobin biosynthetic process (GO:0042541)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of cation channel activity (GO:2001258)|negative regulation of erythrocyte apoptotic process (GO:1902251)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to axon injury (GO:0048678)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to hyperoxia (GO:0055093)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to salt stress (GO:0009651)|response to testosterone (GO:0033574)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein kinase activator activity (GO:0030295)			central_nervous_system(2)|endometrium(2)|lung(7)|prostate(1)	12	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCCTGCTGTCGGAAGCTGTCC	0.652																																					p.S98S													.	.			0			c.G294A							G		0,4402		0,0,2201	21.0	25.0	23.0		294	-6.9	1.0	7		23	1,8597		0,1,4298	no	coding-synonymous	EPO	NM_000799.2		0,1,6499	AA,AG,GG		0.0116,0.0,0.0077		98/194	100320334	1,12999	2201	4299	6500	SO:0001819	synonymous_variant	2056	exon4			GCTGTCGGAAGCT	X02157	CCDS5705.1	7q21	2014-01-30			ENSG00000130427	ENSG00000130427		"""Endogenous ligands"""	3415	protein-coding gene	gene with protein product		133170				9799793, 3838366	Standard	NM_000799		Approved	EP	uc003uwi.3	P01588	OTTHUMG00000152121	ENST00000252723.2:c.294G>A	7.37:g.100320334G>A			104	0	0		128	0.09	11	NM_000799	2	0.00	0	Q2M2L6|Q549U2|Q9UDZ0|Q9UEZ5|Q9UHA0	Silent	SNP	ENST00000252723.2	37	CCDS5705.1																																																																																					0.652	EPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325323.1		NM_000799	
PEBP4	157310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	22582428	22582428	+	Missense_Mutation	SNP	G	G	A	rs201433464	byFrequency	TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr8:22582428G>A	ENST00000256404.6	-	6	536	c.445C>T	c.(445-447)Cgc>Tgc	p.R149C	RP11-459E5.1_ENST00000523627.1_RNA	NM_144962.2	NP_659399.2	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4	149						extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)				breast(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|stomach(2)	10		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		AACTGGTAGCGATGGAAGCCA	0.532																																					p.R149C													PEBP4,colon,carcinoma,+1,3	PEBP4	1	3	0			c.C445T												69.0	79.0	76.0					8																	22582428		1994	4156	6150	SO:0001583	missense	157310	exon6			GGTAGCGATGGAA	BC020779	CCDS43724.1	8p21.3	2009-08-13			ENSG00000134020	ENSG00000134020			28319	protein-coding gene	gene with protein product	"""cousin-of-RKIP 1 protein"""	612473				15302887, 16865237	Standard	NM_144962		Approved	MGC22776, CORK1, hPEBP4	uc003xcn.1	Q96S96	OTTHUMG00000163749	ENST00000256404.6:c.445C>T	8.37:g.22582428G>A	ENSP00000256404:p.Arg149Cys		199	0	0		273	0.12	32	NM_144962	2	0.00	0	Q5EVA1|Q8WW74	Missense_Mutation	SNP	ENST00000256404.6	37	CCDS43724.1	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334516	0.60853	.	.	ENSG00000134020	ENST00000256404	T	0.70399	-0.48	5.66	4.76	0.60689	.	0.000000	0.56097	D	0.000028	D	0.88800	0.6535	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91415	0.5154	10	0.87932	D	0	-31.9767	12.0528	0.53515	0.0:0.0:0.8289:0.1711	.	149	Q96S96	PEBP4_HUMAN	C	149	ENSP00000256404:R149C	ENSP00000256404:R149C	R	-	1	0	PEBP4	22638373	1.000000	0.71417	0.999000	0.59377	0.571000	0.35966	3.423000	0.52756	2.672000	0.90937	0.467000	0.42956	CGC			0.532	PEBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375141.2		NM_144962	
SNTG1	54212	broad.mit.edu	37	8	51449300	51449300	+	Silent	SNP	C	C	T	rs35419988		TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr8:51449300C>T	ENST00000522124.1	+	11	1273	c.612C>T	c.(610-612)tgC>tgT	p.C204C	SNTG1_ENST00000517473.1_Silent_p.C204C|SNTG1_ENST00000518864.1_Silent_p.C204C|SNTG1_ENST00000276467.5_Silent_p.C204C	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	204					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AGCGATGGTGCGACCTCAGAC	0.473																																					p.C204C													SNTG1_ENST00000518864,NS,carcinoma,0,2	SNTG1	304	2	0			c.C612T												216.0	189.0	198.0					8																	51449300		2203	4300	6503	SO:0001819	synonymous_variant	54212	exon11			ATGGTGCGACCTC	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.612C>T	8.37:g.51449300C>T			122	0.0081967213	1		177	0.04	7	NM_018967	0		0	Q2M3Q0|Q9NY98	Silent	SNP	ENST00000522124.1	37	CCDS6147.1																																																																																					0.473	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377964.1			
GABBR2	9568	mdanderson.org	37	9	101470851	101470851	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr9:101470851A>G	ENST00000259455.2	-	1	628	c.169T>C	c.(169-171)Tcc>Ccc	p.S57P		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	57					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	CCCATGATGGAGAGCGGCGGG	0.741																																					p.S57P													.	.			0			c.T169C												14.0	15.0	15.0					9																	101470851		2201	4295	6496	SO:0001583	missense	9568	exon1			TGATGGAGAGCGG	AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.169T>C	9.37:g.101470851A>G	ENSP00000259455:p.Ser57Pro		15	0	0		13	0.23	3	NM_005458	0		0	O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	ENST00000259455.2	37	CCDS6736.1	.	.	.	.	.	.	.	.	.	.	A	12.38	1.921866	0.33908	.	.	ENSG00000136928	ENST00000259455	T	0.21361	2.01	2.82	2.82	0.32997	.	0.000000	0.37669	U	0.001985	T	0.10165	0.0249	N	0.08118	0	0.33311	D	0.566113	B	0.02656	0.0	B	0.01281	0.0	T	0.07121	-1.0789	10	0.46703	T	0.11	.	8.8418	0.35146	1.0:0.0:0.0:0.0	.	57	O75899	GABR2_HUMAN	P	57	ENSP00000259455:S57P	ENSP00000259455:S57P	S	-	1	0	GABBR2	100510672	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.872000	0.39549	1.168000	0.42723	0.374000	0.22700	TCC			0.741	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053373.1			
ZBTB43	23099	mdanderson.org	37	9	129595247	129595247	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr9:129595247G>T	ENST00000373464.4	+	3	723	c.459G>T	c.(457-459)gaG>gaT	p.E153D	ZBTB43_ENST00000373457.1_Missense_Mutation_p.E153D|ZBTB43_ENST00000449886.1_Missense_Mutation_p.E153D	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						GCCTGGTAGAGAGCTTTGAGC	0.478																																					p.E153D													.	.			0			c.G459T												33.0	35.0	34.0					9																	129595247		2203	4300	6503	SO:0001583	missense	23099	exon2			GGTAGAGAGCTTT	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.459G>T	9.37:g.129595247G>T	ENSP00000362563:p.Glu153Asp		83	0	0		49	0.06	3	NM_001135776	0		0	Q5JU96	Missense_Mutation	SNP	ENST00000373464.4	37	CCDS6867.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528298	0.27299	.	.	ENSG00000169155	ENST00000449886;ENST00000373464;ENST00000450858;ENST00000373457	T;T;T;T	0.58210	2.85;2.85;0.35;2.85	5.75	4.63	0.57726	.	0.060372	0.64402	D	0.000005	T	0.30070	0.0753	N	0.24115	0.695	0.34143	D	0.666633	D	0.53885	0.963	B	0.41088	0.347	T	0.29150	-1.0021	10	0.14656	T	0.56	.	4.2898	0.10872	0.3011:0.0:0.6989:0.0	.	153	O43298	ZBT43_HUMAN	D	153	ENSP00000390344:E153D;ENSP00000362563:E153D;ENSP00000412145:E153D;ENSP00000362556:E153D	ENSP00000362556:E153D	E	+	3	2	ZBTB43	128635068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.944000	0.40263	2.878000	0.98634	0.650000	0.86243	GAG			0.478	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054124.1		NM_001135776	
ABO	28	broad.mit.edu;mdanderson.org	37	9	136131248	136131248	+	RNA	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr9:136131248G>T	ENST00000453660.2	-	0	880				RP11-430N14.4_ENST00000606717.1_RNA			P16442	BGAT_HUMAN	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)						protein glycosylation (GO:0006486)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosylgalactoside 3-alpha-galactosyltransferase activity (GO:0004381)|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity (GO:0004380)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|prostate(1)|stomach(2)	11				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		TGGCCTGGTCGACCATCATGG	0.642																																					.													.	ABO	30		0			.												47.0	54.0	52.0					9																	136131248		2112	4204	6316			28	.			CTGGTCGACCATC	AF134415		9q34.2	2014-07-19			ENSG00000175164	ENSG00000175164	2.4.1.40, 2.4.1.37	"""Blood group antigens"", ""Glycosyltransferase family 6 domain containing"""	79	protein-coding gene	gene with protein product		110300				184030	Standard	NM_020469		Approved	A3GALNT, A3GALT1	uc004cda.1	P16442	OTTHUMG00000020872		9.37:g.136131248G>T			107	0	0		66	0.06	4	.	2	0.00	0	B0JDB9|O14758|Q14490|Q53I57|Q6ISD4|Q6KFZ2|Q70V27|Q99484|Q99485|Q9NY01|Q9UQ68|Q9UQ69	RNA	SNP	ENST00000453660.2	37																																																																																						0.642	ABO-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000054907.4		NM_020469	
LCN1	3933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	138415793	138415793	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr9:138415793G>T	ENST00000263598.2	+	4	420	c.360G>T	c.(358-360)gaG>gaT	p.E120D	LCN1_ENST00000371781.3_Missense_Mutation_p.E120D	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	120					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		TTTACTGTGAGGGCGAGCTGC	0.607																																					p.E120D													.	.			0			c.G360T												96.0	78.0	84.0					9																	138415793		2203	4300	6503	SO:0001583	missense	3933	exon4			CTGTGAGGGCGAG		CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.360G>T	9.37:g.138415793G>T	ENSP00000263598:p.Glu120Asp		51	0	0		29	0.34	10	NM_001252617	0		0	Q5T8A1	Missense_Mutation	SNP	ENST00000263598.2	37	CCDS6991.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582959	0.28268	.	.	ENSG00000160349	ENST00000263598;ENST00000371781	T;T	0.09073	3.02;3.02	3.11	-5.83	0.02325	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.354583	0.20062	N	0.100077	T	0.05777	0.0151	M	0.66506	2.035	0.09310	N	1	B	0.34226	0.443	B	0.33042	0.157	T	0.33189	-0.9878	10	0.18276	T	0.48	.	1.72	0.02909	0.4717:0.1387:0.2492:0.1403	.	120	P31025	LCN1_HUMAN	D	120	ENSP00000263598:E120D;ENSP00000360846:E120D	ENSP00000263598:E120D	E	+	3	2	LCN1	137555614	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-2.060000	0.01392	-1.456000	0.01921	0.543000	0.68304	GAG			0.607	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054992.1		NM_002297	
AR	367	hgsc.bcm.edu;broad.mit.edu	37	X	66766356	66766356	+	Silent	SNP	T	T	C			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chrX:66766356T>C	ENST00000374690.3	+	1	1892	c.1368T>C	c.(1366-1368)ggT>ggC	p.G456G	AR_ENST00000396044.3_Silent_p.G456G|AR_ENST00000504326.1_Silent_p.G456G|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	454	Modulating.|Poly-Gly.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gtgggggtggtggcggcggcg	0.741									Androgen Insensitivity Syndrome																												p.G456G													.	.			0			c.T1368C												1.0	2.0	2.0					X																	66766356		861	1905	2766	SO:0001819	synonymous_variant	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GGGTGGTGGCGGC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1368T>C	X.37:g.66766356T>C			9	0	0		21	0.19	4	NM_000044	0		0	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	37	CCDS14387.1																																																																																					0.741	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057007.1		NM_000044	
MAP2K4P1	139201	bcgsc.ca	37	X	72745475	72745475	+	RNA	SNP	C	C	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chrX:72745475C>A	ENST00000602584.1	-	0	1174					NR_029423.1				mitogen-activated protein kinase kinase 4 pseudogene 1																		GTCCAACAGTCACCCTGTCTG	0.353																																					.													.	.			0			.																																											139201	.			AACAGTCACCCTG			Xq13.2	2013-08-05			ENSG00000269904	ENSG00000269904			43837	pseudogene	pseudogene							Standard	NR_029423		Approved		uc022bza.1		OTTHUMG00000021833		X.37:g.72745475C>A			27	0	0		25	0.16	4	.	0		0		RNA	SNP	ENST00000602584.1	37																																																																																						0.353	MAP2K4P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000467477.1			
MAGEC1	9947	broad.mit.edu	37	X	140994163	140994163	+	Nonsense_Mutation	SNP	A	A	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chrX:140994163A>T	ENST00000285879.4	+	4	1259	c.973A>T	c.(973-975)Aga>Tga	p.R325*	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	325										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCCCTGAGAGAACTCACAG	0.468										HNSCC(15;0.026)																											p.R325X													.	MAGEC1	317		0			c.A973T												119.0	118.0	118.0					X																	140994163		2191	4272	6463	SO:0001587	stop_gained	9947	exon4			CCTGAGAGAACTC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.973A>T	X.37:g.140994163A>T	ENSP00000285879:p.Arg325*		109	0	0		174	0.02	4	NM_005462	0		0	A0PK03|O75451|Q8TCV4	Nonsense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	a	15.28	2.787601	0.49997	.	.	ENSG00000155495	ENST00000285879	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.4884	0.02451	0.3397:0.3297:0.0:0.3306	.	.	.	.	X	325	.	ENSP00000285879:R325X	R	+	1	2	MAGEC1	140821829	0.093000	0.21703	0.006000	0.13384	0.007000	0.05969	-1.459000	0.02370	-2.222000	0.00727	-2.219000	0.00296	AGA			0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058604.1		NM_005462	
MAGEC1	9947	broad.mit.edu	37	X	140994165	140994165	+	Missense_Mutation	SNP	A	A	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chrX:140994165A>T	ENST00000285879.4	+	4	1261	c.975A>T	c.(973-975)agA>agT	p.R325S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	325										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCCCTGAGAGAACTCACAGTA	0.468										HNSCC(15;0.026)																											p.R325S													.	MAGEC1	317		0			c.A975T												117.0	117.0	117.0					X																	140994165		2194	4274	6468	SO:0001583	missense	9947	exon4			TGAGAGAACTCAC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.975A>T	X.37:g.140994165A>T	ENSP00000285879:p.Arg325Ser		112	0.0089285714	1		181	0.03	5	NM_005462	0		0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	a	0.891	-0.725628	0.03158	.	.	ENSG00000155495	ENST00000285879	T	0.02216	4.39	.	.	.	.	.	.	.	.	T	0.01029	0.0034	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46219	-0.9207	8	0.22706	T	0.39	.	3.3541	0.07163	0.3532:0.0:0.0:0.6468	.	325	O60732	MAGC1_HUMAN	S	325	ENSP00000285879:R325S	ENSP00000285879:R325S	R	+	3	2	MAGEC1	140821831	0.103000	0.21917	0.008000	0.14137	0.008000	0.06430	1.451000	0.35145	-2.383000	0.00592	-2.380000	0.00233	AGA			0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058604.1		NM_005462	
MAGEA11	4110	mdanderson.org	37	X	148794834	148794834	+	Missense_Mutation	SNP	C	C	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chrX:148794834C>A	ENST00000355220.5	+	2	117	c.15C>A	c.(13-15)ttC>ttA	p.F5L	MAGEA11_ENST00000333104.4_Intron	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	5						cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGACTCAGTTCCGCAGAGGGG	0.597																																					p.F5L													.	.			0			c.C15A												80.0	68.0	72.0					X																	148794834		2203	4300	6503	SO:0001583	missense	4110	exon2			TCAGTTCCGCAGA		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.15C>A	X.37:g.148794834C>A	ENSP00000347358:p.Phe5Leu		34	0	0		34	0.09	3	NM_005366	2	0.00	0	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	ENST00000355220.5	37	CCDS48180.1	.	.	.	.	.	.	.	.	.	.	N	1.423	-0.572214	0.03882	.	.	ENSG00000185247	ENST00000355220	T	0.02140	4.43	0.836	-1.67	0.08238	.	.	.	.	.	T	0.00906	0.0030	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46857	-0.9161	8	0.02654	T	1	.	.	.	.	.	5	P43364	MAGAB_HUMAN	L	5	ENSP00000347358:F5L	ENSP00000347358:F5L	F	+	3	2	MAGEA11	148579571	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.594000	0.00420	-2.647000	0.00426	-1.134000	0.01955	TTC			0.597	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058725.4		NM_005366	
HMGB3	3149	mdanderson.org	37	X	150156360	150156360	+	Silent	SNP	G	G	A			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chrX:150156360G>A	ENST00000325307.7	+	5	672	c.576G>A	c.(574-576)gaG>gaA	p.E192E	HMGB3_ENST00000448905.2_Silent_p.E192E	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	192	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaagaagaggaggaggagg	0.443																																					p.E192E													.	.			1	Substitution - coding silent(1)	large_intestine(1)	c.G576A												50.0	48.0	49.0					X																	150156360		2202	4299	6501	SO:0001819	synonymous_variant	3149	exon5			AGAAGAGGAGGAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.576G>A	X.37:g.150156360G>A			9	0	0		21	0.10	2	NM_005342	91	0.04	4	O95556|Q6NS40	Silent	SNP	ENST00000325307.7	37	CCDS35428.1																																																																																					0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060867.1		NM_005342	
TAP2	6891	mdanderson.org	37	6	32796783	32796783	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AAAL-01A-11D-A435-10	TCGA-4K-AAAL-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	1fd2755d-4d01-429c-8104-5e08621da1a3	405246d8-d554-4802-b3ec-6238c11edb2e	g.chr6:32796783C>T	ENST00000374897.2	-	12	2092	c.1961G>A	c.(1960-1962)cGc>cAc	p.R654H	TAP2_ENST00000452392.2_Intron|TAP2_ENST00000374899.4_Intron	NM_000544.3	NP_000535.3	Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)									Vitamin E(DB00163)	CAGCACTGTGCGATCCCCACG	0.587																																					.													.	.			0			.												9.0	10.0	10.0					6																	32796783		1284	2406	3690	SO:0001583	missense	6891	.			ACTGTGCGATCCC	M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000374897.2:c.1961G>A	6.37:g.32796783C>T	ENSP00000364032:p.Arg654His		48	0	0		42	0.07	3	.	67	0.00	0	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000374897.2	37		.	.	.	.	.	.	.	.	.	.	C	14.43	2.533415	0.45073	.	.	ENSG00000204267	ENST00000374897	T	0.80994	-1.44	5.6	4.73	0.59995	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.46145	D	0.000314	D	0.82944	0.5147	M	0.71036	2.16	0.32088	N	0.592229	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85428	0.1147	9	0.72032	D	0.01	.	7.281	0.26312	0.1676:0.7466:0.0:0.0857	.	655;654	Q59H06;Q03519	.;TAP2_HUMAN	H	654	ENSP00000364032:R654H	ENSP00000364032:R654H	R	-	2	0	TAP2	32904761	0.022000	0.18835	0.125000	0.21846	0.132000	0.20833	0.209000	0.17435	1.375000	0.46248	0.596000	0.82720	CGC			0.587	TAP2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000076088.2		NM_000544	
