#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CDA	978	mdanderson.org	37	1	20931514	20931514	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:20931514G>T	ENST00000375071.3	+	2	430	c.248G>T	c.(247-249)aGg>aTg	p.R83M	CDA_ENST00000461985.1_3'UTR	NM_001785.2	NP_001776.1	P32320	CDD_HUMAN	cytidine deaminase	83	CMP/dCMP deaminase zinc-binding.				cell surface receptor signaling pathway (GO:0007166)|cytidine deamination (GO:0009972)|cytosine metabolic process (GO:0019858)|negative regulation of cell growth (GO:0030308)|negative regulation of nucleotide metabolic process (GO:0045980)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine-containing compound salvage (GO:0008655)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	cytidine deaminase activity (GO:0004126)|nucleoside binding (GO:0001882)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	7		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	AAGGATTTCAGGGCAATTGCT	0.468																																					p.R83M	Pancreas(74;49 1356 2772 27818 40529)												.	.			0			c.G248T												93.0	82.0	86.0					1																	20931514		2203	4300	6503	SO:0001583	missense	978	exon2			ATTTCAGGGCAAT	BC054036	CCDS210.1	1p36.2-p35	2008-02-05			ENSG00000158825	ENSG00000158825	3.5.4.5		1712	protein-coding gene	gene with protein product		123920				8422236, 9878810	Standard	NM_001785		Approved	CDD	uc001bdk.3	P32320	OTTHUMG00000002845	ENST00000375071.3:c.248G>T	1.37:g.20931514G>T	ENSP00000364212:p.Arg83Met		52	0	0		55	0.05	3	NM_001785	45	0.00	0		Missense_Mutation	SNP	ENST00000375071.3	37	CCDS210.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.146862	0.37923	.	.	ENSG00000158825	ENST00000375071	T	0.43688	0.94	5.74	-1.66	0.08265	APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.453061	0.26692	N	0.022989	T	0.42359	0.1199	M	0.62154	1.92	0.36219	D	0.851848	P	0.49307	0.922	P	0.46885	0.53	T	0.52939	-0.8508	10	0.72032	D	0.01	.	11.1997	0.48734	0.5175:0.0:0.4825:0.0	.	83	P32320	CDD_HUMAN	M	83	ENSP00000364212:R83M	ENSP00000364212:R83M	R	+	2	0	CDA	20804101	0.978000	0.34361	0.873000	0.34254	0.233000	0.25261	0.381000	0.20619	-0.629000	0.05575	-1.164000	0.01763	AGG			0.468	CDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007965.1		NM_001785	
EIF4G3	8672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	21205927	21205927	+	Silent	SNP	A	A	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:21205927A>G	ENST00000264211.8	-	14	2537	c.2343T>C	c.(2341-2343)acT>acC	p.T781T	EIF4G3_ENST00000537738.1_Silent_p.T271T|EIF4G3_ENST00000602326.1_Silent_p.T787T|EIF4G3_ENST00000374937.3_Silent_p.T787T|EIF4G3_ENST00000400422.1_Silent_p.T781T|EIF4G3_ENST00000536266.1_Silent_p.T385T|EIF4G3_ENST00000374935.3_Silent_p.T501T	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	781	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.|eIF3/EIF4A-binding. {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CTGTGTCAACAGTAAGTCCTG	0.423																																					p.T817T													.	.			0			c.T2451C												253.0	250.0	251.0					1																	21205927		2203	4300	6503	SO:0001819	synonymous_variant	8672	exon18			GTCAACAGTAAGT	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.2343T>C	1.37:g.21205927A>G			110	0	0		106	0.31	33	NM_001198801	61	0.41	25	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Silent	SNP	ENST00000264211.8	37	CCDS214.1																																																																																					0.423	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000007467.3		NM_003760	
CSMD2	114784	ucsc.edu;bcgsc.ca	37	1	34192157	34192157	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:34192157G>T	ENST00000373381.4	-	16	2674	c.2498C>A	c.(2497-2499)aCc>aAc	p.T833N		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	793	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCTGTCGAAGGTGATTTTGAT	0.597																																					p.T793N													.	CSMD2	946		0			c.C2378A												52.0	56.0	55.0					1																	34192157		2203	4300	6503	SO:0001583	missense	114784	exon16			TCGAAGGTGATTT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2498C>A	1.37:g.34192157G>T	ENSP00000362479:p.Thr833Asn		47	0	0		32	0.13	4	NM_052896	6	0.00	0	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	20.1	3.932592	0.73442	.	.	ENSG00000121904	ENST00000373381	T	0.18174	2.23	5.77	5.77	0.91146	CUB (5);	0.056259	0.64402	D	0.000001	T	0.28333	0.0700	L	0.39514	1.22	0.80722	D	1	P;P	0.45634	0.863;0.863	P;P	0.53809	0.735;0.735	T	0.00217	-1.1909	10	0.28530	T	0.3	.	18.9793	0.92749	0.0:0.0:1.0:0.0	.	793;833	Q7Z408;E7EUA6	CSMD2_HUMAN;.	N	833	ENSP00000362479:T833N	ENSP00000241312:T793N	T	-	2	0	CSMD2	33964744	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.199000	0.65152	2.712000	0.92718	0.655000	0.94253	ACC			0.597	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_052896	
LRRN2	10446	hgsc.bcm.edu;bcgsc.ca	37	1	204587180	204587181	+	Frame_Shift_Ins	INS	-	-	A	rs182204828|rs375246174	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:204587180_204587181insA	ENST00000367175.1	-	1	4152_4153	c.1940_1941insT	c.(1939-1941)gcgfs	p.A647fs	LRRN2_ENST00000367176.3_Frame_Shift_Ins_p.A647fs|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Frame_Shift_Ins_p.A647fs|RP11-430C7.4_ENST00000453895.1_RNA			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	647					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.A647V(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			CAAGGTGGGCCGCTAGCCCAGC	0.658																																					p.A647fs													.	LRRN2	81		1	Substitution - Missense(1)	large_intestine(1)	c.1941_1942insT																																									SO:0001589	frameshift_variant	10446	exon3			GTGGGCCGCTAGC	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1940_1941insT	1.37:g.204587180_204587181insA	ENSP00000356143:p.Ala647fs		66	0	0		59	0.17	10	NM_006338	3	0.00	0	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Frame_Shift_Ins	INS	ENST00000367175.1	37	CCDS1448.1																																																																																					0.658	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000089894.1		NM_006338	
USH2A	7399	mdanderson.org	37	1	215814071	215814071	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:215814071G>T	ENST00000307340.3	-	68	15183	c.14797C>A	c.(14797-14799)Cag>Aag	p.Q4933K	USH2A_ENST00000366943.2_Missense_Mutation_p.Q4933K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4933					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTCGGTACTGAGGCACTGTG	0.448										HNSCC(13;0.011)																											p.Q4933K													.	.			0			c.C14797A												90.0	82.0	85.0					1																	215814071		2203	4300	6503	SO:0001583	missense	7399	exon68			GGTACTGAGGCAC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.14797C>A	1.37:g.215814071G>T	ENSP00000305941:p.Gln4933Lys		65	0	0		49	0.06	3	NM_206933	0		0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	9.309	1.054971	0.19907	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.12465	2.69;2.68	5.12	4.2	0.49525	Fibronectin, type III (2);	0.176645	0.27185	N	0.020525	T	0.13030	0.0316	L	0.53249	1.67	0.37725	D	0.925065	P	0.35745	0.518	B	0.35182	0.197	T	0.03403	-1.1040	10	0.06099	T	0.92	.	14.3092	0.66405	0.0:0.1483:0.8517:0.0	.	4933	O75445	USH2A_HUMAN	K	4933	ENSP00000305941:Q4933K;ENSP00000355910:Q4933K	ENSP00000305941:Q4933K	Q	-	1	0	USH2A	213880694	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	3.206000	0.51098	1.278000	0.44430	0.655000	0.94253	CAG			0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128138.1		NM_007123	
TTC13	79573	mdanderson.org	37	1	231075185	231075185	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:231075185G>T	ENST00000366661.4	-	8	854	c.847C>A	c.(847-849)Cct>Act	p.P283T	TTC13_ENST00000366662.4_Missense_Mutation_p.P230T|TTC13_ENST00000414259.1_Missense_Mutation_p.P230T	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	283										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		ATAGCTATAGGCTGGTTTTTG	0.388																																					p.P283T													.	.			0			c.C847A												97.0	92.0	94.0					1																	231075185		2203	4300	6503	SO:0001583	missense	79573	exon8			CTATAGGCTGGTT		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.847C>A	1.37:g.231075185G>T	ENSP00000355621:p.Pro283Thr		37	0	0		37	0.08	3	NM_024525	6	0.00	0	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	37	CCDS1588.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301871	0.81136	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259	T;T;T	0.63744	-0.06;1.11;1.11	5.14	5.14	0.70334	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.72630	0.3484	L	0.41415	1.275	0.80722	D	1	D;D;P;D	0.89917	0.984;1.0;0.949;0.98	P;D;P;P	0.91635	0.831;0.999;0.465;0.779	T	0.70139	-0.4954	10	0.33141	T	0.24	-5.9987	18.598	0.91236	0.0:0.0:1.0:0.0	.	208;230;230;283	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	T	283;230;230	ENSP00000355621:P283T;ENSP00000355622:P230T;ENSP00000416631:P230T	ENSP00000355621:P283T	P	-	1	0	TTC13	229141808	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.391000	0.81399	0.591000	0.81541	CCT			0.388	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092229.2		NM_024525	
MAP1LC3C	440738	mdanderson.org	37	1	242162272	242162272	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr1:242162272G>T	ENST00000357246.3	-	1	103	c.39C>A	c.(37-39)ttC>ttA	p.F13L		NM_001004343.2	NP_001004343.1	Q9BXW4	MLP3C_HUMAN	microtubule-associated protein 1 light chain 3 gamma	13					autophagy (GO:0006914)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|microtubule (GO:0005874)|organelle membrane (GO:0031090)				endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCCTCTGCTTGAAGGGTCTGA	0.453											OREG0014354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F13L													.	.			0			c.C39A												79.0	84.0	83.0					1																	242162272		2202	4299	6501	SO:0001583	missense	440738	exon1			CTGCTTGAAGGGT	AF276659	CCDS31074.1	1q43	2014-02-12			ENSG00000197769	ENSG00000197769			13353	protein-coding gene	gene with protein product		609605				12740394	Standard	NM_001004343		Approved	ATG8J	uc001hzk.2	Q9BXW4	OTTHUMG00000039865	ENST00000357246.3:c.39C>A	1.37:g.242162272G>T	ENSP00000349785:p.Phe13Leu		63	0	0	2432	39	0.08	3	NM_001004343	0		0	A0PJY8|A2RUP0	Missense_Mutation	SNP	ENST00000357246.3	37	CCDS31074.1	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127348	0.56721	.	.	ENSG00000197769	ENST00000357246	T	0.62105	0.05	3.78	1.86	0.25419	.	0.000000	0.85682	D	0.000000	T	0.64843	0.2635	M	0.83223	2.63	0.41456	D	0.98801	P	0.45531	0.86	P	0.46629	0.522	T	0.64132	-0.6479	10	0.87932	D	0	.	5.2524	0.15529	0.1879:0.1698:0.6423:0.0	.	13	Q9BXW4	MLP3C_HUMAN	L	13	ENSP00000349785:F13L	ENSP00000349785:F13L	F	-	3	2	MAP1LC3C	240228895	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	1.959000	0.40412	0.271000	0.22005	0.637000	0.83480	TTC			0.453	MAP1LC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096185.1		NM_001004343	
FAM21A	387680	broad.mit.edu	37	10	51826259	51826259	+	5'Flank	DEL	A	A	-	rs368712005		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr10:51826259delA	ENST00000282633.5	+	0	0				FAM21A_ENST00000314664.7_5'Flank|RP11-324H6.5_ENST00000456967.1_RNA|FAM21A_ENST00000351071.6_5'Flank	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A						retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						TAACAAAAGCAAAAAAAAAAA	0.333																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			AAAAGCAAAAAAA	BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225		10.37:g.51826259delA	Exception_encountered		8	0	0		8	0.63	5	.	0		0	A2A3S2|A2A3U6|Q6DHY0	RNA	DEL	ENST00000282633.5	37	CCDS41527.1																																																																																					0.333	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276917.2		NM_001005751	
PCBD1	5092	mdanderson.org	37	10	72643793	72643793	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr10:72643793G>T	ENST00000299299.3	-	4	479	c.229C>A	c.(229-231)Ctg>Atg	p.L77M	PCBD1_ENST00000493228.1_5'UTR	NM_000281.2	NP_000272.1	P61457	PHS_HUMAN	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha	77					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein homotetramerization (GO:0051289)|regulation of protein homodimerization activity (GO:0043496)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	4-alpha-hydroxytetrahydrobiopterin dehydratase activity (GO:0008124)|identical protein binding (GO:0042802)|phenylalanine 4-monooxygenase activity (GO:0004505)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|large_intestine(1)	4						TGGGTGCTCAGCGTGATGTGG	0.527																																					p.L77M													.	.			0			c.C229A												89.0	73.0	78.0					10																	72643793		2203	4300	6503	SO:0001583	missense	5092	exon4			TGCTCAGCGTGAT	BC006324	CCDS31217.1	10q22	2014-04-01	2007-11-06	2005-02-11	ENSG00000166228	ENSG00000166228	4.2.1.96		8646	protein-coding gene	gene with protein product	"""Pterin-4a-carbinolamine dehydratase (dimerization cofactor of hepatic nuclear factor 1-alpha)"", ""pterin-4-alpha carbinolamine dehydratase"", ""dimerizing cofactor for HNF1"""	126090	"""6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)"", ""pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)"""	DCOH, PCBD		8486378	Standard	XM_005269877		Approved	PCD	uc001jrn.1	P61457	OTTHUMG00000018417	ENST00000299299.3:c.229C>A	10.37:g.72643793G>T	ENSP00000299299:p.Leu77Met		50	0	0		47	0.06	3	NM_000281	203	0.00	0	P70519|P80095|Q9D930	Missense_Mutation	SNP	ENST00000299299.3	37	CCDS31217.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.383544	0.42207	.	.	ENSG00000166228	ENST00000299299	D	0.92348	-3.02	5.69	3.83	0.44106	.	0.000000	0.85682	D	0.000000	D	0.96793	0.8953	H	0.96333	3.805	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	D	0.95745	0.8787	10	0.87932	D	0	.	8.2871	0.31935	0.3696:0.0:0.6304:0.0	.	77	P61457	PHS_HUMAN	M	77	ENSP00000299299:L77M	ENSP00000299299:L77M	L	-	1	2	PCBD1	72313799	0.999000	0.42202	0.997000	0.53966	0.224000	0.24922	2.140000	0.42159	0.741000	0.32674	0.650000	0.86243	CTG			0.527	PCBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048527.1		NM_000281	
EBF3	253738	mdanderson.org	37	10	131761739	131761739	+	Missense_Mutation	SNP	G	G	T	rs143335830		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr10:131761739G>T	ENST00000355311.5	-	2	255	c.183C>A	c.(181-183)aaC>aaA	p.N61K	EBF3_ENST00000368648.3_Missense_Mutation_p.N61K			Q9H4W6	COE3_HUMAN	early B-cell factor 3	61					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		ATTTCCGGAGGTTGGAAGGCG	0.652																																					p.N61K													.	.			0			c.C183A												46.0	51.0	49.0					10																	131761739		2203	4300	6503	SO:0001583	missense	253738	exon2			CCGGAGGTTGGAA		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.183C>A	10.37:g.131761739G>T	ENSP00000347463:p.Asn61Lys		51	0	0		41	0.07	3	NM_001005463	0		0	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	G	19.37	3.815238	0.70912	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.58210	0.35;0.39	3.27	0.794	0.18638	.	0.000000	0.85682	U	0.000000	T	0.66626	0.2808	M	0.87682	2.9	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.61328	0.882;0.887	T	0.65689	-0.6107	10	0.87932	D	0	-10.3465	5.45	0.16560	0.5259:0.0:0.474:0.0	.	61;61	Q9H4W6;Q9H4W6-2	COE3_HUMAN;.	K	61	ENSP00000347463:N61K;ENSP00000357637:N61K	ENSP00000347463:N61K	N	-	3	2	EBF3	131651729	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.402000	0.44521	0.329000	0.23460	0.205000	0.17691	AAC			0.652	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000051015.2		NM_001005463	
TCERG1L	256536	mdanderson.org	37	10	133058643	133058643	+	Silent	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr10:133058643G>A	ENST00000368642.4	-	4	820	c.735C>T	c.(733-735)gcC>gcT	p.A245A		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	245	Poly-Ala.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CCATggcagcggcggcggcgg	0.667																																					p.A245A													.	.			0			c.C735T												17.0	19.0	18.0					10																	133058643		2197	4292	6489	SO:0001819	synonymous_variant	256536	exon4			GGCAGCGGCGGCG	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.735C>T	10.37:g.133058643G>A			19	0	0		41	0.07	3	NM_174937	88	0.00	0	Q5VWI2|Q86XM8	Silent	SNP	ENST00000368642.4	37	CCDS7662.2																																																																																					0.667	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091619.2		NM_174937	
FAM111B	374393	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	58892877	58892877	+	Missense_Mutation	SNP	A	A	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:58892877A>G	ENST00000343597.3	+	4	1498	c.1307A>G	c.(1306-1308)aAg>aGg	p.K436R	FAM111B_ENST00000411426.1_Missense_Mutation_p.K406R|FAM111B_ENST00000529618.1_Missense_Mutation_p.K406R	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	436							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						ATATATAAAAAGGACTTCGGA	0.368																																					p.K436R													.	.			0			c.A1307G												83.0	88.0	86.0					11																	58892877		2200	4295	6495	SO:0001583	missense	374393	exon4			ATAAAAAGGACTT	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1307A>G	11.37:g.58892877A>G	ENSP00000341565:p.Lys436Arg		84	0	0		71	0.07	5	NM_198947	3	0.00	0	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	A	8.427	0.847646	0.17034	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	T;T;T	0.33438	1.41;1.41;1.41	4.63	0.648	0.17801	Peptidase cysteine/serine, trypsin-like (1);	1.111380	0.06888	N	0.803659	T	0.23492	0.0568	L	0.29908	0.895	0.09310	N	1	P	0.43750	0.816	B	0.42282	0.382	T	0.18524	-1.0334	10	0.12430	T	0.62	.	10.5126	0.44870	0.5204:0.4796:0.0:0.0	.	436	Q6SJ93	F111B_HUMAN	R	406;406;436	ENSP00000393855:K406R;ENSP00000432875:K406R;ENSP00000341565:K436R	ENSP00000341565:K436R	K	+	2	0	FAM111B	58649453	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	1.100000	0.31025	-0.047000	0.13423	0.533000	0.62120	AAG			0.368	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393974.1		NM_198947	
NUDT22	84304	mdanderson.org	37	11	63995082	63995082	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:63995082G>T	ENST00000279206.3	+	3	679	c.523G>T	c.(523-525)Ggg>Tgg	p.G175W	TRPT1_ENST00000541278.1_5'Flank|TRPT1_ENST00000546133.1_5'Flank|DNAJC4_ENST00000321685.3_5'Flank|TRPT1_ENST00000317459.6_5'Flank|DNAJC4_ENST00000355040.4_5'Flank|NUDT22_ENST00000441250.2_Intron|TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000546089.1_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA|TRPT1_ENST00000394547.3_5'Flank	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	175	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						GGACCTCGCTGGGCAGCTGGT	0.617																																					p.G175W													.	.			0			c.G523T												93.0	86.0	88.0					11																	63995082		2201	4297	6498	SO:0001583	missense	84304	exon3			CTCGCTGGGCAGC	BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.523G>T	11.37:g.63995082G>T	ENSP00000279206:p.Gly175Trp		81	0	0		48	0.06	3	NM_001128612	20	0.00	0	C9JY06|Q71RD5	Missense_Mutation	SNP	ENST00000279206.3	37	CCDS8061.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.657940	0.29425	.	.	ENSG00000149761	ENST00000279206;ENST00000428347	T;T	0.33654	2.23;1.4	3.97	3.02	0.34903	NUDIX hydrolase domain (1);	0.805140	0.11645	N	0.543392	T	0.49012	0.1532	L	0.47716	1.5	0.30770	N	0.743158	D	0.69078	0.997	D	0.64144	0.922	T	0.49799	-0.8901	10	0.66056	D	0.02	-11.7532	10.2208	0.43196	0.0:0.0:0.8006:0.1994	.	175	Q9BRQ3	NUD22_HUMAN	W	175;206	ENSP00000279206:G175W;ENSP00000401085:G206W	ENSP00000279206:G175W	G	+	1	0	NUDT22	63751658	.	.	0.892000	0.35008	0.034000	0.12701	.	.	0.971000	0.38288	0.462000	0.41574	GGG			0.617	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396304.2		NM_032344	
DPP3	10072	mdanderson.org	37	11	66272124	66272124	+	Silent	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:66272124G>T	ENST00000360510.2	+	17	1985	c.1920G>T	c.(1918-1920)ctG>ctT	p.L640L	DPP3_ENST00000531863.1_Silent_p.L660L|DPP3_ENST00000453114.1_Silent_p.L640L|DPP3_ENST00000541961.1_Silent_p.L640L|DPP3_ENST00000532677.1_Silent_p.L659L|DPP3_ENST00000530165.1_Silent_p.L610L			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	640					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						GGCGGGCCCTGTACGAGGGGT	0.597																																					p.L640L													.	.			0			c.G1920T												97.0	86.0	90.0					11																	66272124		2200	4295	6495	SO:0001819	synonymous_variant	10072	exon17			GGCCCTGTACGAG	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.1920G>T	11.37:g.66272124G>T			51	0	0		39	0.08	3	NM_005700	81	0.00	0	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	CCDS8141.1																																																																																					0.597	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393424.2			
CCDC87	55231	mdanderson.org	37	11	66360429	66360429	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:66360429G>T	ENST00000333861.3	-	1	125	c.58C>A	c.(58-60)Cgt>Agt	p.R20S	CCS_ENST00000533244.1_5'UTR|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	20					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GACAGCGGACGCAGCAGCCGG	0.677											OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R20S													.	.			0			c.C58A												10.0	13.0	12.0					11																	66360429		1951	3868	5819	SO:0001583	missense	55231	exon1			GCGGACGCAGCAG	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.58C>A	11.37:g.66360429G>T	ENSP00000328487:p.Arg20Ser		42	0	0	1091	45	0.07	3	NM_018219	26	0.00	0	Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	37	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	G	9.246	1.039506	0.19669	.	.	ENSG00000182791	ENST00000333861	T	0.28666	1.6	5.39	2.26	0.28386	.	1.162730	0.06525	N	0.740289	T	0.13543	0.0328	N	0.12746	0.255	0.80722	D	1	B	0.12013	0.005	B	0.06405	0.002	T	0.41360	-0.9513	10	0.06365	T	0.9	0.3761	2.1564	0.03814	0.1131:0.1443:0.4689:0.2738	.	20	Q9NVE4	CCD87_HUMAN	S	20	ENSP00000328487:R20S	ENSP00000328487:R20S	R	-	1	0	CCDC87	66117005	0.954000	0.32549	0.974000	0.42286	0.385000	0.30292	0.434000	0.21494	0.271000	0.22005	0.655000	0.94253	CGT			0.677	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393825.1		NM_018219	
CCDC89	220388	mdanderson.org	37	11	85397036	85397036	+	Missense_Mutation	SNP	C	C	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:85397036C>A	ENST00000316398.3	-	1	284	c.138G>T	c.(136-138)agG>agT	p.R46S		NM_152723.1	NP_689936.1	Q8N998	CCD89_HUMAN	coiled-coil domain containing 89	46						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	15		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CCAAGGCTTCCCTCAGACCGT	0.552																																					p.R46S													CCDC89,NS,carcinoma,-1,1	CCDC89	-1	1	0			c.G138T												82.0	73.0	76.0					11																	85397036		2203	4299	6502	SO:0001583	missense	220388	exon1			GGCTTCCCTCAGA	AK095478	CCDS8270.1	11q14.1	2006-03-16			ENSG00000179071	ENSG00000179071			26762	protein-coding gene	gene with protein product						12477932	Standard	NM_152723		Approved	FLJ38159	uc001pau.1	Q8N998	OTTHUMG00000166976	ENST00000316398.3:c.138G>T	11.37:g.85397036C>A	ENSP00000320649:p.Arg46Ser		125	0	0		50	0.06	3	NM_152723	0		0		Missense_Mutation	SNP	ENST00000316398.3	37	CCDS8270.1	.	.	.	.	.	.	.	.	.	.	C	9.507	1.104744	0.20632	.	.	ENSG00000179071	ENST00000316398	.	.	.	5.72	-0.183	0.13284	.	0.709406	0.13009	N	0.421017	T	0.33614	0.0869	M	0.68317	2.08	0.09310	N	0.999993	B	0.26547	0.152	B	0.25140	0.058	T	0.26258	-1.0108	8	.	.	.	-7.2244	2.9501	0.05859	0.1148:0.4221:0.1133:0.3499	.	46	Q8N998	CCD89_HUMAN	S	46	.	.	R	-	3	2	CCDC89	85074684	0.114000	0.22134	0.913000	0.36048	0.308000	0.27856	0.034000	0.13776	0.053000	0.16036	-0.137000	0.14449	AGG			0.552	CCDC89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392182.1		NM_152723	
BCO2	83875	mdanderson.org	37	11	112071399	112071399	+	Missense_Mutation	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:112071399C>T	ENST00000357685.5	+	7	1064	c.929C>T	c.(928-930)gCc>gTc	p.A310V	BCO2_ENST00000531169.1_Missense_Mutation_p.A276V|BCO2_ENST00000438022.1_Missense_Mutation_p.A276V|BCO2_ENST00000361053.4_Missense_Mutation_p.A237V|BCO2_ENST00000526088.1_Missense_Mutation_p.A276V|BCO2_ENST00000393032.2_Missense_Mutation_p.A276V|BCO2_ENST00000532593.1_Missense_Mutation_p.A205V			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	310					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TGGAAAATTGCCACTTCTAAA	0.403																																					p.A310V	GBM(177;1916 2099 21049 29541 39946)												.	.			0			c.C929T												97.0	100.0	99.0					11																	112071399		2201	4297	6498	SO:0001583	missense	83875	exon7			AAATTGCCACTTC	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.929C>T	11.37:g.112071399C>T	ENSP00000350314:p.Ala310Val		77	0.012987013	1		41	0.07	3	NM_031938	2	0.00	0	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	C	7.862	0.726270	0.15439	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49;-3.49;-3.49	5.54	2.02	0.26589	.	0.806329	0.12069	N	0.502412	D	0.82351	0.5018	N	0.01789	-0.72	0.21290	N	0.999737	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.11329	0.004;0.001;0.004;0.006	T	0.68622	-0.5360	10	0.13853	T	0.58	-29.2677	9.2958	0.37815	0.0:0.1876:0.0:0.8124	.	287;237;310;137	C9JEZ9;E9PBI8;Q9BYV7;Q8NAZ7	.;.;BCDO2_HUMAN;.	V	310;276;237;276;276;205;276	ENSP00000350314:A310V;ENSP00000376752:A276V;ENSP00000354338:A237V;ENSP00000414843:A276V;ENSP00000436615:A276V;ENSP00000431802:A205V;ENSP00000437053:A276V	ENSP00000350314:A310V	A	+	2	0	BCO2	111576609	1.000000	0.71417	0.391000	0.26233	0.984000	0.73092	3.593000	0.54001	0.101000	0.17610	-0.237000	0.12165	GCC			0.403	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256570.3		NM_001037290	
APOA5	116519	mdanderson.org	37	11	116661290	116661290	+	Missense_Mutation	SNP	C	C	T	rs71469115		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:116661290C>T	ENST00000227665.4	-	3	689	c.655G>A	c.(655-657)Gcc>Acc	p.A219T	APOA5_ENST00000542499.1_Missense_Mutation_p.A219T|ZNF259_ENST00000227322.3_5'Flank			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	219					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		GCGGGGCTGGCGGGGGCGTGC	0.692																																					p.A219T													.	.			0			c.G655A												10.0	12.0	11.0					11																	116661290		2076	4066	6142	SO:0001583	missense	116519	exon4			GGCTGGCGGGGGC	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.655G>A	11.37:g.116661290C>T	ENSP00000227665:p.Ala219Thr		26	0	0		10	0.20	2	NM_052968	0		0	B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	ENST00000227665.4	37	CCDS8376.2	.	.	.	.	.	.	.	.	.	.	C	9.938	1.216777	0.22373	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	T;T	0.74209	-0.82;-0.82	4.64	2.61	0.31194	Apolipoprotein/apolipophorin (1);	0.465755	0.18233	N	0.147482	T	0.60327	0.2260	L	0.45228	1.405	0.19575	N	0.999962	B;B	0.28178	0.202;0.106	B;B	0.19946	0.027;0.02	T	0.42032	-0.9475	10	0.15499	T	0.54	-5.9054	9.4261	0.38581	0.0:0.8026:0.0:0.1974	.	216;219	B0YIW1;Q6Q788	.;APOA5_HUMAN	T	219	ENSP00000227665:A219T;ENSP00000445002:A219T	ENSP00000227665:A219T	A	-	1	0	APOA5	116166500	0.958000	0.32768	0.748000	0.31131	0.243000	0.25628	3.168000	0.50801	1.168000	0.42723	0.650000	0.86243	GCC			0.692	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106285.2			
STT3A	3703	mdanderson.org	37	11	125484020	125484020	+	Missense_Mutation	SNP	G	G	T	rs113399395		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr11:125484020G>T	ENST00000529196.1	+	15	1799	c.1593G>T	c.(1591-1593)caG>caT	p.Q531H	STT3A_ENST00000531491.1_Missense_Mutation_p.Q439H|STT3A_ENST00000392708.4_Missense_Mutation_p.Q531H			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	531					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		ATGGCTATCAGATTACAGCTA	0.388																																					p.Q531H													.	.			0			c.G1593T												209.0	190.0	196.0					11																	125484020		2201	4299	6500	SO:0001583	missense	3703	exon14			CTATCAGATTACA	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.1593G>T	11.37:g.125484020G>T	ENSP00000436962:p.Gln531His		113	0	0		40	0.08	3	NM_152713	91	0.00	0	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	ENST00000529196.1	37	CCDS8458.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621234	0.87460	.	.	ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491	D;D;D	0.90563	-2.69;-2.69;-2.69	5.94	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.96876	0.8980	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97866	1.0283	10	0.87932	D	0	-22.8942	13.9208	0.63930	0.0743:0.0:0.9257:0.0	.	439;531	B4DJ24;P46977	.;STT3A_HUMAN	H	531;531;439	ENSP00000376472:Q531H;ENSP00000436962:Q531H;ENSP00000432820:Q439H	ENSP00000376472:Q531H	Q	+	3	2	STT3A	124989230	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.855000	0.62925	1.494000	0.48533	0.650000	0.86243	CAG			0.388	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000386691.1		NM_152713	
ACVR1B	91	mdanderson.org	37	12	52369070	52369070	+	Missense_Mutation	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr12:52369070G>A	ENST00000257963.4	+	2	190	c.113G>A	c.(112-114)aGc>aAc	p.S38N	ACVR1B_ENST00000542485.1_De_novo_Start_OutOfFrame|ACVR1B_ENST00000415850.2_Missense_Mutation_p.S38N|ACVR1B_ENST00000541224.1_Missense_Mutation_p.S38N|ACVR1B_ENST00000426655.2_Missense_Mutation_p.S38N	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	38					activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GCGTGCACCAGCTGCCTCCAG	0.512																																					p.S38N													.	.			0			c.G113A												82.0	73.0	76.0					12																	52369070		2203	4300	6503	SO:0001583	missense	91	exon2			GCACCAGCTGCCT		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.113G>A	12.37:g.52369070G>A	ENSP00000257963:p.Ser38Asn		34	0	0		47	0.06	3	NM_004302	245	0.00	0	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	9.780	1.175050	0.21704	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850	D;D;D;D	0.97665	-4.48;-4.48;-4.48;-4.48	4.76	2.93	0.34026	TGF-beta receptor/activin receptor, type I/II (1);	0.270332	0.41396	N	0.000892	D	0.86736	0.6004	N	0.01576	-0.805	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.001;0.002;0.002;0.003	T	0.77859	-0.2431	10	0.16420	T	0.52	.	6.7354	0.23407	0.4163:0.0:0.5837:0.0	.	38;38;38;38	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	N	38	ENSP00000257963:S38N;ENSP00000442656:S38N;ENSP00000390477:S38N;ENSP00000397550:S38N	ENSP00000257963:S38N	S	+	2	0	ACVR1B	50655337	0.107000	0.21998	1.000000	0.80357	0.992000	0.81027	0.340000	0.19892	0.694000	0.31654	-0.143000	0.13931	AGC			0.512	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397000.1		NM_020328	
HOXC11	3227	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	54367505	54367505	+	Silent	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr12:54367505C>T	ENST00000546378.1	+	1	596	c.480C>T	c.(478-480)tgC>tgT	p.C160C	HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Silent_p.C160C|HOTAIR_ENST00000424518.1_RNA			O43248	HXC11_HUMAN	homeobox C11	160					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						ACGCCTACTGCGGTGGCGGCG	0.721			T	NUP98	AML																																p.C160C				Dom	yes		12	12q13.3	3227	homeo box C11		L	.	HOXC11	32		0			c.C480T												22.0	29.0	27.0					12																	54367505		2202	4295	6497	SO:0001819	synonymous_variant	3227	exon1			CTACTGCGGTGGC		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.480C>T	12.37:g.54367505C>T			94	0.0106382979	1		183	0.21	39	NM_014212	0		0	A8K7D1|Q96DH2	Silent	SNP	ENST00000546378.1	37	CCDS8867.1																																																																																					0.721	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358869.2			
EP400	57634	broad.mit.edu;mdanderson.org	37	12	132551433	132551433	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr12:132551433G>T	ENST00000333577.4	+	50	8885	c.8776G>T	c.(8776-8778)Gtc>Ttc	p.V2926F	EP400_ENST00000389561.2_Missense_Mutation_p.V2890F|EP400_ENST00000389562.2_Missense_Mutation_p.V2889F|EP400_ENST00000332482.4_Missense_Mutation_p.V2853F|EP400_ENST00000330386.6_Missense_Mutation_p.V2809F			Q96L91	EP400_HUMAN	E1A binding protein p400	2926					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGCAGCTGTGGTCTCCTCACC	0.687																																					p.V2890F													.	EP400	370		0			c.G8668T												34.0	35.0	35.0					12																	132551433		2203	4299	6502	SO:0001583	missense	57634	exon49			GCTGTGGTCTCCT	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8776G>T	12.37:g.132551433G>T	ENSP00000333602:p.Val2926Phe		58	0	0		82	0.06	5	NM_015409	150	0.00	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	G	15.49	2.847601	0.51164	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.93547	-3.24;-3.24;-3.16;-3.17;-3.19	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.94706	0.8292	L	0.32530	0.975	0.48696	D	0.999697	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	D;D;D;D	0.87578	0.979;0.998;0.998;0.998	D	0.95556	0.8625	10	0.66056	D	0.02	.	17.9511	0.89053	0.0:0.0:1.0:0.0	.	2926;2890;2809;2889	Q96L91;Q96L91-2;Q96L91-4;Q96L91-5	EP400_HUMAN;.;.;.	F	2926;2890;2889;2853;2809;2890	ENSP00000333602:V2926F;ENSP00000374212:V2890F;ENSP00000374213:V2889F;ENSP00000331737:V2853F;ENSP00000330620:V2809F	ENSP00000330620:V2809F	V	+	1	0	EP400	131117386	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	9.476000	0.97823	2.244000	0.73946	0.561000	0.74099	GTC			0.687	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015409	
PROZ	8858	mdanderson.org	37	13	113826050	113826050	+	Silent	SNP	C	C	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr13:113826050C>A	ENST00000375547.2	+	8	841	c.834C>A	c.(832-834)ctC>ctA	p.L278L	PROZ_ENST00000342783.4_Silent_p.L300L	NM_003891.2	NP_003882.1	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma glycoprotein	278	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(2)|skin(2)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	GTGCGGGGCTCCCCGTGTGCA	0.662																																					p.L300L													.	.			0			c.C900A												69.0	68.0	68.0					13																	113826050		2203	4300	6503	SO:0001819	synonymous_variant	8858	exon9			GGGGCTCCCCGTG	M55670	CCDS9531.1, CCDS58300.1	13q34	2008-07-18			ENSG00000126231	ENSG00000126231			9460	protein-coding gene	gene with protein product		176895				2244898, 2403355	Standard	NM_001256134		Approved	PZ	uc010agr.2	P22891	OTTHUMG00000017376	ENST00000375547.2:c.834C>A	13.37:g.113826050C>A			36	0	0		37	0.08	3	NM_001256134	8	0.00	0	A6NMB4|Q15213|Q5JVF5|Q5JVF6	Silent	SNP	ENST00000375547.2	37	CCDS9531.1																																																																																					0.662	PROZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000045845.1		NM_003891	
UNKL	64718	mdanderson.org	37	16	1447227	1447227	+	Missense_Mutation	SNP	G	G	T	rs144818814	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr16:1447227G>T	ENST00000389221.4	-	6	803	c.804C>A	c.(802-804)gaC>gaA	p.D268E	UNKL_ENST00000397462.1_Missense_Mutation_p.D371E|UNKL_ENST00000508903.2_Missense_Mutation_p.D268E	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	268					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				ACTGGCAGCCGTCGCCGCCAT	0.667																																					p.D268E													.	.			0			c.C804A																																									SO:0001583	missense	64718	exon6			GCAGCCGTCGCCG	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.804C>A	16.37:g.1447227G>T	ENSP00000373873:p.Asp268Glu		20	0	0		19	0.16	3	NM_001193388	10	0.00	0	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	ENST00000389221.4	37	CCDS53981.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082979	0.55861	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462	T	0.68765	-0.35	4.05	3.06	0.35304	.	0.000000	0.85682	D	0.000000	T	0.76521	0.3999	M	0.83483	2.645	0.54753	D	0.999987	.	.	.	.	.	.	T	0.77501	-0.2564	8	0.44086	T	0.13	.	10.2362	0.43284	0.1091:0.0:0.8909:0.0	.	.	.	.	E	268;268;371	ENSP00000373873:D268E	ENSP00000373873:D268E	D	-	3	2	UNKL	1387228	0.731000	0.28111	0.997000	0.53966	0.090000	0.18270	0.904000	0.28491	1.984000	0.57885	0.491000	0.48974	GAC			0.667	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_001037125	
SPG7	6687	mdanderson.org	37	16	89616973	89616973	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr16:89616973G>T	ENST00000268704.2	+	13	1750	c.1735G>T	c.(1735-1737)Gcc>Tcc	p.A579S		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	579					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GTCGGGCCACGCCTTGGTGGG	0.597																																					p.A579S													.	.			0			c.G1735T												103.0	97.0	99.0					16																	89616973		2198	4300	6498	SO:0001583	missense	6687	exon13			GGCCACGCCTTGG	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1735G>T	16.37:g.89616973G>T	ENSP00000268704:p.Ala579Ser		47	0	0		55	0.05	3	NM_003119	290	0.00	0	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	37	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861083	0.71949	.	.	ENSG00000197912	ENST00000268704	D	0.89617	-2.54	5.84	5.84	0.93424	Peptidase M41 (1);Peptidase M41, FtsH (2);	0.091222	0.85682	D	0.000000	D	0.96759	0.8942	H	0.96604	3.85	0.80722	D	1	D	0.64830	0.994	D	0.75020	0.985	D	0.97448	1.0026	10	0.87932	D	0	-1.1864	20.1278	0.97990	0.0:0.0:1.0:0.0	.	579	Q9UQ90	SPG7_HUMAN	S	579	ENSP00000268704:A579S	ENSP00000268704:A579S	A	+	1	0	SPG7	88144474	1.000000	0.71417	0.251000	0.24312	0.267000	0.26476	7.646000	0.83445	2.768000	0.95171	0.561000	0.74099	GCC			0.597	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269921.2		NM_003119	
FGF11	2256	mdanderson.org	37	17	7343090	7343090	+	Nonsense_Mutation	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:7343090C>T	ENST00000293829.4	+	1	745	c.151C>T	c.(151-153)Cga>Tga	p.R51*	RP11-104H15.8_ENST00000576615.1_RNA|FGF11_ENST00000575398.1_5'Flank|FGF11_ENST00000575082.1_5'Flank|FGF11_ENST00000575235.1_Intron|RP11-104H15.10_ENST00000575331.1_RNA|RP11-104H15.7_ENST00000575310.1_RNA|FGF11_ENST00000572907.1_5'Flank|RP11-104H15.9_ENST00000570444.1_RNA	NM_004112.2	NP_004103.1	Q92914	FGF11_HUMAN	fibroblast growth factor 11	51					cell-cell signaling (GO:0007267)|nervous system development (GO:0007399)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	growth factor activity (GO:0008083)			central_nervous_system(1)|large_intestine(3)|ovary(1)|prostate(1)	6		Prostate(122;0.157)				GTCCAAGGTGCGACTGTgcgg	0.746																																					p.R51X													.	.			0			c.C151T												6.0	7.0	7.0					17																	7343090		2138	4184	6322	SO:0001587	stop_gained	2256	exon1			AAGGTGCGACTGT		CCDS11105.1	17p13.1	2008-07-18			ENSG00000161958	ENSG00000161958			3667	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 3"""	601514				8790420	Standard	NM_004112		Approved	FHF3, FLJ16061, MGC45269, MGC102953	uc002ggz.3	Q92914	OTTHUMG00000108136	ENST00000293829.4:c.151C>T	17.37:g.7343090C>T	ENSP00000293829:p.Arg51*		32	0	0		28	0.11	3	NM_004112	0		0	Q2YDX8	Nonsense_Mutation	SNP	ENST00000293829.4	37	CCDS11105.1	.	.	.	.	.	.	.	.	.	.	C	42	9.579851	0.99210	.	.	ENSG00000161958	ENST00000293829	.	.	.	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2583	0.66067	0.0:1.0:0.0:0.0	.	.	.	.	X	51	.	ENSP00000293829:R51X	R	+	1	2	FGF11	7283814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.695000	0.47043	2.426000	0.82243	0.478000	0.44815	CGA			0.746	FGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226939.3		NM_004112	
TVP23C	201158	broad.mit.edu	37	17	15441469	15441469	+	Intron	SNP	C	C	T	rs568909748	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:15441469C>T	ENST00000225576.3	-	5	558				TVP23C_ENST00000438826.3_Splice_Site|TVP23C_ENST00000428082.2_Splice_Site|TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000584811.1_Splice_Site|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000583206.1_5'Flank	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											TCCAGTGTTCCGCAAAAGACA	0.393													c|||	3	0.000599042	0.0015	0.0	5008	,	,		17476	0.001		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001627	intron_variant	201158	.			GTGTTCCGCAAAA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+7629G>A	17.37:g.15441469C>T			294	0.0068027211	2		237	0.03	6	.	3	0.00	0	Q3LIC7	Splice_Site	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	c	13.58	2.280351	0.40294	.	.	ENSG00000175106	ENST00000438826	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0583	0.25111	0.0:0.1033:0.0:0.8967	.	.	.	.	.	-1	.	.	.	-	.	.	FAM18B2	15382194	1.000000	0.71417	0.996000	0.52242	0.698000	0.40448	1.919000	0.40015	0.852000	0.35287	-0.352000	0.07741	.			0.393	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
KRT18P55	284085	broad.mit.edu	37	17	26633347	26633348	+	RNA	INS	-	-	G	rs35679432|rs6505076	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:26633347_26633348insG	ENST00000577198.1	-	0	407					NR_028334.1				keratin 18 pseudogene 55																		ttgttgttgttttttttttttt	0.262													|||unknown(HR)	1257	0.250998	0.1861	0.3343	5008	,	,		18973	0.0665		0.4294	False		,,,				2504	0.2863				.													.	.			0			.																																											0	.			TGTTGTTTTTTTT			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26633347_26633348insG			9	0	0		9	0.56	5	.	0		0		RNA	INS	ENST00000577198.1	37																																																																																						0.262	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446194.1		NR_028334	
SOCS7	30837	broad.mit.edu	37	17	36508345	36508345	+	Missense_Mutation	SNP	T	T	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:36508345T>G	ENST00000577233.1	+	1	218	c.218T>G	c.(217-219)gTc>gGc	p.V73G	SOCS7_ENST00000331159.5_Missense_Mutation_p.V73G	NM_014598.2	NP_055413.1	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7	73					fat cell differentiation (GO:0045444)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of signal transduction (GO:0009968)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			central_nervous_system(1)|endometrium(1)|kidney(1)|prostate(1)|skin(5)	9	Breast(7;3.47e-17)					GGGCCGGGGGTCAAGACAGTC	0.781																																					p.V73G													.	SOCS7	22		0			c.T218G												2.0	3.0	3.0					17																	36508345		1251	2531	3782	SO:0001583	missense	30837	exon1			CGGGGGTCAAGAC	AB005216	CCDS32637.1	17q12	2014-08-12			ENSG00000274211	ENSG00000274211		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	29846	protein-coding gene	gene with protein product	"""Nck, Ash and phospholipase C binding protein"", ""NCK-associated protein 4"""	608788				9344857, 12076535	Standard	XM_005257264		Approved	NAP4, NCKAP4	uc002hqa.3	O14512	OTTHUMG00000188546	ENST00000577233.1:c.218T>G	17.37:g.36508345T>G	ENSP00000464034:p.Val73Gly		29	0.1379310345	4		29	0.10	3	NM_014598	13	0.00	0	A2VCU2|Q0IJ63	Missense_Mutation	SNP	ENST00000577233.1	37	CCDS32637.1	.	.	.	.	.	.	.	.	.	.	-	9.091	1.001616	0.19121	.	.	ENSG00000174111	ENST00000331159	T	0.46063	0.88	3.4	1.17	0.20885	.	0.660835	0.12477	N	0.465489	T	0.20251	0.0487	N	0.08118	0	0.26653	N	0.97207	B	0.02656	0.0	B	0.01281	0.0	T	0.16897	-1.0387	10	0.72032	D	0.01	-4.8889	4.5822	0.12264	0.0:0.2878:0.0:0.7122	.	73	O14512	SOCS7_HUMAN	G	73	ENSP00000330659:V73G	ENSP00000330659:V73G	V	+	2	0	SOCS7	33761871	0.001000	0.12720	0.972000	0.41901	0.845000	0.48019	0.114000	0.15520	0.494000	0.27859	0.330000	0.21533	GTC			0.781	SOCS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440486.4		XM_371052	
MLX	6945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40720884	40720884	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:40720884G>T	ENST00000246912.4	+	4	414	c.361G>T	c.(361-363)Gcc>Tcc	p.A121S	MLX_ENST00000435881.2_Missense_Mutation_p.A67S|MLX_ENST00000346833.4_Missense_Mutation_p.A37S	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	121					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		CCACCAGGAGGCCTACAAGGA	0.612																																					p.A121S	GBM(121;657 1601 4665 24731 34640)												.	.			0			c.G361T												37.0	32.0	34.0					17																	40720884		2203	4300	6503	SO:0001583	missense	6945	exon4			CAGGAGGCCTACA	AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.361G>T	17.37:g.40720884G>T	ENSP00000246912:p.Ala121Ser		112	0	0		80	0.23	18	NM_170607	133	0.38	51	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Missense_Mutation	SNP	ENST00000246912.4	37	CCDS11430.1	.	.	.	.	.	.	.	.	.	.	G	4.681	0.126706	0.08931	.	.	ENSG00000108788	ENST00000346833;ENST00000246912;ENST00000435881	T;T;T	0.78595	-1.06;-1.19;-1.0	5.53	3.27	0.37495	.	0.287715	0.37669	N	0.001998	T	0.49898	0.1584	N	0.14661	0.345	0.27825	N	0.941642	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.37934	-0.9684	10	0.05351	T	0.99	-14.8344	2.1099	0.03700	0.2392:0.0823:0.14:0.5384	.	37;121;67	Q9UH92-2;Q9UH92;Q9UH92-3	.;MLX_HUMAN;.	S	37;121;67	ENSP00000320913:A37S;ENSP00000246912:A121S;ENSP00000416627:A67S	ENSP00000246912:A121S	A	+	1	0	MLX	37974410	0.681000	0.27614	1.000000	0.80357	0.995000	0.86356	0.255000	0.18333	1.123000	0.41961	-0.262000	0.10625	GCC			0.612	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000450415.1		NM_170607	
CA10	56934	mdanderson.org	37	17	49726574	49726574	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:49726574G>T	ENST00000285273.4	-	7	1714	c.603C>A	c.(601-603)aaC>aaA	p.N201K	CA10_ENST00000340813.6_Missense_Mutation_p.N207K|CA10_ENST00000451037.2_Missense_Mutation_p.N201K|CA10_ENST00000571918.1_5'UTR|CA10_ENST00000570565.1_Missense_Mutation_p.N126K|CA10_ENST00000442502.2_Missense_Mutation_p.N201K	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	201					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TAGTATCTCTGTTGAGCATTC	0.388																																					p.N201K													.	.			0			c.C603A												126.0	131.0	129.0					17																	49726574		2203	4300	6503	SO:0001583	missense	56934	exon6			ATCTCTGTTGAGC	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.603C>A	17.37:g.49726574G>T	ENSP00000285273:p.Asn201Lys		63	0	0		43	0.07	3	NM_020178	0		0	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155415	0.57259	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.37	5.37	0.77165	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	L	0.47716	1.5	0.80722	D	1	P;P;B	0.41673	0.759;0.759;0.257	P;P;B	0.47299	0.543;0.543;0.158	T	0.68315	-0.5441	10	0.40728	T	0.16	.	18.0905	0.89474	0.0:0.0:1.0:0.0	.	201;207;126	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	K	201;201;201;207	ENSP00000390666:N201K;ENSP00000285273:N201K;ENSP00000405388:N201K;ENSP00000340363:N207K	ENSP00000285273:N201K	N	-	3	2	CA10	47081573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.035000	0.93752	2.494000	0.84150	0.591000	0.81541	AAC			0.388	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000437480.1		NM_020178	
C17orf64	124773	mdanderson.org	37	17	58503678	58503678	+	Nonsense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:58503678G>T	ENST00000269127.4	+	3	394	c.310G>T	c.(310-312)Gaa>Taa	p.E104*		NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64	104										breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			CCAAGCCTGGGAAATCAAACA	0.517																																					p.E104X													.	.			0			c.G310T												128.0	117.0	121.0					17																	58503678		692	1591	2283	SO:0001587	stop_gained	124773	exon3			GCCTGGGAAATCA	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171	ENST00000269127.4:c.310G>T	17.37:g.58503678G>T	ENSP00000269127:p.Glu104*		53	0	0		45	0.07	3	NM_181707	0		0	Q8IY87	Nonsense_Mutation	SNP	ENST00000269127.4	37	CCDS32698.2	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655860	0.88056	.	.	ENSG00000141371	ENST00000428000;ENST00000269127	.	.	.	5.49	5.49	0.81192	.	0.097133	0.45126	D	0.000387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-17.5771	16.2979	0.82784	0.0:0.0:1.0:0.0	.	.	.	.	X	98;104	.	ENSP00000269127:E104X	E	+	1	0	C17orf64	55858460	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.126000	0.71635	2.591000	0.87537	0.655000	0.94253	GAA			0.517	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000347743.1		NM_181707	
KCNH6	81033	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61619790	61619790	+	Missense_Mutation	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:61619790C>T	ENST00000583023.1	+	9	2154	c.2143C>T	c.(2143-2145)Cgg>Tgg	p.R715W	KCNH6_ENST00000581784.1_Missense_Mutation_p.R662W|KCNH6_ENST00000456941.2_Missense_Mutation_p.R662W|KCNH6_ENST00000314672.5_Missense_Mutation_p.R715W	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	715					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CTTCAACCTGCGGGACGTGAG	0.622																																					p.R715W													.	KCNH6	122		0			c.C2143T												74.0	65.0	68.0					17																	61619790		2203	4300	6503	SO:0001583	missense	81033	exon9			AACCTGCGGGACG	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2143C>T	17.37:g.61619790C>T	ENSP00000463533:p.Arg715Trp		60	0	0		34	0.18	6	NM_030779	1	0.00	0	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623512	0.66901	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.99422	-5.38;-5.88	4.85	4.85	0.62838	.	0.076916	0.50627	D	0.000109	D	0.99223	0.9730	L	0.54323	1.7	0.50313	D	0.999866	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.91635	0.995;0.918;0.999;0.987	D	0.98894	1.0774	10	0.87932	D	0	.	12.7309	0.57197	0.3144:0.6856:0.0:0.0	.	592;715;662;715	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	W	715;662	ENSP00000318212:R715W;ENSP00000396900:R662W	ENSP00000318212:R715W	R	+	1	2	KCNH6	58973522	0.958000	0.32768	1.000000	0.80357	0.983000	0.72400	0.700000	0.25601	2.213000	0.71641	0.563000	0.77884	CGG			0.622	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443853.1		NM_030779	
USP36	57602	mdanderson.org	37	17	76799994	76799994	+	Silent	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:76799994C>T	ENST00000542802.3	-	16	2726	c.2283G>A	c.(2281-2283)ttG>ttA	p.L761L	USP36_ENST00000312010.6_Silent_p.L761L|USP36_ENST00000449938.2_Intron			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	761					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			TACTGGACAGCAATGTGGGGT	0.632																																					p.L761L													.	.			0			c.G2283A												23.0	30.0	27.0					17																	76799994		1922	3661	5583	SO:0001819	synonymous_variant	57602	exon16			GGACAGCAATGTG	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.2283G>A	17.37:g.76799994C>T			30	0	0		33	0.09	3	NM_025090	120	0.00	0	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Silent	SNP	ENST00000542802.3	37	CCDS32755.1																																																																																					0.632	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437472.3		NM_025090	
SIRT7	51547	ucsc.edu;bcgsc.ca	37	17	79873553	79873553	+	Missense_Mutation	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr17:79873553G>A	ENST00000328666.6	-	4	403	c.341C>T	c.(340-342)gCg>gTg	p.A114V		NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	114	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TGGGATAGACGCTGCCTGCAT	0.552																																					p.A114V													.	SIRT7	37		0			c.C341T												63.0	56.0	58.0					17																	79873553		2203	4299	6502	SO:0001583	missense	51547	exon4			ATAGACGCTGCCT	AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.341C>T	17.37:g.79873553G>A	ENSP00000329466:p.Ala114Val		43	0	0		42	0.10	4	NM_016538	58	0.00	0	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Missense_Mutation	SNP	ENST00000328666.6	37	CCDS11792.1	.	.	.	.	.	.	.	.	.	.	G	34	5.318767	0.95682	.	.	ENSG00000187531	ENST00000328666;ENST00000536038	T	0.23552	1.9	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.61739	0.2371	M	0.92880	3.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.965	T	0.72966	-0.4131	10	0.87932	D	0	-18.7783	18.7772	0.91915	0.0:0.0:1.0:0.0	.	114;114	A8K2K0;Q9NRC8	.;SIRT7_HUMAN	V	114;97	ENSP00000329466:A114V	ENSP00000329466:A114V	A	-	2	0	SIRT7	77466845	1.000000	0.71417	0.979000	0.43373	0.813000	0.45954	9.342000	0.97044	2.428000	0.82296	0.655000	0.94253	GCG			0.552	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439961.1		NM_016538	
EPB41L3	23136	mdanderson.org	37	18	5397245	5397245	+	Missense_Mutation	SNP	C	C	T	rs147247153		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr18:5397245C>T	ENST00000341928.2	-	18	2993	c.2653G>A	c.(2653-2655)Gca>Aca	p.A885T	EPB41L3_ENST00000342933.3_Missense_Mutation_p.A885T|EPB41L3_ENST00000427684.2_Missense_Mutation_p.A182T|EPB41L3_ENST00000540638.2_Missense_Mutation_p.A663T|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000544123.1_Missense_Mutation_p.A716T|EPB41L3_ENST00000400111.3_Missense_Mutation_p.A663T|EPB41L3_ENST00000542146.1_Missense_Mutation_p.A190T	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	885	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CCTGTGAATGCGGGCTGTGCT	0.612																																					p.A885T													.	.			0			c.G2653A							C	THR/ALA	0,4406		0,0,2203	95.0	82.0	86.0		2653	2.0	0.0	18	dbSNP_134	86	1,8599	1.2+/-3.3	0,1,4299	yes	missense	EPB41L3	NM_012307.2	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	885/1088	5397245	1,13005	2203	4300	6503	SO:0001583	missense	23136	exon18			TGAATGCGGGCTG	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2653G>A	18.37:g.5397245C>T	ENSP00000343158:p.Ala885Thr		60	0	0		53	0.06	3	NM_012307	1	0.00	0	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	C	2.727	-0.265280	0.05754	0.0	1.16E-4	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66	5.73	1.97	0.26223	.	1.523560	0.03311	N	0.190565	T	0.35885	0.0947	N	0.25647	0.755	0.09310	N	1	B;B;B;B;B;B;B;B	0.21381	0.002;0.001;0.003;0.008;0.002;0.055;0.045;0.005	B;B;B;B;B;B;B;B	0.17979	0.002;0.001;0.008;0.003;0.001;0.02;0.007;0.002	T	0.19128	-1.0315	10	0.13108	T	0.6	.	9.6451	0.39863	0.0:0.7306:0.0:0.2694	.	716;182;190;277;554;663;885;120	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	T	885;554;716;554;182;190;885;663	ENSP00000343158:A885T;ENSP00000441174:A716T;ENSP00000392195:A182T;ENSP00000442233:A190T;ENSP00000341138:A885T;ENSP00000382981:A663T	ENSP00000343158:A885T	A	-	1	0	EPB41L3	5387245	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.058000	0.11750	0.073000	0.16731	-0.216000	0.12614	GCA	0		0.612	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254424.1		NM_012307	
ONECUT2	9480	mdanderson.org	37	18	55103949	55103949	+	Missense_Mutation	SNP	A	A	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr18:55103949A>G	ENST00000491143.2	+	1	1033	c.1001A>G	c.(1000-1002)aAc>aGc	p.N334S	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	334					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		GAAGAAATCAACACCAAAGAG	0.652																																					p.N334S													.	.			0			c.A1001G												26.0	30.0	29.0					18																	55103949		2095	4241	6336	SO:0001583	missense	9480	exon1			AAATCAACACCAA	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.1001A>G	18.37:g.55103949A>G	ENSP00000419185:p.Asn334Ser		54	0	0		40	0.08	3	NM_004852	0		0		Missense_Mutation	SNP	ENST00000491143.2	37	CCDS42440.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.064934	0.76187	.	.	ENSG00000119547	ENST00000491143;ENST00000262095	.	.	.	4.87	4.87	0.63330	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	T	0.79656	0.4483	M	0.85630	2.765	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.83078	-0.0139	9	0.87932	D	0	-25.5326	12.4278	0.55557	1.0:0.0:0.0:0.0	.	334	O95948	ONEC2_HUMAN	S	315;334	.	ENSP00000262095:N334S	N	+	2	0	ONECUT2	53254947	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.195000	0.94971	1.846000	0.53633	0.374000	0.22700	AAC			0.652	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357264.3			
VPS4B	9525	mdanderson.org	37	18	61064290	61064290	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr18:61064290G>T	ENST00000238497.5	-	9	1272	c.1069C>A	c.(1069-1071)Cag>Aag	p.Q357K	VPS4B_ENST00000591383.1_5'Flank	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	357					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						GTAGCTGACTGTACTTTCCTA	0.393																																					p.Q357K													.	.			0			c.C1069A												104.0	101.0	102.0					18																	61064290		2203	4300	6503	SO:0001583	missense	9525	exon9			CTGACTGTACTTT	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.1069C>A	18.37:g.61064290G>T	ENSP00000238497:p.Gln357Lys		84	0.0119047619	1		44	0.07	3	NM_004869	36	0.00	0	Q69HW4|Q9GZS7	Missense_Mutation	SNP	ENST00000238497.5	37	CCDS11983.1	.	.	.	.	.	.	.	.	.	.	G	34	5.295164	0.95574	.	.	ENSG00000119541	ENST00000238497	D	0.93811	-3.29	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.96259	0.8780	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.998	D;D;D	0.85130	0.996;0.997;0.996	D	0.95394	0.8484	10	0.54805	T	0.06	-18.4877	20.8794	0.99867	0.0:0.0:1.0:0.0	.	357;357;357	A8K5D8;A8K4G7;O75351	.;.;VPS4B_HUMAN	K	357	ENSP00000238497:Q357K	ENSP00000238497:Q357K	Q	-	1	0	VPS4B	59215270	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	CAG			0.393	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256198.2		NM_004869	
CAMSAP3	57662	mdanderson.org	37	19	7677132	7677132	+	Missense_Mutation	SNP	T	T	C	rs147882622		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr19:7677132T>C	ENST00000160298.4	+	11	1854	c.1753T>C	c.(1753-1755)Tcc>Ccc	p.S585P	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.S612P	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	585					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CGGAGCGGGGTCCCCCACGTC	0.647																																					p.S612P													.	.			0			c.T1834C												6.0	8.0	7.0					19																	7677132		1864	4043	5907	SO:0001583	missense	57662	exon13			GCGGGGTCCCCCA	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1753T>C	19.37:g.7677132T>C	ENSP00000160298:p.Ser585Pro		33	0.0303030303	1		30	0.13	4	NM_001080429	65	0.00	0	Q8NDF1	Missense_Mutation	SNP	ENST00000160298.4	37	CCDS42489.1	.	.	.	.	.	.	.	.	.	.	t	9.926	1.213513	0.22289	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.15952	2.38;2.38	3.96	2.87	0.33458	.	3.429250	0.01465	U	0.016052	T	0.14442	0.0349	N	0.22421	0.69	0.27273	N	0.958306	B;B	0.09022	0.002;0.001	B;B	0.09377	0.001;0.004	T	0.15867	-1.0422	10	0.32370	T	0.25	-3.9478	8.9041	0.35512	0.0:0.0:0.2932:0.7068	.	585;612	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	P	612;585	ENSP00000416797:S612P;ENSP00000160298:S585P	ENSP00000160298:S585P	S	+	1	0	KIAA1543	7583132	0.000000	0.05858	0.985000	0.45067	0.978000	0.69477	-0.357000	0.07651	1.422000	0.47177	0.445000	0.29226	TCC			0.647	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459300.1		XM_048362	
MUC16	94025	broad.mit.edu	37	19	9046934	9046934	+	Missense_Mutation	SNP	T	T	C			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr19:9046934T>C	ENST00000397910.4	-	5	34900	c.34697A>G	c.(34696-34698)gAg>gGg	p.E11566G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11568	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATATGGGGTCTCACTCAATGT	0.498																																					p.E11566G													.	MUC16	4315		0			c.A34697G												151.0	149.0	150.0					19																	9046934		1979	4160	6139	SO:0001583	missense	94025	exon5			GGGGTCTCACTCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34697A>G	19.37:g.9046934T>C	ENSP00000381008:p.Glu11566Gly		105	0	0		99	0.04	4	NM_024690	4	0.00	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	6.846	0.525336	0.13066	.	.	ENSG00000181143	ENST00000397910	T	0.02236	4.38	2.89	-3.98	0.04082	.	.	.	.	.	T	0.01421	0.0046	N	0.19112	0.55	.	.	.	B	0.22146	0.065	B	0.19148	0.024	T	0.47182	-0.9137	8	0.87932	D	0	.	1.0946	0.01670	0.4833:0.1175:0.164:0.2352	.	11566	B5ME49	.	G	11566	ENSP00000381008:E11566G	ENSP00000381008:E11566G	E	-	2	0	MUC16	8907934	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.894000	0.00340	-1.164000	0.02790	0.378000	0.23410	GAG			0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402806.1		NM_024690	
ZNF85	7639	mdanderson.org	37	19	21132802	21132802	+	Silent	SNP	C	C	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr19:21132802C>A	ENST00000328178.8	+	4	1595	c.1482C>A	c.(1480-1482)ccC>ccA	p.P494P	ZNF85_ENST00000345030.6_Silent_p.P461P|ZNF85_ENST00000601023.1_Silent_p.P435P	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	494					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						TTAAATGGCCCTCAACCCTTA	0.353																																					p.P524P													.	.			0			c.C1572A												24.0	26.0	25.0					19																	21132802		2193	4289	6482	SO:0001819	synonymous_variant	7639	exon5			ATGGCCCTCAACC	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.1482C>A	19.37:g.21132802C>A			24	0	0		47	0.06	3	NM_001256171	25	0.00	0	B9ZVP4|Q6NVI0	Silent	SNP	ENST00000328178.8	37	CCDS32977.1																																																																																					0.353	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463430.1		NM_003429	
FBXO46	23403	mdanderson.org	37	19	46215771	46215771	+	Missense_Mutation	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr19:46215771G>A	ENST00000317683.3	-	2	1116	c.983C>T	c.(982-984)gCc>gTc	p.A328V		NM_001080469.1	NP_001073938.1	Q6PJ61	FBX46_HUMAN	F-box protein 46	328										breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(2)|skin(1)	15		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		ATCCGCCCTGGCCAGCAGGAA	0.701																																					p.A328V													.	.			0			c.C983T												23.0	26.0	25.0					19																	46215771		1980	4141	6121	SO:0001583	missense	23403	exon2			GCCCTGGCCAGCA	BC021978	CCDS46116.1	19q13.3	2008-02-05	2004-06-15	2004-06-16		ENSG00000177051		"""F-boxes /  ""other"""""	25069	protein-coding gene	gene with protein product		609117	"""F-box only protein 34-like"""	FBXO34L		9585442	Standard	NM_001080469		Approved	20D7-FC4, Fbx46	uc002pcz.3	Q6PJ61		ENST00000317683.3:c.983C>T	19.37:g.46215771G>A	ENSP00000410007:p.Ala328Val		56	0	0		42	0.07	3	NM_001080469	39	0.00	0		Missense_Mutation	SNP	ENST00000317683.3	37	CCDS46116.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384826	0.42308	.	.	ENSG00000177051	ENST00000317683	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	T	0.38665	0.1049	N	0.03608	-0.345	0.35356	D	0.787817	D	0.64830	0.994	P	0.60173	0.87	T	0.51818	-0.8657	8	0.46703	T	0.11	-7.7223	9.6702	0.40008	0.0:0.0:0.7924:0.2076	.	328	Q6PJ61	FBX46_HUMAN	V	328	.	ENSP00000410007:A328V	A	-	2	0	FBXO46	50907611	0.996000	0.38824	0.981000	0.43875	0.810000	0.45777	1.774000	0.38573	2.284000	0.76573	0.563000	0.77884	GCC			0.701	FBXO46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459661.1		XM_371179	
CCDC8	83987	hgsc.bcm.edu	37	19	46914867	46914867	+	Missense_Mutation	SNP	A	A	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr19:46914867A>G	ENST00000307522.3	-	1	1974	c.1201T>C	c.(1201-1203)Tca>Cca	p.S401P		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	401					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GTAACCTCTGACCCCTGGTCA	0.607																																					p.S401P													CCDC8,NS,carcinoma,+2,1	CCDC8	2	1	0			c.T1201C												119.0	108.0	112.0					19																	46914867		2203	4300	6503	SO:0001583	missense	83987	exon1			CCTCTGACCCCTG	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1201T>C	19.37:g.46914867A>G	ENSP00000303158:p.Ser401Pro		56	0	0		66	0.05	3	NM_032040	27	0.00	0	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.171871	0.38315	.	.	ENSG00000169515	ENST00000307522	T	0.12039	2.72	3.33	-6.65	0.01795	.	0.658638	0.12488	N	0.464479	T	0.06234	0.0161	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31138	-0.9954	10	0.22706	T	0.39	-0.552	3.3748	0.07233	0.3418:0.2393:0.337:0.0818	.	401	Q9H0W5	CCDC8_HUMAN	P	401	ENSP00000303158:S401P	ENSP00000303158:S401P	S	-	1	0	CCDC8	51606707	0.000000	0.05858	0.000000	0.03702	0.257000	0.26127	-1.341000	0.02647	-1.757000	0.01316	0.260000	0.18958	TCA			0.607	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368598.1		NM_032040	
MATN3	4148	broad.mit.edu	37	2	20202975	20202975	+	Missense_Mutation	SNP	T	T	C	rs373579350		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr2:20202975T>C	ENST00000407540.3	-	3	925	c.863A>G	c.(862-864)cAc>cGc	p.H288R	AC079145.4_ENST00000416575.1_RNA|MATN3_ENST00000421259.2_Intron	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	288	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACACTCACAGTGGTGCTTGCC	0.537																																					p.H288R													.	MATN3	28		0			c.A863G												120.0	113.0	115.0					2																	20202975		2037	4189	6226	SO:0001583	missense	4148	exon3			TCACAGTGGTGCT	AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.863A>G	2.37:g.20202975T>C	ENSP00000383894:p.His288Arg		55	0	0		141	0.03	4	NM_002381	25	0.08	2	B2CPU0|Q4ZG02	Missense_Mutation	SNP	ENST00000407540.3	37	CCDS46226.1	.	.	.	.	.	.	.	.	.	.	T	10.46	1.356678	0.24598	.	.	ENSG00000132031	ENST00000407540	D	0.86865	-2.18	5.5	5.5	0.81552	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.252898	0.40302	N	0.001125	T	0.70587	0.3241	N	0.05510	-0.035	0.80722	D	1	B	0.21452	0.056	B	0.15484	0.013	T	0.65809	-0.6078	10	0.11182	T	0.66	-33.7623	9.002	0.36088	0.1644:0.0:0.0:0.8356	.	288	O15232	MATN3_HUMAN	R	288	ENSP00000383894:H288R	ENSP00000383894:H288R	H	-	2	0	MATN3	20066456	0.938000	0.31826	1.000000	0.80357	0.790000	0.44656	1.054000	0.30455	2.099000	0.63709	0.528000	0.53228	CAC			0.537	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323925.1	rescued with RNA-seq	NM_002381	
DYNC2LI1	51626	hgsc.bcm.edu	37	2	44021861	44021861	+	Intron	SNP	A	A	C			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr2:44021861A>C	ENST00000260605.8	+	6	607				DYNC2LI1_ENST00000605786.1_Intron|DYNC2LI1_ENST00000489222.2_Intron|DYNC2LI1_ENST00000406852.3_Silent_p.R196R|DYNC2LI1_ENST00000443170.3_Intron|DYNC2LI1_ENST00000398823.2_3'UTR	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CAACTTCTTTAGATTTTTATG	0.328																																					p.R196R													.	.			0			c.A586C												82.0	97.0	91.0					2																	44021861		1327	2309	3636	SO:0001627	intron_variant	51626	exon6			TTCTTTAGATTTT		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.507+79A>C	2.37:g.44021861A>C			130	0	0		170	0.04	7	NM_015522	3	0.00	0	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Silent	SNP	ENST00000260605.8	37	CCDS1813.1																																																																																					0.328	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000250536.2		NM_016008	
SPHKAP	80309	mdanderson.org	37	2	228996729	228996729	+	Missense_Mutation	SNP	G	G	T	rs533368400		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr2:228996729G>T	ENST00000392056.3	-	2	151	c.105C>A	c.(103-105)agC>agA	p.S35R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S35R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	35						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S35R(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCCCGGGCCGCTTCCTGAGC	0.468																																					p.S35R													SPHKAP_ENST00000392056,NS,carcinoma,0,2	SPHKAP_ENST00000392056	0	2	2	Substitution - Missense(2)	lung(2)	c.C105A												82.0	89.0	87.0					2																	228996729		2203	4300	6503	SO:0001583	missense	80309	exon2			CGGGCCGCTTCCT		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.105C>A	2.37:g.228996729G>T	ENSP00000375909:p.Ser35Arg		34	0	0		40	0.08	3	NM_030623	0		0	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.763776	0.31228	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.39229	1.09;1.09	5.93	3.15	0.36227	.	0.354583	0.30151	N	0.010291	T	0.35711	0.0941	N	0.19112	0.55	0.09310	N	1	P;D	0.55385	0.95;0.971	P;P	0.53689	0.544;0.732	T	0.10497	-1.0627	10	0.42905	T	0.14	.	7.3608	0.26745	0.2767:0.0:0.7233:0.0	.	35;35	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	35	ENSP00000375909:S35R;ENSP00000339886:S35R	ENSP00000339886:S35R	S	-	3	2	SPHKAP	228704973	0.993000	0.37304	0.013000	0.15412	0.031000	0.12232	1.715000	0.37971	0.404000	0.25506	0.655000	0.94253	AGC			0.468	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000331750.1		NM_030623	
EPB41L1	2036	mdanderson.org	37	20	34809815	34809815	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr20:34809815G>T	ENST00000338074.2	+	20	2630	c.2469G>T	c.(2467-2469)agG>agT	p.R823S	EPB41L1_ENST00000373946.3_Missense_Mutation_p.R643S|EPB41L1_ENST00000202028.5_Missense_Mutation_p.R721S|EPB41L1_ENST00000373941.1_Missense_Mutation_p.R822S|EPB41L1_ENST00000373950.2_Missense_Mutation_p.R714S|EPB41L1_ENST00000441639.1_Missense_Mutation_p.R721S	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	823	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTGAGACAAGGATCGAGAAGC	0.547																																					p.R823S													.	.			0			c.G2469T												132.0	108.0	116.0					20																	34809815		2203	4300	6503	SO:0001583	missense	2036	exon20			GACAAGGATCGAG	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.2469G>T	20.37:g.34809815G>T	ENSP00000337168:p.Arg823Ser		29	0	0		43	0.07	3	NM_012156	46	0.00	0	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	37	CCDS13271.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	3.997766|3.997766	0.74818|0.74818	.|.	.|.	ENSG00000088367|ENSG00000088367	ENST00000451082;ENST00000432603|ENST00000202028;ENST00000373950;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941;ENST00000454226	.|D;D;D;D;D;D;D	.|0.85171	.|-1.95;-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	5.47|5.47	3.54|3.54	0.40534|0.40534	.|Band 4.1, C-terminal (1);	.|.	.|.	.|.	.|.	D|D	0.90376|0.90376	0.6988|0.6988	M|M	0.76170|0.76170	2.325|2.325	0.47511|0.47511	D|D	0.999443|0.999443	.|D;D;D;D;D	.|0.89917	.|1.0;0.989;1.0;0.994;0.993	.|D;D;D;D;D	.|0.91635	.|0.999;0.985;0.997;0.985;0.91	D|D	0.89348|0.89348	0.3659|0.3659	5|9	.|0.87932	.|D	.|0	.|.	8.4702|8.4702	0.32980|0.32980	0.235:0.0:0.765:0.0|0.235:0.0:0.765:0.0	.|.	.|823;643;714;714;721	.|Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.|E41L1_HUMAN;.;.;.;.	V|S	251;61|721;714;714;721;643;823;822;184	.|ENSP00000202028:R721S;ENSP00000363061:R714S;ENSP00000399214:R721S;ENSP00000363057:R643S;ENSP00000337168:R823S;ENSP00000363052:R822S;ENSP00000388281:R184S	.|ENSP00000202028:R721S	G|R	+|+	2|3	0|2	EPB41L1|EPB41L1	34273229|34273229	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.961000|0.961000	0.63080|0.63080	1.202000|1.202000	0.32271|0.32271	0.686000|0.686000	0.31488|0.31488	0.462000|0.462000	0.41574|0.41574	GGA|AGG			0.547	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000078978.3		NM_012156	
KRTAP10-5	386680	broad.mit.edu	37	21	45999711	45999711	+	Missense_Mutation	SNP	C	C	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr21:45999711C>G	ENST00000400372.1	-	1	770	c.745G>C	c.(745-747)Gcc>Ccc	p.A249P	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	249	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						CAGCAGCTGGCCTGGTAGGAG	0.716																																					p.A249P													.	KRTAP10-5	43		0			c.G745C												31.0	42.0	38.0					21																	45999711		2201	4293	6494	SO:0001583	missense	386680	exon1			AGCTGGCCTGGTA	AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.745G>C	21.37:g.45999711C>G	ENSP00000383223:p.Ala249Pro		17	0	0		26	0.12	3	NM_198694	0		0	Q0VAR7|Q0VAR8|Q70LJ3	Missense_Mutation	SNP	ENST00000400372.1	37	CCDS42958.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.083263	0.00035	.	.	ENSG00000241123	ENST00000400372	T	0.00637	6.05	3.43	-0.681	0.11342	.	.	.	.	.	T	0.00241	0.0007	N	0.00500	-1.43	0.09310	N	1	B	0.16166	0.016	B	0.26614	0.071	T	0.43410	-0.9393	9	0.02654	T	1	.	2.0586	0.03587	0.2003:0.1676:0.4835:0.1486	.	249	P60370	KR105_HUMAN	P	249	ENSP00000383223:A249P	ENSP00000383223:A249P	A	-	1	0	KRTAP10-5	44824139	0.213000	0.23551	0.034000	0.17996	0.000000	0.00434	0.085000	0.14912	-0.274000	0.09232	-2.817000	0.00109	GCC			0.716	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128042.1			
ITGB2	3689	mdanderson.org	37	21	46308803	46308803	+	Missense_Mutation	SNP	C	C	T	rs200894474	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr21:46308803C>T	ENST00000397850.2	-	15	2337	c.1885G>A	c.(1885-1887)Gcc>Acc	p.A629T	ITGB2_ENST00000397854.3_Missense_Mutation_p.A572T|ITGB2_ENST00000355153.4_Missense_Mutation_p.A629T|ITGB2_ENST00000397852.1_Missense_Mutation_p.A629T|ITGB2_ENST00000397857.1_Missense_Mutation_p.A629T|ITGB2_ENST00000302347.5_Missense_Mutation_p.A629T			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	629					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	AGGCACTCGGCGCAGGAGCTG	0.692													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		12099	0.0		0.0	False		,,,				2504	0.0				p.A629T													.	.			0			c.G1885A												20.0	22.0	21.0					21																	46308803		2202	4300	6502	SO:0001583	missense	3689	exon14			ACTCGGCGCAGGA	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1885G>A	21.37:g.46308803C>T	ENSP00000380948:p.Ala629Thr		19	0	0		25	0.08	2	NM_001127491	34	0.00	0	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	37	CCDS13716.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	10.47	1.358433	0.24598	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.07	3.17	0.36434	Integrin beta subunit, tail (2);	.	.	.	.	D	0.85575	0.5728	L	0.51422	1.61	0.09310	N	1	B;P	0.36125	0.245;0.538	B;B	0.33890	0.12;0.172	T	0.75405	-0.3329	9	0.48119	T	0.1	.	6.5832	0.22607	0.0:0.6831:0.0:0.3169	.	572;629	A8MYE6;P05107	.;ITB2_HUMAN	T	629;629;572;629;629;629	ENSP00000380950:A629T;ENSP00000380955:A629T;ENSP00000380952:A572T;ENSP00000347279:A629T;ENSP00000380948:A629T;ENSP00000303242:A629T	ENSP00000303242:A629T	A	-	1	0	ITGB2	45133231	0.007000	0.16637	0.017000	0.16124	0.020000	0.10135	1.539000	0.36104	0.466000	0.27193	0.655000	0.94253	GCC	0		0.692	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206566.2		NM_000211	
IGLL3P	91353	mdanderson.org	37	22	25715896	25715896	+	IGR	SNP	T	T	A	rs145766467	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr22:25715896T>A								RP3-462D8.2 (37638 upstream) : LRP5L (31491 downstream)																							GGCGTGGAGATGACCACGCCC	0.577													T|||	5	0.000998403	0.0015	0.0	5008	,	,		17699	0.0		0.001	False		,,,				2504	0.002				.													.	.			0			.												135.0	123.0	127.0					22																	25715896		2201	4300	6501	SO:0001628	intergenic_variant	91353	.			TGGAGATGACCAC																													22.37:g.25715896T>A			109	0	0		189	0.03	6	.	10	0.30	3		RNA	SNP		37																																																																																				0.001	0	0.577								rescued with RNA-seq		
ARPP21	10777	ucsc.edu	37	3	35724364	35724364	+	Nonsense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr3:35724364G>T	ENST00000187397.4	+	4	610	c.154G>T	c.(154-156)Gaa>Taa	p.E52*	ARPP21_ENST00000396481.2_Nonsense_Mutation_p.E52*|ARPP21_ENST00000458225.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000441454.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000412048.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000474696.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000337271.5_Nonsense_Mutation_p.E52*|ARPP21_ENST00000396482.2_Nonsense_Mutation_p.E52*|ARPP21_ENST00000444190.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000438071.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000427542.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000428373.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000432682.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000436702.1_Nonsense_Mutation_p.E52*|ARPP21_ENST00000417925.1_Nonsense_Mutation_p.E52*	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	52					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TCAGAATCAAGAAAGAAGAAA	0.348																																					p.E52X													.	ARPP21	153		0			c.G154T												85.0	96.0	92.0					3																	35724364		2203	4300	6503	SO:0001587	stop_gained	10777	exon3			AATCAAGAAAGAA	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.154G>T	3.37:g.35724364G>T	ENSP00000187397:p.Glu52*		60	0	0		34	0.12	4	NM_001267618	0		0	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Nonsense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	36	5.728953	0.96856	.	.	ENSG00000172995	ENST00000450234;ENST00000428373;ENST00000458225;ENST00000337271;ENST00000444190;ENST00000449196;ENST00000187397;ENST00000452563;ENST00000438577;ENST00000427542;ENST00000474696;ENST00000412048;ENST00000396482;ENST00000432682;ENST00000432450;ENST00000413378;ENST00000417925;ENST00000396481;ENST00000441454;ENST00000436702;ENST00000438071	.	.	.	6.02	5.1	0.69264	.	0.224065	0.38492	N	0.001675	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-22.8009	12.4388	0.55614	0.0:0.1679:0.8321:0.0	.	.	.	.	X	52	.	ENSP00000187397:E52X	E	+	1	0	ARPP21	35699368	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.405000	0.52630	2.865000	0.98341	0.655000	0.94253	GAA			0.348	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253334.2		NM_198399	
LRRFIP2	9209	bcgsc.ca	37	3	37100309	37100309	+	Silent	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr3:37100309G>T	ENST00000336686.4	-	25	1922	c.1842C>A	c.(1840-1842)ggC>ggA	p.G614G	LRRFIP2_ENST00000440230.1_Silent_p.G317G|LRRFIP2_ENST00000421276.2_Silent_p.G317G|LRRFIP2_ENST00000354379.4_Silent_p.G293G|LRRFIP2_ENST00000421307.1_Silent_p.G614G|MLH1_ENST00000536378.1_Intron|LRRFIP2_ENST00000396428.2_Silent_p.G396G			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	614					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GCAAGTCTGAGCCATTCTGCA	0.507																																					p.G614G													.	LRRFIP2	71		1	Whole gene deletion(1)	ovary(1)	c.C1842A												148.0	124.0	133.0					3																	37100309		2203	4300	6503	SO:0001819	synonymous_variant	9209	exon26			GTCTGAGCCATTC	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1842C>A	3.37:g.37100309G>T			46	0	0		48	0.08	4	NM_006309	113	0.00	0	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	ENST00000336686.4	37	CCDS2664.1																																																																																					0.507	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000253335.3		NM_006309	
ULK4	54986	mdanderson.org	37	3	41497052	41497052	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr3:41497052G>T	ENST00000301831.4	-	34	3890	c.3428C>A	c.(3427-3429)gCt>gAt	p.A1143D		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	1143					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		GTCTTCTGCAGCCTGAGGGTC	0.512																																					p.A1143D													.	.			0			c.C3428A												93.0	96.0	95.0					3																	41497052		1919	4138	6057	SO:0001583	missense	54986	exon34			TCTGCAGCCTGAG	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.3428C>A	3.37:g.41497052G>T	ENSP00000301831:p.Ala1143Asp		26	0	0		19	0.11	2	NM_017886	14	0.00	0	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012140	0.54468	.	.	ENSG00000168038	ENST00000301831	T	0.65364	-0.15	5.37	4.49	0.54785	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.44285	U	0.000474	T	0.55146	0.1902	L	0.38175	1.15	0.80722	D	1	P	0.50272	0.933	B	0.44108	0.441	T	0.56890	-0.7904	10	0.45353	T	0.12	.	13.7791	0.63073	0.0737:0.0:0.9263:0.0	.	1143	Q96C45	ULK4_HUMAN	D	1143	ENSP00000301831:A1143D	ENSP00000301831:A1143D	A	-	2	0	ULK4	41472056	1.000000	0.71417	0.901000	0.35422	0.728000	0.41692	3.304000	0.51866	1.273000	0.44346	0.655000	0.94253	GCT			0.512	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000343490.1		XM_929989	
DHX30	22907	mdanderson.org	37	3	47891550	47891550	+	Silent	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr3:47891550G>T	ENST00000445061.1	+	22	3932	c.3525G>T	c.(3523-3525)ctG>ctT	p.L1175L	DHX30_ENST00000348968.4_Silent_p.L1147L|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Silent_p.L1203L|DHX30_ENST00000446256.2_Silent_p.L1136L	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	1175						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TTGCGCTACTGGCAGAGCTGC	0.652											OREG0015550	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1175L													.	.			0			c.G3525T												11.0	14.0	13.0					3																	47891550		2194	4294	6488	SO:0001819	synonymous_variant	22907	exon22			GCTACTGGCAGAG	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.3525G>T	3.37:g.47891550G>T			37	0	0	950	45	0.07	3	NM_138615	68	0.00	0	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Silent	SNP	ENST00000445061.1	37	CCDS2759.1																																																																																					0.652	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000257495.2		NM_138615	
MAGI1	9223	mdanderson.org	37	3	65425585	65425585	+	Silent	SNP	C	C	T	rs374381483		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr3:65425585C>T	ENST00000497477.2	-	9	1238	c.1239G>A	c.(1237-1239)caG>caA	p.Q413Q	MAGI1_ENST00000402939.2_Silent_p.Q413Q|MAGI1_ENST00000483466.1_Silent_p.Q413Q|MAGI1_ENST00000330909.8_Silent_p.Q413Q|MAGI1_ENST00000470990.1_5'UTR			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	413	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgctgctgctgttgct	0.537											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q413Q													.	.			0			c.G1239A												58.0	58.0	58.0					3																	65425585		2194	4275	6469	SO:0001819	synonymous_variant	9223	exon9			CTGCTGCTGCTGT	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1239G>A	3.37:g.65425585C>T			26	0	0	1084	40	0.08	3	NM_001033057	10	0.00	0	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Silent	SNP	ENST00000497477.2	37		.	.	.	.	.	.	.	.	.	.	c	3.068	-0.191851	0.06299	.	.	ENSG00000151276	ENST00000460329	.	.	.	3.77	0.926	0.19430	.	.	.	.	.	T	0.42539	0.1207	.	.	.	0.40284	D	0.978435	.	.	.	.	.	.	T	0.25537	-1.0129	4	.	.	.	.	1.7198	0.02909	0.14:0.458:0.1372:0.2649	.	.	.	.	N	294	.	.	S	-	2	0	MAGI1	65400625	0.998000	0.40836	0.281000	0.24762	0.028000	0.11728	0.481000	0.22260	0.070000	0.16634	-0.142000	0.14014	AGC			0.537	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000349132.2		NM_004742	
MUC4	4585	mdanderson.org	37	3	195509308	195509308	+	Missense_Mutation	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr3:195509308G>A	ENST00000463781.3	-	2	9602	c.9143C>T	c.(9142-9144)tCa>tTa	p.S3048L	MUC4_ENST00000475231.1_Missense_Mutation_p.S3048L|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	989					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGTGTC	0.607																																					p.S3048L													.	.			0			c.C9143T																																									SO:0001583	missense	4585	exon2			GATGCTGAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9143C>T	3.37:g.195509308G>A	ENSP00000417498:p.Ser3048Leu		32	0.03125	1		44	0.07	3	NM_018406	3	0.33	1	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	8.283	0.816093	0.16607	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.44;1.43	.	.	.	.	.	.	.	.	T	0.15869	0.0382	N	0.19112	0.55	0.20975	N	0.999814	B	0.22480	0.07	B	0.14023	0.01	T	0.26360	-1.0105	7	.	.	.	.	5.4195	0.16392	0.0:0.0:1.0:0.0	.	2920	E7ESK3	.	L	3048	ENSP00000417498:S3048L;ENSP00000420243:S3048L	.	S	-	2	0	MUC4	196994087	0.286000	0.24305	0.013000	0.15412	0.000000	0.00434	2.555000	0.45854	0.497000	0.27926	0.000000	0.15137	TCA			0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
CXCL6	6372	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74702735	74702735	+	Missense_Mutation	SNP	C	C	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr4:74702735C>G	ENST00000226317.5	+	2	418	c.164C>G	c.(163-165)aCg>aGg	p.T55R	CXCL6_ENST00000515050.1_Missense_Mutation_p.T55R	NM_002993.3	NP_002984.1	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6	55					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|heparin binding (GO:0008201)	p.T55M(2)		large_intestine(1)|lung(7)	8	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TTACGCGTTACGCTGAGAGTA	0.527																																					p.T55R													CXCL6,NS,carcinoma,0,1	CXCL6	0	1	2	Substitution - Missense(2)	lung(2)	c.C164G												113.0	129.0	123.0					4																	74702735		2203	4300	6503	SO:0001583	missense	6372	exon2			GCGTTACGCTGAG	U83303	CCDS3560.1	4q13.3	2013-02-25	2012-10-17	2002-08-23	ENSG00000124875	ENSG00000124875		"""Endogenous ligands"""	10643	protein-coding gene	gene with protein product	"""granulocyte chemotactic protein 2"""	138965	"""small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2)"", ""chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)"""	SCYB6		9465307	Standard	NM_002993		Approved	GCP-2, CKA-3	uc003hhf.3	P80162	OTTHUMG00000130010	ENST00000226317.5:c.164C>G	4.37:g.74702735C>G	ENSP00000226317:p.Thr55Arg		94	0	0		65	0.51	33	NM_002993	0		0	B2R4X3|Q4W5D4	Missense_Mutation	SNP	ENST00000226317.5	37	CCDS3560.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597775	0.28445	.	.	ENSG00000124875	ENST00000226317;ENST00000515050	T;T	0.05258	3.47;3.47	3.86	-0.0305	0.13914	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.253070	0.40818	N	0.001004	T	0.16471	0.0396	M	0.80982	2.52	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	T	0.13019	-1.0525	10	0.26408	T	0.33	.	3.3124	0.07021	0.3526:0.4412:0.0:0.2062	.	55	P80162	CXCL6_HUMAN	R	55	ENSP00000226317:T55R;ENSP00000424819:T55R	ENSP00000226317:T55R	T	+	2	0	CXCL6	74921599	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.056000	0.11787	-0.175000	0.10725	-0.224000	0.12420	ACG			0.527	CXCL6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252283.2		NM_002993	
PDE6A	5145	mdanderson.org	37	5	149265907	149265907	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr5:149265907G>T	ENST00000255266.5	-	14	1878	c.1759C>A	c.(1759-1761)Cta>Ata	p.L587I		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	587					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	AAGGCCTCTAGGTCCGTGAAG	0.542																																					p.L587I													.	.			0			c.C1759A												146.0	122.0	130.0					5																	149265907		2203	4300	6503	SO:0001583	missense	5145	exon14			CCTCTAGGTCCGT		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.1759C>A	5.37:g.149265907G>T	ENSP00000255266:p.Leu587Ile		63	0	0		49	0.06	3	NM_000440	0		0	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	37	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102116	0.76983	.	.	ENSG00000132915	ENST00000255266	D	0.84146	-1.81	5.73	4.85	0.62838	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.64402	D	0.000003	D	0.88890	0.6560	M	0.62723	1.935	0.49483	D	0.999796	D	0.56521	0.976	P	0.59546	0.859	D	0.87769	0.2604	10	0.37606	T	0.19	.	12.9065	0.58156	0.0797:0.0:0.9203:0.0	.	587	P16499	PDE6A_HUMAN	I	587	ENSP00000255266:L587I	ENSP00000255266:L587I	L	-	1	2	PDE6A	149246100	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.146000	0.58072	1.393000	0.46605	0.655000	0.94253	CTA			0.542	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252326.2			
NOL7	51406	broad.mit.edu	37	6	13621014	13621014	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr6:13621014G>T	ENST00000451315.2	+	8	761	c.729G>T	c.(727-729)agG>agT	p.R243S	AL441883.1_ENST00000600057.1_Missense_Mutation_p.N36K|NOL7_ENST00000474485.1_3'UTR|RANBP9_ENST00000469916.1_5'Flank	NM_016167.3	NP_057251.2	Q9UMY1	NOL7_HUMAN	nucleolar protein 7, 27kDa	243						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(1)	5	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.135)	Epithelial(50;0.176)			ATGCCAAGAGGTTTAAAAGAC	0.249																																					p.R243S													.	NOL7	18		0			c.G729T												35.0	37.0	36.0					6																	13621014		2203	4289	6492	SO:0001583	missense	51406	exon8			CAAGAGGTTTAAA	AF172066	CCDS4528.1	6p23	2008-05-23	2004-02-10		ENSG00000225921	ENSG00000225921			21040	protein-coding gene	gene with protein product		611533	"""chromosome 6 open reading frame 90"", ""polyglutamine binding protein 3"""	C6orf90, PQBP3		16205646	Standard	NM_016167		Approved	NOP27, RARG-1, dJ223E5.2	uc003naz.3	Q9UMY1	OTTHUMG00000014277	ENST00000451315.2:c.729G>T	6.37:g.13621014G>T	ENSP00000405674:p.Arg243Ser		142	0	0		150	0.03	4	NM_016167	577	0.00	0	Q5T297|Q9Y3U7	Missense_Mutation	SNP	ENST00000451315.2	37	CCDS4528.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978793	0.53720	.	.	ENSG00000225921	ENST00000451315	.	.	.	6.07	2.26	0.28386	.	0.272836	0.40222	N	0.001150	T	0.13756	0.0333	N	0.24115	0.695	0.31493	N	0.665737	B	0.11235	0.004	B	0.09377	0.004	T	0.07309	-1.0779	9	0.72032	D	0.01	-3.1197	5.5567	0.17121	0.2131:0.0:0.6416:0.1453	.	243	Q9UMY1	NOL7_HUMAN	S	243	.	ENSP00000405674:R243S	R	+	3	2	NOL7	13728993	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.922000	0.28734	0.871000	0.35750	0.655000	0.94253	AGG			0.249	NOL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039904.1		NM_016167	
CYP21A1P	1590	broad.mit.edu	37	6	31973462	31973462	+	IGR	SNP	T	T	C	rs140323264	byFrequency	TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr6:31973462T>C	ENST00000594256.1	-	0	69				CYP21A1P_ENST00000342991.6_RNA|C4A-AS1_ENST00000458633.1_RNA																							ACGGGCGTCTTGCCAtgctgc	0.662													C|||	236	0.0471246	0.003	0.0418	5008	,	,		14629	0.1488		0.0268	False		,,,				2504	0.0266				.													.	.			0			.												4.0	4.0	4.0					6																	31973462		648	1425	2073	SO:0001628	intergenic_variant	0	.			GCGTCTTGCCATG																													6.37:g.31973462T>C			36	0.0277777778	1		26	0.12	3	.	1	0.00	0		RNA	SNP	ENST00000594256.1	37																																																																																						0.662	AL645922.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding					
ITPR3	3710	mdanderson.org	37	6	33639004	33639004	+	Silent	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr6:33639004G>A	ENST00000374316.5	+	22	3709	c.2649G>A	c.(2647-2649)cgG>cgA	p.R883R	ITPR3_ENST00000605930.1_Silent_p.R883R			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	883					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	AGCTGCTGCGGCTCACTCGCA	0.667																																					p.R883R													.	.			0			c.G2649A												62.0	63.0	62.0					6																	33639004		2203	4300	6503	SO:0001819	synonymous_variant	3710	exon21			GCTGCGGCTCACT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2649G>A	6.37:g.33639004G>A			79	0	0		84	0.05	4	NM_002224	46	0.00	0	Q14649|Q5TAQ2	Silent	SNP	ENST00000374316.5	37	CCDS4783.1																																																																																					0.667	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040204.2		NM_002224	
ABCC10	89845	mdanderson.org	37	6	43406411	43406411	+	Missense_Mutation	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr6:43406411G>A	ENST00000372530.4	+	8	2220	c.2005G>A	c.(2005-2007)Gcc>Acc	p.A669T	ABCC10_ENST00000244533.3_Missense_Mutation_p.A641T	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	669	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CTTTGGCCTGGCCACCCAGGA	0.592																																					p.A669T													.	.			0			c.G2005A												101.0	96.0	98.0					6																	43406411		2203	4300	6503	SO:0001583	missense	89845	exon8			GGCCTGGCCACCC	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2005G>A	6.37:g.43406411G>A	ENSP00000361608:p.Ala669Thr		100	0	0		86	0.06	5	NM_001198934	142	0.00	0	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810282	0.90707	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.90676	-2.71;-2.71;-2.71	5.61	5.61	0.85477	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.132335	0.49916	D	0.000128	D	0.90000	0.6878	L	0.58510	1.815	0.51482	D	0.999926	P;P	0.40794	0.729;0.659	B;P	0.45971	0.439;0.499	D	0.90438	0.4429	10	0.56958	D	0.05	-44.5866	19.6435	0.95767	0.0:0.0:1.0:0.0	.	641;669	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	T	225;669;641	ENSP00000361593:A225T;ENSP00000361608:A669T;ENSP00000244533:A641T	ENSP00000244533:A641T	A	+	1	0	ABCC10	43514389	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.799000	0.85936	2.640000	0.89533	0.655000	0.94253	GCC			0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040603.2		NM_033450	
TRAM2	9697	broad.mit.edu;mdanderson.org	37	6	52372382	52372382	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr6:52372382G>T	ENST00000182527.3	-	7	594	c.595C>A	c.(595-597)Ctg>Atg	p.L199M	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	199	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					ATATGCACCAGGTACAGGCAA	0.468																																					p.L199M													.	TRAM2	27		0			c.C595A												84.0	86.0	86.0					6																	52372382		2203	4300	6503	SO:0001583	missense	9697	exon7			GCACCAGGTACAG	D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.595C>A	6.37:g.52372382G>T	ENSP00000182527:p.Leu199Met		56	0	0		74	0.05	4	NM_012288	139	0.00	0	A8K6T6	Missense_Mutation	SNP	ENST00000182527.3	37	CCDS34477.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631610	0.67015	.	.	ENSG00000065308	ENST00000182527	D	0.87491	-2.26	5.31	2.52	0.30459	TRAM/LAG1/CLN8 homology domain (3);	0.132339	0.52532	D	0.000066	D	0.90745	0.7095	M	0.84948	2.725	0.58432	D	0.999999	D	0.76494	0.999	D	0.71184	0.972	D	0.90833	0.4718	10	0.66056	D	0.02	.	10.0425	0.42166	0.2774:0.0:0.7226:0.0	.	199	Q15035	TRAM2_HUMAN	M	199	ENSP00000182527:L199M	ENSP00000182527:L199M	L	-	1	2	TRAM2	52480341	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	2.344000	0.44010	0.814000	0.34374	0.491000	0.48974	CTG			0.468	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040910.1		NM_012288	
FAM185A	222234	broad.mit.edu	37	7	102401776	102401776	+	Silent	SNP	T	T	G			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr7:102401776T>G	ENST00000413034.2	+	4	711	c.711T>G	c.(709-711)ggT>ggG	p.G237G	FAM185A_ENST00000481697.1_3'UTR|FAM185A_ENST00000409231.3_Silent_p.G120G	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	237										kidney(1)	1						CCGAAGATGGTTTGCTGAAAG	0.383																																					p.G237G													.	FAM185A	10		0			c.T711G												207.0	168.0	180.0					7																	102401776		692	1591	2283	SO:0001819	synonymous_variant	222234	exon4			AGATGGTTTGCTG	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.711T>G	7.37:g.102401776T>G			267	0.0037453184	1		591	0.01	6	NM_001145268	23	0.00	0	A8MUR7|B4DQD3|C9IZ91	Silent	SNP	ENST00000413034.2	37	CCDS47676.1																																																																																					0.383	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000349482.1		NM_001145268	
FOXP2	93986	broad.mit.edu	37	7	114270000	114270000	+	Silent	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr7:114270000G>A	ENST00000393494.2	+	5	816	c.537G>A	c.(535-537)caG>caA	p.Q179Q	FOXP2_ENST00000390668.3_Silent_p.Q203Q|FOXP2_ENST00000393498.2_Silent_p.Q159Q|FOXP2_ENST00000360232.4_Silent_p.Q179Q|FOXP2_ENST00000350908.4_Silent_p.Q179Q|FOXP2_ENST00000393500.3_Silent_p.Q104Q|FOXP2_ENST00000403559.4_Silent_p.Q196Q|FOXP2_ENST00000408937.3_Silent_p.Q204Q|FOXP2_ENST00000393491.3_Silent_p.Q87Q|FOXP2_ENST00000393489.3_Silent_p.Q87Q|FOXP2_ENST00000378237.3_Silent_p.Q179Q|AC020606.1_ENST00000580664.1_RNA			O15409	FOXP2_HUMAN	forkhead box P2	179	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q204Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						agcaacaacagcagcagcagc	0.498																																					p.Q204Q													FOXP2,NS,carcinoma,0,6	FOXP2	133	6	1	Substitution - coding silent(1)	lung(1)	c.G612A												41.0	38.0	39.0					7																	114270000		2199	4282	6481	SO:0001819	synonymous_variant	93986	exon5			ACAACAGCAGCAG	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.537G>A	7.37:g.114270000G>A			14	0	0		36	0.08	3	NM_001172767	3	0.00	0	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	ENST00000393494.2	37	CCDS5760.1																																																																																					0.498	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317366.1		NM_014491	
AKR1B1	231	mdanderson.org	37	7	134135644	134135644	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr7:134135644G>T	ENST00000285930.4	-	3	324	c.245C>A	c.(244-246)aCg>aAg	p.T82K	AKR1B1_ENST00000489022.1_5'UTR	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)	82					C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)			kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	CTCATGGTACGTGCACCACAG	0.572																																					p.T82K													.	.			0			c.C245A												81.0	61.0	68.0					7																	134135644		2203	4300	6503	SO:0001583	missense	231	exon3			TGGTACGTGCACC	J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.245C>A	7.37:g.134135644G>T	ENSP00000285930:p.Thr82Lys		49	0	0		43	0.07	3	NM_001628	212	0.00	0	B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	ENST00000285930.4	37	CCDS5831.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021761	0.93462	.	.	ENSG00000085662	ENST00000285930	T	0.23552	1.9	4.94	4.94	0.65067	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.53965	0.1829	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.59726	-0.7400	10	0.87932	D	0	.	17.5268	0.87802	0.0:0.0:1.0:0.0	.	82	P15121	ALDR_HUMAN	K	82	ENSP00000285930:T82K	ENSP00000285930:T82K	T	-	2	0	AKR1B1	133786184	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	7.838000	0.86804	2.448000	0.82819	0.561000	0.74099	ACG			0.572	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339448.2		NM_001628	
SLC4A2	6522	mdanderson.org	37	7	150772534	150772534	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr7:150772534G>T	ENST00000485713.1	+	20	4280	c.3240G>T	c.(3238-3240)aaG>aaT	p.K1080N	SLC4A2_ENST00000413384.2_Missense_Mutation_p.K1080N|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000461735.1_Missense_Mutation_p.K1066N|SLC4A2_ENST00000310317.5_Missense_Mutation_p.K998N|SLC4A2_ENST00000392826.2_Missense_Mutation_p.K1071N|FASTK_ENST00000489884.1_5'Flank	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	1080	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGGGGACAAGCCCAAGATTC	0.617																																					p.K1080N													.	.			0			c.G3240T												133.0	135.0	135.0					7																	150772534		2203	4300	6503	SO:0001583	missense	6522	exon20			GGACAAGCCCAAG		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3240G>T	7.37:g.150772534G>T	ENSP00000419412:p.Lys1080Asn		21	0	0		18	0.11	2	NM_001199692	215	0.00	0	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065550	0.55539	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.07	2.28	0.28536	Bicarbonate transporter, C-terminal (1);	0.054554	0.64402	D	0.000001	D	0.89403	0.6705	M	0.91196	3.185	0.54753	D	0.999988	D;D;D	0.65815	0.995;0.99;0.992	D;D;D	0.70487	0.962;0.948;0.969	D	0.87613	0.2505	10	0.72032	D	0.01	.	7.6787	0.28500	0.333:0.0:0.667:0.0	.	1071;1066;1080	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	N	1080;1080;998;1071;1066	ENSP00000419412:K1080N;ENSP00000405600:K1080N;ENSP00000311402:K998N;ENSP00000376571:K1071N;ENSP00000419164:K1066N	ENSP00000311402:K998N	K	+	3	2	SLC4A2	150403467	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	2.566000	0.45948	0.310000	0.22990	-1.036000	0.02392	AAG			0.617	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000351039.1		NM_003040	
DOCK5	80005	mdanderson.org	37	8	25203062	25203062	+	Missense_Mutation	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr8:25203062C>T	ENST00000276440.7	+	26	2733	c.2689C>T	c.(2689-2691)Cct>Tct	p.P897S		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	897					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTCCAACAAGCCTGACCACGA	0.542																																					p.P897S	Pancreas(145;34 1887 3271 10937 30165)												.	.			0			c.C2689T												157.0	135.0	143.0					8																	25203062		2203	4300	6503	SO:0001583	missense	80005	exon26			AACAAGCCTGACC		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2689C>T	8.37:g.25203062C>T	ENSP00000276440:p.Pro897Ser		36	0	0		64	0.06	4	NM_024940	7	0.00	0	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.98|15.98	2.991394|2.991394	0.54041|0.54041	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000444569|ENST00000276440	.|T	.|0.19394	.|2.15	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.28632|0.28632	0.0709|0.0709	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	.|P;B;P	.|0.38395	.|0.478;0.161;0.629	.|B;B;B	.|0.43331	.|0.148;0.096;0.416	T|T	0.00357|0.00357	-1.1792|-1.1792	5|10	.|0.48119	.|T	.|0.1	.|.	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|887;672;897	.|D3DSS6;Q68DL4;Q9H7D0	.|.;.;DOCK5_HUMAN	V|S	668|897	.|ENSP00000276440:P897S	.|ENSP00000276440:P897S	A|P	+|+	2|1	0|0	DOCK5|DOCK5	25258979|25258979	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	7.487000|7.487000	0.81328|0.81328	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|CCT			0.542	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254955.2		NM_024940	
FBXW2	26190	bcgsc.ca	37	9	123527003	123527003	+	Missense_Mutation	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr9:123527003C>T	ENST00000608872.1	-	8	1386	c.1199G>A	c.(1198-1200)cGc>cAc	p.R400H	FBXW2_ENST00000340778.5_Missense_Mutation_p.R335H|FBXW2_ENST00000493559.1_Intron	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	400					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						CAGAGGCCAGCGACTAATCAG	0.537																																					p.R400H													FBXW2_ENST00000373926,colon,carcinoma,-1,1	FBXW2	34	1	0			c.G1199A												120.0	121.0	120.0					9																	123527003		1977	4169	6146	SO:0001583	missense	26190	exon8			GGCCAGCGACTAA	AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1199G>A	9.37:g.123527003C>T	ENSP00000476369:p.Arg400His		60	0	0		92	0.07	6	NM_012164	139	0.00	0	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	ENST00000608872.1	37	CCDS43872.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014010	0.75161	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.18338	2.22;2.22	4.95	4.05	0.47172	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.049056	0.85682	N	0.000000	T	0.31104	0.0786	L	0.44542	1.39	0.58432	D	0.999995	D;B;B	0.76494	0.999;0.124;0.046	D;B;B	0.78314	0.991;0.007;0.007	T	0.01810	-1.1269	10	0.52906	T	0.07	-3.1256	11.0611	0.47948	0.0:0.9085:0.0:0.0915	.	335;400;400	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	H	400;335;400	ENSP00000363036:R400H;ENSP00000341161:R335H	ENSP00000341161:R335H	R	-	2	0	FBXW2	122566824	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.247000	0.51422	1.210000	0.43336	0.563000	0.77884	CGC			0.537	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053834.2			
GPR144	347088	mdanderson.org	37	9	127231548	127231548	+	Missense_Mutation	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr9:127231548G>T	ENST00000334810.1	+	15	2356	c.2356G>T	c.(2356-2358)Gac>Tac	p.D786Y				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	786					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GCTCCCCCATGACTACGTGGC	0.637																																					p.D786Y													.	.			0			c.G2356T												46.0	50.0	49.0					9																	127231548		692	1591	2283	SO:0001583	missense	347088	exon15			CCCCATGACTACG	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2356G>T	9.37:g.127231548G>T	ENSP00000335156:p.Asp786Tyr		39	0	0		46	0.07	3	NM_001161808	0		0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658594	0.47467	.	.	ENSG00000180264	ENST00000334810	T	0.37058	1.22	4.74	4.74	0.60224	GPCR, family 2-like (1);	.	.	.	.	T	0.38825	0.1055	N	0.17278	0.47	0.28687	N	0.904786	D	0.65815	0.995	D	0.65874	0.939	T	0.19614	-1.0300	9	0.59425	D	0.04	.	7.4155	0.27042	0.1853:0.0:0.8147:0.0	.	786	Q7Z7M1	GP144_HUMAN	Y	786	ENSP00000335156:D786Y	ENSP00000335156:D786Y	D	+	1	0	GPR144	126271369	0.992000	0.36948	0.872000	0.34217	0.089000	0.18198	2.520000	0.45554	2.163000	0.67991	0.561000	0.74099	GAC			0.637	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054026.2		NM_182611	
DPP7	29952	mdanderson.org	37	9	140005139	140005139	+	Silent	SNP	C	C	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr9:140005139C>T	ENST00000371579.2	-	13	1444	c.1440G>A	c.(1438-1440)caG>caA	p.Q480Q		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	480						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		GAGCTGGCTGCTGCTCACGCC	0.647																																					p.Q480Q													.	.			0			c.G1440A												36.0	38.0	37.0					9																	140005139		2199	4297	6496	SO:0001819	synonymous_variant	29952	exon13			TGGCTGCTGCTCA	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.1440G>A	9.37:g.140005139C>T			21	0	0		38	0.08	3	NM_013379	51	0.00	0	A8K7U7|Q5VSF1|Q969X4	Silent	SNP	ENST00000371579.2	37	CCDS7030.1																																																																																					0.647	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055279.1		NM_013379	
FAM157B	100132403	broad.mit.edu	37	9	141124391	141124392	+	lincRNA	DEL	TG	TG	-	rs367820400		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chr9:141124391_141124392delTG	ENST00000446912.2	+	0	906							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		TAATGTGTTTTGTTTTTTTTTT	0.376																																					.													.	.			0			.																																											0	.			GTGTTTTGTTTTT			9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141124391_141124392delTG			91	0.0549450549	5		106	0.09	10	.	0		0		RNA	DEL	ENST00000446912.2	37																																																																																						0.376	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	lincRNA		OTTHUMT00000055378.2		NM_001145249	
MT-CYB	4519	broad.mit.edu	37	M	14958	14958	+	Missense_Mutation	SNP	G	G	A			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chrM:14958G>A	ENST00000361789.2	+	1	212	c.212G>A	c.(211-213)cGa>cAa	p.R71Q	MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	71					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CCACATCACTCGAGACGTAAA	0.502																																					p.R71Q													.	.			0			c.G212A																																									SO:0001583	missense	4519	exon1			TCACTCGAGACGT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.212G>A	M.37:g.14958G>A	ENSP00000354554:p.Arg71Gln		29	0	0		50	0.08	4	ENST00000361789	0		0	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	37																																																																																						0.502	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024038	
NUDT10	170685	mdanderson.org	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	.			8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A												52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A			189	0.0052910053	1		276	0.06	17	NM_153183	61	0.00	0	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																					0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056578.1		NM_153183	
TAF1	6872	broad.mit.edu;mdanderson.org	37	X	70679039	70679039	+	Intron	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chrX:70679039G>T	ENST00000373790.4	+	36	5112				TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000276072.3_Intron|TAF1_ENST00000449580.1_Missense_Mutation_p.D1701Y|TAF1_ENST00000423759.1_Intron	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GGAAGACTCTGATGTAGATAT	0.488																																					.													.	.			0			.												127.0	114.0	118.0					X																	70679039		876	1991	2867	SO:0001627	intron_variant	6872	.			GACTCTGATGTAG		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.5062-363G>T	X.37:g.70679039G>T			25	0	0		35	0.09	3	.	19	0.00	0	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.895491	0.72639	.	.	ENSG00000147133	ENST00000449580;ENST00000395779	T	0.10763	2.84	4.81	4.81	0.61882	.	.	.	.	.	T	0.32526	0.0832	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.65010	0.931	T	0.08953	-1.0697	8	0.62326	D	0.03	.	17.1353	0.86737	0.0:0.0:1.0:0.0	.	1701	P21675-4	.	Y	1701;409	ENSP00000389000:D1701Y	ENSP00000379125:D409Y	D	+	1	0	TAF1	70595764	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.400000	0.73252	2.224000	0.72417	0.594000	0.82650	GAT			0.488	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000058995.2		NM_004606	
DNASE1L1	1774	mdanderson.org	37	X	153640238	153640238	+	5'UTR	SNP	G	G	T			TCGA-S6-A8JX-01A-11D-A435-10	TCGA-S6-A8JX-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9db7d878-2bc2-4a70-aaa0-3b5faa979a17	49af4ca0-0413-4aa6-9eff-cce3c2f799f2	g.chrX:153640238G>T	ENST00000393638.1	-	0	189				DNASE1L1_ENST00000369809.1_5'UTR|TAZ_ENST00000299328.5_Missense_Mutation_p.A20S|TAZ_ENST00000369790.4_Missense_Mutation_p.A20S|TAZ_ENST00000475699.1_Missense_Mutation_p.A20S|TAZ_ENST00000351413.4_Missense_Mutation_p.A20S|TAZ_ENST00000369776.4_Missense_Mutation_p.A20S|TAZ_ENST00000350743.4_Missense_Mutation_p.A20S	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1						DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGGACCCTGGCCAGCAGCGT	0.756																																					p.A20S													.	.			0			c.G58T												17.0	14.0	15.0					X																	153640238		2194	4274	6468	SO:0001623	5_prime_UTR_variant	6901	exon1			ACCCTGGCCAGCA	L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.-98C>A	X.37:g.153640238G>T			23	0	0		48	0.06	3	NM_181312	13	0.00	0	D3DWW7|Q5HY41	Missense_Mutation	SNP	ENST00000393638.1	37	CCDS14747.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049878	0.55218	.	.	ENSG00000102125	ENST00000369790;ENST00000426834;ENST00000299328;ENST00000350743;ENST00000454722;ENST00000351413;ENST00000369776;ENST00000439735;ENST00000475699	D;D;D;D;D;D;D;D;D	0.98958	-5.25;-4.7;-5.27;-5.26;-5.08;-5.27;-5.06;-5.12;-5.13	4.14	4.14	0.48551	.	0.128665	0.53938	D	0.000057	D	0.96769	0.8945	N	0.10645	0.015	0.32650	N	0.519455	B;B;B;B;B;D	0.69078	0.415;0.275;0.105;0.048;0.073;0.997	B;B;B;B;B;D	0.75020	0.083;0.104;0.031;0.034;0.106;0.985	D	0.95333	0.8431	10	0.31617	T	0.26	-7.2862	7.349	0.26680	0.1246:0.0:0.8754:0.0	.	20;20;20;20;20;20	A6XNE1;Q96F92;Q16635-7;Q16635-3;Q16635-5;Q16635	.;.;.;.;.;TAZ_HUMAN	S	20	ENSP00000358805:A20S;ENSP00000411182:A20S;ENSP00000299328:A20S;ENSP00000338891:A20S;ENSP00000397388:A20S;ENSP00000218246:A20S;ENSP00000358791:A20S;ENSP00000398193:A20S;ENSP00000419854:A20S	ENSP00000299328:A20S	A	+	1	0	TAZ	153293432	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.772000	0.55325	1.666000	0.50821	0.436000	0.28706	GCC			0.756	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080928.2			
